CN118119710A

CN118119710A - Recombinant adeno-associated viral vectors for the treatment of spinal muscular atrophy

Info

Publication number: CN118119710A
Application number: CN202280069055.0A
Authority: CN
Inventors: 陶冶铮; 张小龙; 田幸雪; 赵小平
Original assignee: Shanghai Tianze Yuntai Biomedical Co ltd
Current assignee: Shanghai Tianze Yuntai Biomedical Co ltd
Priority date: 2021-10-15
Filing date: 2022-10-14
Publication date: 2024-05-31
Also published as: WO2023061499A1

Abstract

Provided are codon optimized sequences encoding SMN polypeptides and recombinant adeno-associated virus (rAAV) vectors comprising one of the sequences under the control of a hybrid promoter. Also provided are viral particles comprising the rAAV vector, pharmaceutical compositions comprising the rAAV vector or the viral particles, and their use in the treatment of Spinal Muscular Atrophy (SMA).

Description

Recombinant adeno-associated viral vectors for the treatment of spinal muscular atrophy

Cross Reference to Related Applications

The present application claims priority from PCT application number PCT/CN2021/124183 filed on 10/15 of 2021, the entire contents of which are hereby incorporated by reference.

Technical Field

The present disclosure relates to gene therapy, in particular, methods for treating Spinal Muscular Atrophy (SMA). Provided herein are recombinant adeno-associated viral vectors (rAAV) comprising nucleotide sequences encoding SMN proteins. Also provided herein are viral particles comprising the rAAV vector, pharmaceutical compositions comprising the viral particles, and uses of the viral particles, the pharmaceutical compositions.

Sequence listing

The application comprises a sequence table submitted electronically in an XML file, titled "CT2978VIT33WO. XML", size 67424 bytes, created at 2022, 10 months and 14 days. The information contained in the sequence listing is incorporated herein by reference.

Background

Spinal Muscular Atrophy (SMA) is a neuromuscular disorder caused by motor neuron loss of the brain stem and anterior horn of the spinal cord. SMA is a genetic disease that is normally autosomal recessive. Depending on the severity of the symptoms and/or age of onset, there are five types of SMA, SMA types 0, 1, 2, 3 and 4, with SMA type 1 being the relatively severe and most common type. About 1 of 10,000 infants born each year in the united states suffer from SMA. It is estimated that total cases in china are about 30,000-50,000 cases, with type I and type II being the more common diagnostic types.

It has long been accepted in the art that SMA is caused by loss of function mutations in the SMN1 gene (which result in SMN protein deficiency) followed by spinal motor neuron death. Although SMN2 exists as a "backup gene" for SMN protein, the C6U mutation on SMN2 exon 7 produces delta exon 7SMN protein, which is unstable and unable to support motor neuron survival. As a result, muscles do not work properly and become smaller and weaker ("atrophy"). Currently available SMA treatments are limited and not affordable.

Specifically, approved drugs for SMA have focused mainly on replacing non-functional SMN1 genes (e.g., zolgensma, novartis) by delivering recombinant adeno-associated virus (AAV) encoding functional SMN1 genes, or modulating SMN2 mRNA splicing to increase production of full-length functional SMN protein (Spinraza sold by Biogen and Evrysdi sold by Roche). The advantage of using AAV to deliver a functional SMN1 gene is that it can achieve sustainable therapeutic benefit through a one-time treatment.

AAV9 is known to cross the Blood Brain Barrier (BBB) more effectively as compared to other AAV serotypes (Haery, l. et al ,Adeno-Associated Virus Technologies and Methods for Targeted Neuronal Manipulation.Front Neuroanat,2019.13:, page 93). AAV9 is, for example, the serotype of choice in the approved gene therapy Zolgensma (Novartis) described above. Aavrh.10 and AAV php.b are also promising candidate AAVs discussed in recent studies. However, CNS tropism of PHP.B may only be present in C57BL/6 mice (Hordeaux, J. Et al, the Neurotropic Properties of AAV-PHP.B ARE LIMITED to C57BL/6J Mice.Mol Ther,2018.26 (3): pages 664-668). It has been reported that AAVrh10 has limited ability to infect spinal motor neurons when given intrathecally in non-human primates (Bey, K. Et al ,Intra-CSF AAV9 and AAVrh10 Administration in Nonhuman Primates:Promising Routes and Vectors for Which Neurological DiseasesMol Ther Methods Clin Dev,2020.17:, pages 771-784), while SMN protein expression in the spinal cord is critical to achieving therapeutic benefit. Thus, the use of AAV9 to deliver SMN1 genes would be a preferred method of developing effective SMA gene replacement therapies. Attempts have been made to achieve better therapeutic effects by further optimizing AAV9-SMN1 vector constructs.

WO 2018/160585 A2 discloses a recombinant AAV vector having a AAVhu capsid containing a heterogeneous population of vp1, a heterogeneous population of vp2 and a heterogeneous population of vp3, and the efficacy of the recombinant AAV vector in delivering a codon-optimized sequence of the human SMN1 gene sequence (hSMN 1) by intraventricular administration in a mouse model of SMA. The results show improved survival and growth of the animals.

WO 2019/094253 A1 discloses a recombinant AAV9 viral vector comprising a construct consisting of the following flanking two modified AAV2 ITRs: chicken beta-actin (CB) promoter, cytomegalovirus (CMV) immediate/early enhancer, hSMN protein coding sequence, modified SV40 late 16s intron, and Bovine Growth Hormone (BGH) polyadenylation signal.

WO 2019/01817 A1 discloses a rAAV vector comprising an AAV9 or AAVrh10 capsid and a single stranded genome comprising a CAG promoter, an hSMN protein coding sequence, optionally a WPRE sequence and an HBB2 polyadenylation sequence.

CN112725344a discloses codon optimized sequences encoding SMN proteins and methods of making rAAV viral particles by infecting insect cells with baculoviruses carrying an AAV genome.

CN112011571a discloses a recombinant AAV vector scAAV-php.eb comprising a variant of the capsid protein of AAV9 in which the two amino acids a587 and Q588 are replaced by a peptide stretch of DGTLAVPFK, resulting in a higher infection efficiency compared to AAV 9.

CN108795946a relates to recombinant AAV vectors comprising a codon optimized coding sequence for SMN protein under the control of a hybrid promoter and a targeting sequence complementary to human miRNA-122. AAV serotypes AAV5, AAV9, and AAVrh10 were selected to construct the rAAV vector.

Although clinical trials indicate that SMA patients may benefit from AAV9-SMN1 gene therapy, overexpression of SMN protein may result in toxicity. Recent studies have revealed that when SMN protein is overexpressed in neurons, it may aggregate in neurons and cause late, dose-dependent neuronal toxicity, manifested by sensory-motor defects, synaptic loss, neurodegeneration, impaired biogenesis of small nuclear ribonucleoprotein particles (snRNP) (VAN ALSTYNE et al, nature neurosciences 24,930-940,2021). These findings raise issues with respect to the long-term safety of AAV 9-mediated SMN1 gene delivery when SMN protein expression levels are too high. This also suggests that the most efficient expression level of SMN1 delivered by AAV9 may not be as high as possible.

Thus, there remains a need for a more effective, affordable, and safer rAAV-based therapy to treat SMA patients.

Disclosure of Invention

The inventors developed new AAV constructs comprising a combination of a new hybrid promoter and a codon optimized hSMN protein coding sequence that provides a desired level of SMN protein expression comparable to endogenous SMN protein levels, and demonstrated the expression of SMN protein in the motor cortex and spinal cord of C57BL/6 mice treated with the rAAV-SMN1 vector of the invention, thus completing the invention.

Accordingly, in a first aspect, the present application provides an isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs 3-12, wherein the nucleotide sequence encodes a human SMN polypeptide.

In a second aspect, the application provides an expression cassette comprising the isolated nucleic acid molecule of the first aspect operably linked to a promoter. Preferably, the promoter is an artificially modified promoter comprising an intron sequence of the SMN1 gene.

In a third aspect, the application provides a rAAV vector comprising the isolated nucleic acid molecule of the first aspect or the expression cassette of the second aspect. In preferred embodiments, the rAAV vector provides desired levels of SMN protein expression in disease-associated tissues, including, but not limited to, high levels of expression in, for example, the brain and spinal cord, and/or levels of expression similar to endogenous SMN1 genes in, for example, the brain and spinal cord.

In a fourth aspect, the application provides an AAV viral particle comprising a rAAV vector packaged into an AAV capsid, preferably a capsid having CNS tropism, more preferably an AAV9 or AAV php.b capsid.

In a fifth aspect, the application provides a pharmaceutical composition comprising the rAAV vector of the third aspect or the viral particle of the fourth aspect, and a pharmaceutically acceptable excipient.

In a sixth aspect, the application provides a method for treating SMA in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a rAAV vector of the third aspect, a rAAV particle of the fourth aspect, or a pharmaceutical composition of the fifth aspect.

In a seventh aspect, the application provides the use of the rAAV vector of the third aspect, the rAAV particle of the fourth aspect, or the pharmaceutical composition of the fifth aspect in the treatment of SMA.

Drawings

FIG. 1 shows representative images of Western Blot (WB) results of the first transfection experiments in SH-SY5Y, U-251MG and U-87MG cells of example 1.

FIG. 2 shows representative images of WB results of the second transfection experiment in SH-SY5Y and U-251MG cells of example 1.

FIG. 3 is a schematic of the construct used in the codon optimization study in example 1. The gene of interest (GOI) is under the control of the CMV promoter.

FIG. 4 shows a schematic representation of a luciferase expression cassette used in a promoter screening study. The plasmid components are illustrated using the EF1 alpha promoter as a schematic example.

FIGS. 5A-5C show luciferase activities driven by different promoters evaluated in SH-SY5Y cells (A), U-251MG cells (B) and U-87MG cells (C). Data are expressed as mean ± s.e.m. from one experiment.

FIG. 6 shows a schematic of a construct comprising an EFS derived promoter and an SMN1 coding sequence.

FIG. 7 shows representative images of WB results from transfection assays of the constructs shown in FIG. 6 in SH-SY5Y and U-251MG cells.

FIG. 8 shows representative images of WB results from samples collected from SH-SY5Y and U-87MG cells transfected with constructs containing different combinations of promoters and codons as indicated.

FIG. 9 shows the elimination of SMN protein expression in puromycin resistant SH-SY5Y cells infected with lentivirus expressing SMN1 specific shRNA (shSMN 1). shNT refers to short hairpin RNAs targeting non-coding sequences, which serve as negative controls.

Figure 10 shows WB results of SMN protein expression after infection of SMN1 knockdown SH-SY5Y cell line with candidate AAV vectors.

FIGS. 11A-11B show the rescue efficiency of different transgene constructs in normalizing mRNA levels of microribonucleoprotein-associated protein B (SmB) and microribonucleoprotein D1 (SmD 1) in SMN1 knockdown SH-SY5Y cell lines.

Fig. 12 shows a study protocol of primary human motor neuron differentiation and treatment program. Motor neuron differentiation medium II (MNP medium II) was applied for 14 days.

Figure 13 shows representative images of human motor neurons after treatment with different rAAV packaging different SMN1 transgenic constructs.

FIG. 14 shows the effect of rAAV packaged with a key representative transgene construct in inducing SMN protein expression in SMN1 knockdown primary human motor neurons.

Figures 15 and 16 show SMN protein levels in the motor cortex of wild-type C57BL/6 mice receiving intraventricular injection of rAAV packaged with the indicated transgenic constructs.

Figures 17 and 18 show SMN protein levels in spinal cord of wild-type C57BL/6 mice receiving intraventricular injection of rAAV packaged with the indicated transgenic constructs.

Detailed Description

Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

As used herein (including the appended claims), singular forms such as "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

In the context of the present disclosure, unless otherwise indicated, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated element (e.g. amino acid sequence, nucleotide sequence, characteristic, step or group thereof) but not the exclusion of any other element (e.g. amino acid sequence, nucleotide sequence, characteristic, and step). When used herein, the term "comprising" or any variation thereof may be substituted with the term "including" or sometimes with "having" or equivalents thereof. In certain embodiments, the word "comprising" also includes the case of "consisting of … …".

Expression cassette

The term "expression cassette" herein refers to a DNA component contained in a vector (e.g., a rAAV vector) and consisting of a gene (e.g., SMN1 gene) and one or more regulatory sequences to be expressed in a host cell transfected with the vector.

By optimizing the cDNA sequence (codon) of the SMN1 gene and its regulatory sequences (particularly promoters), the SMN1 expression cassette inserted into the AAV vector can achieve higher and more consistent SMN protein expression in motor neurons.

As an important part of the expression cassette, the present disclosure first provides a set of codon-optimized nucleotide sequences encoding SMN proteins (particularly human SMN proteins having the amino acid sequence as set forth in SEQ ID NO: 32), and isolated nucleic acid sequences comprising any of these nucleotide sequences. "isolated nucleic acid" means DNA or RNA removed from all or part of a polynucleotide to which it is naturally present or to which it is not linked in nature. An isolated nucleic acid molecule "comprising" a specific nucleotide sequence may comprise, in addition to the specified sequence, operably linked regulatory sequences that control the expression of the coding region of the recited nucleic acid sequence. Because of codon degeneracy, one skilled in the art will appreciate that any particular amino acid sequence may be encoded by several different nucleotide sequences.

"Codon optimized coding sequence" as used herein refers to a nucleotide sequence encoding an SMN1 protein modified from a wild-type SMN1 coding sequence that accommodates codon bias. Optimization may be achieved by reducing sequence complexity, adjusting GC content, adjusting codon usage, and/or avoiding rare codons. Codon optimized coding sequences generally show increased translation efficiency of the gene of interest (GOI), resulting in higher protein expression. Tools with embedded algorithms (e.g., JCat) for designing codon optimized coding sequences are readily available to those skilled in the art. In a preferred embodiment, the codons of the SMN1 coding sequence of the application have a codon adaptation index (Codon Adaptation Index, CAI) of greater than 0.8. CAI is a measure of codon bias. Those skilled in the art will appreciate that the actual efficiency of any sequence generated by running an algorithm still needs to be verified experimentally.

In a preferred embodiment, the codon-optimized coding sequence of the human SMN protein comprises or consists of a nucleotide sequence selected from the nucleotide sequences of SEQ ID Nos. 3-12. More preferably, the codon optimized coding sequence of the human SMN protein comprises or consists of the nucleotide sequence of SEQ ID NO. 6 or SEQ ID NO. 9.

Furthermore, the expression cassette may comprise one or more regulatory sequences in addition to the coding sequence. The regulatory sequence may be selected from one or more of the following: promoters, enhancers, polyadenylation sequences, and translation termination signals. Certain combinations of the regulatory sequences of the present disclosure may achieve unexpected results in improving the expression efficiency of the coding sequences.

"Promoter" refers to a DNA sequence capable of promoting transcription of a downstream gene under the control of the promoter. Promoters include, but are not limited to, constitutive promoters, cell type specific promoters, tissue specific promoters, and developmental stage specific promoters. The promoter may be a naturally occurring promoter of a gene, a modified form of a naturally occurring promoter, or a synthetic promoter.

In a preferred embodiment, the promoter of the present disclosure may be a constitutive promoter. In a preferred embodiment, the promoter may be a chicken β -actin promoter or an EFS (short form of EF1 a) promoter, or a promoter derived therefrom.

An "enhancer" is a regulatory DNA sequence that can, along with a promoter, enhance transcription of GOI in AAV. In a preferred embodiment, the expression cassette of the application comprises an enhancer. More preferably, the enhancer may be a CMV enhancer, for example in the CBh promoter.

In some embodiments, an intron sequence that functions as an enhancer may be included. For example, intron sequences derived from introns of the GOI may be included in the expression cassette.

In some cases, a promoter together with enhancer and/or intron sequences is collectively referred to as a "promoter" or "promoter element.

The term "heterozygous" with respect to a nucleotide sequence (e.g., a promoter or intron sequence) means that the nucleotide sequence is obtained by combining two or more sequences that do not exist consecutively in nature. For example, a hybrid promoter may be obtained by combining the complete or partial sequence of a naturally occurring promoter or variant thereof with an intron sequence of a different gene from the promoter or with an intron sequence of the same gene from the promoter in an order different from the natural state.

In a preferred embodiment, the promoter is a CBh promoter. In another preferred embodiment, the promoter consists of an EFS promoter and an intron sequence.

Preferably, the total length of the intron sequence is about or less than 200bp, about or less than 250bp, about or less than 300bp, about or less than 350bp, about or less than 400bp.

For example, an intron sequence is a hybrid intron sequence obtained by combining at least two intron fragments derived from the same gene or different genes. For example, a hybrid intron comprises or consists of an intron fragment derived from one or more of the following introns: introns of the chicken beta-actin (CBA) gene, introns of the mouse picovirus (MMV) gene, introns of the human beta-globin gene, introns of the immunoglobulin heavy chain gene and introns of adenovirus. For example, a hybrid intron comprises or consists of a fragment derived from: (1) Introns of the chicken beta-actin (CBA) gene and the mouse parvovirus (MMV) intron; (2) Introns of the human beta-globin gene and introns of the immunoglobulin heavy chain gene; or (3) an intron of an adenovirus and an intron of an immunoglobulin heavy chain gene. In a specific embodiment, the intron sequence comprises or consists of the nucleotide sequence of any of SEQ ID NOS: 17-19 (preferably SEQ ID NO: 17).

For example, the intron sequences of the present disclosure are derived from the gene of interest. For example, the intron sequence consists of one or more intronic regions derived from the gene of interest, in particular one or more fragments of one or more intronic regions of the human SMN1 gene (e.g. intron 1, intron 2, intron 3, intron 4, intron 5, intron 6 or intron 7). Preferably, the intron sequence is derived from an intron region located closer to the promoter region, for example, intron 1 or intron 2 of the human SMN1 gene. For example, the intron sequence may be a truncated form of intron 1 or intron 2 of the human SMN1 gene, e.g. one or more partial deletions, e.g. an intermediate partial deletion. In a specific embodiment, the intron sequence has the nucleotide sequence shown as nucleotide positions 215-614 through SEQ ID NO. 27 or 28.

For example, an intron sequence is derived from an intron region of a gene other than the gene of interest. For example, the intron sequence is an SV40 small t antigen intron, e.g., having the sequence of SEQ ID NO. 20.

In a more preferred embodiment, the intron has the nucleotide sequence of SEQ ID NO. 17, or the nucleotide sequences at nucleotide positions 215-614 of SEQ ID NO. 27 or 28.

In a specific embodiment, the promoter comprises or consists of a nucleotide sequence selected from the nucleotide sequences of SEQ ID Nos. 22-25 (EFShI 1, EFShI, EFShI3, EFSI 4) and SEQ ID Nos. 28-29 (EFSdI 1 and EFSdI). In a more specific embodiment, the promoter comprises or consists of the nucleotide sequence of SEQ ID NO. 22 (EFShI 1).

In preferred embodiments, the promoter or promoter/intron element is no more than 1000bp, no more than 900bp, no more than 850bp, no more than 800bp, no more than 700bp, no more than 600bp, no more than 500bp, or no more than 400bp in length due to the limited packaging capability of AAV.

In some cases, when an intron sequence is derived from an intron region of a gene of interest, the intron sequence may be inserted into a coding sequence (e.g., a codon optimized coding sequence) at a position corresponding to its location in a gene of nature, e.g., between two exons, rather than at a position 5' upstream of the coding sequence and constituting a promoter/intron element. For example, when the intron sequence is derived from intron 1 of the human SMN1 gene (e.g., a truncated version of intron 1 of the human SMN1 gene), the intron sequence may be inserted at a position between exon 1 and exon 2 of the coding sequence.

The polyadenylation sequence of the present disclosure may be bGH poly A, SPA or SV40 poly a, preferably SV40 poly a. Either poly-A can be combined with woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (WPRE is a DNA sequence that when transcribed produces a tertiary structure that enhances protein expression) and configured as WPRE-bGH poly A, WPRE-SPA or WPRE-SV40 poly-A, respectively. In particular embodiments, modified forms of WPRE containing five point mutations in the putative promoter region and 1 nucleotide change in the start codon of the open reading frame of the woodchuck hepatitis virus X protein (WHx) may also be used.

The kozak consensus sequence (kozak sequence) named by the scientist to find it is a nucleic acid sequence motif present in most eukaryotic mRNA transcripts, which serves as a protein translation initiation site. The kozak sequence ensures that the protein is translated accurately and efficiently.

In a specific embodiment, the expression cassette comprises an EFS promoter, a hybrid intron, a kozak sequence, an optimized SMN1 codon sequence, WPRE and SV40 poly A.

In a most preferred embodiment, the expression cassette of the present disclosure comprises or consists of a nucleotide sequence as set forth in any one of SEQ ID NO:33, SEQ ID NO:34 or SEQ ID NO: 35.

Recombinant AAV vectors and viral particles

The nucleic acid molecules or expression cassettes of the present disclosure can be constructed into recombinant AAV (rAAV) vectors to obtain rAAV particles for delivery into a subject in need thereof.

In addition to the inserted nucleotide sequences described above, rAAV vectors are also in single stranded form. The rAAV vector consists of two Inverted Terminal Repeat (ITR) sequences at both ends of the inserted nucleotide sequence. The ITRs of the present disclosure can be ITRs derived from any AAV serotype. When referring to serotypes of AAV ITRs, the phrase "derived from" means that the ITR can be an ITR of a certain serotype or a variant derived therefrom having one or more modifications. In a preferred embodiment of the present disclosure, the rAAV vector comprises two ITRs derived from AAV 2. For example, a rAAV vector comprises two AAV2 ITRs, or a truncated form of AAV2 ITR comprising one wild-type AAV2 ITR and one deletion region C or region C'. For example, a wild-type AAV2 ITR is located 5 'of the inserted nucleotide sequence, while an AAV2 ITR variant is located 3' of the inserted nucleotide sequence; or vice versa.

The rAAV genome is packaged into AAV capsids. The capsid may be derived from any AAV serotype known in the art or characterized in the future. The capsid and ITR may be derived from the same serotype of AAV or from different serotypes of AAV. Preferably, the capsid is adapted for neurological delivery, e.g., intrathecal, intracavitary, intraventricular delivery, or intravenous. In specific embodiments, the AAV vector comprises a capsid of AAV1, AAV2, AAV4, AAV5, AAV7, AAV8, AAV9, AAVrh10, AAV php.b, AAV2.7m8, or AAVAnc L65 serotypes or variants thereof. In a preferred embodiment, the capsid is an AAV9 capsid.

Pharmaceutical composition

The term "pharmaceutical composition" refers to a composition suitable for delivery to a subject. The pharmaceutical compositions of the disclosure comprise an isolated nucleic acid, rAAV vector or viral particle of the disclosure, and a pharmaceutically acceptable excipient. Conventional pharmaceutically acceptable excipients are known in the art and may be solid or liquid excipients. In one embodiment, the pharmaceutical composition may be a liquid for injection.

Delivery of

When applied to a subject (e.g., an animal, including a human) or to a cell, tissue, organ, or biological fluid, the terms "administration", "treatment" and "treatment" as used herein mean the contact of an exogenous drug, therapeutic, diagnostic agent, or composition with the subject, cell, tissue, organ, or biological fluid. Treatment of a cell encompasses contact of a reagent with the cell, as well as contact of the reagent with a fluid, wherein the fluid is in contact with the cell. The terms "administering" and "treating" also include in vitro and ex vivo treatment of, for example, a cell by an agent, a diagnostic agent, a binding compound, or by another cell.

In preferred embodiments, the rAAV vectors of the application may be delivered via intravenous or intra-CSF administration. In particular embodiments, the rAAV vector is delivered via an intra-CSF route.

The rAAV vector may be administered via single or multiple doses. In particular embodiments, the rAAV vector is administered via a single injection.

The dose of rAAV vector can vary depending on the route of administration. For example, given that SMA is a CNS disorder, intravenous injection is a systemic route, and generally requires the delivery of higher doses of rAAV to achieve adequate therapeutic effects. The dosage may also vary depending on the weight of the subject. Thus, the dosage range can be within a wide range covering 1X 10 ¹³-5×10¹⁴ vg.

Higher doses are often accompanied by increased immunogenicity and risk of other potential side effects, like hepatotoxicity. Thus, intravenous injection may only be suitable for neonatal patients suffering from SMA type I or type II.

Therapeutic use

The terms "treatment", "treatment" or "treatment" include curing or at least alleviating symptoms of SMA or disease conditions associated with SMA.

The SMN protein-encoding viral vectors of the application are useful for treating a subject suffering from SMA. The subject may be an infant, child, adolescent or adult. For example, the subject may be an infant or a child within two years of age.

A subject with SMA may be diagnosed by one or more of the following measurements: examining blood creatine kinase levels; performing gene testing on the SMN1 gene; conducting a nerve conduction test to examine electrical activity of muscles and nerves; and performing a muscle tissue biopsy to identify muscle loss and atrophy.

Examples

For a convenient understanding and appreciation of the invention, advantages thereof will be described in greater detail with reference to the accompanying drawings and examples. It should be understood, however, that the following examples are intended to illustrate the present invention and are not intended to limit the scope of the present invention. The scope of the invention should be defined by the appended claims.

Example 1 optimization of human SMN protein expression by codon optimization

This example describes a method for optimizing SMN protein coding sequences.

The codon optimized sequence is designed by a codon optimization tool such as JCat. Ten sequences were selected to obtain high CAI values containing higher frequency codons to assess the level of protein expressed in biologically relevant cell lines transfected with plasmids carrying the candidate sequences. Wild-type SMN1 sequences and previously reported codon-optimized SMN1 sequences SMNopi (hereinafter "SMN-2011", domiiguez, e.g. ,Intravenous scAAV9 delivery of a codon-optimized SMN1 sequence rescues SMA mice.Hum Mol Genet,2011.20(4): pages 681-93) were used as references. Ten candidate coding sequences (SEQ ID Nos: 3-12) and two reference sequences (SMN-WT and SMNopt-2011, as shown in SEQ ID Nos: 1 and 2) as shown below were inserted into a scaAAV (self-complementing AAV) vector plasmid under the control of a CMV promoter, respectively. A schematic diagram of the plasmid map is shown in fig. 3, using the wild-type sequence as an example. As shown in fig. 3, the construct comprises, from 5 'to 3': 5' AAV2ITR (truncated form of 3' ITR; SEQ ID NO: 13), CMV enhancer/promoter (SEQ ID NO: 15), SMN1 coding sequence, SV40 poly (A) signal (SEQ ID NO: 16) and 3' AAV2ITR (SEQ ID NO: 14).

SEQ ID NO:3，SMNopt-BS，GC＝59％

ATGGCCATGTCTAGCGGCGGCTCTGGCGGCGGCGTGCCTGAGCAGGAGGACTCCGTGCTGTTCCGG

AGAGGCACAGGCCAGTCTGACGACTCTGACATCTGGGACGACACAGCCCTGATTAAGGCCTACGAC

AAGGCCGTGGCCAGCTTCAAGCACGCCCTGAAGAACGGCGACATTTGCGAGACATCTGGCAAGCCT

AAGACCACACCAAAGCGGAAGCCCGCCAAGAAGAACAAGTCTCAGAAGAAGAACACAGCCGCCAGC

CTACAGCAGTGGAAGGTGGGCGACAAGTGCAGCGCCATTTGGTCCGAGGACGGCTGCATTTACCCC

GCCACAATCGCCTCTATTGACTTCAAGAGGGAGACATGCGTGGTGGTGTACACAGGCTACGGCAAC

CGCGAGGAGCAGAACCTGTCCGACCTGCTGTCCCCAATTTGCGAGGTGGCCAACAACATTGAGCAG

AACGCCCAGGAGAACGAGAACGAGTCTCAGGTGTCTACCGACGAGTCCGAGAACTCTCGGTCACCC

GGCAACAAGTCTGACAACATTAAGCCTAAGAGCGCCCCTTGGAACTCTTTCCTGCCACCCCCTCCT

CCAATGCCCGGCCCTAGACTGGGCCCAGGCAAGCCTGGCCTGAAGTTCAACGGCCCTCCTCCACCA

CCTCCTCCACCACCCCCTCACCTGCTGTCTTGCTGGCTGCCACCTTTCCCATCCGGCCCACCTATT

ATTCCTCCTCCACCCCCAATTTGCCCAGACTCTCTCGACGACGCCGACGCCCTCGGCTCTATGCTC

ATTAGCTGGTACATGAGCGGCTACCACACAGGCTACTACATGGGCTTCAGACAGAACCAGAAGGAG

GGCAGATGCTCTCACTCTCTCAACTGA

SEQ ID NO:4，SMNopt-GS，GC＝59％

GCCACCATGGCCATGAGCAGCGGAGGCTCTGGTGGCGGCGTGCCTGAGCAGGAGGACAGCGTGCTG

TTCCGGCGGGGCACCGGCCAGAGCGACGACAGCGACATCTGGGACGATACAGCCCTGATTAAGGCC

TACGACAAGGCCGTGGCCTCTTTTAAGCACGCCCTGAAGAACGGAGATATCTGCGAGACAAGCGGC

AAACCTAAGACCACCCCTAAAAGAAAGCCTGCCAAGAAGAACAAGTCCCAGAAAAAGAATACCGCT

GCTAGCCTGCAGCAGTGGAAGGTGGGAGATAAGTGCAGCGCCATCTGGTCCGAGGACGGCTGCATC

TACCCCGCTACAATCGCCAGCATCGACTTCAAGCGGGAAACCTGCGTGGTCGTGTACACAGGATAC

GGCAACCGCGAGGAACAGAACCTGAGCGATCTGCTGTCACCTATCTGTGAAGTGGCCAACAACATC

GAGCAAAATGCCCAGGAAAACGAGAACGAAAGCCAAGTGTCCACCGACGAGAGCGAGAACAGCAGA

AGCCCTGGCAATAAAAGCGATAACATCAAGCCTAAGTCTGCCCCTTGGAACTCTTTCCTGCCCCCT

CCCCCCCCTATGCCTGGACCTAGACTGGGCCCTGGCAAGCCCGGCCTGAAATTCAACGGCCCTCCA

CCACCTCCACCTCCCCCCCCACCCCACCTGCTGTCTTGTTGGCTGCCTCCGTTCCCCAGCGGCCCC

CCTATCATCCCCCCTCCACCTCCTATCTGCCCTGATAGCCTGGACGACGCCGACGCTCTCGGCTCC

ATGCTGATCAGCTGGTATATGTCCGGCTACCATACCGGCTACTACATGGGCTTTAGACAGAACCAG

AAGGAAGGCAGATGCAGCCACAGCCTGAACTGA

SEQ ID NO:5，SMNopt-JCat，GC＝65％

GCCACCATGGCCATGAGCAGCGGCGGGAGCGGGGGCGGCGTGCCCGAGCAGGAGGATAGCGTGCTG

TTCAGGAGGGGGACCGGCCAGAGCGACGATAGCGACATCTGGGATGACACAGCCCTGATCAAGGCC

TACGATAAGGCCGTGGCCAGCTTCAAGCACGCCCTGAAGAACGGCGATATCTGCGAGACCAGCGGG

AAGCCCAAGACAACCCCCAAGCGGAAGCCCGCCAAGAAGAACAAGAGCCAGAAGAAGAACACCGCC

GCCAGCCTGCAGCAGTGGAAGGTGGGCGACAAGTGCAGCGCCATCTGGAGCGAGGATGGGTGCATC

TACCCCGCCACAATCGCCAGCATTGACTTTAAGCGGGAGACATGCGTGGTGGTGTACACAGGCTAC

GGGAACCGGGAGGAGCAGAACCTGAGCGACCTGCTGAGCCCCATCTGCGAGGTGGCCAACAACATC

GAGCAGAACGCCCAGGAGAACGAGAACGAGAGCCAGGTGAGCACAGATGAGAGCGAGAACAGCAGG

TCCCCAGGCAACAAGAGCGACAACATTAAGCCCAAGTCCGCCCCCTGGAACAGCTTCCTGCCCCCT

CCCCCCCCCATGCCAGGGCCCCGGCTGGGCCCCGGCAAGCCAGGGCTGAAGTTTAACGGCCCCCCC

CCACCCCCTCCCCCCCCCCCTCCCCACCTGCTGTCCTGCTGGCTGCCCCCCTTCCCCAGCGGGCCC

CCCATCATCCCCCCCCCCCCTCCCATCTGCCCCGATAGCCTGGATGACGCCGATGCCCTGGGGTCC

ATGCTGATTAGCTGGTACATGAGCGGGTACCACACCGGCTACTACATGGGCTTTAGGCAGAACCAG

AAGGAGGGCAGGTGCAGCCACAGCCTGAACTGA

SEQ ID NO:6，SMNopt-SAgs，GC＝63％

GCCACCATGGCCATGAGCAGCGGCGGGAGCGGCGGGGGGGTGCCCGAGCAGGAGGATAGCGTGCTG

TTTCGGAGGGGCACCGGCCAGTCCGATGATAGCGACATCTGGGATGACACAGCCCTGATTAAGGCC

TACGACAAGGCCGTGGCCAGCTTCAAGCACGCCCTGAAGAACGGGGACATCTGCGAGACAAGCGGC

AAGCCCAAGACCACACCCAAGAGGAAGCCCGCCAAGAAGAACAAGAGCCAGAAGAAGAACACCGCC

GCCAGCCTGCAGCAGTGGAAGGTGGGCGACAAGTGCTCCGCCATCTGGTCCGAGGACGGGTGCATC

TACCCCGCCACCATCGCCAGCATCGACTTTAAGAGGGAGACATGCGTGGTCGTGTACACAGGCTAC

GGGAACCGGGAGGAGCAGAACCTCTCCGACCTGCTGAGCCCCATCTGCGAGGTGGCCAACAACATC

GAGCAGAACGCCCAGGAGAACGAGAACGAGAGCCAGGTGTCCACCGATGAGAGCGAGAACTCCCGG

AGCCCTGGGAACAAGTCCGATAACATCAAGCCCAAGAGCGCCCCCTGGAACAGCTTTCTGCCCCCT

CCCCCCCCTATGCCTGGACCTAGACTGGGCCCTGGCAAGCCCGGCCTGAAATTCAACGGCCCTCCA

CCACCTCCACCTCCCCCCCCACCCCACCTGCTGTCTTGTTGGCTGCCTCCGTTCCCCAGCGGCCCC

CCTATCATCCCCCCTCCACCCCCCATCTGCCCCGATAGCCTGGATGATGCCGATGCCCTGGGCAGC

ATGCTGATCAGCTGGTACATGAGCGGGTACCACACAGGGTACTACATGGGGTTCAGGCAGAACCAG

AAGGAGGGGCGGTGCAGCCACAGCCTGAACTGA

SEQ ID NO:7，SMNopt-GW，GC＝62.3％

ATGGCCATGAGCAGCGGCGGCAGCGGCGGCGGCGTGCCCGAGCAAGAGGACAGCGTGCTGTTCAGA

AGAGGCACCGGGCAGAGCGACGACAGCGACATCTGGGACGACACCGCCCTGATCAAGGCCTACGAC

AAGGCCGTGGCTAGCTTCAAGCACGCCCTGAAGAACGGCGACATCTGCGAGACAAGCGGCAAGCCC

AAGACCACCCCCAAGAGAAAGCCCGCCAAGAAGAACAAGTCTCAGAAGAAGAACACCGCCGCTAGC

CTGCAGCAGTGGAAGGTGGGCGACAAGTGCAGCGCCATCTGGAGCGAGGACGGCTGCATCTACCCC

GCCACCATCGCTAGCATCGACTTCAAGAGAGAGACCTGCGTGGTGGTGTACACCGGCTACGGCAAC

AGAGAGGAGCAGAACCTGAGCGACCTGCTGAGCCCCATCTGCGAGGTGGCCAACAACATCGAGCAG

AACGCCCAAGAGAACGAGAACGAGAGCCAAGTGAGCACCGACGAGAGCGAGAACAGCAGAAGCCCC

GGCAACAAGAGCGACAACATCAAGCCCAAAAGTGCCCCCTGGAATAGCTTCCTACCGCCTCCTCCG

CCTATGCCCGGACCCCGTCTGGGCCCCGGAAAGCCCGGCCTGAAATTTAACGGCCCGCCGCCCCCC

CCTCCGCCCCCCCCGCCTCATCTTCTGAGCTGCTGGCTGCCCCCATTCCCTAGCGGCCCTCCCATT

ATTCCTCCTCCTCCTCCAATATGCCCTGACAGCCTGGACGACGCCGACGCCCTGGGCAGCATGCTG

ATCAGCTGGTACATGAGCGGCTACCACACCGGCTACTACATGGGCTTCAGACAGAATCAGAAGGAG

GGCAGATGCAGCCACAGCCTGAACTGA

SEQ ID NO:8，SMNopt-NP，GC＝53.4％

ATGGCAATGTCTTCTGGTGGATCAGGAGGAGGTGTGCCAGAACAGGAGGATAGTGTTCTCTTCAGG

CGCGGCACCGGTCAGTCAGATGATAGTGATATCTGGGATGACACCGCCCTCATTAAAGCCTATGAT

AAGGCTGTGGCCAGCTTCAAGCACGCCCTGAAGAACGGAGACATTTGTGAAACCAGTGGGAAACCA

AAGACCACCCCCAAACGCAAGCCAGCGAAGAAAAATAAGTCACAGAAAAAGAACACAGCCGCTAGT

CTCCAGCAGTGGAAGGTGGGCGATAAATGCTCAGCAATCTGGAGCGAGGACGGCTGTATCTATCCC

GCAACCATCGCATCTATCGATTTCAAGCGGGAAACTTGCGTAGTGGTCTACACGGGCTATGGGAAT

CGGGAGGAGCAGAACCTGTCAGACCTCCTGTCCCCAATCTGTGAGGTGGCTAACAACATTGAGCAG

AACGCACAGGAGAATGAAAACGAGTCTCAGGTGTCAACAGATGAAAGTGAAAATTCCCGCTCCCCC

GGGAACAAAAGCGACAATATCAAGCCGAAGTCCGCGCCGTGGAACTCCTTTCTCCCACCTCCGCCA

CCTATGCCTGGACCCCGACTTGGTCCTGGGAAACCAGGCCTGAAGTTTAATGGTCCACCACCTCCT

CCACCTCCACCTCCACCACACTTGCTCAGCTGTTGGTTGCCTCCTTTCCCCTCCGGTCCCCCAATT

ATTCCTCCCCCCCCTCCAATTTGCCCAGACTCTCTGGATGATGCAGATGCCCTGGGCTCCATGCTC

ATTAGCTGGTACATGTCTGGGTACCATACGGGGTATTATATGGGTTTTCGCCAGAATCAGAAGGAA

GGCCGGTGCTCTCATAGTCTGAACtga

SEQ ID NO:9，SMNopt-TY，GC＝58％

ATGGCCATGTCTAGTGGCGGATCTGGTGGCGGAGTGCCCGAGCAAGAAGATAGCGTCCTGTTCAGA

AGAGGCACCGGCCAGAGCGACGACAGCGACATCTGGGATGATACAGCCCTGATCAAGGCCTACGAC

AAGGCCGTGGCCAGCTTTAAGCACGCCCTGAAGAACGGCGATATCTGCGAGACAAGCGGCAAGCCC

AAGACCACACCTAAGAGAAAGCCCGCCAAGAAGAACAAGAGCCAGAAGAAGAATACCGCCGCCAGC

CTGCAGCAGTGGAAAGTGGGCGATAAGTGCAGCGCCATTTGGAGCGAGGACGGCTGTATCTACCCT

GCCACAATCGCCAGCATCGACTTCAAGCGGGAAACCTGCGTGGTGGTGTACACAGGCTACGGCAAC

AGAGAGGAACAGAACCTGAGCGACCTGCTGAGCCCAATTTGCGAGGTGGCCAACAACATCGAGCAG

AACGCCCAAGAGAACGAGAACGAGTCCCAGGTGTCCACCGACGAGAGCGAGAATAGCAGAAGCCCC

GGCAACAAGAGCGACAACATCAAGCCTAAGAGCGCCCCTTGGAACAGCTTCCTGCCTCCTCCTCCA

CCAATGCCTGGACCTAGACTCGGACCTGGAAAGCCCGGCCTGAAGTTCAATGGACCTCCACCACCG

CCACCACCTCCGCCTCCACATCTTCTGTCTTGTTGGCTGCCTCCATTTCCTAGCGGCCCTCCAATC

ATCCCGCCACCTCCACCTATCTGCCCCGACAGTCTGGATGATGCTGATGCCCTGGGCTCCATGCTG

ATCTCTTGGTACATGAGCGGCTACCACACCGGCTACTACATGGGCTTCAGACAGAACCAGAAAGAG

GGCCGTTGCAGCCACAGCCTGAACTGA

SEQ ID NO:10，SMNopt-TK，GC＝58％

ATGGCTATGAGCAGCGGGGGAAGCGGAGGAGGAGTGCCTGAACAGGAGGACAGCGTGCTGTTTAGA

AGGGGGACCGGGCAGAGCGACGACTCTGATATTTGGGACGACACCGCCCTGATCAAAGCCTACGAC

AAGGCCGTGGCTAGCTTTAAGCACGCCCTGAAGAACGGCGATATTTGCGAGACAAGTGGCAAGCCC

AAGACCACACCCAAGCGCAAGCCAGCTAAGAAAAACAAGAGCCAGAAGAAAAACACCGCCGCCAGC

CTGCAGCAGTGGAAAGTGGGAGATAAGTGCAGCGCCATCTGGAGCGAGGACGGATGTATCTACCCC

GCCACCATCGCCAGCATCGACTTCAAAAGAGAAACCTGCGTGGTGGTGTACACCGGCTACGGAAAC

AGGGAGGAGCAGAACCTGAGTGACCTGCTGTCACCTATTTGCGAGGTGGCCAACAACATCGAACAG

AACGCCCAGGAAAACGAAAACGAGAGTCAGGTGAGCACCGATGAGAGCGAGAACAGTAGAAGCCCC

GGCAACAAATCCGACAACATCAAGCCCAAGAGTGCCCCCTGGAACAGCTTCCTGCCCCCTCCTCCT

CCTATGCCTGGACCTAGACTGGGCCCTGGAAAACCAGGACTGAAGTTCAACGGCCCCCCCCCTCCT

CCCCCTCCTCCACCTCCTCATCTGCTGTCATGCTGGCTGCCCCCTTTTCCTTCCGGCCCTCCTATC

ATCCCCCCCCCTCCCCCTATTTGCCCTGATTCTCTGGACGACGCCGACGCTCTGGGATCTATGCTG

ATCTCCTGGTATATGTCCGGCTACCACACCGGCTACTACATGGGCTTCCGGCAGAACCAGAAGGAA

GGCAGGTGTAGCCACAGCCTGAACTGA

SEQ ID NO:11，SMNopt-GScg，GC＝52％

ATGGCAATGAGCTCAGGGGGAAGTGGAGGAGGAGTCCCAGAACAGGAAGATAGTGTGCTGTTTAGG

AGAGGAACTGGGCAGAGTGATGATTCAGACATCTGGGATGATACTGCCCTGATCAAAGCTTATGAC

AAGGCTGTAGCCTCCTTTAAACATGCCCTGAAGAATGGGGACATTTGTGAAACCAGTGGAAAACCT

AAGACTACCCCAAAAAGGAAGCCTGCCAAAAAGAACAAGAGCCAGAAAAAGAATACAGCTGCCTCT

CTGCAGCAGTGGAAGGTGGGAGATAAATGTTCTGCCATTTGGTCTGAAGATGGCTGCATCTACCCA

GCCACTATTGCCTCAATTGATTTCAAGAGGGAGACATGCGTAGTGGTCTACACTGGATATGGGAAC

AGGGAAGAGCAGAATCTGAGTGACCTGCTGTCACCCATTTGTGAGGTGGCCAACAACATTGAGCAG

AATGCCCAGGAAAATGAAAATGAATCACAGGTGTCAACTGATGAGTCTGAGAACTCAAGGTCTCCT

GGGAACAAGTCAGACAACATCAAGCCCAAAAGTGCTCCCTGGAACTCATTCCTGCCACCACCCCCA

CCCATGCCTGGGCCTAGGCTGGGACCTGGCAAACCTGGGCTGAAATTCAATGGCCCACCACCTCCT

CCACCTCCCCCCCCACCTCATCTGCTGTCTTGCTGGCTGCCCCCCTTTCCCTCTGGACCTCCCATC

ATTCCACCCCCTCCCCCCATCTGCCCTGACAGTCTGGATGATGCTGATGCTCTGGGAAGCATGCTG

ATCTCATGGTACATGTCAGGCTATCACACTGGATATTACATGGGCTTTAGGCAGAACCAGAAGGAG

GGGAGGTGCAGCCACTCACTGAACTGA

SEQ ID NO:12，SMNopt-GWcg，GC＝64％

ATGGCCATGAGCAGCGGCGGCAGCGGCGGGGGCGTGCCCGAGCAAGAGGACAGCGTGCTGTTCAGA

AGAGGCACCGGGCAGAGCGACGACAGCGACATCTGGGACGACACCGCCCTGATCAAGGCCTACGAC

AAGGCCGTGGCTAGCTTCAAGCACGCCCTGAAGAACGGCGACATCTGCGAGACAAGCGGCAAGCCC

AAGACCACCCCCAAGAGAAAGCCCGCCAAGAAGAACAAGAGCCAAAAGAAGAACACCGCCGCTAGC

CTGCAGCAGTGGAAGGTGGGCGACAAGTGCAGCGCCATCTGGAGCGAGGACGGCTGCATCTACCCC

GCCACCATCGCTAGCATCGACTTCAAGAGAGAGACCTGCGTGGTCGTGTACACCGGCTACGGCAAC

AGAGAGGAGCAGAACCTGAGCGACCTGCTGAGCCCCATCTGCGAGGTGGCCAACAACATCGAGCAG

AACGCCCAAGAGAACGAGAACGAGAGCCAAGTGAGCACCGACGAGAGCGAGAACAGCAGAAGCCCC

GGCAACAAGAGCGACAACATCAAGCCCAAGAGCGCCCCCTGGAACAGCTTCCTGCCCCCTCCCCCT

CCCATGCCCGGCCCTAGACTCGGCCCCGGGAAGCCTGGCCTCAAGTTCAACGGCCCCCCTCCCCCT

CCCCCTCCCCCTCCCCCCCACCTGCTGTCCTGTTGGCTCCCCCCCTTCCCTAGCGGCCCTCCCATT

ATTCCCCCTCCCCCTCCCATTTGCCCCGACTCCCTGGACGACGCCGACGCCCTGGGCAGCATGCTG

ATCAGCTGGTACATGAGCGGCTACCACACCGGCTACTACATGGGCTTCAGACAGAATCAGAAGGAG

GGCAGATGCAGCCACAGCCTGAACTGA

15CMV enhancer and promoter

GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATA

TGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCC

CATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAAT

GGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGC

CCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGG

ACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGC

AGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACG

TCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCC

CATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT

16SV40 PolyA of SEQ ID NO

CAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCT

TTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTT

Using Lipofectamine 3000 transfection reagent (Invitrogen, #L 3000008), all 12 recombinant vectors (including SMN-WT (wild type), SMN-BS (Biosune), SMN-GS (Genescript), SMN-JCat, SMN-SAgs (Sangon, modified), SMN-GW (Genewiz), SMN-NP (NovoPro), SMN-TK (Tsingke), SMN-TY (Tianyihuiyuan), SMN-GScg (Genscript modified), SMN-GWcg (Genewiz modified), SMN-2011) and negative controls expressing GFP alone were transfected into three cell lines (SH-SY 5Y (Procell, CL-0208), U-251MG (China national institute of authentication of cell culture Collection (China National collection of authenticated cell cultures), catalog number TCHu) and U-87MG (Procell, CL-0238)) according to the manufacturer's instructions. 72 hours after transfection, cells were collected in lysis buffer (RIPA buffer, thermo filter 89901), denatured in 5×sds-PAGE sample loading buffer (Beyotime, P0015L) at 95 ℃ for 15min, separated in 10% SDS-PAGE gel (Sangon, #c 631100), and blotted on 0.22 μm PVDF membrane (Merck Millipore). Protein expression levels of SMN and housekeeping genes β -tubulin were detected with antibodies to human SMN (Sigma, # HPA 045271) and β -tubulin (Proteintech, # 66240-1-Ig), respectively. The results of western blotting are shown in fig. 1. Of all the candidates evaluated here SAgs and TY performed better in terms of SMN protein expression.

To confirm the above results, another batch of purified plasmid was transfected into two cell lines SH-SY5Y and U-251MG according to the same Western blotting protocol, the results are shown in FIG. 2. As shown in the previous study in FIG. 1, similar expression patterns were observed in the two glioma cell lines U-251MG and U-87 MG. To further confirm the results, another transfection was performed in U-251MG cells. By analyzing and combining the data from the two experiments, it was found that SMN-SAgs and SMN-TY consistently showed higher SMN protein expression in all constructs and that the expression levels in multiple cell lines were comparable to the reference SMN-2011. Thus, codon optimized SMN-SAgs and SMN-TY were selected for further evaluation.

Example 2 SMN protein expression driven by different promoters

This example describes the development of optimized expression cassettes for SMN coding sequences.

The strength of the promoter in AAV vectors is known to be critical to the expression of exogenous genes. The strength of 11 different promoters and promoter/intron elements, including constitutive promoters and internally designed EFS/intron chimeric promoters (Table 1) were evaluated in the luciferase assay described below to identify the most suitable promoter elements for our use. The CBh promoter is a previously reported hybrid promoter (Gray, S.J. et al ,Optimizing promoters for recombinant adeno-associated virus-mediated gene expression in the peripheral and central nervous system using self-complementary vectors.Hum Gene Ther,2011.22(9):, pages 1143-53) containing hybrid intron 1. Heterozygous intron 1 (hI 1; SEQ ID NO: 17) is derived from chicken beta-actin (CBA) and mouse picovirus (MMV) introns. Heterozygous intron 2 (hI 2; SEQ ID NO: 18) is a chimeric intron of the human beta-globin and immunoglobulin heavy chain genes. Heterozygous intron 3 (hI 3; SEQ ID NO: 19) is from an adenovirus and an immunoglobulin heavy chain gene. Intron 4 (I4; SEQ ID NO: 20) is the SV40 small t antigen intron. In Table 1, promoter numbers 8-11 (SEQ ID NOS: 22-25) were designed and constructed by the inventors.

TABLE 1 constructs tested in the luciferase assay of FIG. 5

SEQ ID No.17 heterozygous intron 1

GGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCG

GCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAA

TTAGCTGAGCAAGAGGTAAGGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTTTAATTACCT

GGAGCACCTGCCTGAAATCACTTTTTTTCAG

SEQ ID No.18 heterozygous intron 2

GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGA

AGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACA

G

SEQ ID No.19 heterozygous intron 3

GTGAGTACTCCCTCTCAAAAGCGGGCATGACTTCTGCGCTAAGATTGTCAGTTTCCAAAAACGAGG

AGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGGCCGCGTCCATCTGGTCAGAAA

AGACAATCTTTTTGTTGTCAAGCTTGAGGTGTGGCAGGCTTGAGATCTGGCCATACACTTGAGTGA

CAATGACATCCACTTTGCCTTTCTCTCCACAG

Intron 4 of SEQ ID No.20

GTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCTAATTGTTTGTGTATTTTAG

SEQ ID No.22EFShI1

GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACGGGTG

CCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCG

AGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTG

CCGCCAGAACACAGGGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCG

CGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCT

CCTCCGGGCTGTAATTAGCTGAGCAAGAGGTAAGGGTTTAAGGGATGGTTGGTTGGTGGGGTATTA

ATGTTTAATTACCTGGAGCACCTGCCTGAAATCACTTTTTTTCAG

SEQ ID No.23EFShI2

GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACGGGTG

CCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCG

AGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTG

CCGCCAGAACACAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCT

TGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTG

CCTTTCTCTCCACAG

SEQ ID No.24EFShI3

GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACGGGTG

CCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCG

AGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTG

CCGCCAGAACACAGGTGAGTACTCCCTCTCAAAAGCGGGCATGACTTCTGCGCTAAGATTGTCAGT

TTCCAAAAACGAGGAGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGGCCGCGTC

CATCTGGTCAGAAAAGACAATCTTTTTGTTGTCAAGCTTGAGGTGTGGCAGGCTTGAGATCTGGCC

ATACACTTGAGTGACAATGACATCCACTTTGCCTTTCTCTCCACAG

SEQ ID No.25EFSI4

GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACGGGTG

CCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCG

AGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTG

CCGCCAGAACACAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCTAATTG

TTTGTGTATTTTAG

Vectors were constructed by ligating promoter or promoter-intron sequences with a humanized firefly luciferase reporter gene and then transfected into SH-SY5Y, U-251MG and U-87MG cells. Fig. 4 is a schematic diagram illustrating the structure of a representative construct by using EF 1a as an example. After transfection, cells were collected and homogenized in 1 Xpassive lysis buffer (Promega, E1910) and stored at-80 ℃. In determining luciferase activity, 12.5 μl of luciferase assay reagent II (Promega, E1910) was added to 50 μl of thawed cell lysate at room temperature, and then luciferase values were determined on Spectra MaxL i3X (MOLECULAR DEVICES) after rapid shaking for 5 seconds. As shown in FIGS. 5A-5C, the CBh promoter (SEQ ID NO: 20) resulted in higher luciferase activity in all three cell lines, especially in SH-SY5Y and U-251MG, where the luciferase activity driven by CBh was significantly higher than that using the different promoter elements (FIGS. 5A-5C). EFShI1 (SEQ ID NO: 22), consisting of the EFS promoter plus heterozygous intron 1 (hI 1; SEQ ID NO: 17), also shows good expression and is much better than the EFS in combination with other introns (hI 2, hI3 and I4; SEQ ID NO 18, 19 and 20 respectively). The EF1 alpha promoter, which consists of a 212bp EFS core promoter and 939bp long intron, is much longer than the combination of EFS with 229bp hybrid intron 1 and may exceed the packaging capacity of scaAAV when combined with other desired expression elements. Thus, CBh and EFShI1 promoters were selected for further analysis.

EXAMPLE 3 further improvement of SMN protein expression by inclusion of SMN1 intron

This example continues promoter optimization by evaluating potential expression improving introns derived from the SMN1 gene.

Specifically, two 400bp intron fragments, designated Δintron 1 (dI 1, seq. No. 27) and Δintron 2 (dI 2, seq. No. 28), were derived from the first and second introns of SMN1 (nm_ 000344.4) by the following means, respectively: the corresponding intermediate portion was truncated and the 5 'end-most 200bp fragment and the 3' end-most 200bp fragment (dI 1, GRCH/hg 38, chr5 (+): 70925185-70925384;dI2 GRCH38/hg38, chr5 (+): 70938911-70939110) were combined. In the vector, each newly formed 400bp intron is inserted at its original position in the SMN1 gene (e.g., where dI1 is inserted into intron 1, between exon 1 and exon 2 sequences) or at the 3' position of the promoter. The study used the EFS promoter, which was combined with wild type SMN1 (SMN 1-WT. SEQ ID No: 1) to a GOI due to its small size. Seven vectors were constructed as shown in FIG. 6, including four constructs (EFS-SMN 1dI1, EFS-SMN1dI2, EFSdI-SMN 1, EFSdI-SMN 1) and three reference constructs (CMV-SMN 1, EFS-SMN1 and EFShI1-SMN 1) containing dI1 or dI2 inserted into the interior or 5' of WT SMN1, with WPRE and SV40 multiple (A) signals as elements downstream of GOI. These vectors were used to transfect two cell lines SH-SY5Y and U-251MG. Transfection experiments were performed as described above. SMN protein levels were evaluated by WB to determine the additive effect of intron addition and the results are shown in fig. 7.

As shown in FIG. 7, dI2 enhances SMN1 expression when located in a natural location within the gene or between the EFS promoter and GOI, whereas dI1 enhances expression only in U-251MG cells when located 3' of the EFS promoter. Furthermore, EFShI1 promoter showed relatively high strength in SH-SY5Y and U-251MG cells. In summary, in both the neuronal-like cell line (SH-SY 5Y) and glial-like cell line (U-251 MG), the transcriptional strength of EFS was better when combined with the heterozygous intron (hI 1) or dI2 than when combined with the other SMN truncated intron, suggesting that better and wider expression in the central nervous system can be achieved using EFShI or EFSdI2 to express SMN 1.

SEQ ID NO:27EFSdI1

GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACGGGTG

CCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCG

AGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTG

CCGCCAGAACACAGAGGTGAGGTCGCAGCCAGTGCAGTCTCCCTATTAGCGCTCTCAGCACCCTTC

TTCCGGCCCAACTCTCCTTCCGCAGCCTCGGGACAGCATCAAGTCGATCCGCTCACTGGAGTTGTG

GTCCGCGTTTTTCTACGTCTTTTCCCACTCCGTTCCCTGCGAACCACATCCGCAAGCTCCTTCCTC

GAGCAGTTTGGGCTCCTTATTTACCTATGTCTAGCTTTTGGAGTAAAGTCACATAACCTCTAACCA

GGTAAGTTTCCTGTGGCTTTATTTAGGATTTTAAATACTCATTTTCAGTGTAATTTTGTTATGTGT

GGATTAAGATGACTCTTGGTACTAACATACATTTTCTGATTAAACCTATCTGAACATGAGTTGTTT

TTATTTCTTACCCTTTCCAGAG

SEQ ID NO:28EFSdI2

GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACGGGTG

CCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCG

AGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTG

CCGCCAGAACACAGAGGTATGAAATGCTTGCTTAGTCGTTTTCTTATTTTCTCGTTATTCATTTGG

AAAGGAATTGATAACATACGATAAAGTGTTAAAGTACATGTTATTCAGTTTTCATTTTGAAGATTA

GATGGTAGTATGAGTTAGTTAAATCAGGTGATATCCTCCTTTAGAAGTTGATAGCCTATATATGTC

ATCCTTTGTGGAGGCAATAGGGTCTTTAGAGCTGATGTCAGGTGTATGATGCCTTTAAGAGCAGTT

TTTATAGTGCAGGGGGTGGTCAAAAGAGAAAATAGGTGCTTTCTGAGGTGACGGAGCCTTGAGACT

AGCTTATAGTAGTAACTGGGTTATGTCGTGACTTTTATTCTGTGCACCACCCTGTAACATGTACAT

TTTTATTCCTATTTTCGTAGCA

EXAMPLE 4 construction of rAAV vector

Based on the above results, the first two candidate coding sequences (SMN-SAgs and SMN-TY) and the first four promoters (CBh, EFShI1, EFSdI1 and EFSdI 2) were selected for further evaluation. In this example, the optimal combination driving SMN protein expression was studied.

Eight constructs (designated CBh-SAgs, CBh-TY, EFSHI1-SAgs, EFSHI1-TY, EFSdI1-SAgs, EFSdI1, EFSdI-SAgs and EFSdI-TY) were constructed by combining the two optimized coding sequences described above with four promoters in the ITR-WPRE-SV40 poly A-ITR backbone. Three benchmarks were used, including wild-type SMN1 under the control of the CBs promoter (CB promoter plus 97bp SV40 intron; SEQ ID NO: 29), CBh-WT and CBh-2011. 11 recombinant vectors were constructed and transfected into SH-SY5Y and U-87MG cells (two cell lines with different cell identities).

As shown in fig. 8, EFShI and EFSdI2 perform better than EFSdI a when the same coding sequence is directed. SAgs showed slightly better performance than TY in SH-SY5Y and U-87MG cells under the control of the same promoter. In summary, SAgs codons were selected for further evaluation in combination with promoters CBh, EFShI1 and EFSdI.

Example 5 functional SMN protein expression of candidate rAAV vectors

This example shows the performance of candidate vector derived virosomes in restoring SMN function in vitro.

3 Candidate vectors (CBh-SAgs, EFSHI1-SAgs and EFSdI 2-SAgs) were packaged into AAV9 virus particles along with 2 bases (CBs-WT and CBh-2011).

To assess the ability of these viral vectors to express functional SMN proteins, SMN1 knockdown cell models were established by lentiviral mediated gene knockdown in SH-SY5Y cell lines. The pLenti plasmid containing SMN 1-targeting shRNA (SEQ ID NO: 30) was packaged as a lentivirus and then added to SH-SY5Y cells. Puromycin challenge enriches cells stably expressing SMN1 shRNA by embedding puromycin resistance genes in lentiviruses. Puromycin resistant cells were collected and analyzed to confirm knockdown of SMN protein (fig. 9). The SMN1 KD cell line was designated SMN1-KD-SH. Negative controls were used: shNT (SEQ ID NO: 31) targeting non-coding genes.

The 3 candidates and 2 benchmarks described above were added to SMN1-KD-SH cells at MOI 4E+5 together with MG-132 (1. Mu.M or 10. Mu.M, medChemExpress, catalog number HY-13259) to improve AAV transduction efficiency (Ran, G. Et al ,Site-Directed Mutagenesis Improves the Transduction Efficiency of Capsid Library-Derived Recombinant AAV Vectors.Mol Ther Methods Clin Dev,2020.17: pages 545-555). An increase in SMN protein expression was observed in all 5 vectors evaluated. Of the vectors tested, the vector containing EFShI1 showed the highest expression level (fig. 10).

The deletion of SMN protein results in impaired cellular function, including defective assembly of U-rich micronuclear ribonucleoprotein particles (UsnRNP) and down-regulation of Sm transcripts like SmB and SmD. The reintroduction of SMN protein will rescue these cell defects (Prusty, A.B. et al ,Impaired spliceosomal UsnRNP assembly leads to Sm mRNA down-regulation and Sm protein degradation.J Cell Biol,2017.216(8): pages 2391-2407.). The 3 candidates and 2 benchmarks were tested in the presence of 1. Mu.M MG-132 in SMN1-KD-SH cells. 3 days after infection, useTotal RNA was extracted from the cell/tissue total RNA isolation kit (Vazyme, catalog number RC 112) and the relative levels of SmB and SmD mRNA were determined on a QuantStudioTM Pro real-time PCR system (thermofisher, catalog number A43180) by a HISCRIPT II one-step qRT-PCR SYBR Green kit (Vazyme, catalog number Q221-01). GAPDH MRNA levels were used as a housekeeping control. The results showed that the mRNA levels of UsnRNP biogenesis-related genes SmB and SmD were reduced in SMN1-KD-SH cells, whereas the EFShI-SAgs vector (FIG. 11) significantly normalized these down-regulated messages at a MOI of 1E+6.

An in vitro assay of human motor neurons was established to further evaluate candidate AAV vectors.

Human Induced Pluripotent Stem Cell (iPSC) -derived motor progenitor cells (MNP) are supplied by HopStem (catalog number HopCell-MPC). MNPs were cultured in differentiation medium (HopStem, motor neuron differentiation medium with supplemental factor II) for 7 days, and then lentiviruses expressing SMN1 shRNA were applied to cells at MOI 20 (fig. 12). Two days after lentivirus addition, candidate AAV and two benchmarks were added. The morphology of AAV vector transduced cells was normal, without any apparent defect in neurite formation, and neurite outgrowth was observed 5 days after AAV administration (14 days after differentiation) (fig. 13). Treated motor neuron samples were collected by N-PERTM neuronal protein extraction reagent (Thermo filter, 87792) and SMN protein levels were determined by WB. The results indicate that CBh-SAgs gave better expression in lentiviral treated cells than other candidate vectors (fig. 14), but only EFShI-SAgs expressed the same level of SMN as in the PBS + GFP group (which can be considered as an endogenous level of SMN in human motor neurons).

Example 6 expression of SMN protein in brain and spinal cord of wild-type C57BL/6 mice by administering rAAV vector via the ventricle

Candidate AAV vectors comprising expression cassettes CBh-SAgs, EFSHI1-SAgs and EFSdI2-SAgs (SEQ ID NO:33, SEQ ID NO:34 and SEQ ID NO:35, respectively) were injected into the lateral ventricle of wild type C57BL/6 mice (intraventricular) on postnatal day 1. After 21 days, mice were euthanized and tissue samples were collected in N-PERTM neuronal protein extraction reagent (Thermo-fisher, 87792) and proteins were extracted after tissue homogenization. We observed elevated SMN protein levels in both motor cortex and spinal cord samples collected from the five treatment groups as compared to the CMV-GFP control group (fig. 15-18), and EFShI-SAgs expressed the most SMN protein among the three candidates.

Claims

1. An isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs 3-12, wherein said nucleotide sequence encodes a human SMN polypeptide.

2. The isolated nucleic acid molecule of claim 1, wherein the nucleotide sequence is SEQ ID No.6 or SEQ ID No. 9.

3. An expression cassette comprising the isolated nucleic acid molecule of claim 1 or claim 2.

4. The expression cassette of claim 3, further comprising a promoter operably linked to the 5' of the nucleotide sequence encoding the human SMN polypeptide.

5. The expression cassette of claim 4, wherein the promoter is a hybrid promoter optimized for gene expression in the Central Nervous System (CNS).

6. The expression cassette of claim 4 or claim 5, further comprising an intron.

7. The expression cassette of claim 6, wherein the intron is a hybrid intron or an intron of a gene derived from human SMN.

8. The expression cassette of claim 7, wherein the introns are introns derived from (1) the chicken β -actin (CBA) gene and the mouse adenovirus (MMV) intron; (2) Introns of the human beta-globin gene and introns of the immunoglobulin heavy chain gene; or (3) a hybrid intron of an adenovirus and an intron of an immunoglobulin heavy chain gene, or an intron derived from (4) an SV40 small t antigen intron.

9. The expression cassette according to claim 8, wherein the intron comprises or consists of a nucleotide sequence as shown in any of SEQ ID No. 17-20.

10. The expression cassette of claim 9, wherein the intron sequence comprises the nucleotide sequence of SEQ ID No. 17.

11. The expression cassette according to any one of claims 4-10, wherein the promoter is an EFS-derived promoter and comprises the nucleotide sequence set forth at nucleotide positions 1-212 of SEQ ID No. 22.

12. The expression cassette of claim 11, wherein the EFS derived promoter comprises an intron sequence comprising a nucleotide sequence selected from the group consisting of SEQ ID NO 17-20 (hI 1, hI2, hI3, I4).

13. The expression cassette of claim 12, wherein the EFS-derived promoter is a promoter comprising an intron sequence comprising the nucleotide sequence of SEQ ID No. 17 (hI 1).

14. The expression cassette according to any one of claims 6-13, wherein the promoter comprises or consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs 21-25.

15. The expression cassette according to claim 14, wherein the promoter has the nucleotide sequence of SEQ ID No. 21 or 22.

16. The expression cassette of claim 7, wherein the intron sequence is derived from the SMN1 gene.

17. The expression cassette of claim 16, wherein the intron sequence is a complete or partial sequence of intron 1 or intron 2 of the SMN1 gene.

18. The expression cassette of claim 17, wherein the intron sequence consists of a 5 'terminal 50-300bp fragment and a 3' terminal 50-300bp fragment of intron 1 or intron 2 of the SMN1 gene.

19. The expression cassette of claim 18, wherein the intron sequence has the nucleotide sequence at nucleotide positions 215-614 of SEQ ID No. 27 or 28.

20. The expression cassette according to any one of claims 16-19, wherein the intron sequence is located immediately 3' of the promoter or at a position between exon 1 and exon 2 of the SMN1 coding sequence.

21. The expression cassette of claim 20, wherein the promoter is an EFS promoter as set forth in nucleotide positions 1-212 of SEQ ID NO. 22.

22. The expression cassette of claim 21, wherein the promoter and the intron sequence form an EFS-derived promoter comprising or consisting of the nucleotide sequence of SEQ ID No. 27 (EFSdI 1) or SEQ ID No. 28 (EFSdI 2).

23. The expression cassette of any one of claims 3-22, further comprising one or more of:

a) Woodchuck hepatitis virus posttranscriptional regulatory elements (WPREs);

b) A polyadenylation sequence; and

C) miRNA binding motifs.

24. The expression cassette of claim 23, wherein the polyadenylation sequence is simian virus 40 poly a (SV 40 poly a).

25. The expression cassette according to any one of claims 3-24, comprising the nucleotide sequence of SEQ ID No. 33, SEQ ID No. 34 or SEQ ID No. 35.

26. A rAAV vector comprising the nucleic acid molecule of claim 1 or claim 2 or the expression cassette of any one of claims 3-25.

27. The rAAV vector of claim 26, further comprising two AAV Inverted Terminal Repeats (ITRs).

28. The rAAV vector of claim 27, wherein the ITR is selected from the group consisting of AAV2 ITR of SEQ ID No. 14 and ITR of a terminal dissociation site mutation of SEQ ID No. 13.

29. A viral particle comprising the rAAV vector of any one of claims 26-28 packaged into an AAV capsid.

30. The viral particle according to claim 29, wherein the capsid has CNS tropism.

31. The viral particle according to claim 30, wherein the capsid is an AAV9 or AAV php.b capsid.

32. A pharmaceutical composition comprising the rAAV vector of any one of claims 26-28 or the viral particle of any one of claims 29-31, and a pharmaceutically acceptable excipient.

33. A method for treating Spinal Muscular Atrophy (SMA) in a subject in need thereof, the method comprising administering to the subject a therapeutically effective dose of the viral particle of any one of claims 29-31 or the pharmaceutical composition of claim 32.

34. The method of claim 33, wherein the viral particle or the pharmaceutical composition is administered intrathecally.

35. The method of claim 33 or claim 34, wherein the subject is a mammal.

36. The method of claim 35, wherein the subject is a human.

37. Use of the rAAV vector according to any one of claims 26-28 or the viral particle according to any one of claims 29-31 for the manufacture of a medicament for the treatment of SMA.