CN1181097C - Monochain antibody with dual specificities possessing activity for restraining adherence and aggregation of blood platelets - Google Patents
Monochain antibody with dual specificities possessing activity for restraining adherence and aggregation of blood platelets Download PDFInfo
- Publication number
- CN1181097C CN1181097C CNB021111049A CN02111104A CN1181097C CN 1181097 C CN1181097 C CN 1181097C CN B021111049 A CNB021111049 A CN B021111049A CN 02111104 A CN02111104 A CN 02111104A CN 1181097 C CN1181097 C CN 1181097C
- Authority
- CN
- China
- Prior art keywords
- chain antibody
- sequence
- gly
- antibody
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention relates to a monochain antibody with dual specificities, which is combined by the monochain antibodies SZ-2 and SZ-21 which respectively have specific combining activity on the glucoprotein GPIb alpha and GPIIIa of the surface of platelets. The monochain antibody with the dual specificities of the present invention simultaneously has the dual activity of the monochain antibodies SZ-2 and the SZ-21. A platelet starting activating section (i.e. an adhesion function of the platelets) can be inhibited, and the final forming process (i.e. a platelet aggregation function) of thrombus can be inhibited. Thus, the novel monochain antibody of the present invention, which is used as new thrombus resistant substitute medicine, has the advantages which are better than those of conventional thrombus resistant medicine and potential application value.
Description
The present invention relates to new bispecific single-chain antibody, particularly relate to new SZ-2/SZ-21 bispecific single-chain antibody with antiplatelet adhesion and aggregation activity, its preparation method and suppressing platelet adhesion reaction and gathering, and the application of antithrombotic in forming.
Thrombotic disease as myocardium infarct, cerebrovascular thrombosis etc., is the serious harm human health, causes one of human body main causes of death.In addition, thrombosis still is a related a kind of important pathologic process in numerous disease (as glomerulonephritis, the change of the diabetes small vessel disease etc.) pathogenesis.Therefore, prevention and treatment thrombosis have become the current method that generally adopts clinically.Thrombocyte plays crucial effect in the thrombosis process.In the normal blood working cycle, thrombocyte remains static.Yet in case vascular damaged takes place, thrombocyte will combine and adhere to the subendothelial tissue that the damaged blood vessels place exposes with the blood plasma von Willebrand factor (vWF) by the Ib acceptor in its surface film glycoprotein (GP) Ib-IX mixture.Adherent thrombocyte is activated by subendothelial tissue or the local zymoplasm that forms, and causes release reaction and arachidonic acid metabolism process.Thromboxane (TX) A that secretes the ADP of release or form by the former by the latter
2All can cause platelet aggregation.Platelet aggregation is subjected to the conciliation of thrombocyte GP IIb/IIIa acceptor.The GP IIb/IIIa acceptor that is activated forms cross-bridges by fibrinogen molecule between adjacent thrombocyte, constitute the skeleton of platelet aggregation, finally causes thrombosis.The TXA that thrombocyte discharges
2Also can be further and the plasma proteins effect Deng product, promote the formation of thrombus.Therefore, suppressing hematoblastic effect in each stage effectively, is the important channel of prevention or treatment thrombosis disease.GP IIb/IIIa antagonist is the common final approach of anticoagulant directly, so be than stronger, more special antiplatelet drugs of other anti-platelet agent effects such as present Asprin known and that generally use clinically, Ticlopidines.These drug mains will comprise three classes: monoclonal antibody (McAb), the peptide class of synthetic and non-peptide micromolecular material.For example, succeeded in developing the also humanization anti-CD 61 epi-position GP IIb/IIIa monoclonal antibody 7E3 (C7EFab, trade(brand)name ReoPro) of clinical application.In addition, the integrelin type cyclic peptide with sequence RGD (Alg-Gly-Asp) (it is the common characteristic sequence of platelet receptor aglucon) has also dropped into clinical application (referring to United States Patent (USP) 6,168, No. 925).
Have immunogenicity in order to overcome mouse source property McAb, and the defectives such as tissue penetration difference of complete antibody, people attempt to prepare various novel antibody based on genetically engineered and protein engineering.Single-chain antibody (scFv) is exactly to utilize the DNA recombinant technology, by a joint sequence antibody heavy chain variable region (VH) is connected with variable region of light chain (VL) gene and express produce antibody fragment.According to different research and application purpose, with the scFv of two different sourcess be combined into have two kinds not synantigen be the research direction of those skilled in the art's common concern in conjunction with the novel antibody (being bispecific single-chain antibody) of feature.And, use in order to expand in clinical diagnosis and treatment neutralization, select for use the different scFv in source to make up bispecific single-chain antibody (bisFvs) usually, like this, bisFv has just concentrated two aspect characteristics of bifunctional antibody and single-chain antibody.Therefore, no matter be as immune blocker or drug targeting carrier, be used for still target cell identification of immune imaging diagnosis, bispecific single-chain antibody all has bigger application potential clinically.
An object of the present invention is to provide a kind of bispecific single-chain antibody that suppresses platelet adhesion reaction and aggregation activity that has.
According to a preferred embodiment of the invention, wherein said bispecific single-chain antibody is by the SZ-2 single-chain antibody with anti-GPIb alpha active and has the active SZ-21 single-chain antibody of anti-GPIIIa and merge and form, and has a joint sequence between the two.
According to a preferred embodiment of the invention, wherein said bispecific single-chain antibody has the aminoacid sequence shown in SEQ ID NO:14 in the sequence table basically.
According to a preferred embodiment of the invention, wherein said joint sequence is (Gly
4Ser)
1-3.
Another object of the present invention provides the dna sequence dna and the function equivalent thereof of the coding SZ2/SZ21 bispecific single-chain antibody shown in SEQ ID NO:13 in the sequence table.
A further object of the present invention provides the recombinant expression vector that carries above-mentioned dna sequence dna.
A further object of the present invention provides and is transformed by said recombinant expression vector or the host cell of transfection.
A further object of the present invention provides the method for producing the bispecific single-chain antibody that is defined as above, and this method comprises:
(1) provides heavy chain and the variable region of light chain dna encoding sequence of SZ2 and SZ21;
(2) by joint sequence (Gly
4Ser)
1-3SZ2 or SZ21 dna encoding sequence light, variable region of heavy chain that step (1) is obtained connect into the single-chain antibody encoding sequence;
(3) SZ2 that step (2) is obtained, SZ21 single-chain antibody dna encoding sequence are by joint sequence (Gly
4Ser)
1-3Be operably connected on the suitable expression;
(4) recombinant expression vector with step (3) transforms or the transfection appropriate host cell;
(5) host cell of culturing step (4), and from said cell and its substratum, reclaim required desired polypeptides.
A further object of the present invention provides the application of bispecific single-chain antibody in producing antiplatelet adhesion and accumulative medicine that is defined as above.
A further object of the present invention provides the application of bispecific single-chain antibody in the immune imaging diagnosis that is defined as above.
Fig. 1 shows pET22-21-L-2 construction of recombinant plasmid synoptic diagram.
Fig. 2 shows that the enzyme of pET22-21-L-2 recombinant plasmid cuts evaluation.Wherein: swimming lane 1 is a DNA/EcoRI+HindIII molecular weight standard thing; Swimming lane 2 is the EcoRI single endonuclease digestion product of pET22-21-L-2; Swimming lane 3 is the EcoRI single endonuclease digestion contrast of pET22; Swimming lane 4 is the BamHI/NotI double digestion product of pET22-21-L-2; Swimming lane 5 is cut product for the BamHI/NotI/EcoRI/SalI enzyme of pET22-21-L-2; Swimming lane 6 is the PCR product of SZ-21; Swimming lane 7 is the PCR product of joint sequence; Swimming lane 8 is 100 gradients (ladder) dna molecular amount standard substance.
Fig. 3 shows the SZ-2/SZ-21 bispecific single-chain antibody in intestinal bacteria behind the abduction delivering, and the polyacrylamide gel electrophoresis of bacterium protein (SDS-PAGE) is analyzed.Wherein: swimming lane 1 is the protein standard substance; Swimming lane 2 is inductive bacterium lysate not; Swimming lane 3 is an inductive bacterium lysate; Swimming lane 4 is an inductive bacterium tropina precipitation; Swimming lane 5 is an inductive bacterium tropina supernatant; Swimming lane 6 is the protein expression product of purifying.A is the Western engram analysis result of not inductive bacterium lysate; B is the Westem engram analysis result of inductive bacterium lysate.
Fig. 4 shows that thrombocyte with the SZ-2/SZ-21 bispecific single-chain antibody of Flow cytometry is in conjunction with activity.Frame A is the thrombocyte negative control; Frame B is that the SZ-2 monoclonal antibody combines positive control with thrombocyte; Frame C is that the SZ-21 monoclonal antibody combines positive control with thrombocyte; Frame D shows that the SZ-2/SZ-21 bispecific single-chain antibody combines with hematoblastic.
Fig. 5 shows SZ-2/SZ-21 bispecific single-chain antibody and thrombocyte lysate bonded Western engram analysis.Swimming lane 1 is the protein molecular weight standard thing; Swimming lane 2 is SZ-2 monoclonal antibody and thrombocyte lysate bonded positive control; Swimming lane 3 is SZ-21 monoclonal antibody and thrombocyte lysate bonded positive control; Swimming lane 4 demonstration SZ-2/SZ-21 bispecific single-chain antibodies combine with the thrombocyte lysate.
Fig. 6 shows the inhibition activity of SZ-2/SZ-21 bispecific single-chain antibody to ristomycin inductive platelet aggregation.The negative contrast of frame A; Frame B is SZ-2 monoclonal antibody (10 μ g/mL)+ristomycin inductive thrombocyte (positive control); Frame C is SZ-2/SZ-21 bispecific single-chain antibody (20 μ g/mL)+ristomycin inductive thrombocyte.
Fig. 7 shows the inhibition activity of SZ-2/SZ-21 bispecific single-chain antibody to the platelet aggregation of thrombin induction.The negative contrast of frame A; Frame B is the thrombocyte (positive control) of SZ-2 monoclonal antibody (10 μ g/mL)+thrombin induction; Frame C is the thrombocyte of SZ-2/SZ-21 bispecific single-chain antibody (20 μ g/mL)+thrombin induction.
Fig. 8 shows the inhibition activity of SZ-2/SZ-21 bispecific single-chain antibody to ADP inductive platelet aggregation.The negative contrast of frame A; Frame B is SZ-21 monoclonal antibody (10 μ g/mL)+ADP inductive thrombocyte (positive control); Frame C is SZ-2/SZ-21 bispecific single-chain antibody (30 μ g/mL)+ADP inductive thrombocyte.
The present invention relates to have platelet adhesion reaction and assemble the bispecific single-chain antibody that suppresses active, special Relate to respectively Platelet surface glycoprotein GPIb α and GPIIIa are had the specific bond activity by known SZ-2 and SZ-21 single-chain antibody merge the bispecific single-chain antibody form. The invention further relates to Produce method and the application thereof of said bispecific single-chain antibody with the DNA recombinant technique. Of the present invention The SZ-2/SZ-21 bispecific single-chain antibody by specifically in conjunction with Platelet surface glycoprotein GPIb α and GPIIIa suppresses hematoblastic adhesion and gathering effectively.
SZ-2 is at first by a strain of the inventor and its colleague's preparation monoclonal antibody for GPIb α (Ruan Changgeng etc., Chinese science (B collects), 948-963,1986). This monoclonal antibody not only can suppress Ristomycin/win the platelet aggregation that Tobramycin is induced namely suppresses the specific binding of GPIb and vWF, But but also the platelet aggregation that Trombin inhibiting or type i collagen albumen and platelet activating factor are induced. For reducing immunogenicity and the molecular weight of mouse originality SZ-2 antibody on human body, inquire into it in treatment thrombotic disease Application in the disease, we successfully make up and have expressed SZ-2 single-chain antibody (Ruan Changgeng etc., platelet membrane Structure, expression and the functional study of glycoprotein monoclonal antibody SZ-2 single-chain antibody, Chinese Journal of Hematology, Wait to publish).
Equally, SZ-21 also is single by the new anti-GP IIb/IIIa of a strain of the inventor and its colleague's preparation Clonal antibody (Ruan Changgeng etc., Chinese Medical Journal, 67 (2): 76-78,1987). In the external and body Test shows that SZ21 antibody can suppress hematoblastic aggreation, and can suppress the moving of living Animal Models Phlebothrombosis forms. We successfully make up and have expressed SZ21 single-chain antibody (Ruan Changgeng etc., blood Structure, the expression of platelet membrane glycoprotein monoclonal antibody SZ-21 Gene cloning and single-chain antibody, immunology Magazine, 17 (3): 200-203,2001). Studies have shown that the single-chain antibody that we make has kept the parent The antiplatelet of antibody and fibrinogen binding ability, and performance has obvious platelet aggregation-against and anti-The thrombosis activity.
After thrombotic diseases pathogenesis and the circumscribed in-depth analysis of existing antithrombotic reagent, we recognize Knowledge to: existing anti-platelet agent just suppresses some links of platelet function basically, although GP The IIb/IIIa antagonist is the final common pathway that suppresses platelet aggregation, but before this by Activated platelet The bioactivator that discharges, equally can to go out/physiological equilibrium of blood coagulation produces negative influence. Therefore, Wish to prepare a kind of hematoblastic initiating activated channel that both can suppress, can suppress again the final of platelet aggregation The novel antiplatelet antibody of common pathway.
The inventor on the basis that has obtained respectively SZ2 and SZ21 single-chain antibody, the applying gene worker Journey and protein engineering principle and operation are recombinated and are spliced two single-chain antibodies, obtain of the present invention New bispecific single-chain antibody, thus the present invention finished.
In order to realize the foregoing invention purpose, can according to technology well known by persons skilled in the art (as referring to J.Sambrook, E.F.Fritsck﹠T.Maniatis, Molecular Cloning, A Laboratory Mannual, 2nd ed, Cold Spring Harbour Press, NY, 1989) carry out separation or synthetic, the nucleotides of gene The cutting of fragment be connected, analysis and the mirror of the structure of clone and expression vector and amplification, nucleotide sequence Fixed, transformation and cultivation, and the operations such as isolation and purification of expression product. Anti-as for monoclonal The technology of preparing of body also is well known to those of ordinary skill in the art. Briefly, exempt from blood platelet The epidemic disease BALB/C mice is put to death animal and separating Morr. cell then. Then, for example gather second two at polymerizer Alcohol exists lower, and the single cell suspension of splenocyte is pressed suitable cell proportion in myeloma cell (SP2/0) Contact is also merged. The hybridoma that has merged with conventional H AT Screening of Media. Then, use Western The methods such as blotting, immuno-precipitation, enzyme linked immunosorbent assay identify that the positive resistance of required specificity is thin Born of the same parents' strain.
For example, can use the RT-PCR technology, from SZ2, SZ21 hybridoma, amplify the dna encoding sequence of SZ2 and SZ21 heavy chain and variable region of light chain, by a joint sequence [(Gly4Ser)
1-3] The dna encoding sequence of light chain and variable region of heavy chain is linked together, and resultant sequence clone is arrived Suitable prokaryotic expression carrier for example among pET22 (SZ2) and the pET20 (SZ21), obtains with structure Required expression vector pET22-SZ2scFv and pET20-SZ21scFv (Ruan Changgeng etc., platelet membrane glycoprotein Structure, expression and the functional study of protein monoclonal antibody SZ-2 single-chain antibody, Chinese Journal of Hematology, Wait to publish; Ruan Changgeng etc., platelet membrane glycoprotein monoclonal antibody SZ-21 Gene cloning and single-chain antibody Structure, expression, Journal of Immunology, 17 (3): 200-203,2001)). Can be according to pET22-SZ2scFv (Gly in the carrier4Ser)
1-3The dna sequence dna of joint designs and synthesizes one couple of PCR primers. Then, The ET22-SZ2scFv expression vector is template, and pcr amplification obtains the dna encoding sequence of corresponding joint. Borrow Help the suitable restriction enzyme site of introducing in the pcr amplification, said polypeptid coding sequence is spliced to before us Make up, and in the pET22-SZ2scFv carrier of the known coded sequence that carries SZ-2 single-chain antibody polypeptide 5 ' end of SZ-2scFv coded sequence. Then, design and synthesize again another to suitable PCR primer, Amplification obtains compiling from the recombinant vector pET20-SZ21scFv of the known SZ-21scFv of carrying coded sequence The dna sequence dna of code SZ-21scFv. This sequence is operably connected to above-mentioned pET22-SZ2scFv Introduced 5 ' end of the SZ-2 polypeptid coding sequence of joint sequence in the carrier, thereby obtained for expressing this The recombinant expression carrier pET22-21-L-2 of the bispecific single-chain antibody (SZ2/SZ21) of invention (referring to Embodiment 1). The recombinant expression carrier that so obtains has carried the coding of bispecific single-chain antibody of the present invention Sequence, and this sequence is basically shown in SEQ ID NO:13.
As the initial plasmid that makes up recombinant expression carrier of the present invention, can use any can be carefully The plasmid vector that stably keeps and copy in the bacterial cell. Initial plasmid like this comprises but is not only limited to PET22b, pTZ18R, pBR322, pKK223-3, pUC18, pUC19, pUC119 etc. But this Efficient expression plasmid pET22b preferably in the invention.
Can use any suitable method (such as CaCl2What facture) will as above obtain is recombinant expressed Carrier transforms or is transfected into for example coli strain BL21 (DE3) of suitable protokaryon or eucaryon host Among the PlysS, and be converted or the place of transfection being suitable for expressing cultivating under the condition of above-mentioned SZ2/SZ21 polypeptide Chief cell. Behind cultivation and the proliferative cell, select transformant according to the resistance to the action of a drug that bacterial cell obtains. In the situation of using escherichia coli host, preferably utilize drug resistance gene as selected marker gene, For example ampicillin resistance gene, chloramphenicol resistance gene, kalamycin resistance gene, tetracycline resist Property gene and bleomycin resistant gene etc.
Can go out the culture supernatant through centrifugation simply, then with various separation and purification technique from cultivating Separate and purifying SZ2/SZ21 polypeptide product in the cleer and peaceful product of cell lysis on the thing. Be used for purifying and reclaim institute The method that needs polypeptide comprise but be not only limited to ammonium sulfate precipitation, ultrafiltration, ion-exchange chromatography, hydrophobic chromatography, The various combination of gel permeation chromatography, affinity chromatography or these methods.
The SZ2/SZ21 bispecific single-chain antibody polypeptide of purifying of the present invention has basically such as sequence table Amino acid sequence shown in the middle SEQ ID NO:14 is made at the BA that is unlikely said polypeptide Become under the prerequisite of substantial effect, can in sequence, add, delete, replace and replace indivedual or part Amino acid is for example deleted in one or more amino acid, deletion of N or C end or the displacement complete sequence Blank area, the one or more amino acid in the sequence are changed into have similar charging property/hydrophobic ammonia Base acid or D type amino acid etc. Those skilled in the art are appreciated that also these changes and change will fall Entering the present invention awaits the reply in the claim scope.
The present invention also provides the strand of the coding SZ2/SZ21 bispecific shown in SEQ ID NO:13 The dna sequence dna of antibody and function equivalent thereof, this dna sequence dna have merged coding SZ2 and SZ21 is single The coded sequence of chain antibody, and between has added a joint sequence. Said joint sequence Do not express any functional polypeptide product, but can effectively improve flexibility and the stability of fusion product. Simultaneously, the present invention also provides the recombinant expression carrier that carries above-mentioned dna sequence dna. Said restructuring table Reach carrier and can be and be suitable for the recombinant expression carrier of in protokaryon or eucaryon host, expressing, but the present invention be preferred Be pET22-21-L-2. In addition, the present invention also provides and has been transformed by said recombinant expression carrier or turn to The protokaryon that dyes or eukaryotic host cell, particularly Bacillus coli cells. What should particularly point out is the present invention The dna sequence dna of coding SZ2/SZ21 bispecific single-chain antibody include but are not limited to such as sequence table Sequence shown in the middle SEQ ID NO:13. It will be appreciated by those skilled in the art that, do not changing its institute Under the condition of the amino acid sequence of coding, to any adding, deletion, the replacement of said dna sequence dna Or displacement all will fall into the present invention and await the reply in the claim scope.
The present invention further provides the method for producing the bispecific single-chain antibody that is defined as above, the method comprises:
(1) provides heavy chain and the variable region of light chain coded sequence of SZ2 and SZ21;
(2) by joint sequence (Gly4Ser)
1-3SZ2 or SZ21 that step (1) is obtained are light, heavy The dna encoding sequence of chain variable region connects into the single-chain antibody coded sequence;
(3) SZ2 that step (2) is obtained, SZ21 single-chain antibody dna encoding sequence are by joint sequence (Gly
4Ser)
1-3Be operably connected on the expression vector;
(4) recombinant expression vector with step (3) transforms or the transfection appropriate host cell;
(5) host cell of culturing step (4), and from said cell and its substratum, reclaim required desired polypeptides.
According to a preferred embodiment of the invention, the dna encoding sequence of wherein said SZ-2 and SZ-21 antibody can be based on the known amino acid de novo synthesis of SZ-2 and SZ-21 antibody polypeptides; Also can be by suitable primer with polymerase chain reaction (PCR) method, from the recombinant plasmid of known dna encoding sequence of carrying the SZ-2 single-chain antibody amplification ground to; Or use the RT-PCR technology, to amplify from SZ2 and SZ21 hybridoma be connected to each other behind the heavy chain of SZ2 and SZ21 and the chain variable region gene forms.Be the object of the invention, can use any plasmid vector that can in bacterial cell, stably keep and duplicate.For example, the initial plasmid that is used to make up recombinant expression vector of the present invention comprises but is not only limited to pET22b, pTZ18R, pBR322, pKK223-3, pUC18, pUC19, pUC119 etc.But efficient expression plasmid pET22b preferably among the present invention.In addition, the host cell that is used to express bispecific single-chain antibody of the present invention can be any prokaryotic cell prokaryocyte, eukaryotic cell, vegetable cell or the insect cell that can express the external source fused protein under proper condition.But be the object of the invention, wherein preferably prokaryotic cell prokaryocyte, particularly Bacillus coli cells.Can use the various combination of ordinary methods such as ammonium sulfate precipitation known in the art, ultrafiltration, ion exchange chromatography, hydrophobic chromatography, gel permeation chromatography, affinity chromatography or these methods, separate and purifying fused protein of the present invention, to obtain purity more than or equal to 98% protein.
Can use methods such as flow cytometry, enzyme linked immunosorbent assay (ELISA), the test of Western trace to detect the thrombocyte binding ability of expression product, and use the thrombocyte combined function of ristomycin, zymoplasm or ADP inductive PAgT research expression product.The result shows forcefully, the expression product that as above obtains not only has with thrombocyte and platelet surface membrane glycoprotein Ib and IIIa and combines activity, and can suppress ristomycin, zymoplasm or ADP inductive platelet aggregation (referring to embodiment 3 and 4) effectively.
SZ-2/SZ-21 bispecific single-chain antibody of the present invention can be discerned and in conjunction with platelet surface membrane glycoprotein (GP) Ib and IIIa, thereby can suppress platelet adhesion reaction and aggregation capability effectively.Therefore, SZ2/SZ21 bispecific single-chain antibody of the present invention both can suppress thrombocyte initiating activation link (being platelet adhering function), can suppress the final forming process (being platelet aggregation) of thrombus again.
Because bispecific single-chain antibody of the present invention not only can combine with GPIIIa but also can combine with GPIb, causes both to lead each other, realize two valency combinations, thereby have better specificity and stability than its precursor polypeptide.In addition, the molecular weight of SZ-2/SZ-21 bispecific single-chain antibody of the present invention less relatively (about 64KDa) is so its immunogenicity is also relatively low.Moreover, because this antibody do not have the Fc end, the therefore destruction that can not cause platelet cell because of itself and combining of reticuloendothelial system.
Bispecific single-chain antibody of the present invention has the activity in conjunction with platelet surface membrane glycoprotein Ib and IIIa, promptly this bispecific single-chain antibody has the double activity of single-chain antibody SZ-2 and SZ-21 simultaneously, so, it not only can suppress thrombocyte initiating activation link (being platelet adhering function), and, also can suppress the final forming process (being platelet aggregation) of thrombus.Bispecific single-chain antibody of the present invention also has the advantage of monoclonal antibody institute inherent high specific and high affinity.Therefore, novel single-chain antibody of the present invention can be used as a kind of new antithrombotic drug candidate, has incomparable advantage of conventional antithrombotic reagent and potential using value.In addition, based on above-mentioned these activity and the advantage of bispecific single-chain antibody of the present invention, it also can be used as a kind of high specific and high affinity diagnostic reagent, is used for the non-invasi diagnostic imaging of artery and vein thrombus.
Below describe the present invention for example in detail by non-limiting example.Those skilled in the art can not deviate under essence spirit of the present invention and the principle prerequisite, change or change some technology contents or the sport technique segment of describing in this specification sheets, but one will understand that change that these are parallel or change all will be included within the claim scope that awaits the reply of the present invention.
The structure of embodiment 1:pET22-21-L-2 expression vector
Present embodiment is intended to illustrate the structure of the recombinant expression vector that is used to express SZ2/SZ21 bispecific single-chain antibody polypeptide of the present invention.
(1) structure of recombinant plasmid pET22-2scFv
(a) clone of SZ-2 variable region gene: use Triol test kit (Gibco BRL), extract total RNA in SZ-2 antibody and the well-grown hybridoma (Ruan Changgeng etc., Chinese science (B collects), 948-963,1986) from secreting.Use random primer, reverse transcription synthesizes cDNA.Be template with this synthetic cDNA then, and use following light/heavy chain primer P1:5 '-AGGTCCAGCTGCAGGAGTCTGG (SEQ ID NO:1) and P2:5 '-TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG (SEQ ID NO:2), and P3:5 '-GACATTGAGCTCACCCAGTCTCCA (SEQ ID NO:3) and P4:5 '-GTTAGATCTCGAGCTTGGTCCC (SEQ ID NO:4), the VH of the SZ-2 that increases respectively and VL gene.With the ordinary method purifying and after reclaiming these pcr amplification products, they are connected on pUC-Tm (worker bio-engineering corporation is given birth in the Shanghai) carrier.With resulting ligation product transformed competence colibacillus e. coli tg1 cell, and after cultivating, under X-gal and IPTG display mark, select white colony.(VH and VL gene order are seen GenBank, and the gene order accession number is: VH:AF468835 to select positive colony to carry out dna sequencing; VL:AF468836).
(b) structure of SZ-2 single-chain antibody expression vector: cloning vector VH-Tm that will as above obtain and VL-Tm also use PstI/Bst EII and SacI/XhoI double digestion respectively, after recovery and purifying VH, the VL fragment, successively they are cloned in PSW1-ScFv (MCR laboratory doctor Winter of the univ cambridge uk is so kind as to give) carrier.With resulting recombinant plasmid transformed competence colibacillus TG1 cell and from by extracting plasmid DNA the cell transformed, then with enzyme cutting method preliminary evaluation positive recombinant.With the positive recombinant is template, and uses primer P5:5 '-CCAGGTCGACCTGCAGGAGTCAGG (SEQ ID NO:5) and P6:5 '-TATGCGGCCGCCTCGAGCTTGGTCC (SEQ ID NO:6), the VH-VL junction fragment that amplification as above obtains.Resulting junction fragment is cloned in the pUC-Tm carrier, with the enzyme cutting method screening positive clone.The also required small segment of purifying is reclaimed in order-checking and with behind the SalI/NotI double digestion.Then they are connected with the expression vector pET22b that cuts with same enzyme, obtain naming recombinant plasmid into pET22-2scFv.
(2) structure of recombinant plasmid pET20-21scFv
(a) clone of SZ-21 variable region gene: use Triol test kit (Gibco BRL), extract total RNA in SZ-21 antibody and the well-grown hybridoma (Ruan Changgeng etc., Chinese Medical Journal, 67 (2): 76-78,1987) from secreting.Use random primer, reverse transcription synthesizes cDNA.Be template with this synthetic cDNA then, use same primer described in (1) and method amplification VH and VL gene.With the ordinary method purifying and after reclaiming pcr amplification product, they are connected on pUC18 (Invetrogen) carrier.Transform TG1 competence intestinal bacteria with the ligation product, under X-gal and IPTG display mark, select white colony then.(VH and VL gene order are seen GenBank, and the gene order accession number is: VH:AF354053 to select positive colony to carry out dna sequencing; VL:AF354054).
(b) structure of SZ-21 single-chain antibody expression vector: VH that will as above obtain and VL gene fragment successively are cloned in the PSW1-ScFv carrier, and with resulting recombinant plasmid transformed competence colibacillus TG1 cell.From by extracting plasmid DNA the cell transformed, and with enzyme cutting method preliminary evaluation positive recombinant.With the positive recombinant is template, uses primer P7:5 '-ATTCTGCAGTCGGATCCGGAGTCAGGACCTGAGCTG (SEQ ID NO:7) and P8:5 '-TTAGCGGCCGCGAGCTTGGTCCCCCCTCC (SEQ ID NO:8) amplification VH-VL junction fragment.Resulting junction fragment is cloned in the pUC18 carrier, obtains recombinant vectors VHVL-pUC18.Behind this clone of BamHI/NotI double digestion, reclaim and the required small segment of purifying.Then, they are connected with the expression vector pET20b that cuts processing with same enzyme, obtain naming recombinant plasmid into pET20-21scFv.
(3) structure of pET22-21-L-2 expression vector
Briefly, according to structure flow process shown in Figure 1, at first based on the aminoacid sequence of SZ-2 single-chain antibody and joint sequence [(Gly to be introduced
4Ser)
3] design and synthesize a pair of primer P9:5 '-CACGAATTCCGTCTCCTCAGGTG (SEQ ID NO:9) and P10:5 '-GGTGTCGACGATGTCCGATCCG (SEQ ID NO:10), and with the known expression vector pET22-2scFv that carries the SZ-2 encoding sequence as template, required linker fragment gene increases.Employed amplification system is in the PCR reaction: pET22-2scFv carrier 1 μ g, and P9 and each 10pmol of P10 primer, 10mM dNTP 1 μ l, Taq plus polysaccharase 2U, 10 * reaction buffer, 5 μ l add water to 50 μ l.Thermal cycle conditions be 94 ℃ 5 minutes, 94 ℃ 1 minute, 58 ℃ 1 minute, 72 ℃ 30 seconds, totally 35 circulations, 72 ℃ were extended 7 minutes then.The about 70bp of 1.5%Agarose electrophoresis detection amplified production is with expection size consistent (Fig. 2).Using QIAEX II glue to reclaim test kit (Qiagen) reclaims and purified pcr product.Then, use contains PUC-Tm carrier 1 μ l, PCR purified product 6 μ l, T
4Ligase enzyme 1 μ l (3U), 50% PEG, 1 μ l, the connection mixture of 10 * Buffer, 1 μ l connects 18 hours.Connect product (5 μ l) transformed competence colibacillus e. coli tg1 (100 μ l) with this.The bacterium that will be transformed is evenly coated on the agar plate that contains penbritin and X-gel and IPTG colour developing sign, picking white colony and with conventional alkaline lysis extracting recombinant plasmid after 37 ℃ of incubated overnight.According to the endonuclease bamhi size, the screening positive recombinant.Sequencing result shows that amplified production is target gene fragment.Behind the PCR product purification,, reclaim and the purifying small segment with Sal I/EcoR I double digestion, after pET22-2scFv single-chain antibody expression vector that same enzyme is cut processing is connected, transformed competence colibacillus e. coli jm109 bacterial strain.The bacterium that will be transformed is coated and contains on the 100 μ g/ml penbritin plates, selects positive colony and screens positive plasmid.
Be template and use primer P11:5 '-TATTGGCCATGGCGGAAGTCAGGA (SEQ ID NO:11) and P12:5 '-TGATCGGAATTCGCCGCGAGCTTGGTCC (SEQ ID NO:12) with SZ-21 single-chain antibody expression vector, amplification SZ-21 single chain antibody fragments gene wherein.Employed amplification system is in the reaction: SZ-21 single-chain antibody expression vector 1 μ g, and P11, each 10pmol of P12 primer, 10mM dNTP 1 μ l, Taq plus polysaccharase 2U, 10 * reaction buffer, 5 μ l add water to 50 μ l.The PCR cycling condition is 94 ℃ of pre-sex change 5 minutes, then 94 ℃ 1 minute, 60 ℃ 1 minute, 72 ℃ 1 minute 30 seconds, totally 35 circulations were extended 7 minutes for back 72 ℃.Electrophoresis detection (1.0% Agarose) is the result show, amplified production has size (about 750bp) (see figure 2) of expection.This fragment with after the PUC-Tm carrier is connected, is carried out sequencing analysis to verify it.This PCR product of purifying is also used the BamHI/EcoRI double digestion, reclaims then and the purifying endonuclease bamhi.After the above-mentioned positive carrier that required fragment and same enzyme are cut processing is connected, with connection product transformed competence colibacillus e. coli jm109 bacterial strain.The bacterium that will be transformed is coated on the plate that contains 100 μ g/ml penbritins, selects positive colony and enzyme to cut screening positive plasmid (see figure 2).The result has obtained to contain the recombinant expression vector pET22-21-L-2 of complete S Z-2/SZ-21 bispecific single-chain antibody gene.The dna encoding sequence of SZ-2/SZ-21 bispecific single-chain antibody is shown in SEQ ID NO:13.
The abduction delivering of embodiment 2:SZ-2/SZ-21 bispecific single-chain antibody in intestinal bacteria and the separation and the purifying of expression product
(1) abduction delivering of SZ-2/SZ-21 bispecific single chain antibody in intestinal bacteria: according to ordinary method, with pET22-21-L-2 plasmid transformed competence colibacillus coli strain BL21 (DE3) plys (Novagen).To be coated in the plate that contains 100 μ g/ml penbritins and 34 μ g/ml paraxin by cell transformed then.Based on the single positive bacterium colony (Amp of antibiotics resistance picking
r) and be seeded in the 2ml LB nutrient solution (containing 100 μ g/ml penbritins, 34 μ g/ml paraxin) 37 ℃ of jolting overnight incubation.Cultivate the back and collect bacterial cell, and be inoculated in 50ml by 1: 20 (V/V) and contain among the antibiotic LB of same concentrations, 37 ℃ are continued the joltings cultivations.When treating A600=0.6, add IPTG (1mmol/L) and induce, 37 ℃ of joltings were cultivated 4.5 hours.After cultivation was finished, centrifugal collection bacterium bacterium carried out electrophoresis (10%SDS-PAGE) analysis.The result is a visible tangible protein band (see figure 3) at the about 64kDa of molecular weight place.
(2) the Western engram analysis of expression product: centrifugal collection inductive and non-inductive bacterium and with after the sample loading buffer cracking, centrifugal collection supernatant also is transferred to split product on the cellulose nitrate film.After the 2%BSA sealing, being first antibody with Penta-His (Qiagen), is second antibody with the sheep anti-mouse antibody (GAM-HRP) (the magnificent company in Shanghai) of horseradish peroxidase-labeled, and is that developer carries out the Western engram analysis with chloronaphthalene phenol.The result shows that the polypeptide of abduction delivering is desired polypeptides (see figure 3) of the present invention.
(3) separation of expression product (inclusion body): centrifugal (5000rpm, 4 ℃, 10 minutes) results bacterium.After washing 1 time with the Tris-HCl that contains NaCl (0.15mol) (20mmol/L) washings, add 1/10 (V/V) lysate (20mmol/L Tris-HCl, 1%Triton X-100,250 μ mol/LPMSF, 100 μ g/ml N,O-Diacetylmuramidases), handled 15 minutes for 30 ℃, then in supersound process (output rating 80%) 10 seconds on ice and with 10 seconds 3～5 times repeatedly at interval, to cell suspension thickness no longer.Recentrifuge (15000rpm, 4 ℃, 20 minutes) is collected supernatant and precipitation.In throw out, add 2.5ml Binding damping fluid (5mM imidazoles, 0.5mM NaCl, 20mM Tirs-HCl, 6M urea), stirring and dissolving is 1 hour in the ice, and 4 ℃ centrifugal (16000rpm) collects supernatant and filter it with 0.45 μ m filter membrane (Millipor) after 20 minutes.
(4) purifying of expression product and renaturation: get His-Bind Rasine gel (Novagen) 1ml dress post, and use Charge damping fluid (the 50Mm NiSO of the distilled water of 3 times of volumes, 5 times of volumes successively
4) and combination (5mM imidazoles, 0.5mM NaCl, 20mM Tris-HCl) the damping fluid upper prop treatment gel of 3 times of volumes.Then with above-mentioned inclusion body extracting solution upper prop (flow velocity be 10 times of column volumes/hour), and use the binding buffer liquid of 10 times of volumes and the lavation buffer solution of 6 times of volumes (60mM imidazoles, 0.5mM NaCl, 20mM Tris-HCl) to wash post successively.Use elution buffer (300mM imidazoles, 0.5mM NaCl, 20mM Tris-HCl) the required protein of wash-out of 6 times of volumes at last.The aminoacid sequence of SZ-2/SZ-21 bispecific single-chain antibody of the present invention is shown in SEQ ID NO:14.
Collect the protein of wash-out, in the following solution of 400ml, dialyse respectively: 1. 2mol/L urea, 1mmol/L Sleep-promoting factor B; 2. 2mol/L urea+0.5mmol/L reduced glutathion; 3. 0.15M NaCl, 50mM Tirs-HCl.After tentatively concentrating with PEG20000, ultrafiltration once more (MicroconTM10) concentrates.With Bradford standard measure protein, the output of purifying SZ-2/SZ-21 bispecific single chain antibody reaches 65mg/L as a result.
The thrombocyte of embodiment 3:SZ-2/SZ-21 bispecific single-chain antibody is in conjunction with activity
Present embodiment is described respectively with enzyme-linked immunosorbent assay (ELISA), flow cytometry and Western blotting, and the thrombocyte that detects SZ-2/SZ-21 bispecific single-chain antibody of the present invention is in conjunction with activity.
(1) ELISA method: the thrombocyte blood plasma (PRP) that is rich in that will derive from healthy people's whole blood with TEN solution (Tris, EDTA) is washed 3 times, then with 2 * 10
5The concentration bag in thrombocyte/hole is by microtiter plate.4 ℃ of sealings are spent the night and are fixed with 0.5% glutaraldehyde.After the washing (PBS), to wherein adding the SZ-2/SZ-21 bispecific single-chain antibody be diluted to different concns, and in 37 ℃ of insulations 2 hours down.Then, with Penta-His as first antibody and with GAM-HRP as second antibody, carry out conventional ELISA and detect, the result is with A
492Value representation.Simultaneously, with BSA-PBS as negative control, and respectively with SZ-2 and SZ-21 monoclonal antibody as positive control.Shown in the following tabulation 1 of result.
Table 1 SZ-2/SZ-21 bispecific single-chain antibody and thrombocyte bonded ELISA method detected result (OD
492)
Antibody concentration (μ g/ml) 10 1 0.1 0.01
SZ-2mAb 1.197 1.066 0.839 0.171
SZ-21mAb 1.320 1.242 1.185 0.985
SZ-2/SZ-21 is two special
Opposite sex single-chain antibody 0.837 0.558 0.445 0.087
2％BSA-PBS 0 0 0 0
From the result shown in the table 1 as can be seen, SZ-2/SZ-21 bispecific single chain antibody has and good combines activity with thrombocyte.
(2) flow cytometry: in the solution (cumulative volume is 100 μ l) that SZ-2/SZ-21 bispecific single chain antibody (1 μ g) forms in phosphate buffered saline (PBS) (PBS), (PC is 3 * 10 to add 3 μ l PRP
8/ ml) and under room temperature placed 30 minutes.After the washing, in Penta-His as first antibody and with the GAM of fluorescein mark as second antibody, on flow cytometer, carry out flow cytometry.Simultaneously, with BSA as negative control, and respectively with SZ-2 and SZ-21 monoclonal antibody as positive control.By result shown in Figure 4 as can be seen, 1 μ g SZ-2 monoclonal antibody and thrombocyte combination rate are 86%, 1 μ gSZ-21 monoclonal antibody and thrombocyte combination rate are 87%, and 1 μ g SZ-2/SZ-21 bispecific single chain antibody and thrombocyte combination rate are 79%, and fluorescence intensity is obviously high and SZ-2 or SZ-21 monoclonal antibody.These results show that SZ-2/SZ-21 bispecific single chain antibody of the present invention has and thrombocyte bonded ability.
(3) Western blotting: from anticoagulated whole blood, separate and be rich in thrombocyte blood plasma (PRP), wash 3 times with TEN solution after, platelet count is adjusted to 1 * 10
8/ ml.Add 1mmol/L PMSF, 1%TritonX-100 cracking thrombocyte in this platelet suspension after, centrifugal collection supernatant by the application of sample amount in 40 μ l/ holes, carries out reductibility SDS-PAGE (8%) electrophoresis.Be transferred on the cellulose nitrate film and, add 37 ℃ of incubations of SZ-2/SZ-21 bispecific single-chain antibody 2 hours with after the 2%BSA-PBS sealing.With Penta-His is first antibody, and is second antibody with GAM-HRP, carries out the Western engram analysis.Simultaneously, with SZ-2 or SZ-21 monoclonal antibody as positive control.As seen from Figure 5, SZ-2/SZ-21 bispecific single chain antibody had both showed platelet membrane glycoprotein (GP) Ib identical with the SZ-2 monoclonal antibody in conjunction with activity, and performance has platelet membrane glycoprotein (GP) IIIa identical with the SZ-21 monoclonal antibody in conjunction with activity again.
The platelet adhesion reaction of embodiment 4:SZ-2/SZ-21 bispecific single-chain antibody and gathering suppress active
Present embodiment is described respectively with the PAgT and the ADP inductive PAgT of ristomycin inductive PAgT, thrombin induction, detects the platelet aggregation inhibitory activity of SZ-2/SZ-21 bispecific single-chain antibody of the present invention.
(1) ristomycin inductive PAgT: get healthy people's citrate anticoagulated whole blood, therefrom separate and be rich in thrombocyte blood plasma (PRP), and adjust PC to 3 * 10
8/ ml.The SZ-2/SZ-21 bispecific single chain antibody of getting 20 μ l different concns adds among the 180 μ l PRP.Get SZ-2 simultaneously as positive control, and with PBS as negative control.37 ℃ hatch 5 minutes after, add ristomycin (Sigma, final concentration are 1.25mg/ml) and assemble with induced platelet.Use platelet aggregation instrument detection of aggregation result.As seen from Figure 6, the thrombocyte MA is 74% in the PBS negative control, the thrombocyte MA is 30% in the SZ-2 monoclonal antibody positive control (10 μ g/mL), and the thrombocyte MA is 34% in the SZ-2/SZ-21 bispecific single chain antibody (20 μ g/mL).These results clearly illustrate that SZ-2/SZ-21 bispecific single-chain antibody of the present invention can suppress ristomycin inductive platelet aggregation effectively.
2) PAgT of thrombin induction: get healthy people EDTA anticoagulated whole blood, therefrom separate and be rich in thrombocyte blood plasma (PRP).Use thrombocyte washings (0.5%EDTA-Na
2, NaCl 0.137M, KCl 2.7mM, NaHCO
312mM, NaH
2PO
40.36mM, glucose 5mM) and after the washing, adjust PC to 3 * 10
8/ ml.The SZ-2/SZ-21 bispecific single-chain antibody of getting 20 μ l different concns adds in the 180 μ l platelet suspensions.Simultaneously, get SZ-2 as positive control, and with PBS as negative control.37 ℃ hatch 5 minutes after, add zymoplasm (Zhuhai Dalte, final concentration are 10u/ml) and assemble, and with platelet aggregation instrument detection of aggregation result with induced platelet.As seen from Figure 7, the thrombocyte MA is 70% in the PBS negative control, the thrombocyte MA is 13% in the SZ-2 monoclonal antibody positive control (10 μ g/mL), and the thrombocyte MA is 19% in the SZ-2/SZ-21 bispecific single-chain antibody (20 μ g/mL).Therefore these results show that SZ-2/SZ-21 bispecific single chain antibody is Trombin inhibiting inductive platelet aggregation effectively.
(3) ADP inductive PAgT: get healthy people's citrate anticoagulated whole blood, therefrom separate and be rich in thrombocyte blood plasma (PRP), and adjust PC to 3 * 10
8/ ml.The SZ-2/SZ-21 bispecific single-chain antibody of getting 20 μ l different concns adds among the 180 μ l PRP, gets SZ-21 simultaneously as positive control, and with PBS as negative control.37 ℃ hatch 5 minutes after, add ADP (Sigma, final concentration are 2 μ M) and assemble, and use platelet aggregation instrument detection of aggregation result with induced platelet.As seen from Figure 8, the thrombocyte MA is 73% in the PBS negative control, the thrombocyte MA is 21% in the SZ-21 monoclonal antibody positive control (10 μ g/mL), and the thrombocyte MA is 29% in the SZ-2/SZ-21 bispecific single-chain antibody (30 μ g/mL).This result shows that too SZ-2/SZ-21 bispecific single-chain antibody of the present invention is Trombin inhibiting inductive platelet aggregation effectively.
Sequence table
(1) general information
(I) applicant: Jiangsu Province's Blood Research Institute
(II) denomination of invention: have platelet adhesion reaction and assemble the active bispecific single-chain antibody of inhibition
(III) sequence number: 14
(IV) address:
(A) contact person: Ruan Changgeng
(B) street: No. 96, ten Chinese catalpas street
(C) city: Suzhou
(D) country: the People's Republic of China (PRC)
(E) postcode: 215006
(V) computer-reader form:
(A) amboceptor type: 3.5 inches floppy disks
(B) computer: IBM PC
(C) operating system: WINDOW97
(D) software: WORD98
(VI) telecommunication information:
(A) phone: 86-0512-5101708
(B) fax: 86-0512-5101708
(2) information of SEQIDNO:1
(I) sequence signature:
(A) length: 22 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: DNA
(III) sequence description: SEQ ID NO:1
AGGTCCAGCTGCAGGAGTCTGG
(2) information of SEQ ID NO:2
(I) sequence signature:
(A) length: 34 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: DNA
(III) sequence description: SEQ ID NO:2
TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG
(2) information of SEQ ID NO:3
(I) sequence signature:
(A) length: 34 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: DNA
(III) sequence description: SEQ ID NO:3
GACATTGAGCTCACCCAGTCTCCA
(2) information of SEQ ID NO:4
(I) sequence signature:
(A) length: 22 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: DNA
(III) sequence description: SEQ ID NO:4
GTTAGATCTCGAGCTTGGTCCC
(2) information of SEQ ID NO:5
(I) sequence signature:
(A) length: 24 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: DNA
(IIi) sequence description: SEQ ID NO:5
CCAGGTCGACCTGCAGGAGTCAGG
(2) information of SEQ ID NO:6
(I) sequence signature:
(A) length: 25 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: DNA
(III) sequence description: SEQ ID NO:6
TATGCGGCCGCCTCGAGCTTGGTCC
(2) information of SEQ ID NO:7
(I) sequence signature:
(A) length: 36 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: DNA
(III) sequence description: SEQ ID NO:7
ATTCTGCAGTCGGATCCGGAGTCAGGACCTGAGCTG-
(2) information of SEQ ID NO:8
(I) sequence signature:
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: DNA
(III) sequence description: SEQ ID NO:8
TTAGCGGCCGCGAGCTTGGTCCCCCCTCC
(2) information of SEQ ID NO:9
(I) sequence signature:
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: DNA
(III) sequence description: SEQ ID NO:9
CACGAATTCCGTCTCCTCAGGTG
(2) information of SEQ ID NO:10
(I) sequence signature:
(A) length: 22 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: DNA
(III) sequence description: SEQ ID NO:10
GGTGTCGACGATGTCCGATCCG
(2) information of SEQ ID NO:11
(I) sequence signature:
(A) length: 24 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: DNA
(III) sequence description: SEQ ID NO:11
TATTGGCCATGGCGGAAGTCAGGA
(2) information of SEQ ID NO:12
(I) sequence signature:
(A) length: 28 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: DNA
(III) sequence description: SEQ ID NO:12
TGATCGGAATTCGCCGCGAGCTTGGTCC
(2) information of SEQIDNO:13
(I) sequence signature:
(A) length: 1494 base pairs
(B) type: nucleic acid
(C) chain: two strands
(D) topological framework: linearity
(II) molecule type: gene
(III) sequence description: SEQ ID NO:13
GAG?TCA?GGA?CCT?GAG?CTG?GTG?AAC?CCT?GGA?GCT?TCA?ATG?AAG?ATT?TCC
TGT?AAG?GCA?TCT?GGT?TAC?TCA?TTC?ACT?GGC?TAC?ACC?ATG?AAC?TGG?GTG
AAA?CAG?AGC?CAT?GGA?AAG?AAC?CTT?GAG?TGG?ATT?GGA?CTT?ATT?AAT?CCT
TAC?CAT?GGT?GGT?TCT?AGC?TAC?AAC?CAG?AAG?TTC?AAG?GGC?AAG?GCC?ACA
TTG?ACT?GTA?GAC?AAG?TCA?TCC?AGC?ACA?GCC?TAC?ATG?GAG?CTC?CTC?AGT
CTG?ACA?TCT?GAG?GAC?TCT?GCG?GTC?TAT?TTC?TGT?GCA?AGA?AGG?GAT?GCT
AAC?TAC?GTT?TTT?TTC?TTT?GAC?TAC?TGG?GGC?CAA?GGG?ACC?ACG?GTC?ACC
GTC?TCC?TCA?GGT?GGA?GGC?GGT?TCA?GGC?GGA?GGT?GGG?TCT?GGC?GGT?GGC
GGA?TCG?GAC?ATC?GAG?CTC?ACC?CAG?TCT?CCA?GCA?CTC?ATG?TCT?GCA?TCT
CCA?GGG?GAG?AAG?GTC?ACC?ATG?ACC?TGC?AGT?GCC?AGT?TCA?GGT?GTA?AGT
TAC?ATT?CAC?TGG?TAC?CAG?CAG?AAG?TCA?GGC?ACC?TCC?CCC?AAA?AGA?TGG
ATT?TAT?GAC?ACA?TCC?AAA?CTG?GCT?TCT?GGA?GTC?CCT?GCT?CGC?TTC?AGT
GGC?AGT?GGG?TCT?GGG?ACC?TCT?TAC?TCT?CTC?ACA?ATC?AGC?AAC?ATG?GAG
GCT?GAA?GAT?GCT?GCC?ACT?TAT?TAC?TGC?CAG?CAG?TGG?AGT?AGT?AAA?CCA
CCC?ACG?TTC?GGA?GGG?GGG?ACC?AAG?CTC?GCG?GCG?AAT?TCC?GTC?TCC?TCA
GGT?GGA?GGC?GGT?TCA?GGC?GGA?GGT?GGC?TCT?GGC?GGT?GGC?GGA?TCG?GAC
ATC?GTC?GAC?CTG?CAG?GAG?TCA?GGT?GGA?GGA?TTG?GTG?CAG?CCT?AAA?GGG
TCA?TTG?AAA?CTC?TCG?TGT?GCA?GCC?TCT?GGA?TTC?ACC?TTC?AAT?ACC?TAC
GCC?ATG?AAC?TGG?GTC?CGC?CAG?GCT?CCA?GGA?AAG?GGT?TTG?GAA?TGG?GTT
GCT?CGC?ATA?AGA?AAT?AAA?AAT?AAT?AAT?TAT?GCA?ACG?CAT?TAT?GCC?GAG
TCA?GTG?AAA?GAC?AGG?TTC?ATC?ATC?TCC?AGA?GAT?GAT?TCA?CAA?AGC?ATG
CTC?TAT?CTG?CAA?ATG?AAC?AAC?TTG?AAA?ACT?GAG?GAC?ACA?GCC?ATG?TAT
TAC?TGT?GTG?AGG?CCC?TTT?AGT?ACG?GCT?ACA?GGG?GCT?ATG?GAC?TAC?TGG
GGC?CAA?GGG?ACC?ACG?GTC?ACC?GTC?TCC?TCA?GGT?GGA?GGC?GGT?TCA?GGC
GGA?GGT?GGC?TCT?GGC?GGT?GGC?GGA?TCG?GAC?ATC?GAG?CTC?ACC?CAG?TCT
CCA?TCC?AGT?CTG?TCT?GCA?TCC?CTT?GGA?GAC?ACA?ATT?ACC?ATC?ACT?TGC
CAT?GCC?AGT?CAG?AAC?ATT?AAT?GTT?TGG?TTA?AGC?TGG?TAC?CAG?CAG?AAA
CCA?GGA?AAT?ATT?CCT?AAA?CTA?TTG?ATC?TAT?AAG?GCT?TCC?AAC?TTG?CAC
ACA?GGC?GTC?CCA?TCA?AGG?TTT?AGT?GGC?AGT?GGA?TCT?GGA?ACA?GGT?TTC
ACA?TTA?ACC?ATC?AGC?AGC?CTG?CAG?CCT?GAA?GAC?ATT?GCC?ACT?TAC?TAC
TGT?CAA?CAG?GGT?CAA?AGT?TAT?CCT?CTC?ACG?TTC?GGA?GGG?GGG?ACC?AAG
CTC?GAG
(2) information of SEQ ID NO:14
(I) sequence signature:
(A) length: 498 amino acid
(B) type: polypeptide
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: polypeptide
(III) sequence description: SEQ ID NO:14
Glu?Ser?Gly?Pro?Glu?Leu?Val?Asn?Pro?Gly?Ala?Ser?Met?Lys?Ile?Ser?Cys?Lys?Ala?Ser?Gly
Tyr?Ser?Phe?Thr?Gly?Tyr?Thr?Met?Asn?Trp?Val?Lys?Gln?Ser?His?Gly?Lys?Asn?Leu?Glu?Trp
Ile?Gly?Leu?Ile?Asn?Pro?Tyr?His?Gly?Gly?Ser?Ser?Tyr?Asn?Gln?Lys?Phe?Lys?Gly?Lys?Ala?Thr
Leu?Thr?Val?Asp?Lys?Ser?Ser?Ser?Thr?Ala?Tyr?Met?Glu?Leu?Leu?Ser?Leu?Thr?Ser?Glu?Asp
Ser?Ala?Val?Tyr?Phe?Cys?Ala?Arg?Thr?Arg?Asp?Ala?Asn?Tyr?Val?Phe?Phe?Phe?Asp?Tyr?Trp
Gly?Gln?Gly?Thr?Val?Thr?Val?Ser?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly
Gly?Gly?Ser?Asp?Ile?Glu?Leu?Thr?Gln?Ser?Pro?Ala?Leu?Met?Ser?Ala?Ser?Pro?Gly?Glu?Lys
Val?Thr?Met?Thr?Cys?Ser?Ala?Ser?Ser?Gly?Val?Ser?Tyr?Ile?His?Trp?Tyr?Gln?Gln?Lys?Ser?Gly
Thr?Ser?Pro?Lys?Arg?Trp?Ile?Tyr?Asp?Thr?Ser?Lys?Leu?Ala?Ser?Gly?Val?Pro?Ala?Arg?Phe?Ser
Gly?Ser?Gly?Ser?Ser?Leu?Thr?Ile?Ser?Ser?Met?Glu?Ala?Glu?Asp?Ala?Ala?Thr?Tyr?Gly?Thr?Ser
Tyr?Tyr?Cys?Gln?Gln?Trp?Ser?Ser?Lys?Pro?Pro?Thr?Phe?Gly?Gly?Gly?Thr?Lys?Leu?Ala?Ala
Asn?Ser?Val?Ser?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Asp
Ile?Val?Asp?Lle?Gln?Glu?Ser?Gly?Gly?Gly?Leu?Val?Gln?Pro?Lys?Gly?Ser?Leu?Lys?Leu?Ser
Cys?Ala?Ala?Ser?Gly?Phe?Thr?Phe?Asn?Thr?Tyr?Aln?Met?Asn?Trp?Val?Arg?Gln?Ala?Pro?Gly
Lys?Gly?Leu?Glu?Trp?Val?Ala?Arg?Ile?Arg?Asn?Lys?Asn?Asn?Asn?Tyr?Ala?Thr?His?Tyr?Ala
Glu?Ser?Val?Lys?Asp?Arg?Phe?Ile?Ile?Ser?Arg?Asp?Asp?Ser?Gln?Ser?Met?Leu?Tyr?Leu?Gln
Met?Asn?Asn?Leu?Lys?Thr?Glu?Asp?Thr?Ala?Met?Tyr?Tyr?Cys?Val?Arg?Pro?Phe?Ser?Thr?Ala
Thr?Gly?Ala?Met?Asp?Tyr?Trp?Gly?Gln?Gly?Thr?Thr?Val?Thr?Val?Ser?Ser?Gly?Gly?Gly?Gly
Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Asp?Ile?Glu?Leu?Thr?Gln?Ser?Pro?Ser?Ser
Leu?Ser?Ala?Ser?Leu?Gly?Asp?Thr?Ile?Thr?Ile?Thr?Cys?His?Ala?Ser?Gln?Asn?Ile?Asn?Val?Trp
Leu?Ser?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Asn?Ile?Pro?Lys?Leu?Leu?Ile?Tyr?Lys?Ala?Ser?Asn
Leu?His?Thr?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly?Ser?Gly?Ser?Gly?Thr?Gly?Phe?Thr?Leu?Thr
Ile?Ser?Ser?Leu?Gln?Pro?Glu?Asp?Ile?Ala?Thr?Tyr?Tyr?Cys?Gln?Gln?Gly?Gln?Ser?Tyr?Pro?Leu
Thr?Phe?Gly?Gly?Gly?Thr?Lys?Leu?Glu
Claims (8)
1, has the bispecific single-chain antibody that suppresses platelet adhesion reaction and aggregation activity, be characterised in that said bispecific single-chain antibody is by the SZ-2 single-chain antibody with anti-GPIb alpha active and has the active SZ-21 single-chain antibody of anti-GPIIIa and merge and form, and have a joint sequence between the two.
2, according to the bispecific single-chain antibody of claim 1, said bispecific single-chain antibody has the aminoacid sequence shown in SEQ ID NO:14 in the sequence table.
3, according to the bispecific single-chain antibody of claim 1, wherein said joint sequence is (Gly
4Ser)
1-3
4, the dna sequence dna of the coding SZ2/SZ21 bispecific single-chain antibody shown in SEQ ID NO:13 in the sequence table.
5, carry the recombinant expression vector of the dna sequence dna of claim 4.
6, by the host cell of conversion of the recombinant expression vector of claim 5 or transfection.
7, production claim 1 the method for bispecific single-chain antibody, this method comprises:
(1) provides heavy chain and the variable region of light chain dna encoding sequence of SZ2 and SZ21;
(2) by joint sequence (Gly
4Ser)
1-3SZ2 and SZ21 dna encoding sequence light, variable region of heavy chain that step (1) is obtained connect into corresponding single-chain antibody encoding sequence respectively;
(3) SZ2 that step (2) is obtained and SZ21 single-chain antibody dna encoding sequence are by joint sequence (Gly
4Ser)
1-3Be operably connected on the suitable expression;
(4) recombinant expression vector with step (3) transforms or the transfection appropriate host cell;
(5) host cell of culturing step (4), and from said cell and its substratum, reclaim required desired polypeptides.
8, the application of the bispecific single-chain antibody of claim 1 in producing antiplatelet adhesion and accumulative medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB021111049A CN1181097C (en) | 2002-03-20 | 2002-03-20 | Monochain antibody with dual specificities possessing activity for restraining adherence and aggregation of blood platelets |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB021111049A CN1181097C (en) | 2002-03-20 | 2002-03-20 | Monochain antibody with dual specificities possessing activity for restraining adherence and aggregation of blood platelets |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1445241A CN1445241A (en) | 2003-10-01 |
| CN1181097C true CN1181097C (en) | 2004-12-22 |
Family
ID=27811224
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB021111049A Expired - Fee Related CN1181097C (en) | 2002-03-20 | 2002-03-20 | Monochain antibody with dual specificities possessing activity for restraining adherence and aggregation of blood platelets |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1181097C (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101735307B (en) * | 2008-11-18 | 2012-05-30 | 北京航空航天大学 | Platelet envelope glycoprotein oligopeptide or trim/derivate thereof and application thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102614513A (en) * | 2012-04-12 | 2012-08-01 | 苏州大学附属第一医院 | Application of anti-angiohemophilia factor A3 zone bifunctional monoclonal antibody |
| CN103175817B (en) * | 2013-03-18 | 2015-02-04 | 苏州大学附属第一医院 | Method for detecting activity of antitumor drug on inhibiting adhesiveness between tumor cell and blood platelet |
-
2002
- 2002-03-20 CN CNB021111049A patent/CN1181097C/en not_active Expired - Fee Related
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101735307B (en) * | 2008-11-18 | 2012-05-30 | 北京航空航天大学 | Platelet envelope glycoprotein oligopeptide or trim/derivate thereof and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1445241A (en) | 2003-10-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1267452C (en) | Monoclonal antibodies, antigens and diagnosis and therapy of malignant diseases | |
| CN1217956C (en) | Soluble single-chain T-cell receptor proteins | |
| CN1222162A (en) | Mutated nonactivating IgG2 domains and anti-cd3 antibodies incorporating same | |
| CN1110323A (en) | Novel polypeptides and DNAS encoding them | |
| CN1422333A (en) | Polypeptide inducing apoptosis | |
| CN1681926A (en) | Human antihuman MCP-1 antibody and antibody fragment thereof | |
| CN101029082A (en) | Recombination and preparation of human monocloned antibody against EGFR | |
| CN1966526A (en) | Evolved immunoglobulin binding molecule, and its preparation method and uses | |
| CN1289668C (en) | In vitro molecular directed evolution method for reshaping antibody | |
| CN1181097C (en) | Monochain antibody with dual specificities possessing activity for restraining adherence and aggregation of blood platelets | |
| CN1835763A (en) | CCN1 compositions and methods | |
| CN1194991C (en) | Recombinant Toxoplasma fusion protein antigen and preparation process and use thereof | |
| CN1298412A (en) | G-CSF receptor agonist antibodies and screening method therefor | |
| CN1181099C (en) | Anticoagulation and thrombolytic thrombus target fusion mA5UKB | |
| CN1189483C (en) | Humanized CD3-resisting monoclonal antibody | |
| CN1310758A (en) | Novel method for isolating gene | |
| US20240034809A1 (en) | Heterodimeric iga fc constructs and methods of use thereof | |
| CN1279057C (en) | Recombinated anti-CD25 monoclonal antibody, coding sequence and application | |
| CN1225480C (en) | Anti CD52 monoclonal antibody, coding sequence and use thereof | |
| CN1795205A (en) | Spex compositions and methods of use | |
| CN1207307C (en) | Recombination human cytomegalovirus fusion protein and its preparing method, application | |
| CN1488000A (en) | Method for purification of soluble SSAO | |
| CN1158896A (en) | Novel stress proteins | |
| CN1238381C (en) | Anti-cancer surface antigen of p185 monoantigen embedded antibody and its preparation | |
| CN101058808A (en) | Breast cancer relevant p69 gene, coding protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Assignee: Suzhou Suda Saier Immunobiology Technology Co., Ltd. Assignor: The First Affiliated Hospital of Suzhou University Contract fulfillment period: 2009.2.1 to 2019.2.1 contract change Contract record no.: 2009320000427 Denomination of invention: Monochain antibody with dual specificities possessing activity for restraining adherence and aggregation of blood platelets Granted publication date: 20041222 License type: Exclusive license Record date: 2009.3.18 |
|
| LIC | Patent licence contract for exploitation submitted for record |
Free format text: EXCLUSIVE LICENSE; TIME LIMIT OF IMPLEMENTING CONTACT: 2009.2.1 TO 2019.2.1; CHANGE OF CONTRACT Name of requester: SUZHOU SOOCHOW UNIVERSITY + SAIER IMMUNO BIOTECH C Effective date: 20090318 |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20041222 Termination date: 20140320 |