CN118086465A

CN118086465A - Immobilized heme specific sex-construct transcription factor and CRISPR/Cas mediated heme detection method

Info

Publication number: CN118086465A
Application number: CN202211487904.2A
Authority: CN
Inventors: 谭高翼; 张立新; 汪姚宏; 梁敏东; 何昕蔚; 吕东源
Original assignee: East China University of Science and Technology
Current assignee: East China University of Science and Technology
Priority date: 2022-11-25
Filing date: 2022-11-25
Publication date: 2024-05-28

Abstract

The invention provides a heme detection system based on a heme specific sex-conformation transcription factor and a CRISPR/Cas system, a heme detection method mediated by an immobilized heme specific sex-conformation transcription factor and the CRISPR/Cas, and application thereof. The immobilized heme specific sex-conformation transcription factor and CRISPR/Cas mediated heme detection system and method provided by the invention have extremely high sensitivity, and can detect the heme with the concentration of nanomole grade, for example, the detection lower limit can reach 7nM.

Description

Immobilized heme specific sex-construct transcription factor and CRISPR/Cas mediated heme detection method

Technical Field

The invention belongs to the field of biological monitoring, and particularly relates to a heme detection method mediated by immobilized heme specific sex-conformation transcription factors and CRISPR/Cas.

Background

Heme is a compound formed by chelating a ferrous ion in the middle of a porphyrin ring, and has a molecular formula of C ₃₄H₃₂FeN₄O₄, a molecular weight of 616.49 and a structural formula shown in the specification.

Heme has important roles in organisms, is an important cofactor in cells, is also an iron supplement reagent for treating iron deficiency anemia, and has a certain trend in industrial production, but currently lacks a heme high-throughput detection method. The traditional heme detection method is based on pi-pi transition of porphyrin ring system, heme has strong absorption near 400nm (Soret band), and the absorption spectrometry is used for heme determination, and has simple principle and easy operation, but the method is only applicable to compounds with single component and simple composition and no other absorption peak at 300-400 nm. However, some porphyrin compounds interfere with the detection of heme, and thus the accuracy of spectroscopic detection of heme is somewhat degraded in samples of complex composition. Heme detection methods such as gas chromatography and liquid chromatography, which are commonly used in laboratories, are long in time, expensive and complex in sample preparation, and the response range of detection is only at the level of micromoles (mu M). Other detection methods such as absorption spectroscopy can be used for heme measurement, which is simple to operate, but because biological samples are very complex, which may contain various heme structural analogues, interfere with the accuracy and sensitivity of the detection results, and have poor specificity.

Heme has wide application as a high value-added compound in the fields of food and medicine, but microbial synthesis thereof still has efficiency bottlenecks and lacks a high-throughput detection method.

Therefore, there is a need to develop a simple, rapid, sensitive and highly specific method for detecting heme.

Disclosure of Invention

In order to overcome the problems, the invention provides a heme detection system based on a heme specific sex-conformation transcription factor and a CRISPR/Cas system, an immobilized heme specific sex-conformation transcription factor and a CRISPR/Cas mediated heme detection method and application thereof.

In one aspect, the present application provides a heme detection system comprising:

A sensing module comprising an immobilized heme-specific sex-conformation transcription factor and double-stranded DNA (dsDNA) having a sequence capable of being recognized by the heme-specific sex-conformation transcription factor; and

A signal output module comprising a CRISPR/Cas system and a single-stranded DNA probe (ssDNA probe), wherein the CRISPR/Cas system is capable of recognizing and binding the dsDNA and has trans-cleaving activity.

In one aspect, the application provides a method of immobilized heme-specific sex-configured transcription factor with CRISPR/Cas mediated heme detection, the method comprising:

immobilizing heme-specific sex-construct transcription factors;

Binding the immobilized heme-specific sex-conformation transcription factor to double-stranded DNA (dsDNA) having a sequence capable of being recognized by the heme-specific sex-conformation transcription factor;

contacting a sample comprising heme with said immobilized heme-specific sex-conformation transcription factor such that said dsDNA is released;

And activating a detection system comprising a CRISPR/Cas system capable of recognizing and binding the dsDNA and a single stranded DNA probe (ssDNA probe) with the released dsDNA, measuring a signal generated by cleavage of the ssDNA probe by the CRISPR/Cas system, thereby detecting heme,

Wherein the CRISPR/Cas system is a CRISPR/Cas system with trans-cleaving activity.

In one aspect, the application provides a device for heme detection comprising a solid matrix immobilized with a heme-specific sex-conformation transcription factor bound to double-stranded DNA (dsDNA), wherein the double-stranded DNA has a sequence capable of being recognized by the heme-specific sex-conformation transcription factor. In some embodiments, the device for heme detection further comprises a unit for a signal output module to provide the signal output module to the solid substrate. The unit for the signal output module has a container that separately contains the CRISPR/Cas system and ssDNA probes. Or the CRISPR/Cas system and ssDNA probe may be packaged together in a container. The CRISPR/Cas system and ssDNA probes can optionally be in liquid or powder form, e.g., dissolved in a buffer, or lyophilized powder.

In some embodiments, the heme-specific sex-conformational transcription factor is directly or indirectly bound to the solid matrix by non-covalent or covalent binding. In a preferred embodiment, the heme-specific sex-conformational transcription factor is non-covalently bound to the solid matrix by a biotin-biotin binding protein.

In a preferred embodiment, the solid substrate is a porous plate, for example, a porous plate made of polyethylene/polystyrene or the like, or a modified porous plate.

In some embodiments, the device for heme detection comprises an well plate immobilized with a heme-specific sex-conformation transcription factor, the well plate being made of polyethylene/polystyrene or the like, wherein the heme-specific sex-conformation transcription factor is non-covalently bound to the well plate by a biotin-biotin binding protein.

In one aspect, the application provides a kit for detecting heme comprising a heme detection system of the application. In some embodiments, the kit further comprises a signal detection module for detecting a signal.

In one aspect, the present application provides a kit for detecting heme, the kit comprising an well plate immobilized with a heme-specific sex-configured transcription factor of the present application, the well plate being made of polyethylene/polystyrene, the heme-specific sex-configured transcription factor being bound to double-stranded DNA (dsDNA), wherein the double-stranded DNA has a sequence capable of being recognized by the heme-specific sex-configured transcription factor; a container comprising a CRISPR/Cas system and ssDNA probes; and instructions for performing the heme test.

In one aspect, the application provides the use of a heme detection system, or kit for detecting heme, as described herein in detecting heme.

The immobilized heme specific sex-conformation transcription factor and CRISPR/Cas mediated heme detection system and method provided by the invention have extremely high sensitivity, and can detect the heme with the concentration of nanomole grade, for example, the detection lower limit can reach 7nM.

According to the invention, the heme specific sex-organization transcription factor is arranged on the surface of the solid phase carrier, so that the heme specific transcription factor and Cas protein are eliminated from competing and combining with dsDNA, and the detection result is more accurate and cannot be influenced by the heme specific transcription factor.

In addition, the heme detection method has excellent specificity in heme detection; compared with the traditional spectrometry for detecting heme, the method is not interfered by heme structural analogues (such as protoporphyrin, coproporphyrin, fe-coproporphyrin and the like). Meanwhile, the application can realize high flux detection of heme samples, and has simple and convenient operation, low cost and simple equipment.

Drawings

FIG. 1 shows a map of the transcription factor domain of heme response. HAP1 domain structure: zinc cluster (Zn), dimerization Domain (DD), inhibition modules RPM1-3 (RPM 3/1 and RPM 2), CP motif and activation domain (ACT). BACH1/2 domain structure: bric-a-brac, TRAM TRACK, and a bromoad complex domain (BTB), leucine zipper (bzip). P53 structure: transcription Activation Domain (TAD), DNA Binding Domain (DBD), tetramerization domain (TET). Domain structure of GIS1 protein: jumonji N domain (JMJN), jumonji N domain (JMJC), two Transcription Activation Domains (TADS), 2 CP motifs. PPSR domain structure: heix-Turn-Heix domain (HTH), per-Arnt-Sim (PAS). HXH, his72, his149 and CXXC are amino acid sequences.

Fig. 2 shows an exemplary flow diagram of a heme detection method according to the present invention.

Fig. 3 shows coomassie brilliant blue staining patterns of purified HrtR protein and Cas12a protein.

FIG. 4 shows a fluorescent quantitative analysis of dsDNA. (A) fluorescence intensity curves corresponding to dsDNA concentrations. (B) Linear relationship between dsDNA concentration and fluorescence curve slope. Data were from the mean and standard deviation of three independent replicates. The fluorescent signal is related to the concentration of dsDNA in the cleavage system, demonstrating that the concentration of dsDNA is linear with the rate of Cas12a cleavage.

FIG. 5 shows detection of hemin by microcrystalline cellulose-CBD-immobilized protein. (A) Fluorescence intensity curves for different concentrations of hemin. (B) the dsDNA concentration and fluorescence curve slope between linear relation. Data were from the mean and standard deviation of three independent replicates.

Figure 6 shows analysis of 96-well plate immobilized proteins. Biotinylated HrtR at different concentrations was immobilized on 96 microwell plates (n=6, p < 0.0001). The significance differences were calculated from each set of data compared to the blank set, respectively, using GRAPHPAD PRISM software.

FIG. 7 shows the effect of washing the well plate times on the slope of fluorescence intensity. Data were from the mean and standard deviation of three independent replicates.

Fig. 8 shows the effect of BSA blocking on detection signal. (A) fluorescence intensity readings corresponding to the absence or presence of BSA blocking. (B) fluorescence intensity slope corresponding to whether BSA was blocked or not. Data were from the mean and standard deviation of three independent replicates.

Fig. 9 shows the fluorescence signal detected by the heme structural analog. (A) Fluorescence intensity readings in the presence of heme analogs protoporphyrin IX, coproporphyrin I/III, and Fe-coproporphyrin. (B) slope of fluorescence intensity in the presence of heme analog. Data were from the mean and standard deviation of three independent replicates.

Fig. 10 shows a linear relationship between heme concentration and fluorescence slope for the detection of heme according to the method of the present invention. (A) Different concentrations of hemin correspond to fluorescence intensities. (B) A linear relationship between the concentration of hemin and the fluorescence slope. Data were from the mean and standard deviation of three independent replicates.

FIG. 11 shows the range of H149S protein concentrations for detecting hemin. Data were from the mean and standard deviation of three independent replicates.

Detailed Description

Conventional methods of heme detection require expensive specialized equipment or require complex samples to be processed with organic solvents, which greatly limit the sensitivity, efficiency and convenience of heme detection. At present, liquid chromatography is a qualitative and quantitative detection method commonly used in laboratories, but the method cannot realize high-flux detection of heme samples, is unfavorable for being applied to detection of samples in clinical large-batch sample and detection of samples in the environmental field, and therefore, the establishment of the high-flux heme detection method has important significance.

The present inventors developed a simple, ultrasensitive, rapid heme detection platform using allosteric transcription factors (Allosteric transcription factors, aTFs) to specifically recognize various small molecule compounds and release double stranded DNA (dsDNA), in combination with CRISPR/Cas with "trans-cleavage" activity. Specifically, screening allosteric transcription factors for characterizing heme specific response, coupling a CRISPR/Cas signal output system with trans-cleavage activity by using the allosteric transcription factors as a heme sensing module to realize high-efficiency detection of heme, and establishing a high-flux sample detection method.

The immobilized heme specific sex-conformation transcription factor and CRISPR/Cas mediated heme detection system and method provided by the application have extremely high sensitivity, and can detect the heme with the concentration of nanomole grade, for example, the detection lower limit can reach 7nM. In addition, the heme detection has excellent specificity in the aspect of heme detection, and compared with the detection of heme by the traditional spectrometry, the heme detection is not interfered by heme structural analogues (such as protoporphyrin, coproporphyrin, fe-coproporphyrin and the like); meanwhile, the operation flow and fixation are more standard and simpler, and the repeatability and accuracy of detection are improved to a certain extent. The application can also realize high flux detection of heme samples, and has simple and convenient operation, low cost and simple equipment.

Further, the method of the present invention can also be used to easily adjust the level of biotinylation by modifying biotin to react with specific functional groups of the solid support/solid matrix. The affinity-based assembly of the present invention provides for simple and highly flexible system or device preparation. It is highly specific and stable. The assembly process is simple enough to ensure high reproducibility; only a few steps are required, which reduces the risk of lot-to-lot variation and has great industrial advantages. In terms of product: which facilitates the adjustment of the composition and physical properties of the final product.

Heme-specific response allosteric transcription factor (heme-specific sex-conformational transcription factor) and transcription factor binding site

Heme plays an important role in the organism, whose function depends mainly on the nature of heme and on the bound protein. Heme binds to certain enzymes as cofactors for catalytic reactions, most commonly monooxygenases. Heme combines with the corresponding protein to perform transport and storage functions, such as transport of oxygen in hemoglobin, storage of oxygen in myoglobin. In addition, heme has a redox function as an electron carrier in the respiratory chain. Since heme has a certain oxidation potential and a certain hydrophobicity, free heme is toxic to cells. In addition, disruption of the heme synthesis pathway can cause related diseases, most commonly porphyria.

Heme plays a key role in signal transduction, including transcription, microRNA splicing, translation, protein degradation, heme degradation, and bi-component signal transduction, in addition to being an important cofactor in oxygen storage, electron transfer, and the like.

An allosteric transcription factor (aTF) comprises a domain (EBD) that binds to an effector, typically a small molecule, and a DNA Binding Domain (DBD) that binds to the effector causing a conformational change such that the binding affinity of the allosteric transcription factor to a DNA fragment that specifically interacts with it, typically a promoter operator sequence in its natural state, is altered, thereby enhancing or attenuating transcription of the DNA sequence controlled by the operator sequence (Nat methods.2016, 13 (2): 177-183), in such a way that transcription of the gene is dependent on the concentration of the small molecule. The term "allosteric transcription factor" as used herein has a meaning well known in the art. In prokaryotes, the operator sequences are typically present upstream of the metabolic-related operators or reporter genes; allosteric transcription factors often act as sensors for intracellular effectors (e.g., small molecules), feeding back concentration information of the effector, and thus dynamically regulating the biosynthetic pathway within the cell. In eukaryotes, such allosteric transcription factors are often present in pathways that control cell differentiation and ontogenesis.

Whereas in the present application the interaction of the allosteric transcription factor with DNA occurs in vitro, both prokaryotic and eukaryotic sources of allosteric transcription factor can be used for the heme detection of the present application.

Many heme-responsive transcription factors bind to specific DNA sequences to form heterodimeric or hetero-oligomeric complexes, thereby inhibiting gene transcription, altering the protein structure of the transcription factor and disrupting protein-DNA interactions when heme binds to the transcription factor, thereby initiating transcription of downstream genes and subsequent protein expression, such as Bach1, bach2, p53, gis1, ppsR, hrtR, furA, and the like transcription factors function in the mechanisms described above. Bach is the first mammalian transcription factor discovered to be regulated by heme, bach1 forms heterodimers with small Maf family proteins (e.g., mafK), bach1/MafK heterodimers bind to the Maf recognition element (MARE) in DNA and inhibit the expression of heme oxygenase-1, iron-related proteins and iron transporter genes, and when heme binds to Bach1, resulting in reduced DNA binding affinity of the heterodimers, downstream genes are expressed ^[1]. The transcriptional regulation of Bach2 is similar to that of Bach1 ^[2]. The mechanism of action of tumor suppressor protein p53 is similar to Bach1 and Bach2, interfering with p53 interactions with DNA and triggering nuclear export and cytoplasmic degradation ^[3,4] of p53 when heme binds to p 53. Yeast Gis1 transcriptional regulator can specifically bind heme and has important roles ^[5] in histone methylation, cell signaling and tumorigenesis. Transcription factor FurA from blue algae can regulate iron metabolism, furA is combined with DNA in an iron regulatory gene promoter, furA and heme form an axial ligand of 6-coordination low-spin heme, and in vitro experiments show that one molecule of heme is combined with one molecule of FurA, and interaction ^[6] between FurA-DNA is inhibited. Irr of nitrogen-fixing bacteria (Bradyrhizobium japonicum), a key transcriptional regulator of iron homeostasis, is one of the Fur superfamily proteins, binds to the target gene and inhibits translation of the gene encoding the enzyme involved in heme biosynthesis, and in the presence of iron or heme, irr is degraded, thus initiating transcription ^[7] of the target gene. The global iron regulatory protein Irr of Rhizobium leguminosarum (Rhizobium leguminosarum), irr ^Rl, has slightly different regulatory mechanisms than Irr ^Bj, irrRl binds to heme, resulting in reduced affinity between protein and DNA, and IrrR is not degraded ^[8]. PpsR protein controls synthesis of heme and folic acid bacillus in purple photosynthetic bacteria ^[9]. -heme-specific sex construct transcription factor HrtR of the genus lactococcus forms a 6-coordinate low spin complex by binding to heme. For example, hrtR ^Ll in lactococcus lactis (Lactococcus lactis) interacts with specific sequences in the promoter regions of the hrtA and hrtB genes (hrtA and hrtB encode heme regulatory transporters HrtA and HrtB, respectively) to inhibit transcription of hrtA and hrtB. When heme binds to HrtR ^Ll to form a complex, the conformation of HrtR ^Ll protein is changed, hrtR ^Ll dissociates from the DNA of the promoter region, transcription and subsequent translation of HrtA-HrtB transporter proteins occurs, and intracellular excess toxic heme is transported out of the cell, whereby the heme-responsive transport mechanism controls heme toxicity ^[10,11].

Thus, any heme-specific sex-conformation transcription factor (aTF) may be used in the present application. In the present application, the heme-specific sex-conformation transcription factor may be a naturally derived heme-specific aTF, or a heme-specific aTF derived from a naturally derived heme-specific aTF, or an active variant thereof. For example, the heme specificity aTF may be selected from one or more of the following: bach1, bach2, p53, gis1, ppsR, irr, hrtR, and FurA, or active variants thereof.

In the present application, an "active variant" as used herein refers to a biologically active heme-specific aTF, i.e., having the activity of specifically binding heme and binding to a particular DNA sequence, wherein one or more amino acid residues of said heme-specific aTF have been modified. Such variants necessarily have less than 100% sequence identity or similarity to native heme specificity aTF. In one embodiment, the active variant will have an amino acid sequence identity or similarity to the amino acid sequences of EBD and DBD of native heme specificity aTF of at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, and most preferably at least 95%. The identity or similarity with respect to this sequence is defined herein as: after aligning the sequences and introducing gaps (if necessary) to achieve the maximum percent sequence identity, the percentage of amino acid residues in the candidate sequence that are identical (i.e., identical residues) or similar (i.e., amino acid residues from the same group based on common side chain characteristics) to the species-dependent antibody residues. N-terminal, C-terminal or internal elongation, deletion or insertion of sequences other than EBD and DBD should not be construed as affecting sequence identity or similarity.

Nucleic acid molecules encoding such heme-specific aTF amino acid sequence variants are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from natural sources (in the case of naturally occurring amino acid sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of previously prepared heme-specific aTF variants or non-variant forms of heme-specific aTF. Alternatively, the heme-specific aTF variant may be prepared by molecular docking techniques and the like.

In some embodiments, the heme specificity aTF may be selected from one or more of the following: transcription factors Bach from mammals, for example, bach1 (NCBI accession number: NP-001177.1) and Bach2 (NCBI accession number: NP-068585.1); mammalian tumor suppressor protein p53 (NCBI accession number: BAC 16799.1); transcription factor Gis1 from yeast (NCBI accession number: KZV 12332.1); transcription factor FurA from blue algae (NCBI accession number: NP-216425.2); global iron regulatory protein Irr (NCBI accession number: CAD 37806.1) from Rhizobium leguminosarum (Rhizobium leguminosarum); ppsR protein from purple photosynthetic bacteria (NCBI accession number: AAF 24278.1); transcription factor HrtR ^Ll from lactococcus lactis (Lactococcus lactis) (NCBI accession number: WP_010905492.1, shown in SEQ ID NO: 1); transcription factor HrtR ^Lc from lactococcus cremoris (Lactococcus cremoris) (NCBI accession number: WP_011834636.1, shown in SEQ ID NO: 8), and HrtR ^Lc variant H149S (shown in SEQ ID NO: 3); and active variants thereof.

In the present application, the amino acid sequence of the transcription factor HrtR ^Ll from lactococcus lactis was identical to that of the conserved region of the transcription factor HrtR ^Lc from lactococcus cremoris, and had 83.51% identity. Mutant H149S of transcription factor HrtR ^Lc derived from lactococcus cremoris is obtained by saturation mutation of H149 of HrtR ^Lc protein, and heme binding force of the obtained mutant H149S protein is enhanced (see Zhang J,Wang Z,Su T,et al.,Tuning the Binding Affinity of Heme-Responsive Biosensor for Precise and Dynamic Pathway Regulation[J].iScience.2020May 22;23(5):101067).

In the present application, the transcription factor acting site is also referred to as a transcription factor binding site. Without wishing to be limited by theory, the transcription factor site of action is typically complementary double stranded DNA. Furthermore, the presence of a single 3',5' -phosphodiester bond break (notch) near the site of action of the transcription factor does not affect the binding of the allosteric transcription factor to its site of action.

The sequence of the site of action of transcription factors in the natural transcription system is known. The transcription factor binding site length varies slightly from species to species. The average length of the transcription factor binding site in E.coli is 24.5bp and in Drosophila is 12.5bp (J Mol biol.1998, 284 (2): 241-54;Nucleic Acids Res.2003, 31 (1): 374-8). In the present application, the length of the site of action of the transcription factor is preferably 6 to 40bp, more preferably 10 to 40bp, for example, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40bp.

In the present application, the site of action of an allosteric transcription factor is also referred to as an allosteric transcription factor binding site. The DNA fragment that acts with an allosteric transcription factor is not limited to the site of allosteric transcription factor acting that exists in the natural system. Several candidate sequences were selected by random or directed mutagenesis of the site of action sequences, or in combination with computer modeling, and the ability of the allosteric transcription factor to bind to each DNA fragment was verified as a well established technique in the art (Mol Microbiol.2005, 55 (3): 712-23.). Alternatively, the effector binding domain and/or the DNA binding domain of an allosteric transcription factor may be mutated to optimize the binding affinity of the allosteric transcription factor to the effector and/or DNA.

Table 1 lists various heme-specific aTF and the DNA sequences from which they were derived, which interact with. It will be appreciated by those skilled in the art that heme specificity aTF for use in the present application is not limited to those listed. Alternatively, one or more bases may be substituted, deleted or added to the DNA sequence that interacts with the listed heme specificities aTF, thereby altering the binding strength of the allosteric transcription factor to the DNA sequence that interacts therewith.

Table 1: exemplary heme-specific sex-construct transcription factors and sources thereof, DNA sequences interacting therewith

Immobilization of proteins

Immobilized proteins refer to proteins that are immobilized on the surface of a matrix material by physical, chemical, affinity, or the like. Depending on the nature of the support material, the proteins may be immobilized to the surface of the solid material by hydrogen bonding, hydrophobic interactions, electrostatic interactions, van der Waals forces, covalent bonds, or the like. The mechanisms of immobilization are in turn generally divided into physical adsorption, affinity immobilization and covalent immobilization in an interactive manner. There are also nonspecific covalent/noncovalent and specific covalent/noncovalent immobilization depending on the orientation of the molecule. In the present application, any of the immobilization methods may be employed for the immobilization method of the heme-specific sex-conformation transcription factor.

Traditional immobilization methods are non-specific. Porous polymeric materials such as polyethylene, polypropylene, carboxymethyl cellulose and the like are immobilized proteins such as hydrophobic interaction and electrostatic interaction between proteins through physical adsorption.

Covalent immobilization refers to the realization of strong immobilization by covalent bonding of groups of amino acid side chains of proteins to functional groups on the surface of solid materials through chemical reactions. The functional groups on the surface of amino acids or materials are usually chemically modified, for example, amino groups (-NH ₂) in proteins can be bound to surface carboxyl groups (-COOH), mercapto groups (-SH) to maleimides, pyridine disulfides, hydroxyl groups (-OH) to epoxy resins, etc.

In the case where there are often multiple reactive functional groups present in the protein, specific non-covalent immobilization generally uses groups at specific positions of the protein or groups introduced, depending on the affinity to immobilize the protein on the surface of the material. Introducing, for example, 6 consecutive histidine tags (6×His); or peptide epitopes, such as the HA tag Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala derived from influenza virus hemagglutinin. The biotin-biotin binding protein system is also a common means of affinity immobilization.

Alternatively, the immobilization may be performed using a fusion protein form. For example, the cellulose domain CBD may be selected for fusion expression with the protein to be immobilized, and the two genes linked by a flexible linker (linker) to effect immobilization of the transcription factor by microcrystalline cellulose material.

In some embodiments, the heme-specific sex-conformational transcription factor is immobilized by direct or indirect covalent or non-covalent means. In some preferred embodiments, the heme-specific sex-conformation transcription factor is immobilized by covalent means. In some preferred embodiments, the heme-specific sex-conformation transcription factor is immobilized by non-covalent means.

In one aspect of the invention, the heme-specific sex construct transcription factor is immobilized by means of a complementary pair of affinity molecules comprising an affinity binding molecule and a complementary affinity molecule.

For example, the invention relates to associating the heme-specific sex-conformation transcription factor with an affinity binding molecule, and associating the immobilization material with a complementary affinity molecule, such that the heme-specific sex-conformation transcription factor is indirectly linked to the immobilization material when the affinity binding molecule is associated with the complementary affinity molecule.

In a preferred embodiment, the heme-specific sex construct transcription factor is immobilized by a biotin-biotin binding protein complementary affinity molecule.

In some embodiments, the affinity binding molecule is biotin, a biotin derivative, or a biotin mimetic, such as, but not limited to, amine-PEG 3-biotin ((+) biotin acyl-3, 6, 9-trioxoundecanediamine) or a derivative or functional fragment thereof.

The attachment of the affinity binding molecule to the allosteric transcription factor, and the attachment of the complementary affinity molecule to the solid support can be non-covalent, or by chemical mechanisms (e.g., covalent, affinity, intercalating, coordination, and complexing). Covalent bonding provides a very stable bond, particularly suitable for use in embodiments herein. Covalent binding may be achieved by direct condensation of existing side chains or by incorporation of external bridging molecules.

In some embodiments, the affinity binding molecule is linked to the allosteric transcription factor by a non-covalent bond or by a covalent bond. In some embodiments, the affinity binding molecule is covalently bound to an allosteric transcription factor disclosed herein using a cross-linking agent.

In some embodiments, the affinity binding molecule is crosslinked to the heme-specific sex conformation transcription factor with a crosslinking agent, e.g., a crosslinking agent selected from the group consisting of: CDAP (1-cyano-4-dimethylaminopyridine tetrafluoroborate), EDC (1-ethyl-3- [ 3-dimethylaminopropyl ] carbodiimide hydrochloride), sodium cyanoborohydride; cyanogen bromide; or ammonium bicarbonate/iodoacetic acid. In some embodiments, the affinity binding molecule is crosslinked to carboxyl, hydroxyl, amino, phenoxy, hemiacetal, and thiol functional groups of the heme-specific sex construct transcription factor. In some embodiments, the affinity binding molecule is covalently bound to the heme-specific sex conformation transcription factor. For example, biotinylation is usually carried out on amino groups of protein molecules, and directional immobilization can be achieved depending on the choice of the modified position.

In some embodiments, the complementary affinity molecule is a biotin-binding protein or derivative or functional moiety thereof. In some embodiments, the complementary affinity molecule is an avidin-like protein or derivative or functional portion thereof, such as, but not limited to, avidin, rhizavidin, or streptavidin, or variants, derivatives, or functional portions thereof.

Streptavidin is an avidin tetramer protein derived from Streptomyces, and one molecule of streptavidin can rapidly form a non-covalent interaction with four biotin molecules. Streptavidin has a lower isoelectric point than avidin, the former having a pI of 5.5 and the latter having a pI of 10.5. Thus, at neutral pH, streptavidin is negatively charged and avidin is positively charged, which results in avidin being susceptible to electrostatic adsorption to DNA in a detection system in the presence of DNA, which is detrimental to the use of the system to mediate DNA-containing detection.

In a preferred embodiment, the immobilization material may be streptavidin coated. Biotinylation of proteins can also be carried out by known methods.

In the present application, the immobilization material for immobilization of the heme-specific sex-conformation transcription factor may be a solid support or a solid matrix, which are used interchangeably herein. Examples of such solid supports or solid matrices include, but are not limited to, nitrocellulose or nylon membranes, affinity column chromatography matrices, magnetic beads, gold nanoparticles, gold nanorods, well plates, microfluidic devices, dipsticks, silver nanoparticles, solid fillers, microcrystalline cellulose, or commercially available nucleic acid immobilization media, and the like.

In a preferred embodiment, the solid support or solid matrix is a heterogeneous support or a homogeneous support. In a preferred embodiment, the solid support or solid matrix is a homogeneous support, e.g., a well plate made of polyethylene/polystyrene or the like, such as a 48-well plate, 96-well plate, 384-well plate, or the like. For example, for the purpose of reproducibility, ease of operation, low cost, commercially available PCR plates made of polyethylene/polystyrene or the like, 48-well plates, 96-well plates, 384-well plates, or the like can be used.

The range of the detection compound is related to the protein amount coated on the pore plate, and too small a fixed amount can lead to a smaller detection range, which is unfavorable for sample detection, and too large a fixed amount can cause unnecessary economic loss.

In a preferred embodiment, the immobilized heme-specific sex-conformation transcription factor is performed at a protein concentration of 5 μg/mL to 20 μg/mL, preferably 7.5 μg/mL to 12.5, e.g. 10 μg/mL. For example, the immobilized heme-specific sex-conformation transcription factor was biotinylated at a protein concentration of 5μg/mL、5.5μg/mL、6μg/mL、6.5μg/mL、7μg/mL、7.5μg/mL、8μg/mL、8.5μg/mL、9μg/mL、9.5μg/mL、10μg/mL、10.5μg/mL、11μg/mL、11.5μg/mL、12μg/mL、12.5μg/mL、13μg/mL、13.5μg/mL、14μg/mL、14.5μg/mL、15μg/mL、15.5μg/mL、16μg/mL、16.5μg/mL、17μg/mL、17.5μg/mL、18μg/mL、18.5μg/mL、19μg/mL eggs, 19.5 μg/mL, 20 μg/mL.

Double-stranded DNA (dsDNA)

The term "double stranded DNA" or "dsDNA" as used herein is a nucleotide comprising a DNA fragment of an allosteric transcription factor acting site, a CRISPR/Cas protein recognition site PAM, and a sequence at least partially complementary to a guide nucleic acid (gRNA) that is double stranded at least at the allosteric transcription factor acting site, the CRISPR/Cas protein recognition site, and the sequence at least partially complementary to the gRNA. The dsDNA can act as an activator to activate the trans-cleavage activity of the CRISPR/Cas system, and thus can be referred to herein as "activating dsDNA". In the present invention, the length of the activating dsDNA is preferably 20 to 80bp, more preferably 25 to 65bp, and most preferably 30 to 60bp. Wherein the definition of allosteric transcription factor binding sites is as described above.

CRISPR/Cas protein recognition site PAM as described herein refers to a sequence that is recognized by the CRISPR/Cas system and thus activates the cleavage activity of the CRISPR/Cas system, which sequence is referred to as a Protospacer Adjacent Motif (PAM). For example, for CRISPR/Cas12a, its PAM is typically rich in T.

In the present invention, the length of PAM is preferably 3-8bp, more preferably 3-6bp, most preferably 4bp. The PAM sequence is not limited to PAM present in natural systems. The selection of several candidate sequences and verification of PAM's ability to bind to CRISPR/Cas by random or directed mutation of the site of action sequences, or in combination with computer modeling, is a technique known in the art.

For example, in an embodiment of the invention, the activated dsDNA forms double stranded DNA by annealing. In some embodiments, the activating dsDNA comprises an allosteric transcription factor site of action as described above. For example, for HrtR proteins or active variants thereof, the activating dsDNA may comprise a 15bp palindromic sequence as allosteric transcription factor binding site with a nucleotide sequence of ATGACACAGTGTCAT (shown in SEQ ID NO: 4).

In an exemplary embodiment, for HrtR protein or an active variant thereof, the sequences of the two strands of the double stranded DNA are shown below (SEQ ID NOS: 5-6):

5’-TAGAATTTAATAAATGACACAGTGTCATAAATT-3’

5'-AATTTATGACACTGTGTCATTTATTAAATTCTA-3' (wherein the underlined portion is PAM and the bolded portion is the allosteric transcription factor binding site, i.e., the portion complementary to the gRNA).

In the present invention, the term "at least partially complementary" to a gRNA means a sequence that is at least 50% or more, such as at least 70% or more, such as 80%, 85%, 90%, 95%, 99% or more, or 100% complementary to the gRNA.

In embodiments of the invention, the sequence that is at least partially complementary to the gRNA may be before, after, or between the transcription factor binding site and PAM, or at least partially overlapping the transcription factor binding site, or within the allosteric transcription factor binding site, in activating dsDNA. For example, in activating dsDNA, the allosteric transcription factor binding site is the sequence that is at least partially complementary to the gRNA. Thus, in a preferred embodiment, only PAM and an allosteric transcription factor binding site (wherein the allosteric transcription factor binding site comprises a sequence complementary to the gRNA) may be included in the activation dsDNA. Thus, the length of the activating dsDNA can be as low as 18bp.

In the present invention, in "activating dsDNA", the allosteric transcription factor acting site may be separated from the PAM sequence by several nucleotides, for example, by 0 to 20bp, more preferably 5 to 10bp, and most preferably 6 to 9bp. In one embodiment, the allosteric transcription factor site of action may be directly linked to the PAM sequence or may overlap partially or completely. Alternatively, the PAM sequence may be located in the site of allosteric transcription factor action.

In this context, the "activating dsDNA" has both an allosteric transcription factor acting site and a CRISPR/Cas protein recognition site PAM present thereon, and thus can bind both an allosteric transcription factor and a Cas protein. The equilibrium dissociation constant of the allosteric transcription factor binding to the activating dsDNA fragment can be higher, lower, or similar to the equilibrium dissociation constant of the CRISPR/Cas protein binding to the activating dsDNA fragment. In some embodiments of the invention, the equilibrium dissociation constant of the allosteric transcription factor binding to the activating dsDNA fragment is lower than the equilibrium dissociation constant of the CRISPR/Cas protein binding to the activating dsDNA fragment, i.e. the activating DNA fragment binds to CRISPR/Cas protein more readily than the allosteric transcription factor. Thus in order to reduce interference of the allosteric transcription factor and the CRISPR/Cas system on each other's functions, reduce noise, increase sensitivity, the allosteric transcription factor and the CRISPR/Cas system of the present invention can be provided in separate forms and react in different spaces.

In some embodiments, the activating dsDNA can be prepared by: for example, double stranded DNA is formed by annealing (e.g., pre-denaturation at 95℃for 5min; denaturation at 95℃for 30s, 1℃for each cycle, 70 cycles; preservation at 25 ℃) using a primer pair targeting a specific allosteric transcription factor action site and a CRISPR/Cas protein recognition site; alternatively, double-stranded DNA having nucleotide sequences shown in SEQ ID NOs:5 and 6 may be synthesized by artificial synthesis, for example, artificial synthesis. The activated dsDNA may also be prepared by other means known in the art.

In one embodiment, to avoid activating dsDNA by competitive binding of aTF to CRISPR/Cas protein in the same reaction system, the dsDNA can be activated by fusion expression of aTF to other proteins that do not affect its activity (e.g., CBD), or by overlapping the allosteric transcription factor action site in the activating dsDNA with the portion complementary to the gRNA and optional PAM sequence.

CRISPR/Cas system

CRISPR/Cas systems can be divided into two major classes (Class 1 and Class 2), six types (type I to type VI) and at least 33 subtypes, depending on the composition of the Cas protein and the different mechanisms of action. Can be classified into 2 classes according to ribonucleoprotein effectors: ribonucleoprotein effectors in class 1 (I, III and type IV) systems comprise a plurality of Cas protein complexes; class 2 (types II, V, and VI) contains only a single Cas protein. In a type II system in class 2, an independent Cas9 nuclease is responsible for target cleavage, and the system recruits Cas proteins using double-stranded RNA (tracrRNA-crRNA), cas9 contains domains of HNH-nucleases and RuvC-like nucleases that cleave the complementary (target) and non-complementary (non-target) strands of DNA, respectively, while type V (Cas 12) and type VI (Cas 13) target DNA and RNA cleavage, respectively.

In recent years, many new class 2 CRISPR/Cas systems, such as Cas12b, cas12c, cas12d (Y), cas12e (X), cas12g, cas12h, cas12i, and Cas14a, etc., have greatly expanded the application of CRISPR technology.

In terms of detection, cas proteins with trans-cleaving activity in Class 2 in CRISPR systems are most commonly used. Taking Cas12a protein as an example, cas12a recognizes a DNA sequence rich in a/T and its RuvC and Nuc domains cross-cleave at their distal sites to form cohesive ends, this cleavage activity is termed Cis-cleavage activity of Cas12a (Cis-CLEAVAGE ACTIVITY), which activates non-specific ssDNA Trans-cleavage activity (Trans-CLEAVAGE ACTIVITY) while Cas12a targets dsDNA.

In the present application, CRISPR/Cas systems with trans-cleaving activity, i.e. CRISPR/Cas systems with non-specific ssDNA trans-cleaving activity, can be used. In some embodiments, the CRISPR/Cas system is selected from any one of the CRISPR/Cas12a systems or active variants thereof. For example, the CRISPR/Cas12a system can be selected from any of LbCas a, fnCas12a, or active variants thereof.

As used herein, an "active variant" refers to a CRISPR/Cas12a system having biological activity that has at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, and most preferably at least 95% amino acid sequence identity or similarity to the amino acid sequence of the native CRISPR/Cas12a system.

Guide RNAs (grnas or sgrnas) are specific RNA sequences that guide CRISPR/Cas proteins to recognize and cleave target nucleic acid molecules, either by in vitro transcription or artificial chemical synthesis. The guide RNA may be formed by hybridization of CRISPR RNA (crRNA) and transactivation crRNA (tracrRNA), or may be provided as separate, contiguous RNAs. The gRNA specifically binds to the complementary target sequence via a target-specific sequence (e.g., a spacer sequence "spacer") in the crRNA portion, while the CRISPR/Cas protein itself binds to PAM, and then Cas nuclease mediates cleavage of the target nucleic acid (e.g., DNA probe). For different CRISPR/Cas systems, some may use grnas with crrnas and tracrrnas, and some may use crRNA only grnas.

For example, for CRISPR/Cas12a, only crRNA guidance is required, and no tracrRNA is required; and CRISPR/Cas12a cleaves not only DNA double strands of a specific sequence (dsDNA containing a sequence complementary to a crRNA recognized by the crRNA) but also any single stranded DNA (ssDNA) when activated by a DNA double strand of a specific sequence (e.g., the activating DNA herein) to form a CRISPR/Cas/dsDNA ternary complex. These properties enable CRISPR/Cas12a to increase the sensitivity, specificity and speed of detection. Thus, in some embodiments, a CRISPR/Cas12a system is preferred.

In the present invention, the length of gRNA is preferably 20-70bp, more preferably 30-50bp, most preferably 38-45bp. gRNA can be designed based on the needs of the user. The design is preferably performed in conjunction with bioinformatics software.

In some embodiments, the crRNA sequence is as shown below (SEQ ID No. 7):

GAAUUUCUACUGUUGUAGAUUGACACUGUGUCAUUUAU (wherein the underlined part is the scafold of the crRNA and the bolded part is the sequence complementary to the recognition dsDNA site).

In a CRISPR/Cas system, the molar ratio of Cas protein to gRNA can be determined by the skilled person based on the nature of the system. For example, the molar ratio of Cas12a protein to gRNA can be about 1:1.

In the present invention, the concentration of Cas protein added may be 50-500nM, preferably 100-200nM, in order to sufficiently bind the released dsDNA.

Single-stranded DNA probe (ssDNA probe)

"Probe" or "DNA probe" used interchangeably herein refers to a nucleotide sequence that can be cleaved by the CRISPR/Cas system and has a group (also referred to herein as a "tag") that can generate a detectable signal upon cleavage.

In some embodiments, the probe is a single stranded DNA, which may be any nucleotide sequence, for example a nucleotide sequence of about 3-30bp, preferably about 5bp, such as TTATT, in length. For example, the ssDNA may be 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12bp in length.

In some embodiments, the signal comprises a fluorescent signal or an absorbance light signal. It will be appreciated by those skilled in the art that in order to quantify the color change that occurs in an analysis, the intensity of the absorbed light is typically detected after excitation with light of a particular wavelength. Thus, in the present invention, the term "absorbed light signal" may also refer to the resulting color change (colorimetric analysis). In some embodiments, the probe can carry a label to generate a detectable optical signal after cleavage by CRISPR/Cas. Examples of markers include, but are not limited to: luminescent organic compounds (e.g., fluorescein, turnin), luminescent inorganic compounds (e.g., chemical dyes), fluorophores (e.g., FAM fluorophores), and the like; nanoparticles, quantum dots, and the like; or chromophores, etc. The techniques for labeling nucleic acid sequences with the above materials to produce a detectable signal are well known to those skilled in the art and can be selected and modified as desired without limiting the invention. In some preferred embodiments, the signal is a fluorescent signal. In a further preferred embodiment, the labels are a luminophore and a quencher, labeled at both ends (3 'or 5' ends) of the probe, respectively. Preferably, the luminophore is a FAM fluorophore and the quencher is a BHQ fluorescence quencher. In other preferred embodiments, the signal is an absorption light signal. In a further preferred embodiment, the labels are a chromophore and a quencher, respectively, at both ends (3 'or 5' ends) of the probe. In one embodiment, the ssDNA probe may be 6-FAM-TTATT-BHQ1.

Without being limited by a particular theory, in the case where the activated DNA of the present invention is double-stranded DNA and can be designed to be recognized by gRNA and/or crRNA, one skilled in the art can design the activated dsDNA of the present invention as double-stranded DNA probes (e.g., labeled at both ends of the activated DNA) to practice the present invention, and such modifications are intended to be included within the scope of the present invention.

In some embodiments, the ssDNA probe is at a concentration of 50-500nM, preferably 100-200nM, more preferably 200nM.

Heme-containing sample

In the present invention, the sample to be detected comprising heme may be present in any liquid sample or a solid sample which can be converted into a liquid sample by a suitable operation. The sample may be an environmental sample, for example, a sample of groundwater, reclaimed water, seawater, wastewater, mining waste. Or the sample may be a biological sample, in particular a sample from a microorganism. The sample may also be from food, drinking water or feed.

In some embodiments, the sample may be pre-treated to enrich and extract heme to be detected or to remove impurities that may interfere with detection. For example, the pretreatment reagents may be added by centrifugation, filtration, sonication, homogenization, heating, freezing, thawing, mechanical treatment, or a combination of various procedures. The person skilled in the art is aware of common pretreatment methods and pretreatment reagents for specific samples. For example, commonly used pretreatment reagents include surfactants and detergents, salts, cell lysing agents, anticoagulants, degrading enzymes (e.g., proteases, lipases, nucleases, lipases, collagenases, cellulases, amylases, etc.), solutions (e.g., buffers), and the like.

In addition, most samples for heme detection require efficient extraction of protein-bound heme from the sample. Thus, the sample comprising heme may also be a heme sample in an extraction reagent. In some embodiments, the heme-containing sample is also a heme sample from which the extraction reagent is removed. The reagent for extracting heme may comprise HCl and an organic solvent, and is generally prepared by mixing organic solvents such as acetonitrile, methanol, acetone and the like with HCl in a certain proportion to directly extract heme, or extracting heme by auxiliary ultrasonic technology and the like. In some embodiments, the extraction reagent may also be replaced with a buffer more suitable for heme-specific sex-conformation transcription factors to prepare a heme sample.

Detection method

In the present invention, methods of immobilized heme-specific sex-configured transcription factors and CRISPR/Cas mediated heme detection are provided. In an embodiment of the present invention, heme may be detected using the heme detection system of the present invention. In the present invention, the qualitative or quantitative detection of heme in a sample can be performed.

The invention provides a method for detecting heme mediated by immobilized heme specific sex-conformation transcription factor and CRISPR/Cas, which comprises the following steps:

immobilizing heme-specific sex-construct transcription factors;

contacting a sample comprising heme with said immobilized heme-specific sex-conformation transcription factor such that said dsDNA is released; and

Activating a detection system comprising a CRISPR/Cas system capable of recognizing and binding to said dsDNA and a single stranded DNA probe (ssDNA probe) using said released dsDNA, measuring a signal generated by cleavage of said ssDNA probe by said CRISPR/Cas system, thereby detecting heme,

In one embodiment, the method further comprises: a step of separating the supernatant containing the released dsDNA fragments.

In one aspect, the invention provides a method of immobilized heme-specific sex-conformational transcription factor with CRISPR/Cas mediated heme detection, the method comprising:

(1) Immobilizing heme-specific sex-construct transcription factors;

(2) Binding the immobilized heme-specific sex-conformation transcription factor to double-stranded DNA (dsDNA) having a sequence capable of being recognized by the heme-specific sex-conformation transcription factor;

(3) Contacting a sample comprising heme with said immobilized heme-specific sex-conformation transcription factor such that said dsDNA is released;

(4) Isolating a supernatant containing the released dsDNA fragments, adding a CRISPR/Cas protein, a guide RNA and a ssDNA probe thereto, measuring a signal generated by cleavage of the ssDNA probe by the CRISPR/Cas system, thereby detecting the presence or amount of heme,

In some embodiments, the heme-specific sex construct transcription factor may be selected from the group consisting of transcription factor HrtR ^Ll from lactococcus lactis (Lactococcus lactis) (as shown in SEQ ID NO: 1); transcription factor HrtR ^Lc (shown as SEQ ID NO: 8), and variant H149S HrtR ^Lc (shown as SEQ ID NO: 3) from lactococcus cremoris (Lactococcus cremoris); global iron regulatory protein Irr (NCBI accession number: CAD 37806.1) from Rhizobium leguminosarum (Rhizobium leguminosarum); or an active variant thereof. In a preferred embodiment, the heme-specific sex construct transcription factor may be selected from the group consisting of transcription factor HrtR ^Ll from lactococcus lactis (Lactococcus lactis) (as shown in SEQ ID NO: 1); transcription factor HrtR ^Lc (shown as SEQ ID NO: 8) from lactococcus cremoris (Lactococcus cremoris), and variants H149S (shown as SEQ ID NO: 3) thereof; or an active variant thereof.

In a preferred embodiment, the heme-specific sex-conformation transcription factor is immobilized by covalent or non-covalent means. The heme-specific sex-conformation transcription factor is immobilized by a complementary affinity molecule pair (particularly biotin-streptavidin) system.

For example, in embodiments using a biotin-streptavidin system, the heme-specific sex-conformation transcription factor is biotinylated. The protein solution should be free of amine buffer and therefore Tris-HCl buffer is not suitable. For example, PBS buffer may be used. Labeling with an excess of biotin reagent is performed, for example, 5-fold or more molar ratio, 10-fold or more molar ratio, 20-fold or more molar ratio, 25-fold molar ratio, 50-fold molar ratio or more molar ratio, or the like.

The homogeneous solid support or solid matrix is coated with streptavidin. In a preferred embodiment, the solid support or solid matrix is a well plate, such as 48-well plate, 96-well plate, 384-well plate, etc., made of polyethylene/polystyrene, etc., for example. For example, a commercially available PCR plate made of polyethylene/polystyrene or the like, a 48-well plate, a 96-well plate, a 384-well plate, or the like can be used.

In a preferred embodiment, the immobilized heme-specific sex-configured transcription factor is performed at a protein concentration of 5 μg/mL-20 μg/mL, preferably 7.5 μg/mL-12.5 μg/mL, more preferably 10 μg/mL. In a preferred embodiment, the biotinylated heme-specific sex-conformational transcription factor is incubated with a streptavidin-coated well plate at room temperature (about 25 ℃) with shaking for 30min-120min, preferably 30-60min, followed by washing with buffer (e.g., PBST buffer) 3-6 times (e.g., 3 times or 4 times), each wash time being 2-5min, preferably 3min.

In general, in homogeneous solid support (e.g., microwell plate) detection systems, it is desirable to add inert macromolecules such as BSA, gelatin, and defatted proteins to reduce non-specific background interference at unbound sites in the blocked well plate. However, in embodiments of the present application, this step of blocking with inert molecules is not necessary. According to experimental results, no non-specific adsorption exists between the homogeneous solid phase carrier, especially the micro-pore plate and dsDNA, so that the step of inert macromolecule sealing is not needed, the experimental process is greatly simplified, and the time and the cost are saved.

The immobilized heme-specific sex-conformation transcription factor is bound to dsDNA having a sequence capable of being recognized by the heme-specific sex-conformation transcription factor by mixing and incubating the dsDNA with the heme-specific sex-conformation transcription factor. For example, the reaction is performed at room temperature for 1min or more, for example, 10min to 30min, preferably 15min to 20min (but not limited thereto). The ratio of allosteric transcription factor to activating dsDNA can be adjusted according to practical requirements. In some embodiments of the invention, the molar ratio of activated dsDNA to allosteric transcription factor can be equal to or greater than 1, for example, equal to or greater than 2, equal to or greater than 3, equal to or greater than 4, equal to or greater than 5. After incubation is complete, the unbound dsDNA may be removed by washing 3-6 times, preferably 3 times, with buffer (e.g., PBST buffer), each for a period of 2-5min, preferably 3 min.

In particular embodiments, dsDNA may be diluted (e.g., PBS) from a buffer to a suitable concentration. In one exemplary embodiment, dsDNA is diluted to an appropriate concentration with PBS buffer. In the embodiment of the microplate, 200. Mu.L of dsDNA solution was added and incubated at room temperature for 20min to form a protein-nucleic acid complex.

Contacting a sample comprising heme with said immobilized heme-specific sex-conformation transcription factor for 10min and below such that said dsDNA is released. For example, a sample comprising heme is incubated with the immobilized heme-specific sex-conformation transcription factor with shaking at room temperature for 5-10min, e.g., 5min, 6min, 7min, 8min, 9min and 10min. Of course, a longer time may also be selected. However, for the method of the application, a time of 10min is sufficient to allow dsDNA to be released.

Since heme is insoluble in water due to its strong hydrophobicity, it can only be dissolved in an organic solvent or an alkaline sodium hydroxide solution, so that the pretreatment reagents of samples are different according to the detection method. The method of the application is applicable to most samples or pretreated samples. In some embodiments, the heme is dissolved in its appropriate organic solvent or alkaline sodium hydroxide solution and then diluted with a corresponding buffer (e.g., PBS). In some embodiments, samples comprising heme extraction reagents may also be used in the methods of the application. For example, the heme-containing sample may contain nitrile, methanol, acetone, etc. organic solvents and HCl, wherein the HCl and organic reagents need to be controlled to a concentration below 1.5% and 18%, respectively, for example, diluted with a buffer to a suitable range. This greatly simplifies the heme detection process, enabling immediate detection of the extracted sample.

In a specific embodiment, the supernatant containing the released dsDNA fragments is obtained by filtration or centrifugation (e.g., 7000rpm at room temperature), which is simple to operate, time-and cost-effective and economically viable. This isolation step can also be omitted, with the CRISPR/Cas12a system and optional ssDNA probes directly added thereto.

The resulting signal is detected using methods and apparatus for detecting fluorescent signals or absorbing light signals commonly used in the art. For example, when the signal generated is a fluorescent signal, an enzyme-labeled instrument is used for measurement. It should be noted that when qualitative analysis of the heme to be detected is performed, the resulting color change (as described above, including within the scope of "absorbed light signal") may not be quantitatively analyzed, but merely colorimetrically analyzed, which is also within the scope of the claimed invention.

The generated signal may be analyzed based on a reference level to detect the presence or amount of heme. The "reference level" is used interchangeably herein with "reference sample", "reference level" and refers to a control of conditions. For example, in the context of qualitative detection of heme (detecting the presence or absence), the reference level may be the level of a sample that does not contain heme. In the context of quantitative detection (detection of amounts) of heme, the reference level may be the level of a sample containing a known amount of heme. In terms of determining the presence and amount of a sample comprising heme, the reference level is a reference value, and the sample can be normalized to an appropriate standard to infer the presence, absence or amount of heme in the sample. In some embodiments, the reference level may be a previously determined level, for example, a predetermined number or ratio, without requiring determination with the same physical iterations of the detection methods described herein.

The term "derivative" as used herein refers to a chemically modified protein or polypeptide, for example, by ubiquitination, labelling, pegylation (derivatization with polyethylene glycol) or addition of other molecules. A molecule is also a "derivative" of another molecule when it contains additional chemical moieties that are not typically part of the molecule. Such moieties may improve the solubility, absorption, biological half-life, etc. of the molecule. Or the moiety may reduce toxicity of the molecule, or eliminate or attenuate undesired side effects of the molecule, etc. The term "activity" when used in connection with a "derivative" or "variant" refers to a protein molecule having a biological activity that is substantially similar to the biological activity of the entity or molecule.

In one aspect, the invention provides a method of:

(1) HrtR protein that specifically responds to biotin-modified heme: bio-HrtR was immobilized in streptavidin pre-coated 96-well plates;

(2) Adding excessive double-stranded DNA into the pore plate to saturate HrtR proteins in the pore plate, and washing out excessive nucleic acid by using PBST buffer solution; and

(3) Adding a sample to be detected, incubating for 10min in an orifice plate, adding a CRISPR/Cas12a fluorescent cutting system into the supernatant, and detecting a fluorescent signal.

In one embodiment, the HrtR protein is an allosteric transcription factor derived from specific response heme of lactococcus lactis (Lactococcus lactis) and has the amino acid sequence shown in SEQ ID NO. 1.

In some embodiments, the crRNA concentration is 200nm and the ratio of cas12 to crRNA concentration is 1:1.

In some embodiments, the PBST buffer ：10mM Na₂HPO₄,137mM NaCl,2.7mM KCl,1.76mM KH₂PO₄,pH 7.4,0.05％ Tween-20.

In some embodiments, the ssDNA is 6-FAM-TTATT-BHQ1.

In some embodiments, hrtR proteins are immobilized on the well plate for 30-60min, PBST buffer is used for 3min, samples are added to the well plate for incubation for 10min, and fluorescence detection is used for 30-60min.

In some embodiments, the chlorhexidine is dissolved in DMSO to make a mother liquor, which is diluted to the corresponding concentration with PBS buffer at the time of use.

In some embodiments, the temperature at which fluorescence is detected is set to 37℃and the excitation and emission wavelengths are 480nm and 520nm, respectively.

In a preferred embodiment, the heme detection method comprises:

(1) Downloading a heme response specific transcription factor HrtR protein sequence from NCBI database, cloning a corresponding DNA sequence of the protein on a protein expression plasmid vector, and carrying out protein expression purification;

(2) Purified HrtR protein is modified by adding Biotin, and the side chain of the N-terminal and lysine (Lys, K) residues of the protein molecule contains primary amino (-NH ₂), and a Sulfo-NHS-Biotin biotinylation reagent can be dissolved in water, so that the whole chemical reaction is carried out in PBS buffer solution, and the mol ratio of Biotin to protein in a reaction system is 20:1, placing on ice for incubation for 2 hours, removing excessive biotin by using a dialysis bag or a PD-10 desalting column after the reaction is finished, and adding glycerol for storage at the temperature of minus 80 ℃;

(3) 100 mu L of biotin-modified HrtR protein is fixed on a 96-well plate pre-coated with streptavidin, the HrtR protein concentration is optimized to 10 mu g/mL, the rotation speed is 300rpm on a horizontal shaking table, the incubation is carried out for 30-60min, after the incubation is completed, 200 mu L of PBST buffer is added for 3 times, and the washing time is 3min each time;

(4) Adding 200 μl of dsDNA to the well plate of step 3) to incubate with HrtR protein in the well plate for 20min, wherein the molar amount of dsDNA is in excess of HrtR protein, the dsDNA concentration is 0.11 μΜ, and after incubation, adding 200 μl of PBST buffer to wash 3 times for 3min each time;

(5) Adding 50 mu L of heme (hemin) with different concentrations and a sample to be tested into the pore plate in the step 4), and incubating for 10min on a horizontal shaking table at the rotating speed of 300 rpm;

(6) Cas12a/crRNA complex solution was prepared: the ratio of Cas12a to crRNA is 1:1, 100nM concentration, 200nM concentration of ssDNA probe, NEB 3.1buffer for cleavage, and mixing well;

(7) Adding 10 mu L of sample into the complex solution in the step 6) by a row gun in the pore plate in the step 5), uniformly mixing, detecting fluorescent signals by an enzyme-labeled instrument, wherein the temperature is 37 ℃, and the excitation wavelength and the emission wavelength are 480nm and 520nm respectively.

Application of

In addition to heme detection for the corresponding sample, the heme detection system and method of the present invention can also be used for engineering evolution of Fe-coproporphyrin decarboxylase, which can perform high throughput screening on constructed mutant libraries.

The systems, kits and methods of the invention can be used for diagnostic or non-diagnostic purposes.

Device for heme detection

In one aspect, the application provides a device for heme detection comprising a solid matrix immobilized with a heme-specific sex-conformation transcription factor. In a preferred embodiment, the heme-specific sex-conformation transcription factor is bound with double-stranded DNA (dsDNA), wherein the double-stranded DNA has a sequence capable of being recognized by the heme-specific sex-conformation transcription factor.

In some embodiments, the device for heme detection further comprises a unit for a signal output module to provide the signal output module to the solid substrate. The unit for the signal output module has a container that separately contains the CRISPR/Cas system and ssDNA probes. Or the CRISPR/Cas system and ssDNA probe may be packaged together in a container. The CRISPR/Cas system and ssDNA probes can optionally be in liquid or powder form, e.g., dissolved in a suitable buffer, or lyophilized powder.

In the device of the present invention, the unit for signal output module can be designed to provide the CRISPR/Cas system and ssDNA probes directly to the solid substrate; or it may be designed to provide the CRISPR/Cas system and ssDNA probes into a supernatant comprising dsDNA isolated from the solid substrate.

In a preferred embodiment, the solid substrate is a porous plate, for example, a porous plate made of polyethylene/polystyrene or the like.

In some embodiments, the device for heme detection comprises an well plate immobilized with a heme-specific sex-conformation transcription factor, the plate being made of polyethylene/polystyrene or the like, wherein the heme-specific sex-conformation transcription factor is non-covalently bound to the well plate by a biotin-biotin binding protein.

In an embodiment of the present invention, the well plate to which the heme-specific constitutive transcription factor is immobilized may be provided in the form of a prefabricated plate, i.e., a plate to which the heme-specific constitutive transcription factor is immobilized at a proper concentration. In a preferred embodiment, the heme-specific sex-conformation transcription factor is bound with double-stranded DNA (dsDNA) in the pre-cast plate. In embodiments of the invention, the preformed sheet may be provided in a dry form that is convenient to store and carry, making it suitable for use in a wider variety of inspection scenarios (including rapid field inspection).

In some embodiments, the device further comprises a means for providing a buffer, e.g., a buffer (e.g., PBS) that reconstitutes the CRISPR/Cas system or ssDNA probe, and optionally a wash buffer (e.g., PBST). In some embodiments, a buffer is also provided that washes the preformed sheet prior to use.

Kit for detecting a substance in a sample

The invention also provides a kit for detecting heme, which comprises the heme detection system and an additional signal detection module. In this context, the signal detection module refers to an element, device or system that detects a signal generated by the detection system of the present invention. In some embodiments, the signal detection module is configured to analyze the optical signal generated by the DNA probe by fluorescence analysis or absorption light analysis (including colorimetric analysis) to obtain qualitative or quantitative detection results of heme.

In one aspect, the present application provides a kit for detecting heme, the kit comprising an well plate immobilized with a heme-specific sex-configured transcription factor of the present application, the well plate being made of polyethylene/polystyrene, the heme-specific sex-configured transcription factor being bound to double-stranded DNA (dsDNA), wherein the double-stranded DNA has a sequence capable of being recognized by the heme-specific sex-configured transcription factor; a container comprising a CRISPR/Cas system and ssDNA probes; and instructions for performing the heme test. In some preferred embodiments, the kit further comprises a container comprising a buffer.

In some embodiments, the kits of the invention further comprise a delivery means or device (e.g., a pipette) for detecting heme using the detection system of the invention, a wash buffer, a dilution buffer, a stop buffer (e.g., for stopping color development), a microtiter plate (e.g., 96-well or 384-well), one or more containers, a data carrier (e.g., instructions or computer readable medium) that records instructions for use, a standard (e.g., a sample containing a known amount of small molecules), combinations thereof, and the like.

Examples

The invention is further illustrated, but not limited, by the following examples. The advantages and features of the present invention will become more apparent from the following description of the embodiments, which are not intended to limit the invention in any way.

The heme used in the establishment of the heme detection method is a commercial heme standard, namely, hemin. The remaining reagents are all commercially available, for example from NEB.

The research establishes a simple, time-saving, economical, efficient and high-flux method named as E-Cat-Smelor, the detection is divided into two modules, a sensing module based on the allosteric transcription factor response heme of a 96-well plate and an output module of the CRISPR fluorescent signal of the 384-well plate. By coupling the heme sensing module and the signal output module, the heme is efficiently detected, and the detection flow is shown in figure 2. According to the linear relation between the concentration of the hemin and the fluorescence slope, the detection linear range of the hemin of E-CaT-Smelor is determined to be 10-200nM, the detection limit is 7nM, the repeatability of the detection system is good, and the variation coefficients in the plate and between the plates are smaller than 10%. Compared with the existing similar detection technology, the E-CaT-Smelor experimental operation flow and fixation are more standard and simpler, and the repeatability and accuracy of detection are improved to some extent.

The working flow of the E-CaT-SMelor disclosed by the invention is as follows:

As shown in fig. 2, the detection method includes the following steps: 1. fixing protein for 30-60min; PBST washes the plate 3 times; 3. adding dsDNA for incubation for 20min; PBST washing the plates for 3 times; 5. adding a sample to be detected for incubation for 10min;6. detection was based on CRISPR fluorescence for 30min. The whole detection flow can be completed within 3 hours.

1) Preparation of dsDNA

Using the HrtR-specific binding dsDNA sequence (SEQ ID NO. 5-6) in the hrtRBA operon of lactococcus lactis, which contains the HrtR protein-binding 15bp sequence, the present study intercepts 33bp long, synthesizes two complementary single strands hrtO-1 and hrtO-2 (SEQ ID NO. 5-6), dsDNA obtained by annealing the two strands. The annealing buffer contained 10mM Tris-HCl, 40mM KCl, 1mM DTT, 1mM MgCl ₂、1mM ZnSO₄, 10% (v/v) glycerol, pH=8.0. After the two complementary strands of DNA are mixed uniformly in an annealing buffer solution, the temperature is 95 ℃ for 5min, the temperature is cooled to room temperature, the annealing is finished, the concentration of the nucleic acid is measured by Nanodrop, and the sample is stored at-20 ℃.

2) Protein purification

The Cas12a used in the present invention is Lachnospiraceae bacterium (LbCas 12 a) Cas12a, abbreviated as LbCas. HrtR proteins are derived from Lactococcus lactis.

Preparing purified protein: the gene sequence of LbCas was synthesized and the gene cloned into the prokaryotic expression vector pET28TEV to give plasmid pET28TEV-LbCPf1, the recombinant plasmid was transformed into E.coli.BL21 (DE 3). HrtR ^Ll the gene sequence is shown as SEQ ID NO.2, which is synthesized and cloned into pET28a (+) vector, two restriction sites EcoRI and XhoI are selected, and the recombinant plasmid is transformed into E.coli BL21 (DE 3). Expression of the expressed protein was induced with IPTG and affinity chromatography was performed to purify the protein. Purified LbCas protein and HrtR ^Ll protein were each checked for protein purity by SDS-PAGE, as shown in FIG. 3.

3) CRISPR/Cas12a cleavage System

The concentration of Cas12a, crRNA and probe is 10 mu M, and the ratio of Cas12a to crRNA in the cleavage system is 1:1, the concentration of the probe is 2 times that of the Cas12a-crRNA complex, the temperature is 37 ℃, and a fluorescence signal is detected by an enzyme-labeled instrument.

Example 1: fluorescent quantitative analysis of dsDNA

The length of the crRNA sequence used by the invention is 38bp, and the crRNA sequence is used for activating the cutting activity of Cas12a, and the sequence is shown as SEQ ID NO. 7. The trans-cleaving activity of Cas12a was first verified using dsDNA. The crRNA forms a complex with Cas12a, and when the target sequence on the dsDNA is recognized, cas12a, crRNA and target dsDNA form a ternary complex, which activates the "trans-cleavage activity" of Cas12a, indifferently cleaves ssDNA in the system, and ssDNA serves as a probe for fluorescent signal output. The 5 'end of the ssDNA probe in the cleavage system is modified by FAM, the 3' end is modified by a fluorescence quenching group, and the probe is trans-cleaved into small fragments to generate a fluorescence signal.

As a result, the fluorescence signal generated was related to the dsDNA concentration in the cleavage system and was linear as shown in FIG. 4.

Example 2: detection of hemin using cellulose-CBD immobilized protein

100 Mug microcrystalline cellulose material and 10 mu g HrtR-CBD protein are uniformly mixed in buffer solution in an EP tube of 1.5mL, the mixture is subjected to shaking incubation at room temperature for 20min, equimolar dsDNA is added, the mixture is subjected to room temperature incubation, PBST buffer solution is used for washing 3 times, redundant dsDNA is washed off, different concentrations of chlorhydrin are added, the chlorhydrin and transcription factor are combined to release dsDNA, supernatant is taken and added into a Cas12a cutting system for incubation at 37 ℃ for 10min, and a fluorescent signal is measured by an enzyme-linked immunosorbent assay.

As a result, as shown in fig. 5, there is a positive correlation between the slope of the fluorescence signal, i.e., cas12a cleavage rate, and the concentration of hemin. Although micro-molecular detection can be performed by immobilizing allosteric transcription factors with microcrystalline cellulose materials, microcrystalline cellulose is used as a solid material, so that the whole operation system is a heterogeneous system, the detection flow is not simple enough, and high requirements are provided for the operation process of experimental staff, so that errors are easy to generate.

Example 3: biotin modified HrtR proteins

The Biotin (Sulfo-NHS-Biotin, available from Bio-technology; product number: NO. C100213) powder was stored at-20℃and equilibrated to room temperature prior to opening, otherwise Biotin was prone to water failure, affecting subsequent experiments. The protein solution should be free of amine buffer, and it is necessary to replace Tris-HCl buffer (50 mM Tris-HCl,50mM KCl,pH =8.0) with PBS buffer (10 mM Na ₂HPO₄, 137mM NaCl,2.7mM KCl,1.76mM KH2PO4,pH 7.4), and the protein solution may be eluted by replacing the buffer with PBS buffer at pH 7.4 by dialysis bags or by replacing the Tris-HCl buffer with PBS buffer during purification of the protein. A10 mM biotin reagent solution was prepared, 2.2mg of biotin powder was weighed out, and 500. Mu.L of ultrapure water was added for dissolution, and the reagent had to be prepared immediately before use. Add 20 times molar ratio of biotin reagent label, 500. Mu.L solution with protein concentration of 2.27mg/mL, add 50. Mu.L 10mM biotin reagent solution, mix well. The reaction is carried out on ice for 2 hours or at room temperature for 30 minutes, and the reaction is usually carried out on ice for 2 hours so as not to affect the activity of the protein. After completion of the biotin-labeled protein, the protein activity can be detected by ELISA assay. It was determined that biotin modification had no effect on protein activity, and that desalting column was used to remove reaction by-products from the solution, as well as excess biotin. The desalting column is balanced by PBS buffer solution, 550 mu L of reaction solution is complemented to 2.5mL by the PBS buffer solution and is uniformly mixed, the desalting column is loaded with 2.5mL, the PBS buffer solution is eluted, 2mL of eluent is collected, and the protein concentration is measured by the BCA protein quantitative kit. The protein concentration was diluted to 200. Mu.g/mL with PBS and glycerol was added to a final concentration of 10% and stored at-80 ℃.

Example 4: protein immobilization to 96 microwell plate

The range of detecting compounds by using a 96-well plate is related to the protein amount coated by the well plate, the protein concentration for fixing is too small to meet the detection requirement, and the cost is increased due to the too large protein concentration, so that the proper bio-HrtR protein concentration needs to be determined firstly and is effectively fixed on the well plate. The bio-HrtR protein was diluted to 5. Mu.g/mL, 10. Mu.g/mL, 20. Mu.g/mL and 40. Mu.g/mL concentrations, 100. Mu.L each was added to streptavidin pre-coated 96-well plates and incubated for 1h at room temperature with a horizontal shaker set at 300rpm. After incubation, the non-immobilized bio-HrtR was washed out with PBST buffer, dsDNA was added for incubation to form protein nucleic acid complexes, heme standards were added for 10min, and supernatants were added to 384 well plates, respectively, for fluorescent signal measurement.

As a result, as shown in FIG. 6, when the concentration of immobilized protein was higher than 10. Mu.g/mL, there was no increase in fluorescence signal, indicating that the amount of protein added to 10. Mu.g/mL was sufficient to saturate streptavidin on 96-well plates.

Conventional ELISA experiments are typically washed 3-5 times to minimize interference of residual antigen/antibody with the detection system. The number of times the plate was washed with PBST was changed under the condition that the protein concentration of 10. Mu.g/mL was determined as above, and the plate was washed 3, 4, 5,6 times with PBST, respectively, by the effect of fluorescence signal intensity on the number of times of washing.

The results are shown in FIG. 7, where there was no significant difference in fluorescence between the blank when washed 3 times and more than 3 times. Thus, washing 3 times can completely wash the well plate with excess unbound dsDNA.

Some inert macromolecules such as BSA, gelatin and defatted protein are added to the detection system of the common microplate to reduce the background interference caused by non-specificity. Whether the inert molecule seals the pore plate or not is determined by whether the background is interfered or not according to the characteristics of experimental materials. A set of non-immobilized HrtR protein plates was set as controls, incubated with dsDNA alone, and the plates were tested for dsDNA adsorption, and after the remaining plates were protein immobilized HrtR, washed 3 times and blocked with 200. Mu.L of 1% BSA for 1h.

As a result, FIG. 8 shows that the well plate has little adsorption to dsDNA and no increase in fluorescence signal is detected, so that the step of closing the well plate is not required, which greatly simplifies the experimental procedure and saves more time.

Example 5: specificity of detecting heme by E-CaT-SMelor system

The concentration of the protein fixed on the pore plate is determined, the specificity of the detection method is verified through experiments, and a heme analogue standard substance and a heme standard substance are added into the 96 pore plate. The heme analog is coproporphyrin I/III, protoporphyrin IX and Fe-coproporphyrin. The coproporphyrin I/III and protoporphyrin IX standard were dissolved in DMSO to prepare a 1mM stock solution, and the Fe-coproporphyrin was dissolved in 0.1M sodium hydroxide. To the microwell plate, 2. Mu.M heme structural analog concentration and 0.2. Mu.M heme standard solution were added, respectively.

As a result, as shown in FIG. 9, the fluorescence signal of the heme structural analog was hardly increased, and only the fluorescence signal of the sample containing the heme standard was increased, which indicates that E-CaT-SMelor can specifically respond to heme and not to the heme structural analog, and the detection specificity was good.

Example 6: E-CaT-SMelor system for detecting heme range

The specific process is as follows: 5mM heme stock solution was prepared in DMSO and stored at-20℃in the dark. In use, the solution is diluted into different concentrations of heme with PBS buffer. After the biotin-modified protein is fixed on a 96-micro-well plate, the liquid in the plate is sucked and dried as much as possible, and heme solutions with different concentrations are added and incubated on a horizontal shaker for 10min. 40 mu L of the premixed Cas12a cutting system is taken out of a 384-well plate, 10 mu L to 384-well plate is taken out by a row gun, and the mixture is uniformly mixed. The temperature of the enzyme label instrument is set to be 37 ℃, the excitation wavelength and the emission wavelength are 480nm and 520nm respectively, recording is carried out every 30sec, and the detection time is 30min.

TABLE 2 cleavage System composition

As a result, as shown in FIG. 10, E-Cat-SMelor detected heme, which was as low as 7nM, was sensitively detected, and as the concentration of heme increased, the fluorescence signal increased and increased linearly over 30 minutes. The slope of the fluorescent signal is linear with the concentration of heme, which is between 10nM and 200nM (R ² > 0.99), allowing detection of nanomolar (nM) levels of heme.

Example 7: parallelism of E-Cat-SMelor System

To test the reproducibility of E-Cat-SMelor, experiments were performed by performing a reproducibility experiment on three different concentrations of heme standards, 6 wells per concentration were tested and coefficient of variation (CV%) was calculated. The results are shown in Table 3, and the coefficient of variation measured for the samples in the panels was measured to be 5.15% -5.9%. To test the reproducibility of the test between different batches, three well plates were selected for the detection of heme standards, the experimental results are shown in table 4 with an inter-plate coefficient of variation (CV%) of 4.15% -6.55%. The range of coefficient of variation (CV%) in and between plates is less than 10%, indicating that the E-CaT-SMelor detection system has good reproducibility.

TABLE 3 in-plate repeatability

TABLE 4 in-plate repeatability

Example 8: hrtR ^Lc variant H149S detection of E-Cat-SMelor System

Through modifying a heme sensing module, molecular docking is carried out on a heme key binding site of HrtR ^Lc protein, H149 is mutated into serine, and a concentration range of chloroheme responded by the H149S protein is larger, because the H149S mutant forms a looser hydrophobic pocket compared with the wild type HrtR ^Lc protein, and the binding with heme is facilitated. The experimental procedure was identical to HrtR ^Ll protein.

As shown in FIG. 11, the H149S protein changed the detection range of heme and the level of hemin was measured at micromolar level. Thus, fine tuning of the detection range of E-CaT-Smelor can be achieved by altering the binding affinity between small molecules and allosteric transcription factors.

[ Reference ]

[1]IGARASHI K,WATANABE-MATSUI M.Wearing red for signaling:the heme-bach axis in heme metabolism,oxidative stress response and iron immunology[J].Tohoku J Exp Med,2014,232(4):229-53.

[2]WATANABE-MATSUI M,MUTO A,MATSUI T,et al.Heme regulates B-celldifferentiation,antibody class switch,and heme oxygenase-1 expression in B cells as aligand of Bach2[J].Blood,2011,117(20):5438-48.

[3]SHEN J,SHENG X,CHANG Z,et al.Iron metabolism regulates p53 signaling throughdirect heme-p53 interaction and modulation of p53 localization,stability,and function[J].

Cell Rep,2014,7(1):180-93.

[4]SENITZKI A,SAFIEH J,SHARMA V,et al.The complex architecture of p53 binding sites

[J].Nucleic Acids Res,2021,49(3):1364-82.

[5]LAL S,COMER J M,KONDURI P C,et al.Heme promotes transcriptional anddemethylase activities of Gis1,a member of the histone demethylase JMJD2/KDM4 family

[J].Nucleic Acids Res,2018,46(1):215-28.

[6]PELLICER S,GONZALEZ A,PELEATO M L,et al.Site-directed mutagenesis andspectral studies suggest a putative role of FurA from Anabaena sp.PCC 7120 as a hemesensor protein[J].FEBS J,2012,279(12):2231-46.

[7]RUDOLPH G,SEMINI G,HAUSER F,et al.The Iron control element,acting in positiveand negative control of iron-regulated Bradyrhizobium japonicum genes,is a target for theIrr protein[J].J Bacteriol,2006,188(2):733-44.

[8]SINGLETON C,WHITE G F,TODD J D,et al.Heme-responsive DNA binding by theglobal iron regulator Irr from Rhizobium leguminosarum[J].J Biol Chem,2010,285(21):16023-31.

[9]YIN L,DRAGNEA V,BAUER C E.PpsR,a regulator of heme and bacteriochlorophyllbiosynthesis,is a heme-sensing protein[J].J Biol Chem,2012,287(17):13850-8.

[10]HITOMIM Y,HIROSHI SUGIMOTO§2,YOSHITSUGU SHIRO§,ANDSHIGETOSHI/>Structural Basis for the Transcriptional Regulation of HemeHomeostasis in Lactococcus lactis[J].THE JOURNAL OF BIOLOGICAL CHEMISTRY,

2012,287(36):30755–68.

[11]DELPHINE LECHARDEUR B C,LIEBL,U,ALEXANDRA GRUSS,et al.Discoveryof Intracellular Heme-binding Protein HrtR,Which Controls Heme Efflux by theConserved HrtB-HrtA Transporter in Lactococcus lactis.[J].THE JOURNAL OFBIOLOGICAL CHEMISTRY 2012,287(7):4752–8.

Claims

1. A heme detection system, the heme detection system comprising:

A sensing module comprising an immobilized heme-specific sex-conformation transcription factor and double-stranded DNA having a sequence capable of being recognized by the heme-specific sex-conformation transcription factor; and

A signal output module comprising a CRISPR/Cas system and a single-stranded DNA probe, wherein the CRISPR/Cas system is capable of recognizing and binding the double-stranded DNA and has trans-cleaving activity.

2. The system of claim 1, wherein the heme-specific sex-conformation transcription factor is immobilized by direct or indirect non-covalent or covalent binding; preferably, the heme-specific sex-conformation transcription factor is non-covalently immobilized by a biotin-biotin binding protein.

3. The system of claim 1 or 2, wherein the heme-specific sex-conformation transcription factor is immobilized on a solid matrix; preferably, the solid substrate is a porous plate; preferably, the solid substrate is an orifice plate made of polyethylene/polystyrene.

4. An immobilized heme-specific sex-configured transcription factor and CRISPR/Cas mediated heme detection method, the method comprising:

immobilizing heme-specific sex-construct transcription factors;

binding the immobilized heme-specific sex-conformation transcription factor to double-stranded DNA having a sequence capable of being recognized by the heme-specific sex-conformation transcription factor;

Contacting a sample comprising heme with said immobilized heme-specific sex-conformation transcription factor such that said double-stranded DNA is released;

and activating a detection system comprising a CRISPR/Cas system capable of recognizing and binding the double-stranded DNA and a single-stranded DNA probe using the released double-stranded DNA, measuring a signal generated by cleavage of the single-stranded DNA probe by the CRISPR/Cas system, thereby detecting heme,

5. A device for heme detection comprising a solid matrix immobilized with a heme-specific sex-conformation transcription factor bound to double-stranded DNA, wherein the double-stranded DNA has a sequence capable of being recognized by the heme-specific sex-conformation transcription factor.

6. The device of claim 5, wherein the device for heme detection further comprises a unit for a signal output module to provide the signal output module to the solid substrate; preferably, the unit for the signal output module has a container that separately contains the CRISPR/Cas system and single stranded DNA probes.

7. The device of claim 5 or 6, wherein the heme-specific sex-conformation transcription factor is bound directly or indirectly via non-covalent or covalent binding to the solid matrix; preferably, the heme-specific sex-conformational transcription factor is non-covalently bound to the solid matrix by a biotin-biotin binding protein.

8. The device of claim 5 or 6, wherein the solid substrate is a multi-well plate; preferably, the solid substrate is an orifice plate made of polyethylene/polystyrene.

9. A kit for detecting heme, the kit comprising an orifice plate immobilized with a heme-specific sex-conformation transcription factor, the orifice plate made of polyethylene/polystyrene, the heme-specific sex-conformation transcription factor being bound to double-stranded DNA, wherein the double-stranded DNA has a sequence capable of being recognized by the heme-specific sex-conformation transcription factor; a container comprising a CRISPR/Cas system and a single stranded DNA probe; and instructions for performing the heme test.