CN118086400A

CN118086400A - Nucleic acid molecule, recombinant baculovirus comprising same and application thereof

Info

Publication number: CN118086400A
Application number: CN202410459550.3A
Authority: CN
Inventors: 张胜; 申未然; 杨兴林; 杨佳丽; 李琴; 师瑞瑾; 高花; 许佳; 潘讴东
Original assignee: Obio Technology (shanghai) Corp ltd
Current assignee: Obio Technology (shanghai) Corp ltd
Priority date: 2024-04-17
Filing date: 2024-04-17
Publication date: 2024-05-28
Anticipated expiration: 2044-04-17
Also published as: CN118086400B

Abstract

The application belongs to the field of biological medicine, and in particular relates to a nucleic acid molecule, a recombinant baculovirus containing the same and application thereof. The nucleic acid molecule comprises: nucleic acid fragment 1, nucleic acid fragment 2 and an exogenous gene expression cassette for expressing an exogenous fragment located between the nucleic acid fragment 1 and the nucleic acid fragment 2; the complementary fragments of the nucleic acid fragment 1 and the nucleic acid fragment 2 are tail-to-tail gene pairs; the nucleic acid fragment 1 and the nucleic acid fragment 2 are connected with a non-coding region, the 5 'end of the non-coding region is taa, the 3' end of the non-coding region is tta, and the exogenous fragment is inserted between the taa and tta. The application discovers new insertion sites of exogenous fragments on baculovirus genome, and inserts exogenous fragments at the insertion sites, thereby not affecting baculovirus replication and stable passage and providing new selection for effective insertion in BEV genome in baculovirus expression system.

Description

Nucleic acid molecule, recombinant baculovirus comprising same and application thereof

Technical Field

The application belongs to the field of biological medicine, and in particular relates to a technology for modifying a viral vector, and particularly relates to a nucleic acid molecule, a recombinant baculovirus containing the nucleic acid molecule and application of the recombinant baculovirus.

Background

The insect cell expression system (i.e., recombinant baculovirus expression system) is a eukaryotic expression system that can express exogenous genes from a variety of species including fungi, bacteria, viruses and plants in insect cells. The insect cell expression system has the advantages of high recombinant protein expression, comprehensive protein post-translational modification, suitability for large-scale production, low production cost and the like, and has been widely used for the expression of various recombinant proteins, drug development, the production of commercial biological products such as drugs, vaccines and the like.

In the traditional recombinant baculovirus expression system, bac-to-Bac system is widely adopted, and the earliest developer of the system, luckow et al, selects a replication non-essential gene polyhedrin gene (Polyhedron, polh) locus of baculovirus as a recombination locus of Tn7 transposon, and exogenous gene is selected to be inserted into the locus, so that a very high expression level can be obtained (Luckow et al, 1993, J.Virol.67 (8): 4566-4579). It has been reported that BEV in insect baculovirus expression systems produces defective interfering viruses that lose part of the gene during passage, and that defective interfering viruses gradually take up a proportional advantage during passage, resulting in a decrease in exogenous gene expression (Pijlman et al, J Gen Virol,2003, 84:2041-2049). The instability factors of the foreign gene in the BEV genome include instability of the foreign gene itself, insertion of DNA fragments, site of insertion, and selectivity of different cellular environments for defective viruses (WILLEMSEN et al, virus Evol,2019,5 (2): vez 045). It has been reported that the BEV obtained when the Tn7 transposon in the Bac to Bac system is replaced from the original polh site to the new insertion site odv-e56 gene locus is capable of highly expressing the foreign gene, and it is particularly notable that the BEV has significantly enhanced stability in serial passages (Pijlman et al, J GenVirol,2003, 84:2669-78). In addition, studies have shown that the traditional shuttle plasmid-based baculovirus system, in which the Rep gene, cap gene and ITR core expression elements are contained simultaneously on the shuttle plasmid, has poor stability, and the highly integrated recombinant baculovirus BEV can only be stably passaged for 4 passages, and the yield of rAAV produced by BEV after the 5 th passage is significantly reduced (refer to Yang et al, 2018,Mol Ther Methods Clin Dev.2018Jul 4;10:38-47.).

In view of the above background, there is still a need to screen for effective insertion sites in new BEV genomes in order to achieve long-term stable passage of inserted foreign genes.

Disclosure of Invention

Based thereon, one or more embodiments of the application provide a nucleic acid molecule, recombinant baculovirus comprising the same and uses thereof. The technical proposal comprises:

one or more embodiments of the present application provide a nucleic acid molecule comprising: nucleic acid fragment 1, nucleic acid fragment 2 and an exogenous gene expression cassette for expressing an exogenous fragment located between the nucleic acid fragment 1 and the nucleic acid fragment 2;

The complementary fragments of the nucleic acid fragment 1 and the nucleic acid fragment 2 are tail-to-tail gene pairs;

the nucleic acid fragment 1 and the nucleic acid fragment 2 are connected with a non-coding region, the 5 'end of the non-coding region is taa, the 3' end of the non-coding region is tta, and the exogenous fragment is inserted between the taa and tta.

In some embodiments of the application, the sequence of the non-coding region is taatta, and the exogenous fragment is inserted between taa and tta.

In some embodiments of the application, the sequence of the non-coding region is 7bp to 200bp in length.

In some embodiments of the application, the tail-to-tail gene pair is from a baculovirus.

In some embodiments of the application, the tail-to-tail gene pair is from any one of the following baculoviruses:

Leptospira virens nuclear polyhedrosis virus, silkworm nuclear polyhedrosis virus, picea armyworm polynuclear capsid nuclear polyhedrosis virus, gypsy moth polynuclear capsid nuclear polyhedrosis virus, beet armyworm polynuclear capsid nuclear polyhedrosis virus, cotton bollworm nuclear polyhedrosis virus and prodenia litura nuclear polyhedrosis virus.

In some embodiments of the application, the tail-to-tail gene pair is from a noctuid california nuclear polyhedrosis virus.

In some embodiments of the application, the tail-to-tail gene pairs are all baculovirus conserved genes.

In some embodiments of the application, the exogenous fragment comprises one or more of a selectable marker gene and a gene of interest.

In some embodiments of the application, the target gene comprises an AAV packaging essential element comprising one or more of Cap gene, rep gene, and ITR gene;

in some embodiments of the application, a GOI is inserted between the left ITR fragment and the right ITR fragment of the ITR gene.

In some embodiments of the application, the exogenous gene expression cassette includes a promoter that regulates the selectable marker gene including a baculovirus very early promoter.

In some embodiments of the application, the exogenous gene expression cassette includes a promoter that regulates the gene of interest including a P10 promoter or a PH promoter.

In some embodiments of the application, the selectable marker gene comprises one or more of a luciferase gene, a neomycin resistance gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene.

In some embodiments of the application, the selectable marker gene is a luciferase gene.

In some embodiments of the application, the gene of interest encodes one or more of an antibody, a polypeptide, an enzyme, a hormone, a growth factor, and a receptor.

In some embodiments of the application, the tail-to-tail gene pair comprises any one of the following gene pairs:

The gene pair 1 is the lef4 gene and the orf91 gene, and the corresponding insertion sites are marked as OB1 sites;

The gene pair 2 is p15 gene and cg30 gene, and the corresponding insertion site is marked as OB2 site; and

The gene pair 3 is env-prot gene and pkip gene, and the corresponding insertion site is marked as OB3 site. In some embodiments of the application, the sequence of the non-coding region comprises the sequence shown as SEQ ID NO. 1.

In some embodiments of the application, the sequence of the nucleic acid molecule is shown as 2779bp to 4912bp in SEQ ID NO.44, 2779bp to 11984bp in SEQ ID NO.46, 2779bp to 8988bp in SEQ ID NO.47, 2903bp to 8875bp in SEQ ID NO.48, 2861bp to 8881bp in SEQ ID NO.49, 749bp to 4910bp in SEQ ID NO.50, 749bp to 4776bp in SEQ ID NO.52, or 2903bp to 6930bp in SEQ ID NO. 53.

One or more embodiments of the present application also provide a recombinant plasmid comprising the nucleic acid molecule.

In some embodiments of the application, the recombinant plasmid comprises a shuttle plasmid.

In some embodiments of the application, the recombinant plasmid is as shown in SEQ ID NO.15、SEQ ID NO.44、SEQ ID NO.46、SEQ ID NO.47、SEQ ID NO.48、SEQ ID NO.49、SEQ ID NO.50、SEQ ID NO.52 or SEQ ID NO. 53.

One or more embodiments of the application also provide a recombinant baculovirus whose genome comprises the nucleic acid molecule.

In some embodiments of the application, the recombinant baculovirus comprises a california solani nuclear polyhedrosis virus, a silkworm nuclear polyhedrosis virus, a picea armyworm polynuclear capsid nuclear polyhedrosis virus, a gypsy moth polynuclear capsid nuclear polyhedrosis virus, a asparagus caterpillar nuclear polyhedrosis virus, or a prodenia litura nuclear polyhedrosis virus.

In some embodiments of the application, the genome is deleted for one or more of the Chia gene and the cat gene.

In some embodiments of the application, other loci of the genome of the recombinant baculovirus are inserted with exogenous fragments as defined above.

In some embodiments of the application, the selectable marker gene is inserted at any one of the OB1 site, the OB2 site, and the OB3 site.

One or more embodiments of the present application also provide a construction method of the recombinant baculovirus, the construction method comprising the steps of:

homologous recombination of the donor plasmid and baculovirus genome to construct a recombinant baculovirus;

the donor plasmid comprises the nucleic acid molecule.

In some embodiments of the application, the recombinases employed for homologous recombination include RED recombinase, bxb1 integrase, Φc31 integrase, cre recombinase or FLP recombinase.

In some embodiments of the application, the donor plasmid comprises a shuttle plasmid.

In some embodiments of the application, the donor plasmid is as shown in SEQ ID NO.15、SEQ ID NO.44、SEQ ID NO.46、SEQ ID NO.47、SEQ ID NO.48、SEQ ID NO.49、SEQ ID NO.50、SEQ ID NO.52 or SEQ ID NO. 53.

One or more embodiments of the present application also provide an adeno-associated virus packaging vector system comprising AAV packaging-essential elements including one or more of Cap gene, rep gene, and ITR gene; the AAV packaging essential elements are located in the same or different of the nucleic acid molecules.

One or more embodiments of the present application also provide a method for producing an expression product of an exogenous fragment, the method comprising the steps of:

after the host cells are infected with the recombinant baculovirus, culturing is carried out, and the expression product of the exogenous fragment is isolated from the obtained culture product.

In some embodiments of the application, the host cell comprises an insect cell line.

In some embodiments of the application, the insect cell line comprises a lepidopteran insect cell line.

In some embodiments of the application, the lepidopteran insect cell line comprises a spodoptera frugiperda cell line, a silkworm cell line, or a spodoptera frugiperda cell line.

In some embodiments of the application, the lepidopteran insect cell line comprises an ovarian tissue cell line or an adipose cell line.

In some embodiments of the application, the production method further comprises the step of detecting the titer of the resulting recombinant baculovirus.

In some embodiments of the application, the titer of the resulting recombinant baculovirus is measured using a standard curve method comprising the steps of:

providing a standard curve reflecting a linear relationship between the luciferase activity value and the viral titer value; and

Detecting an activity value of luciferase expressed by the luciferin gene in the recombinant baculovirus to be detected, substituting the activity value into the standard curve, and calculating a virus titer value of the recombinant baculovirus to be detected;

wherein, the activity value of the luciferase=the luminous intensity value generated by the catalysis of recombinant baculovirus expressed luciferase-the luminous intensity value of the virus-free reference substance.

One or more embodiments of the present application also provide a method for producing a recombinant adeno-associated virus or GOI expression product, which employs the adeno-associated virus packaging vector system.

Compared with the prior art, the application has the following beneficial effects:

The application discovers new insertion sites of exogenous fragments on baculovirus genome, and inserts exogenous fragments at the insertion sites, thereby not affecting baculovirus replication and stable passage and providing new selection for effective insertion in BEV genome in baculovirus expression system.

Drawings

In order to more clearly illustrate the technical solution in the embodiments of the present application and to more fully understand the present application and its advantageous effects, the following brief description will be given with reference to the accompanying drawings, which are required to be used in the description of the embodiments. It is evident that the figures in the following description are only some embodiments of the application, from which other figures can be obtained without inventive effort for a person skilled in the art.

FIG. 1 is a schematic diagram of a recombinant baculovirus genome in an embodiment of the application; wherein: the left side is a schematic diagram of AcMNPV recombinant bacmid genome, and the baculovirus AcMNPV genome is double-stranded circular DNA with the total length of 133,894bp;

FIG. 2 is an electrophoretogram of the PCR-identified products of pKD46/DH10Bac competent cells of example 1;

FIG. 3 is a PCR identification electrophoretogram of the ΔCC-DH10Bac competent cells of example 1;

FIG. 4 is a PCR identification electrophoretogram of pKD 46/DeltaCC-DH 10Bac competent cells of example 1;

FIG. 5 is a schematic diagram of the genome of R0329{ rBEV-GLuc (OB 1) -8KC-EGFP (Tn 7) } constructed in example 1;

FIG. 6 is a schematic diagram of the genome of R0330{ rBEV-8KC-EGFP (OB 1) } constructed in example 2;

FIG. 7 is a schematic diagram of the genome of R0331{ rBEV-8KC (OB 1) -EGFP (Tn 7) } constructed in example 4;

FIG. 8 is a schematic diagram of the genome of R0332{ rBEV-8KC (OB 1) } constructed in example 5;

FIG. 9 is a schematic diagram of the genome of R0004{ rBEV-EGFP (Tn 7) } constructed in example 6;

FIG. 10 is a schematic diagram of the genome of R0333{ rBEV-8KC (OB 2) } constructed in example 7;

FIG. 11 is a schematic diagram of the genome of R0334{ rBEV-8KC (OB 2) -EGFP (Tn 7) } constructed in example 8;

FIG. 12 is a schematic view of the genome of R0335{ rBEV-8KC (OB 3) } constructed in example 9;

FIG. 13 is a schematic diagram of the genome of R0336{ rBEV-ITR-EGFP (OB 3) } constructed in example 10;

FIG. 14 is a schematic diagram of the genome of R0337{ rBEV-8KC (OB 1) -ITR-EGFP (OB 3) } constructed in example 11;

FIG. 15 is a photograph of each generation of fluorescence of R0330{ rBEV-8KC-EGFP (OB 1) }, R0336{ rBEV-ITR-EGFP (OB 3) } and R0337{ rBEV-8KC (OB 1) -ITR-EGFP (OB 2) } in example 2, example 10, and P7 at a fixed start density and a fixed MOI;

Fig. 16 is a correlation analysis of recombinant baculovirus luciferase activity-titer in example 13, with R ² = 0.9845, according to a standard curve formed by log of titer of standard substance and RLU value;

FIG. 17 shows the results of the contamination of the purified end product virus of each recombinant baculovirus system pattern of example 14, lane 1 is the R0329-AAV8-EGFP of example 1, lane 2 is the R0330-AAV8-EGFP of example 2, lane 3 is the R0331-AAV8-EGFP of example 4, lane 5 is the R0334-AAV8-EGFP of example 8, lane 6 is the R0335-AAV8-EGFP of example 9, lane 6 is the R0336-AAV8-EGFP of example 10, the titer of the end product virus purified from the initial mixture of the recombinant adeno-associated virus R0336-AAV8-EGFP of example 10 is low, and only light shadows can be seen for VP1 and VP 2;

FIG. 18 shows the results of the transfection of each purified finished virus in example 3, lane 1 is R0338-AAV9-EGFP, lane 2 is R0339-AAV5-EGFP, lane 3 is R0340-AAV2-EGFP, and the titer of the finished virus purified from the initial mix of R0338-AAV9-EGFP is low and VP1/VP2 is not apparent.

Detailed Description

The present application will be described in further detail with reference to the drawings, embodiments and examples. It should be understood that these embodiments and examples are provided solely for the purpose of illustrating the application and are not intended to limit the scope of the application in order that the present disclosure may be more thorough and complete. It will also be appreciated that the present application may be embodied in many different forms and is not limited to the embodiments and examples described herein, but may be modified or altered by persons skilled in the art without departing from the spirit of the application, and equivalents thereof are also intended to fall within the scope of the application. Furthermore, in the following description, numerous specific details are set forth in order to provide a more thorough understanding of the application, it being understood that the application may be practiced without one or more of these details.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the description of the application is for the purpose of describing the embodiments and examples only and is not intended to be limiting of the application.

Terminology

Unless otherwise indicated or contradicted, terms or phrases used herein have the following meanings:

The term "and/or," "and/or," as used herein, includes any one of two or more of the listed items in relation to each other, as well as any and all combinations of the listed items in relation to each other, including any two of the listed items in relation to each other, any more of the listed items in relation to each other, or all combinations of the listed items in relation to each other. It should be noted that, when at least three items are connected by a combination of at least two conjunctions selected from the group consisting of "and/or", "and/or", it should be understood that, in the present application, the technical solutions include technical solutions that all use "logical and" connection, and also include technical solutions that all use "logical or" connection. For example, "a and/or B" includes three parallel schemes A, B and a+b. For another example, the technical schemes of "a, and/or B, and/or C, and/or D" include any one of A, B, C, D (i.e., the technical schemes of all "logical or" connections), also include any and all combinations of A, B, C, D, i.e., the combinations of any two or three of A, B, C, D, and also include four combinations of A, B, C, D (i.e., the technical schemes of all "logical and" connections).

The terms "plurality", "plural", "multiple", and the like in the present application refer to, unless otherwise specified, an index of 2 or more in number. For example, "one or more" means one kind or two or more kinds.

As used herein, "a combination thereof," "any combination thereof," and the like include all suitable combinations of any two or more of the listed items.

The "suitable" in the "suitable combination manner", "suitable manner", "any suitable manner" and the like herein refers to the fact that the technical scheme of the present application can be implemented, the technical problem of the present application is solved, and the technical effect expected by the present application is achieved.

Herein, "preferred", "better", "preferred" are merely to describe better embodiments or examples, and it should be understood that they do not limit the scope of the application.

In the present application, "further", "still further", "particularly" and the like are used for descriptive purposes to indicate differences in content but should not be construed as limiting the scope of the application.

In the present application, "optional" means optional or not, that is, means any one selected from two parallel schemes of "with" or "without". If multiple "alternatives" occur in a technical solution, if no particular description exists and there is no contradiction or mutual constraint, then each "alternative" is independent.

In the present application, the terms "first", "second", "third", "fourth", etc. are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or quantity, nor as implying an importance or quantity of a technical feature being indicated. Moreover, the terms "first," "second," "third," "fourth," and the like are used for non-exhaustive list description purposes only, and are not to be construed as limiting the number of closed forms.

In the application, the technical characteristics described in an open mode comprise a closed technical scheme composed of the listed characteristics and also comprise an open technical scheme comprising the listed characteristics.

In the present application, a numerical range (i.e., a numerical range) is referred to, and optional numerical distributions are considered to be continuous within the numerical range and include two numerical endpoints (i.e., a minimum value and a maximum value) of the numerical range and each numerical value between the two numerical endpoints unless otherwise specified. Unless otherwise indicated, when a numerical range merely refers to integers within the numerical range, both end integers of the numerical range are included, as well as each integer between the two ends, herein, each integer is recited directly, such as t is an integer selected from 1-10, and t is any integer selected from the group of integers consisting of 1,2, 3, 4, 5, 6, 7, 8, 9, and 10. Further, when a plurality of range description features or characteristics are provided, these ranges may be combined. In other words, unless otherwise indicated, the ranges disclosed herein are to be understood to include any and all subranges subsumed therein.

The temperature parameter in the present application is not particularly limited, and may be a constant temperature treatment or may vary within a predetermined temperature range. It should be appreciated that the constant temperature process described allows the temperature to fluctuate within the accuracy of the instrument control. Allows for fluctuations within a range such as + -5 ℃, + -4 ℃, + -3 ℃, + -2 ℃, + -1 ℃.

In the present application,% (w/w) and wt% each represent weight percent,% (v/v) represents volume percent, and% (w/v) represents mass volume percent.

All documents mentioned in this disclosure are incorporated by reference in this disclosure as if each were individually incorporated by reference. Unless otherwise indicated to the contrary by the intent and/or technical scheme of the present application, all references to which this application pertains are incorporated by reference in their entirety for all purposes. When reference is made to a cited document in the present application, the definitions of the relevant technical features, terms, nouns, phrases, etc. in the cited document are also incorporated. In the case of the cited documents, examples and preferred modes of the cited relevant technical features are also incorporated into the present application by reference, but are not limited to being able to implement the present application. It should be understood that when a reference is made to the description of the application in conflict with the description, the application is modified in light of or adaptive to the description of the application.

The locus (locus) is also known as locus. The locus of the gene on the chromosome. At the molecular level, is a DNA fragment with genetic effects. A locus may be a gene, a portion of a gene, or a DNA fragment with some regulatory effect. The locus differs from the site (site), which is a mutation site within the cistron, which can be as small as a nucleotide pair.

Infection titer refers to: concentration of viral particles that can transduce the cells. The infectious titer is usually quantified by a cell transduction assay. Studies have shown that the ratio of rAAV physical to infectious titer is about 50:1 (Zeltner et al, 2010).

TCID50, half the dose of tissue culture infection, also known as 50% of the tissue cell infection, refers to the amount of virus required to cause half of the cytopathy or death (cytopathic effect, CPE) in a culture plate well or test tube, and is used to characterize the titer of the virus.

Tail-to-tail gene pair refers to two adjacent genes located on each strand of DNA within a genomic region and transcribed in opposite directions.

Gene expression cassette (Gene Expression Box) is a biological concept that contains the DNA sequences required for gene expression for a particular purpose. This box generally comprises the following four parts: (1) promoter: the coding region of the protein responsible for the initiation of gene transcription. (2) codon optimized coding sequence: information directing the synthesis of proteins. (3) terminator: a region where transcription of the gene ends. (4) possible regulatory sequences: other regulatory elements for regulating the intensity of gene expression.

GOI is an abbreviation for Gene of Interest, a Gene of Interest.

First aspect of embodiments of the application

A nucleic acid molecule, the nucleic acid molecule comprising: nucleic acid fragment 1, nucleic acid fragment 2 and an exogenous gene expression cassette for expressing an exogenous fragment located between the nucleic acid fragment 1 and the nucleic acid fragment 2;

In some embodiments, the sequence of the non-coding region is taatta. In other embodiments, the sequence of the non-coding region is 7bp to 200bp in length, e.g 7、8、9、10、15、20、25、30、35、40、45、50、55、60、65、70、75、80、85、90、95、100、105、110、115、120、125、130、135、140、145、150、155、160、165、170、185、190、195、200bp.

The insertion of exogenous fragments into the nucleic acid molecule at the sites described with reference to the examples of the application does not affect baculovirus replication and passage stability and enables higher compatibility, for example: for the inserted recombinant competent cells with AAV expression frames, the recombinant baculovirus packaged by the AAV can be obtained by only carrying out reconstruction construction of a target gene by a shuttle plasmid of traditional Tn7 recombination and carrying out Tn7 recombination to obtain recombinant bacmid and transfecting host cells.

In some embodiments, the tail-to-tail gene pair is from a baculovirus. The baculoviruses include, but are not limited to: leptospira virens nuclear polyhedrosis virus, silkworm nuclear polyhedrosis virus, picea armyworm polynuclear capsid nuclear polyhedrosis virus, gypsy moth polynuclear capsid nuclear polyhedrosis virus, beet armyworm polynuclear capsid nuclear polyhedrosis virus, cotton bollworm nuclear polyhedrosis virus and prodenia litura nuclear polyhedrosis virus. The following examples illustrate the technical scheme of the present application by taking tail-to-tail gene pairs from the noctiluca californica nuclear polyhedrosis virus as examples, and it should be understood that the present application is not limited thereto.

In some embodiments, the exogenous fragment comprises one or more of a selectable marker gene and a target gene. The application is not particularly limited in the type of target gene, including but not limited to AAV packaging essential elements. The AAV packaging essential elements comprise one or more of Cap genes, rep genes and ITR genes. The application is not particularly limited to the serotypes of AAV packaged by the AAV packaging essential elements, such as 13 AAV of different serotypes (i.e., AAV1-AAV 13) and related recombinant AVVs in a primate (e.g., rAAV2/1、rAAV2/2、rAAV2/3、rAAV2/3、rAAV2/4、rAAV2/5、rAAV2/6、rAAV2/7、rAAV2/8、rAAV2/9、rAAV2-retro、AAV-PHP.eB、AAV-PHP.S、AAV-PAN、AAV-LUNG、AAV-DJ、AAV-7m8、AAV-ShH10Y、AAV-Rh10、AAV-Anc80L65、AAV-SCH9）.. Alternatively, the gene sequence of the Cap gene is a Cap8 sequence codon optimized according to a ribosome leakage scan, further alternatively, a sequence as shown in SEQ ID No. 2. It is to be understood that the sequence of the Cap gene is not limited to the Cap8 sequence, for example, the sequence of Cap9 contained in SEQ ID No.54, the sequence of Cap5 contained in SEQ ID No.55, the sequence of Cap2 contained in SEQ ID No. 56. Alternatively, the gene sequence of the Cap gene is a Rep2 sequence codon optimized according to a ribosome leakage scan, further alternatively, a sequence as shown in SEQ ID No. 3. It is to be understood that the sequence of the Rep gene is not limited to the Rep2 sequence, alternatively, the ITR gene has the sequences as shown in SEQ ID No.4 and ITR 5 (ITR).

In some embodiments, the ITR gene has a GOI inserted between the left ITR fragment (L-ITR) and the right ITR fragment (R-ITR). The application is not particularly limited in the type of GOI and may be any gene of interest to those skilled in the art, including but not limited to genes encoding biologically active proteins (e.g., EGFP gene as shown in SEQ ID No. 6).

It will be appreciated that to achieve expression of the selectable marker gene and/or gene of interest in the exogenous fragment, the exogenous fragment should contain the complete expression cassette for the selectable marker gene and/or gene of interest. In some embodiments, the exogenous gene expression cassette includes a promoter in the expression cassette that regulates the selectable marker gene, including a baculovirus very early promoter, facilitating rapid visual infection titer detection of recombinant baculovirus containing the nucleic acid molecule. In some embodiments, the exogenous gene expression cassette includes a promoter in the expression cassette that regulates the gene of interest including a P10 promoter or a PH promoter, e.g., an AAV packaging essential element downstream of and under the control of the promoter.

The selectable marker gene of the present application is not particularly limited and includes, but is not limited to, a luciferase gene, a neomycin resistance gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, and a tryptophan synthetase gene. The following examples illustrate the technical scheme of the present application by taking luciferase gene as an example, and it should be understood that the present application is not limited thereto.

The target gene is not particularly limited in the present application, and includes, but is not limited to: genes encoding one or more of antibodies, polypeptides, enzymes, hormones, growth factors, and protein receptors.

It will be appreciated that for the purpose of achieving homologous recombination, the nucleic acid molecule may contain a homology arm recognized by a recombinase, such as RED recombinase, bxb1 integrase, ΦC31 integrase, cre recombinase or FLP recombinase, the sequence of which homology arm is, for example: loxP sequence, loxPL sequence, loxP 2L sequence, loxFas sequence, lox511 sequence, lox2272 sequence, lox2372 sequence, lox5171 sequence, loxm sequence, lox71 sequence, lox66 sequence, FRT sequence, bxb1 attP sequence, bxb1 attB sequence, attP sequence, attB, attL and attR sequence.

In some embodiments, the tail-to-tail gene pair comprises any one of the following gene pairs:

The gene pair 3 is env-prot gene and pkip gene, and the corresponding insertion site is marked as OB3 site.

In some embodiments, the sequence of the non-coding region comprises a sequence as set forth in SEQ ID No. 1.

Taking AcMNPV genome as an example: the lef4 gene and the orf91 gene are tail-to-tail gene pairs, which have reverse overlapping stop codons ttaa, and after ttaa is changed into taatta to form reverse connecting stop codons, exogenous fragments are inserted at the position between taa and tta (namely between 77990bp and 77991bp and corresponding to OB1 locus); the p15 gene and the cg30 gene are tail-to-tail gene pairs, a non-coding region with a sequence taatta exists between the two genes, and the non-coding region is a stop codon reversely connected with the two genes, and an exogenous fragment is directly inserted into a position between taa and tta (namely, between 74736bp and 74737bp and corresponding to an OB2 site); a non-coding region with the length of 48bp shown in SEQ ID NO.1 exists between the env-prot gene and the pkip gene, an exogenous fragment can be inserted into any site of the non-coding region with the length of 48bp, or the exogenous fragment can be directly inserted between the env-prot gene and the pkip gene by knocking out the non-coding region with the length of 48 bp.

In some embodiments, the sequence of the nucleic acid molecule is shown as 2779bp to 4912bp in SEQ ID NO.44, 2779bp to 11984bp in SEQ ID NO.46, 2779bp to 8988bp in SEQ ID NO.47, 2903bp to 8875bp in SEQ ID NO.48, 2861bp to 8881bp in SEQ ID NO.49, 749bp to 4910bp in SEQ ID NO.50, 749bp to 4776bp in SEQ ID NO.52, or 2903bp to 6930bp in SEQ ID NO. 53.

Second aspect of embodiments of the application

A recombinant plasmid comprising said nucleic acid molecule.

In some embodiments, the recombinant plasmid comprises a shuttle plasmid. Further, the recombinant plasmid is shown as SEQ ID NO.15、SEQ ID NO.44、SEQ ID NO.46、SEQ ID NO.47、SEQ ID NO.48、SEQ ID NO.49、SEQ ID NO.50、SEQ ID NO.52 or SEQ ID NO. 53.

Third aspect of embodiments of the application

A recombinant baculovirus, the genome of which comprises said nucleic acid molecule.

The recombinant baculovirus of the present application is not particularly limited, and includes, but is not limited to, a california solani nuclear polyhedrosis virus, a silkworm nuclear polyhedrosis virus, a picea maritima polynuclear capsid nuclear polyhedrosis virus, a gypsy polynuclear capsid nuclear polyhedrosis virus, a beet armyworm nuclear polyhedrosis virus, or a prodenia litura nuclear polyhedrosis virus. The following examples illustrate the technical aspects of the present application using the nuclear polyhedrosis virus from Spodoptera frugiperda as an example, and it should be understood that the present application is not limited thereto. Recombinant Baculovirus (BEV) has the following major advantages as an exogenous gene expression vector: the baculovirus genome is relatively small and easy to operate, and can accommodate large exogenous gene fragments, high safety and the like. Currently, the most widely used recombinant Baculovirus (BEV) is modified based on the alfalfa silver vein moth nuclear polyhedrosis virus (AcMNPV) genome, which is double-stranded circular DNA, with the length of 133,894bp, and the sequence and the map of which are referenced in GenBank: NC_001623.

In some embodiments, the genome of the recombinant baculovirus is deleted for one or more of the Chia gene and the Cath gene. The Chia and V-Cath genes are nonessential genes for baculovirus replication, the chiA and V-Cath coding genes in the baculovirus genome are removed, the secretion efficiency of recombinant proteins and the stability of intracellular proteins can be improved, and any proteins can be expressed in an over-level manner, including secretory proteins, cell membrane proteins or proteins which are particularly easy to degrade.

In some embodiments, other loci of the genome of the recombinant baculovirus are inserted with exogenous fragments as defined above.

The recombinant baculovirus provided by the application has the advantage that any one of the OB1 site, the OB2 site and the OB3 site is inserted into the exogenous fragment.

In some embodiments, in the recombinant baculovirus, the OB1 site is inserted into the exogenous fragment. The exogenous fragment may include both the selectable marker gene and the target gene, and the target gene may include AAV packaging-essential elements including the Cap gene, rep gene, and ITR gene, e.g., as described in example 2. The foreign fragment may include only the target gene, and the target gene may include an AAV packaging essential element including the Cap gene, rep gene, and ITR gene, for example, as described in example 4.

In some embodiments, the recombinant baculovirus, the OB2 site is inserted into the exogenous fragment, the exogenous fragment may include only the target gene, the target gene may include an AAV packaging essential element, and the AAV packaging essential element includes the Cap gene, rep gene, and ITR gene, for example, as described in the technical scheme of example 6.

In some embodiments, the OB3 site is inserted into the exogenous fragment in the recombinant baculovirus. The exogenous fragment may include only the selectable marker gene, for example, as described in example 9.

According to the recombinant baculovirus provided by the application, part of the exogenous fragment is inserted into any one of the OB1 site, the OB2 site and the OB3 site, and the part of the exogenous fragment is inserted into other loci; alternatively, the other loci include the polh gene (exemplified by male-parent bacmid bMON14272, which may be inserted at the attTn7 transposition site of the polh gene, designated as the Tn7 site).

In some embodiments, the exogenous fragment comprises a selectable marker gene inserted at the OB1 site and a target gene inserted at the Tn7 site, the target gene comprising an AAV packaging essential element. Optionally, a GOI (e.g., EGFP gene) is inserted between the left ITR fragment and the right ITR fragment of the ITR gene in the AAV packaging essential element, e.g., as described in example 1.

In some embodiments, a portion of the AAV packaging essential elements are inserted at any of the OB1 site, the OB2 site, and the OB3 site, and the remaining portion of the essential elements are inserted at other loci. Optionally, a GOI (e.g., EGFP gene) is inserted between the left and right ITR fragments of the ITR gene in the AAV packaging essential element. In one embodiment, the ITR gene is inserted at the other locus and the Cap gene and Rep gene are inserted at the OB1 locus, such as in the protocol described in example 3. In another embodiment, the Cap gene and the Rep gene are inserted at the OB2 locus and the ITR gene is inserted at the other locus, for example, as described in example 7. In yet another embodiment, the Cap gene and the Rep gene are inserted at the OB3 locus and the ITR gene is inserted at the other locus, for example, as described in example 8.

The recombinant baculovirus provided by the application has a foreign fragment inserted into a plurality of (e.g. 2 or 3) of the OB1 site, the OB2 site and the OB3 site. Among the essential elements of AAV packaging, the Cap gene, the Rep gene and the ITR gene are inserted into 3 sites, respectively (there is no correspondence with the sites), or two of them are inserted into one of the three sites, and the remaining one is inserted into one of the remaining sites. For example, the embodiment described in example 10.

In some of these embodiments, the selectable marker gene is inserted at any one of the OB1 site, the OB2 site, and the OB3 site. Insertion of a selectable marker gene at the OB1, OB2 or OB3 locus can be used to rapidly visualize the infectious titer of BEV.

Fourth aspect of embodiments of the application

A method of constructing the recombinant baculovirus, the method comprising the steps of:

the donor plasmid comprises the nucleic acid molecule.

Fifth aspect of embodiments of the application

An adeno-associated virus packaging vector system comprising AAV packaging essential elements comprising one or more of Cap gene, rep gene, and ITR gene; the AAV packaging essential elements are located in the same or different of the nucleic acid molecules.

In some of these embodiments, the ITR gene has a GOI inserted between the left and right ITR fragments. The application is not particularly limited in the type of GOI and may be any gene of interest to those skilled in the art, including but not limited to genes encoding biologically active proteins (e.g., EGFP gene as shown in SEQ ID No. 6).

Sixth aspect of embodiments of the application

A method for producing an expression product of an exogenous fragment, the method comprising the steps of:

In an embodiment of the application, the host cell comprises an insect cell line. Such insect cell lines include, but are not limited to, lepidopteran insect cell lines. The lepidopteran insect cell line includes, but is not limited to, a spodoptera frugiperda cell line, a silkworm cell line, or a spodoptera frugiperda cell line. The lepidopteran insect cell line includes, but is not limited to, an ovarian tissue cell line or an adipose cell line. Insect cell lines which are used more widely are the spodoptera frugiperda ovarian cell line (Sf 21), sf9 cells cloned from Sf21 cells and H5 (high five) cell lines.

In some of these embodiments, the method of production further comprises the step of detecting the titer of the resulting recombinant baculovirus.

In some of these embodiments, the titer of the resulting recombinant baculovirus is measured using a standard curve method comprising the steps of:

Seventh aspect of embodiments of the application

Embodiments of the present application will be described in detail below with reference to examples. It is to be understood that these examples are illustrative of the present application and are not intended to limit the scope of the present application. The experimental methods in the following examples, in which specific conditions are not noted, are preferably referred to the guidelines given in the present application, and may be according to the experimental manual or conventional conditions in the art, the conditions suggested by the manufacturer, or the experimental methods known in the art.

In the specific examples described below, the measurement parameters relating to the raw material components, unless otherwise specified, may have fine deviations within the accuracy of weighing. Temperature and time parameters are involved, allowing acceptable deviations from instrument testing accuracy or operational accuracy.

Referring to FIG. 1, the application selects a plurality of baculovirus conserved locus sites for testing by analyzing the genome sequence of baculovirus AcMNPV (Autographa californica nuclear polyhedrosis virus), and finally designs 3 sites preferably: the OB1 locus is a reverse overlapping stop codon ttaa of 77987-77990 bp between Ac-lef-4 and the C terminal of Ac-orf-91, and after ttaa is changed to taatta to form a reverse connecting stop codon, the reverse overlapping stop codon is positioned at the connecting point of the reverse connecting stop codon of 77990 bp; the OB2 locus is a reverse connection termination codon connection point which is positioned at 74736bp between the conserved gene locus Ac-p15 and the C terminal of Ac-cg 30; the OB3 locus is a 48bp non-coding region (SEQ ID NO. 1) located between the conserved gene locus Ac-env-prot and the C terminal end of Ac-pkip at 20586-20633 bp.

Example 1 obtaining recombinant baculovirus expressing reporter genes Luciferase and Tn7 recombinant 8KC-EGFP at OB1 insertion site, R0329{ rBEV-GLuc (OB 1) -8KC-EGFP (Tn 7) }

1 Construction of the baculovirus vector of the Gluc expression cassette Gluc (OB 1) - ΔCC-DH10Bac

1.1 Preparation of pKD 46/. DELTA.CC-DH 10Bac competent cells

(1) Preparation of pKD46/DH10Bac competent cells

The pKD46 plasmid is a temperature sensitive low copy plasmid, and the expression of 3 proteins, namely Exo, beta and Gam (Red recombinase) can be induced by adding arabinose to the culture medium of cells transfected with the pKD46 plasmid at 30 ℃, so that the exogenous gene carrying a homology arm can be subjected to efficient specific recombination with the bacmid genome in bacteria (refer to Doublet et al, 2008,J Microbiol Methods, 75 (2): 359-61).

The application converts pKD46 into DH10Bac competent cells, cultures the competent cells at 30 ℃ in the whole process, screens and identifies the competent cells, adds 100mM L-arabinose (final concentration) at OD600 of 0.2 to induce for 2 hours, and prepares the competent cells of pKD46/DH10 Bac.

Bet gene identification primer of pKD 46: the sequence of Bet-F is 5'-atgagtactgcactcgcaa-3' (SEQ ID NO. 20), and the sequence of Bet-R is 5'-tgctctgcggctttctgtt-3' (SEQ ID NO. 21); amplified fragment size: 768bp; detecting 768bp amplified fragments, and judging positive bacteria;

The araC gene identification primer of pKD 46: the sequence of araC-F is 5'-ttatgacaacttgacggctaca-3' (SEQ ID NO. 22) and the sequence of araC-R is 5'-atggctgaagcgcaaaatga-3' (SEQ ID NO. 23); amplified fragment size: 879bp; if 879bp amplified fragment is detected, the positive bacteria are judged.

PCR identification of pKD46/DH10Bac competent cells the electrophoretogram is shown in FIG. 2. In fig. 2: marker is 2000bp, lanes 1, 2, 3 and 4 are identification primer PCR product loading electrophoresis bands of Bet genes of pKD46 with small shake numbers of 1-4 of the selected bacteria, the size of a target band is 768bp, and detection bacteria are positive bacteria; lanes 5, 6, 7 and 8 are identification primer PCR product loading electrophoresis bands of araC gene of pKD46 of the small shake number 1-4 of the selected bacteria, the target band size is 879bp, and the detected bacteria are positive bacteria. Wherein the picking small shake number 3 is a target positive strain with the pKD46/DH10Bac meeting the identification requirement.

(2) Preparation of delta CC-DH10Bac competent cells

The application knocks out the Chia and V-Cath genes of the baculovirus (the Chia and V-Cath genes are nonessential genes for replication of the baculovirus, the chiA and V-Cath coding genes in the baculovirus genome are removed, the secretion efficiency of recombinant proteins and the stability of intracellular proteins can be improved, and any proteins can be expressed in an over-level manner, including secreted proteins, cell membrane proteins or proteins which are particularly easy to degrade):

Extracting AcMNPV genome stem granule bMON14272 from DH10Bac competent cell megaly, and designing primer HAL (lef 7) -F (SEQ ID NO. 24) by taking AcMNPV genome stem granule bMON14272 as a template: 5'-gggtgtacaggtaacggccaatt-3' and HAL (lef 7) -R (SEQ ID No. 25): 5'-TCCCCCCGGGaagcaatatattgagtatcaTTTTAG-3', amplified fragment HAL (lef 7) (420 bp) (sequence shown as SEQ ID NO. 7); primers HAR (GP 64) -F (SEQ ID No. 26) were designed using AcMNPV genome bacmid bMON14272 as template: 5'-ACATGcatgctctcaacacactcgctatttgga-3' and HAR (GP 64) -R (SEQ ID No. 27): 5'-AGCTTTGTTTAAACtggagaacaccaagtttg-3', amplified fragment HAR (GP 64) (430 bp) (sequence shown as SEQ ID NO. 8);

To facilitate selection of recombinants, a chloramphenicol (Chloromycetin, cmR) resistance gene with Frt fragments on both sides was introduced, and primer Nhe I-F (SEQ ID NO. 28) was designed: 5'-ctaGCTAGCgtgtaggctggag-3' and HindIII-R (SEQ ID NO. 29): 5'-cccAAGCTTatgggaattagccatg-3' the fragment P1-FRT-CmR-P2 (1053 bp) was amplified from the pKD3 plasmid (SEQ ID NO. 9).

HAL (lef 7) (420 bp), HAR (GP 64) (430 bp) and P1-FRT-CmR-P2 (1053 bp) are cloned on a vector plasmid pQB1064 to obtain pQB1064-HAL (lef 7) -P1-FRT-CmR-P2-HAR (GP 64), the plasmid pQB1064-HAL (lef 7) -P1-FRT-CmR-P2-HAR (GP 64) is linearized, the DNA fragment HAL (lef 7) -P1-FRT-CmR-P2-HAR (GP 64) is recovered, the plasmid pCD 46/DH10Bac is transformed with the DNA fragment (small picked fungus number 3 in step (1)), the plasmid C is subjected to the knock-out of Chia and V-Cath genes of baculovirus, the plasmid C is subjected to the plasmid C-resistance (anti-chloramphenicol) plate screening to obtain the monoclonal plasmid D46/CmR-DeltaCC-DH 10Bac, the plasmid pCCC is prepared by culturing the plasmid, and the plasmid pCCC is subjected to the plasmid pCCC-20-CmCC-DH 10 c-CmCC-20 is prepared, and the plasmid pCCC-20 is subjected to the plasmid transformation is selected to the plasmid transformation.

Identification primer of DeltaCC-DH 10 Bac:

identification primer of Bet gene of pKD 46: bet-F (SEQ ID NO. 20): 5'-atgagtactgcactcgcaa-3' and Bet-R (SEQ ID NO. 21): 5'-tgctctgcggctttctgtt-3'; amplified fragment size: 768bp; detecting 768bp amplified fragments, and determining the amplified fragments as negative strains;

homologous arm recombination successfully identifies the primer: pCAT-HAL (lef 7) -F (SEQ ID NO. 30): 5'-cgatcaactttctcgccaac-3' and pCAT-HAR (gp 64) -R (SEQ ID No. 31): 5'-gactcgtcgcaatgcata-3'; amplified fragment size: 1347bp; detecting 1347bp amplified fragment, and determining the amplified fragment as a positive strain; primer FLP-F (SEQ ID NO. 32) of pCP20 plasmid: 5'-CCCTTGCGCTAAAGAAGT-3' and FLP-R (SEQ ID NO. 33): 5'-GAGAGCCACATTCATGAG-3'; amplified fragment size: 551bp; detecting 551bp amplified fragment, and then obtaining a negative strain;

Identification primer of CmR sequence: pCAT-Chl-F (SEQ ID NO. 34): 5'-tgatcggcacgtaagaggtt-3' and pCAT-Chl-R (SEQ ID NO. 35): 5'-actggtgaaactcaccca-3'; amplified fragment size: 568bp; the amplified fragment was detected as a negative strain.

PCR identification electrophoresis pattern of DeltaCC-DH 10Bac is shown in FIG. 3. In the diagram A in FIG. 3, marker is 2000bp, lanes 1, 2, 3, 4 and 5 are identification primer PCR product loading electrophoresis bands of Bet proteins of pKD46 with small shake numbers of 1-5 of selected bacteria, and the size of target bands is 768bp, and the bacteria are negative; lanes 6, 7, 8, 9 and 10 are identification primers pCAT-HAL (lef 7) -F and pCAT-HAL (gp 64) -R for successful recombination of homologous arms of the small shaking numbers 1-5 of the selected bacteria, and PCR products of the identification primers are loaded into electrophoresis bands, the size of the target band is 1347bp, and the positive bacteria are obtained; lanes 11, 12, 13, 14 and 15 are identification primer PCR product sample application electrophoresis bands of pCP20 plasmids with small shake numbers of 1-5 of the selected bacteria, and the size of the target bands is 551bp, and the bacteria are negative bacteria; in the diagram B in FIG. 3, marker is 2000bp, lanes 1, 2, 3, 4 and 5 are identification primer PCR product sample electrophoresis bands of CmR fragments with the small shaking numbers 1-5 of the picking bacteria, and the target band size is 568bp, and the negative bacteria. Wherein the small shake numbers 3 and 4 of the choosen bacteria are target positive strains with delta CC-DH10Bac meeting the identification requirements.

(3) Preparation of pKD 46/DeltaCC-DH 10Bac competent cells

The pKD46 plasmid was transformed into ΔCC-DH10Bac competent cells, cultured at 30℃in the whole procedure, and subjected to selection assay, and after 100mM of L-arabinose was added at OD600 of 0.2 to induce for 2 hours, the L-arabinose-induced electrotransformation competent cells of pKD46/ΔCC-DH10Bac were prepared. Identification primer of pKD 46/DeltaCC-DH 10 Bac:

The Bet gene Bet-F of pKD46 (SEQ ID NO. 20): 5'-atgagtactgcactcgcaa-3' and Bet-R (SEQ ID NO. 21): 5'-tgctctgcggctttctgtt-3'; amplified fragment size: 768bp; if the amplified fragment is detected, judging that the amplified fragment is positive bacteria;

Successful identification of homologous arm recombination primer pCAT-HAL (lef 7) -F (SEQ ID NO. 30): 5'-cgatcaactttctcgccaac-3' and pCAT-HAR (gp 64) -R (SEQ ID No. 31): 5'-gactcgtcgcaatgcata-3'; amplified fragment size: 1347bp; when the amplified fragment is detected, it is determined as a positive bacterium.

The PCR identification electrophoresis pattern of pKD 46/. DELTA.CC-DH 10Bac is shown in FIG. 4. In the A diagram of FIG. 4, lanes Marker are 2000bp and 10000bp respectively, lanes 1, 2, 3 and 4 are identification primer PCR product loading electrophoresis bands of Bet genes of pKD46 with small shake numbers 1-4 of selected bacteria, the size of a target band is 768bp, and the positive bacteria are detected; in the diagram B of FIG. 4, marker is 2000bp, lanes 1, 2, 3 and 4 are homologous arm recombination successful identification primers pCAT-HAL (lef 7) -F and pCAT-HAL (gp 64) -R identification primers PCR product sample electrophoresis bands, the target band size is 1347bp, and the positive bacteria are selected from the small shake numbers 1-4; wherein, the picking bacteria with small shake numbers 1 and 2 are target positive strains with pKD 46/delta CC-DH10Bac meeting the identification requirements.

1.2 Preparation of CmR-GLuc (OB 1) - ΔCC-DH10Bac competent cells

Primers HAL (lef 4) -F (SEQ ID NO. 36) were also designed using AcMNPV genome bacmid bMON14272 as template: 5'-ccaATGCATtcatacgctatagatccg-3' and HAL (lef 4) -R (SEQ ID No. 37): 5'-tccCCCGGGttaatttggcacgattcg-3', amplified fragment HAL (lef 4) (420 bp) (sequence shown as SEQ ID NO. 10); primers HAR (ORF 91) -F (SEQ ID No. 38) were designed using AcMNPV genome bacmid bMON14272 as template: 5'-acatGCATGCttaaagcacgttaagcg-3' and HAR (ORF 91) -R (SEQ ID No. 39): 5'-agctttGTTTAAACtccaccttctcctat-3', amplified fragment HAR (ORF 91) (344 bp) (sequence shown as SEQ ID NO. 11);

In the embodiment, a baculovirus early and late ETL promoter is selected for regulating and controlling a Luciferase reporter gene, and an expression frame of the SV40PA element is ETL-Luciferase-SV40pA (the sequence is shown as SEQ ID NO. 12), and because the ETL belongs to the early to late promoter, the expression of the Luciferase can be started at an early time after the BEV infects host cells. The sequence pETL-GLuc-Dura-SV40pA was synthesized by the assigned Biotechnology company.

HAL (lef 4) (420 bp), HAR (ORF 91) (344 bp), P1-FRT-CmR-P2 (1053 bp) and synthetic fragment pETL-GLuc-Dura-SV40pA were cloned on vector plasmid pQB1064 to obtain pQB1064-HAL (lef 4) -P1-FRT-CmR-P2-pETL-GLuc-Dura-SV40pA-HAR (ORF 91) plasmid (SEQ ID NO.44, vector sequence of SEQ ID NO.44 will define the actual sequence and position of the OB1 site GLuc (OB 1)) by molecular cloning recombination of restriction sites. After linearizing pQB1064-HAL (lef 4) -P1-FRT-CmR-P2-HAR (ORF 91) plasmid, recovering the gel to obtain DNA fragment HAL (lef 4) -P1-FRT-CmR-P2-pETL-GLuc-Dura-SV40Pa-HAR (ORF 91), transforming the DNA fragment into L-arabinose-induced electrotransformation competence of pKD 46/DeltaCC-DH 10Bac (pKD 46/DeltaCC-DH 10Bac of Zaojun small shake number 1), screening and identifying to obtain single clone bacterial liquid of pKD46/CmR-GLuc (OB 1) -DeltaCC-DH 10Bac, culturing and eliminating the pKD46 plasmid at 42 ℃, and preparing CmR-GLuc (OB 1) -DeltaCC-DH 10Bac competence by resistance plate screening.

Experiments show that after the pCP20 plasmid is transformed and subjected to the competence with a chloramphenicol expression frame after two knockouts, all target fragments inserted by knockouts are identified to be lost, because FRT targets on one side are left after the RED recombination is used for knockouts, two FRT targets are left after the two knockouts, the complementation in the same direction is formed, and large fragment knockouts are formed, so that the chloramphenicol resistance expression frame left by the knockouts is reserved.

2 Recombinant baculovirus R0329{ rBEV-GLuc (OB 1) -8KC-EGFP (Tn 7) } was obtained by Tn7 recombination

The application discloses a packaging element expression cassette (sequence shown as SEQ ID NO. 13) of AAV8-EGFP composed of Cap8 (sequence shown as SEQ ID NO. 2), rep2 (sequence shown as SEQ ID NO. 3) and ITR-EGFP (sequence shown as SEQ ID NO. 6), the actual sequence and position of Tn7 locus 8KC-EGFP (Tn 7) are defined by constructing a carrier sequence of a cloning vector pFastBac1-AAV8-SV40pA-Rep2←Polh..P10→Cap8-HSV-TKpA-ITR-CMV-EGFP-WPRE-hGHpA-ITR（SEQ ID NO.45,SEQ ID NO.45 for obtaining the co-expression of packaging elements of adeno-associated virus AAV8, then CmR-GLuc (OB 1) -DeltaCC-DH 10Bac competent cells prepared by the step 1.2 of converting PfastBac1-AAV8-SV40pA-Rep 2?Polh. Large shaking extraction recombinant BacmidDNA, transfecting Bacmid DNA into a host cell line for culturing, obtaining recombinant baculovirus R0329{ rBEV-GLuc (OB 1) -8KC-EGFP (Tn 7) } #P0 after 4 days of culture, transferring into suspension Sf9 cells for culturing for 3 days, further infecting a large amount of replication and proliferation recombinant baculovirus to cause Sf9 cells to obtain seed viruses with higher titer, centrifuging partially packaged cell suspension at 3000rpm for 5min, subpackaging and preserving supernatant, namely the harvested recombinant baculovirus R0329{ rBEV-GLuc (OB 1) -8KC-EGFP (Tn 7) } #P1, and collecting the residual packaged cell suspension for purifying recombinant adeno-associated virus R0329-AAV8-EGFP, wherein the virus is used for testing as shown in a lane 1 of FIG. 17.

A schematic of the genome of R0329{ rBEV-GLuc (OB 1) -8KC-EGFP (Tn 7) } is shown in FIG. 5.

Example 2 recombinant baculovirus obtained with the packaging element expression cassette of AAV8-EGFP loaded at the OB1 insertion site, R0330{ rBEV-8KC-EGFP (OB 1) }

1 Preparation of CmR-8KC-EGFP (OB 1) -DeltaCC-DH 10Bac competent cells

The cloning vector pFastBac1-AAV8-SV40pA-Rep2 ≡Polh P10- & gtCap 8-HSV-TKpA-ITR-CMV-EGFP-WPRE-hGHpA-ITR (SEQ ID NO. 45) obtained by constructing the packaging element co-expression of adeno-associated virus AAV8 in example 1 was used for restriction enzyme digestion and gel recovery to obtain the linearized DNA fragment of the packaging element expression cassette of AAV8-EGFP (sequence shown as SEQ ID NO. 13), the cloning of the DNA fragment of HAL (lef 4) (420 bp), HAR (ORF 91) (344 bp), P1-FRT-CmR-P2 (1053 bp) and the packaging element expression cassette of AAV8-EGFP (sequence shown as SEQ ID NO. 13) was performed on vector plasmid pQB1064 to obtain pQB-1064 (lef 4) -P1-FRT-CmR-P2-8-EGFP (ORF 91) and the actual position of the plasmid EGFP 1-EGFP (KCID NO. 46) was defined by the molecular cloning recombination of restriction enzyme cleavage sites. After linearizing pQB1064-HAL (lef 4) -P1-FRT-CmR-P2-8KC-EGFP-HAR (ORF 91) plasmid, recovering the gel to obtain DNA fragment HAL (lef 4) -P1-FRT-CmR-P2-8KC-EGFP-HAR (ORF 91), transforming the DNA fragment into L-arabinose induced electrotransformation competence of pKD 46/DeltaCC-DH 10Bac, screening and identifying to obtain monoclonal bacterial solution of pKD46/CmR-8KC-EGFP (OB 1) -DeltaCC-DH 10Bac, culturing at 42 ℃ to eliminate pKD46 plasmid, and screening by resistance plate to prepare CmR-8KC-EGFP (OB 1) -DeltaCC-DH 10Bac competence.

2 Transfection of host cells by the extraction of bacmid to obtain recombinant baculovirus R0330{ rBEV-8KC-EGFP (OB 1) }

Large shaking CmR-8KC-EGFP (OB 1) -delta CC-DH10Bac competent cells, extracting recombinant Bacmid DNA, transfecting the Bacmid DNA into a host cell line for culturing, obtaining recombinant baculovirus R0330{ rBEV-8KC-EGFP (OB 1) } #P0 after culturing for 4 days, transferring into suspension Sf9 cells for culturing for 3 days, further infecting a large amount of recombinant baculovirus which replicates and proliferates to lead Sf9 cells to obtain seed viruses with higher titer, centrifuging part of the packed cell suspension by using 3000rpm for 5min, subpackaging and preserving the supernatant, namely the harvested recombinant baculovirus R0330{ rBEV-8KC-EGFP (OB 1) } #P1, and purifying recombinant adeno-associated virus R0330-AAV8-EGFP after the residual packed cell suspension is attenuated. A schematic of the genome of R0330{ rBEV-8KC-EGFP (OB 1) } is shown in FIG. 6. A cytofluorescence photograph of R0330{ rBEV-8KC-EGFP (OB 1) } #p1 expanded to P7 at the fixed priming density and the priming MOI is shown in fig. 15; as shown in the figure, the expression of EGFP fluorescence of the target gene inserted into the OB1 site is stable continuously in the generation P7.

Example 3 obtaining recombinant baculoviruses with the OB1 insertion site loaded with the packaging element expression cassettes of AAV9-EGFP, AAV5-EGFP and AAV2-EGFP, respectively, R0338{ rBEV-9KC-EGFP (OB 1) }, R0339{ rBEV-5KC-EGFP (OB 1) }, and R0340{ rBEV-2KC-EGFP (OB 1) }

1 Preparation of CmR-9KC-EGFP (OB 1) - ΔCC-DH10Bac, cmR-5KC-EGFP (OB 1) - ΔCC-DH10Bac and CmR-2KC-EGFP (OB 1) - ΔCC-DH10Bac competent cells

The synthetic sequences p10-Cap9-PA (SEQ ID NO. 54), p10-Cap5-PA (SEQ ID NO. 55) and p10-Cap2-PA (SEQ ID NO. 56) were fed separately.

A pQB1064-HAL (lef 4) -P1-FRT-CmR-P2-8KC-EGFP-HAR (ORF 91) plasmid (SEQ ID NO. 46) was constructed using example 1. The Cap8 sequence marked in the sequence of SEQ ID NO.46 is replaced by Cap9, cap5 and Cap2 through the enzyme cutting sites at two ends of each sequence of P10-Cap9-PA (SEQ ID NO. 54), P10-Cap5-PA (SEQ ID NO. 55) and P10-Cap2-PA (SEQ ID NO. 56), so as to obtain pQB1064-HAL (lef 4) -P1-FRT-CmR-P2-9KC-EGFP-HAR (ORF 91) plasmid, pQB1064-HAL (lef 4) -P1-FRT-CmR-P2-5KC-EGFP-HAR (ORF 91) plasmid and pQB1064-HAL (lef 4) -P1-FRT-CmR-P2-2KC-EGFP-HAR (ORF 91) plasmid. After linearizing the above plasmids respectively, the DNA fragments HAL (lef 4) -P1-FRT-CmR-P2-9KC-EGFP-HAR (ORF 91), HAL (lef 4) -P1-FRT-CmR-P2-5KC-EGFP-HAR (ORF 91) and HAL (lef 4) -P1-FRT-CmR-P2-2KC-EGFP-HAR (ORF 91) were recovered, and the L-arabinose-induced electrotransduction competence of the above DNA fragments was selected and identified to obtain single-clone bacterial solutions of pKD46/CmR-9KC-EGFP (ORF 91), pKD46/CmR-5KC-EGFP (OB 1) - ΔCC-DH10Bac and pKD46/CmR-2 EGFP (OB 1) - ΔCC-DH10Bac, and the plasmid-EGFP 46/CmR-2 EGFP-DH 10Bac were deleted at 42℃and subjected to the PCR- ΔCmR 1- ΔCC-2-CmR-1-CmR-QC (KC 1) - ΔCC-CmR-dC 10Bac, respectively.

2 Transfection of host cells by separate extraction of bacmid, recombinant baculoviruses R0338{ rBEV-9KC-EGFP (OB 1) }, R0339{ rBEV-5KC-EGFP (OB 1) }, and R0340{ rBEV-2KC-EGFP (OB 1) } were obtained

Large shaking CmR-9KC-EGFP (OB 1) -DeltaCC-DH 10Bac, cmR-5KC-EGFP (OB 1) -DeltaCC-DH 10Bac and CmR-2KC-EGFP (OB 1) -DeltaCC-DH 10Bac competent cells, respectively extracting recombinant Bacmid DNA, respectively transfecting the Bacmid DNA into host cell line culture, culturing for 4 days to obtain recombinant baculovirus R0338{ rBEV-9KC-EGFP (OB 1) } #P0, R0339{ rBEV-5KC-EGFP (OB 1) } #P0 and R0340{ rBEV-2KC-EGFP (OB 1) } #0, respectively transferring into suspension Sf9 cells, further infecting a large amount of the recombinant baculovirus to obtain seed viruses with higher titer, using 3000rpm and 5min to partially package cell suspensions, and subpackaging the supernatant to obtain the recombinant baculovirus R0338{ rBEV-FP (OB 1) } { 37-9 KCP (OB 1) } #0 and R0340{ rBEV-2KC-EGFP (OB 1) } #0, respectively transfecting AAV#40 { 40{ 4-KC 1) } 4-7 and carrying out the AAV 032 (OB 1) } 1-4 to obtain the recombinant baculovirus with the recombinant baculovirus. The genomic schematic of R0338, R0339 and R0340 is the same as R0330, as shown in FIG. 6.

Example 4 obtaining recombinant baculovirus with OB1 insertion site loaded with the packaging element expression cassette of AAV8 and Tn7 recombinant ITR-EGFP, R0331{ rBEV-8KC (OB 1) -EGFP (Tn 7) }

1 Preparation of CmR-8KC (OB 1) -DeltaCC-DH 10Bac competent cells

Cloning vector pFastBac1-AAV8-SV40pA-Rep2 ≡Polh.P10→Cap8-HSV-TKpA-ITR-CMV-EGFP-WPRE-hGHpA-ITR (SEQ ID NO. 45) obtained by constructing the packaging element co-expression of adeno-associated virus AAV8 in example 1, restriction enzyme digestion and gel recovery to obtain the DNA fragment of the packaging element expression cassette of AAV8 (sequence shown as SEQ ID NO. 14), cloning HAL (lef 4) (420 bp), HAR (ORF 91) (344 bp), P1-FRT-CmR-P2 (1053 bp) and the packaging element expression cassette of AAV8 (sequence shown as SEQ ID NO. 14) on vector plasmid pQB1064 to obtain pQB1064-HAL (lef 4) -P1-FRT-CmR-P2-8-HAR (ORF 91) (SEQ ID NO. 47) by molecular cloning recombination at restriction enzyme cleavage site and the actual position of the plasmid KC 1 (SEQ ID NO. 47). After linearizing pQB1064-HAL (lef 4) -P1-FRT-CmR-P2-8KC-HAR (ORF 91) plasmid, recovering the gel to obtain DNA fragment HAL (lef 4) -P1-FRT-CmR-P2-8KC-HAR (ORF 91), converting the DNA fragment into L-arabinose induction electrotransformation competence of pKD 46/DeltaCC-DH 10Bac, screening and identifying to obtain monoclonal bacterial solution of pKD46/CmR-8KC (OB 1) -DeltaCC-DH 10Bac, culturing at 42 ℃ to eliminate pKD46 plasmid, and preparing CmR-8KC (OB 1) -DeltaCC-DH 10Bac competence by resistance plate screening.

2 Recombinant baculovirus R0331{ rBEV-8KC (OB 1) -EGFP (Tn 7) } was obtained by Tn7 recombination

A cloning vector pFastBac1-AAV8-SV40pA-Rep2≡Polh P10- & gtCap 8-HSV-TKpA-ITR-CMV-EGFP-WPRE-hGHpA-ITR (SEQ ID NO. 45) obtained by constructing in example 1 is utilized to carry out enzyme digestion and glue recovery to obtain a linearization DNA fragment of a packaging element expression cassette (the sequence of which is shown in SEQ ID NO. 6) of ITR-EGFP, a cloning vector pFastBac1-ITR-CMV-EGFP-WPRE-hGHpA-ITR (the sequence of which is shown in SEQ ID NO. 15) is constructed, the actual sequence and position of a Tn7 locus EGFP (Tn 7) are defined by the vector sequence of SEQ ID NO.15, and CmCC-DH 10Bac competent cells are transformed by using pFastBac 1-ITR-EGFP-WPRE-hGHpA-ITR plasmids, screening recombinant clone through blue and white, extracting recombinant Bacmid DNA by shaking, transfecting the Bacmid DNA into a host cell line, culturing for 4 days to obtain recombinant baculovirus R0331{ rBEV-8KC (OB 1) -EGFP (Tn 7) } #P0, transferring into suspension Sf9 cells, culturing for 3 days, further infecting a large amount of replicated and proliferated recombinant baculovirus to lead the Sf9 cells to obtain higher titer seed viruses, centrifuging partially packed cell suspension by using 3000rm5min, subpackaging and preserving supernatant to obtain the harvested recombinant baculovirus R0331{ rBEV-8KC (OB 1) -EGFP (Tn 7) } #P1, and collecting residual packed cell suspension for purifying recombinant adeno-associated virus R0331-AAV8-EGFP.

A schematic of the genome of R0331{ rBEV-8KC (OB 1) -EGFP (Tn 7) } is shown in FIG. 7.

Example 5 obtaining recombinant baculovirus with the OB1 insertion site loaded with the packaging element expression cassette of AAV8, R0332{ rBEV-8KC (OB 1) }

The CmR-8KC (OB 1) -DeltaCC-DH 10Bac competent cells were constructed by using example 4, the CmR-8KC (OB 1) -DeltaCC-DH 10Bac competent cells were subjected to large shaking to extract recombinant Bacmid DNA, the Bacmid DNA was transfected into a host cell line for culturing, recombinant baculovirus R0332{ rBEV-8KC (OB 1) } #P0 was obtained after 4 days of culturing, the recombinant baculovirus was transferred into suspension Sf9 cells for culturing for 3 days, a large amount of replication-proliferated recombinant baculovirus was further infected to cause Sf9 cells to obtain higher titer seed viruses, the whole cell suspension was centrifuged at 3000rpm for 5min, and the supernatant was sub-cultured to obtain the genome of the recombinant baculovirus R0332{ rBEV-8KC (OB 1) } #P1, R0332{ rBEV-8KC (OB 1) } as shown in FIG. 8.

Example 6 recombinant baculovirus obtained with the packaging element expression cassette of AAV8 loaded at the OB1 insertion site, R0004{ rBEV-EGFP (Tn 7) }

The cloning vector pFastBac1-ITR-CMV-EGFP-WPRE-hGHpA-ITR (the sequence is shown as SEQ ID NO. 15) obtained in example 4 is utilized to transform the pFastBac1-ITR-CMV-EGFP-WPRE-hGHpA-ITR plasmid into delta CC-DH10Ba competent cells prepared in example 1, recombinant cloning is carried out through blue-white screening, recombinant Bacmid DNA is subjected to large shaking extraction, the Bacmid DNA is transfected into a host cell line for culture, recombinant baculovirus R0004{ rBEV-EGFP (Tn 7) } #P0 is obtained after 4 days of culture, the recombinant baculovirus subjected to large replication and proliferation is transferred into suspension Sf9 cells for culture for 3 days, the Sf9 cells are further infected to obtain seed viruses with higher titer, all cell suspensions are centrifuged at 3000rpm for 5min, and the supernatant is split-packed and stored to obtain the recombinant baculovirus R0004{ rBEV-EGFP (Tn 7) } #P1. The genomic schematic of R0004{ rBEV-EGFP (Tn 7) } is shown in FIG. 9.

Example 7. Recombinant baculovirus with the OB2 insertion site loaded with the packaging element expression cassette of AAV8, R0333{ rBEV-8KC (OB 2) }, was obtained.

1 Preparation of CmR-8KC (OB 2) -DeltaCC-DH 10Bac competent cells

Primers HAL (p 15) -F (SEQ ID NO. 40): 5'-ATGCATtaccatcgcatacaac-3' and HAL (p 15) -R (SEQ ID NO. 41): 5'-ACTAGTttaactgtttacataac-3', amplified fragment HAL (p 15) (412 bp) (sequence shown in SEQ ID NO. 16) were designed similarly using AcMNPV genome bacmid bMON14272 as template; primers HAR (cg 30) -F (SEQ ID NO. 42): 5'-Gcatgcttaatctacatttattgtaac-3' and HAR (cg 30) -R (SEQ ID NO. 43): 5'-GTTTAAACgaagacaacaacgc-3', amplified fragment HAR (cg 30) (458 bp) (sequence shown in SEQ ID NO. 17) were designed using AcMNPV genome bacmid bMON14272 as template;

HAL (P15) (412 bp), HAR (cg 30) (458 bp), P1-FRT-CmR-P2 (1053 bp) and the packaging element expression cassette of AAV8 (sequence shown in SEQ ID NO. 14) were linearized into DNA fragments by means of molecular cloning recombination at restriction enzyme sites, and cloning was performed on vector plasmid pQB1064 to obtain pQB 1064-HAL (P15) -P1-FRT-CmR-P2-8KC-HAR (cg 30) plasmid (SEQ ID NO.48, the vector sequence of SEQ ID NO.48 will define the actual sequence and position of OB2 site 8KC (OB 2). After linearizing pQB 1064-HAL (P15) -P1-FRT-CmR-P2-8KC-HAR (ORF 91) plasmid, recovering the gel to obtain DNA fragment HAL (P15) -P1-FRT-CmR-P2-8KC-HAR (ORF 91), transforming the DNA fragment into L-arabinose-induced electrotransformation competence of pKD 46/DeltaCC-DH 10Bac, screening and identifying to obtain monoclonal bacterial solution of pKD46/CmR-8KC (OB 2) -DeltaCC-DH 10Bac, culturing and eliminating pKD46 plasmid at 42 ℃, and preparing CmR-8KC (OB 2) -DeltaCC-DH 10Bac competent cells by resistance plate screening.

2 Obtaining recombinant baculovirus R0333{ rBEV-8KC (OB 2) }

The CmR-8KC (OB 2) -delta CC-DH10Bac competent cells are subjected to large shaking, recombinant Bacmid DNA is extracted, the Bacmid DNA is transfected into a host cell line for culture, recombinant baculovirus R0333{ rBEV-8KC (OB 2) } #P0 is obtained after 4 days of culture, the recombinant baculovirus is transferred into suspension Sf9 cells for culture for 3 days, a large number of the recombinant baculovirus subjected to replication and proliferation are further infected to cause Sf9 cells to obtain seed viruses with higher titer, the whole cell suspension is centrifuged at 3000rpm for 5min, and the supernatant is subpackaged and stored, so that the genome of the harvested recombinant baculovirus R0333{ rBEV-8KC (OB 2) } #P1 and R0333{ rBEV-8KC (OB 2) } is shown in figure 10.

Example 8 obtaining recombinant baculovirus with OB2 insertion site loaded with the packaging element expression cassette of AAV8 and Tn7 recombinant ITR-EGFP, R0334{ rBEV-8KC (OB 2) -EGFP (Tn 7) }

The cloning vector pFastBac1-ITR-CMV-EGFP-WPRE-hGHpA-ITR (the sequence is shown as SEQ ID NO. 15), the vector sequence of SEQ ID NO.15 is used for defining the actual sequence of EGFP (Tn 7) at Tn7 site and the actual sequence and position of KC (OB 2) at position 8, which are defined in the previous example), the plasmid conversion of pFastBac1-ITR-CMV-EGFP-WPRE-hGHpA-ITR is used for preparing CmR-8KC (OB 2) - ΔCC-DH10Bac competent cells prepared in example 7, recombinant cloning is carried out by blue-white screening, recombinant Bacmid DNA is extracted by shaking, the Bacmid DNA is transfected into a host cell line for culturing, recombinant baculovirus R0334{ rBEV-8KC (OB 2) -EGFP (Tn 7) } #P0 is obtained after culturing for 4 days, the recombinant baculovirus is transferred into Sf9 cells for culturing for 3 days, the recombinant baculovirus which is greatly proliferated to further infect and result in obtaining higher levels of Sf9 cells, and the recombinant baculovirus (Tn 7-7) is obtained after the recombinant adenovirus suspension is used for storing the recombinant adenovirus suspension (3-7) and the recombinant adenovirus-related recombinant strain (3, namely, the recombinant strain-7 strain-7 is obtained. The genomic schematic of R0334{ rBEV-8KC (OB 2) -EGFP (Tn 7) } is shown in FIG. 11.

Example 9 obtaining recombinant baculovirus with OB3 insertion site loaded with ITR-EGFP, R0335{ rBEV-8KC (OB 3) -EGFP (Tn 7) }

1 Preparation of CmR-8KC (OB 3) -DeltaCC-DH 10Bac competent cells

Because the GC content of the tail end sequence of the upstream and downstream homology arms of the OB3 locus is extremely low, the sequence HAL (prot) (478 bp) (the sequence is shown as SEQ ID NO. 18) is synthesized by the entrusted biotechnology company; the synthesis of HAR (pkip) (428 bp) (sequence shown in SEQ ID NO. 19) by Committee Biotechnology company;

HAL (prot) (478 bp), HAR (pkip) (428 bp), P1-FRT-CmR-P2 (1053 bp) and the packaging element expression cassette of AAV8 (sequence shown in SEQ ID NO. 14) were linearized into DNA fragments by means of molecular cloning recombination at restriction sites, and cloning was performed on vector plasmid pQB1064 to obtain pQB 1064-HAL (prot) -P1-FRT-CmR-P2-8 KC-HAR (pkip) plasmid (SEQ ID NO.49, the vector sequence of SEQ ID NO.49 would define the actual sequence and position of OB3 site 8KC (OB 3). After linearizing pQB 1064-HAL (prot) -P1-FRT-CmR-P2-8 KC-HAR (pkip) plasmid, recovering the gel to obtain DNA fragment HAL (prot) -P1-FRT-CmR-P2-8 KC-HAR (pkip), converting the DNA fragment into L-arabinose-induced electrotransformation competence of pKD 46/delta CC-DH10Bac, screening and identifying to obtain monoclonal bacterial solution of pKD46/CmR-8KC (OB 3) -delta CC-DH10Bac, culturing at 42 ℃ to eliminate pKD46 plasmid, and screening a resistance plate to prepare CmR-8KC (OB 3) -delta CC-DH10Bac competent cells.

2 Obtaining recombinant baculovirus R0335{ rBEV-8KC (OB 3) }

The CmR-8KC (OB 3) -delta CC-DH10Bac competent cells are subjected to large shaking, recombinant Bacmid DNA is extracted, the Bacmid DNA is transfected into a host cell line for culture, recombinant baculovirus R0335{ rBEV-8KC (OB 3) } #P0 is obtained after 4 days of culture, the recombinant baculovirus is transferred into suspension Sf9 cells for culture for 3 days, a large number of the recombinant baculovirus subjected to replication and proliferation are further infected to cause Sf9 cells to obtain seed viruses with higher titer, the whole cell suspension is centrifuged at 3000rpm for 5min, and the supernatant is subpackaged and stored, so that the genome of the harvested recombinant baculovirus R0335{ rBEV-8KC (OB 3) } #P1 and R0335{ rBEV-8KC (OB 3) } is shown in figure 12.

Packaging recombinant adeno-associated virus R0335-AAV8-EGFP by two baculovirus-infected host cells

R0335{ rBEV-8KC (OB 3) } #P1 and R0004{ rBEV-EGFP (Tn 7) } #P1 were inoculated into suspension Sf9 cells according to MOI0.05 and cultured for 3 days, and the virus was used for purifying recombinant adeno-associated virus R0335-AAV8-EGFP after virus collection.

Example 10 obtaining recombinant baculovirus with OB3 insertion site loaded with ITR-EGFP, R0336{ rBEV-ITR-EGFP (OB 3) }, and packaging of recombinant adeno-associated Virus R0336-AAV8-EGFP by two baculovirus-infected host cells

1 Preparation of CmR-ITR-EGFP (OB 3) - ΔCC-DH10Bac competent cells

The packaging element expression cassette (sequence shown as SEQ ID NO. 6) of ITR-EGFP obtained by enzyme digestion and gel recovery of example 2 is utilized to linearize DNA fragments, HAL (prot) (478 bp), HAR (pkip) (428 bp), P1-FRT-CmR-P2 (1053 bp) and the packaging element expression cassette (sequence shown as SEQ ID NO. 6) of ITR-EGFP are utilized for molecular cloning recombination of restriction enzyme digestion sites, and cloning is carried out on a vector plasmid pQB1064 to obtain pQB-HAL (prot) -P1-FRT-CmR-P2-ITR-EGFP-HAR (pkip) plasmid (SEQ ID NO.50, vector sequence of SEQ ID NO.50 is used for defining actual sequence and position of EGFP (OB 3) at position of EGFP 3. After linearizing pQB 1064-HAL (prot) -P1-FRT-CmR-P2-ITR-EGFP-HAR (pkip) plasmid, recovering the gel to obtain DNA fragment HAL (prot) -P1-FRT-CmR-P2-ITR-EGFP-HAR (pkip), transforming the DNA fragment into L-arabinose induced electrotransformation competence of pKD 46/delta CC-DH10Bac, screening and identifying to obtain monoclonal bacterial solution of pKD46/CmR-ITR-EGFP (OB 3) -delta CC-DH10Bac, culturing at 42 ℃ to eliminate pKD46 plasmid, and screening by a resistance plate to prepare CmR-ITR-EGFP (OB 3) -delta CC-DH10Bac competence.

2 Obtaining recombinant baculovirus R0336{ rBEV-ITR-EGFP (OB 3) }

And (3) carrying out large shaking bacteria on CmR-ITR-EGFP (OB 3) -delta CC-DH10Bac competent cells, extracting recombinant Bacmid DNA, transfecting the Bacmid DNA into a host cell line for culturing, obtaining recombinant baculovirus R0336{ rBEV-ITR-EGFP (OB 3) } #P0 after culturing for 4 days, transferring into suspension Sf9 cells for culturing for 3 days, further infecting a large number of replication and proliferation recombinant baculovirus to cause Sf9 cells to obtain seed viruses with higher titer, centrifuging the whole cell suspension by using 3000rpm for 5min, and subpackaging and preserving the supernatant, wherein the genome schematic diagram of the obtained recombinant baculovirus R0336{ rBEV-ITR-EGFP (OB 3) } P1, R0336{ rBEV-ITR-EGFP (OB 3) } is shown in figure 13. A cytofluorescence photograph of R0336{ rBEV-ITR-EGFP (OB 3) } #p1 expanded to P7 at fixed priming density and priming MOI is shown in fig. 15; as shown in the figure, the expression of EGFP fluorescence of the target gene inserted into the OB3 site is stable continuously in the P7 generation.

Packaging recombinant adeno-associated virus R0336-AAV8-EGFP by two baculovirus-infected host cells

R0335{ rBEV-8KC (OB 3) } #P1 and R0336{ rBEV-ITR-EGFP (OB 3) } #P1 were inoculated into suspension Sf9 cells according to MOI0.05 and cultured for 3 days, and the virus was used for purifying recombinant adeno-associated virus R0336-AAV8-EGFP after virus collection.

Example 11A recombinant baculovirus was obtained with an OB1 insertion site loaded with 8KC and an OB2 insertion site loaded with ITR-EGFP, R0337{ rBEV-8KC (OB 1) -ITR-EGFP (OB 2) }.

1 Preparation of GmR-ITR-EGFP (OB 2) -CmR-8KC (OB 1) -DeltaCC-DH 10Bac competent cells

The resulting sequence FRT-pCAT-GmR (SEQ ID NO. 51), FRT-pCAT-GmR was cloned with the pQB1064-HAL (prot) -P1-FRT-CmR-P2-ITR-EGFP-HAR (pkip) plasmid of example 10 (SEQ ID NO.50, the vector sequence of SEQ ID NO.50 will define the actual sequence and position of EGFP (OB 3) at the OB3 site) to obtain pQB1064-HAL (prot) -P1-FRT-GmR-P2-ITR-EGFP-HAR (pkip) plasmid (SEQ ID NO. 52) by means of molecular cloning recombination at the restriction sites

The cloning was performed by using a molecular cloning recombination method of restriction enzyme sites to linearize the plasmid pQB1064-HAL (prot) -P1-FRT-GmR-P2-ITR-EGFP-HAR (pkip) with the HAL (P15) (412 bp) obtained in example 6 and HAR (cg 30) (458 bp) to obtain the plasmid pQB1064-HAL (P15) -P1-FRT-GmR-P2-ITR-EGFP-HAR (cg 30) (SEQ ID NO.53, the actual sequence and position of the EGFP (OB 2) at the position of the EGFP 2 site of SEQ ID NO.53 was clarified, and after linearization of the plasmid pQB1064-HAL (P15) -P1-FRT-GmR-P2-ITR-EGFP-HAR (cg 30), the DNA fragment HAR (P15) -P1-FRT-GmR-P2-ITR-EGFR (cg 30) was recovered, and the DNA fragment was transformed to obtain the plasmid (Cb 1-EGFP 2-EGFP-HAR (cg DH) and the PCR solution was screened for the PCR solution (Cb 46. Delta. Mu.C) -PCR solution (Cb.10-46. Mu.C) -PCR solution (Cb.10. Mu.46-Cb.46).

2 Obtaining recombinant baculovirus R0337{ rBEV-8KC (OB 1) -ITR-EGFP (OB 2) }

And (2) carrying out large shaking bacteria on GmR-ITR-EGFP (OB 2) -CmR-8KC (OB 1) -delta CC-DH10Bac competent cells, extracting recombinant Bacmid DNA, transfecting the Bacmid DNA into a host cell line, culturing for 4 days to obtain recombinant baculovirus R0337{ rBEV-8KC (OB 1) -ITR-EGFP (OB 2) } #P0, transferring into suspension Sf9 cells, culturing for 3 days, carrying out further infection on a large amount of replication-amplified recombinant baculovirus to obtain seed viruses with higher titer on the Sf9 cells, centrifuging all cell suspensions by using 3000rpm for 5min, and subpackaging and preserving supernatants, namely obtaining genome schematics of the harvested recombinant baculovirus R0337{ rBEV-8KC (OB 1) -ITR-EGFP (OB 2) } #P1, R0337{ rBEV-8KC (OB 1) -ITR-EGFP (OB 2) }. A cytofluorescence photograph of R0337{ rBEV-8KC (OB 1) -ITR-EGFP (OB 2) } #p1 expanded to P7 at fixed priming density and priming MOI as shown in fig. 15; as shown in the figure, the expression of EGFP fluorescence of the target gene inserted into the OB2 site is stable continuously in the P7 generation.

Example 12. Detection of infectious titer of recombinant baculoviruses by TCID50 method based on indirect immunofluorescence of GP64 protein expressed by recombinant viruses.

And culturing Sf9 insect cells cultured by using a serum-free culture medium Sf-900II SFM to a viable cell density of 1-6E+6cells/mL, diluting the cell suspension according to the viable cell density of 4.5E+5cells/mL, paving 96-well plates of the Sf9 cells according to 100 mu L of the cell suspension in each hole, standing at 27 ℃ for 0.5-2 hours, and carrying out virus inoculation infection.

Sample R0329{rBEV-GLuc (OB1)-8KC-EGFP(Tn7)}#P1、R0330{rBEV-8KC-EGFP(OB1)}#P1、R0331{rBEV-8KC(OB1)-EGFP(Tn7)}#P1、R0332{rBEV-8KC(OB1)}#P1、R0004{rBEV-EGFP(Tn7)}#P1、R0333{rBEV-8KC(OB2)}#P1、R0334{rBEV-8KC(OB2)-EGFP(Tn7)}#P1、R0335{rBEV-8KC(OB3)}#P1 to be tested and R0336{ rBEV-ITR-EGFP (OB 3) } #P1 toxins are added into 900 μl of culture medium Sf-900II SFM according to 100 μl of the virus stock solution, namely 10-1, 100 μl of the virus stock solution is added into 900 μl of culture medium Sf-900II SFM from 1mL of 10-1, namely 10-2, gradient dilution is sequentially carried out to 10-9, each gradient of each virus is respectively inoculated into 96-well plate holes paved with Sf9 cells, 100 μl of each hole is inoculated with 8 multiple holes, after infection, standing culture is carried out for 96 hours at 27 ℃, the supernatant is discarded, 200 μl of PBS (pH 7.2) is used for cleaning the cell surface once, PBS is discarded, 150 μl of absolute ethanol is discarded, room temperature is fixed for 10-15 minutes, absolute ethanol is placed at room temperature for 2-5 minutes, and natural airing is carried out. 200. Mu.L of PBS (pH 7.2) was added to each well to Wash the cell surface once, PBS was discarded, 100. Mu.L of primary antibody working solution (PBS was used to dilute Baculovirus Envelop gp64 monoclonal antibody at 1:500) was added to the well and incubated at 37℃for 1H, 200. Mu.L of Wash plate was added 3 times each time with Wash Buffer (PBS solution of 0.05% Tween-20), washing was performed with a gentle shaking for 1 min, PBS was discarded, 100. Mu.L of secondary antibody working solution (PBS was used to dilute Goat anti-Mouse IgG (H+L) monoclonal antibody at 1:300) for 1H, 200. Mu.L of Wash plate was added 3 times each time with Wash Buffer (PBS solution of 0.05% Tween-20), 100. Mu.L of PBS was added, wells positive for red fluorescence of cells were judged under a fluorescence microscope and labeled, and two bar-type virus titer was calculated by the Reed-Mued method. Indirect immunofluorescence TCID50 infection titres for the various toxins are shown in Table 1:

TABLE 1

Example 13 infection titre detection of recombinant baculoviruses based on novel methods of Gluc (OB 1) expression by recombinant viruses

The R0329{ rBEV-GLuc (OB 1) -8KC-EGFP (Tn 7) } #P1 virus with known titer of 1.311E+07 TCID50/mL is inoculated into suspension Sf9 cells according to MOI0.05 to culture for 3 days, the virus is recovered, the cell suspension packed partially is centrifuged at 3000rpm for 5min, and the supernatant is split-packed and stored to obtain the recombinant baculovirus R0329{ rBEV-GLuc (OB 1) -8KC-EGFP (Tn 7) } #P2, and the rest sample is used for purifying R0329-AAV8-EGFP.

R0329{ rBEV-GLuc (OB 1) -8KC-EGFP (Tn 7) } #P1 was diluted to recombinant baculovirus standards with titers of 1.2E+7TCID50/mL, 6E+6TCID50/mL, 3E+6TCID50/mL, 1.5E+6TCID50/mL and 7.5E+5TCID50/mL, inoculated in 96-well plate wells plated with Sf9 cells, 100. Mu.L per well, and 3 multiplex wells.

Inoculating the sample R0329{ rBEV-GLuc (OB 1) -8KC-EGFP (Tn 7) } #P2 virus stock solution to be detected into a 96-well plate hole paved with Sf9 cells, wherein each hole is 100 mu L, and 3 compound holes are inoculated; using fresh medium Sf-900II SFM as a blank control, 100 μl per well, 3 duplicate wells were accessed; after Sf9 cells are infected by standard viruses and viruses to be detected for 2 hours, fresh culture medium is replaced, culture is continued for 4 hours, 50 mu L of supernatant (without centrifugation) is taken from 3 cell holes of each sample and added into a new 96-hole black plate, 50 mu L of 1:100 luciferase kit substrate is added into each hole, incubation is carried out for 5 minutes, and chemiluminescence intensity is measured in a chemiluminescence detector. The average value of the obtained values was subtracted from the average luciferase activity background value of the culture medium control to obtain an actual luciferase activity value.

Taking the logarithmic value of the virus infection titer of the standard substance as the abscissa and the value of the actual luciferase activity as the ordinate, a standard curve and a linear regression equation are prepared:

Y＝a×logX-b；

x: virus infection titer, TCID50/mL;

y: luciferase activity value, RLU;

a, b: slope and intercept of the linear regression equation respectively;

Substituting the actual luciferase activity value of the virus sample to be detected into a linear regression equation, and calculating to obtain the virus infection titer of the virus sample to be detected.

TABLE 2 results of novel recombinant baculovirus luciferase titration

The titer of the original strain virus R0329{ rBEV-GLuc (OB 1) -8KC-EGFP (Tn 7) } #P1 is 1.311E+07 TCID50/mL, the titer measured by the method of the invention is 1.39E+7/mL, and in the expected range, the titer of the virus R0329{ rBEV-GLuc (OB 1) -8KC-EGFP (Tn 7) } #P2 to be tested is 8.10E+06/mL. The standard curve of the method has the characteristics of R ² = 0.9845, and the result is reliable. FIG. 16 is a correlation analysis of recombinant baculovirus luciferase activity versus titer.

For the determination of recombinant baculovirus infection titer in recombinant baculovirus expression systems, the TCID50 method of direct fluorescence of virus background expression and immunoindirect fluorescence of GP64 antibody, and the flow detection method based on baculovirus GP64 fluorescent antibody are most widely used. The TCID50 method of direct fluorescence expressed by virus background is not applicable to recombinant baculovirus which does not express fluorescence and the recombinant virus produced by the system expresses the same fluorescence, and the antibody using cost of the method adopting fluorescent antibody is too high. The method based on the standard curve can rapidly, efficiently and low-cost detect the virus titer.

Example 14 purified AAV and electrophoresis run silver staining test

10ML of the initial mixture was removed from the initial mixture of recombinant adeno-associated virus R0329-AAV8-EGFP of example 1, the initial mixture of recombinant adeno-associated virus R0330-AAV8-EGFP of example 2, the initial mixture of recombinant adeno-associated virus R0331-AAV8-EGFP of example 4, the initial mixture of recombinant adeno-associated virus R0334-AAV8-EGFP of example 8, the initial mixture of recombinant adeno-associated virus R0335-AAV8-EGFP of example 9 and the initial mixture of recombinant adeno-associated virus R0336-AAV8-EGFP of example 10, and the supernatant were harvested by centrifugation, respectively, the harvested cell pellet and supernatant were purified, the cells were repeatedly thawed 3 times, and centrifuged at 5000rpm for 10min to collect the supernatant of the lysate, the supernatant of the lysate was added to the crude supernatant, the supernatant was added with 10% PEG for 2 hours in an ice bath at 4℃and the temperature, the supernatant was subjected to PBS, the pellet was added, the supernatant was subjected to nuclease (Benzonase) 37℃to centrifugation at 60℃and 60 g of the supernatant was subjected to centrifugation at 50 g (60 rpm, and 50 g of 60 g, 60 g of iodine was obtained by the centrifugation gradient, and the method of 60 g, which was performed by using the method of 60 g, and the method of 60 g, which was described below, and 50.50.60 g, and the method were used for obtaining the supernatant. The final purified finished virus was resuspended in 80. Mu. LPBS. Mu.L and 10. Mu.L of purified finished virus was run on SDS-PAGE gels for staining.

The results of the transfection of purified finished virus for each recombinant baculovirus system model are shown in FIG. 17. Lanes 1,2, 3, 4, 5 and 6 are, in order, the finished product virus purified from the initial mixture of the recombinant adeno-associated virus R0329-AAV8-EGFP of example 1, the finished product virus purified from the initial mixture of the recombinant adeno-associated virus R0330-AAV8-EGFP of example 2, the finished product virus purified from the initial mixture of the recombinant adeno-associated virus R0331-AAV8-EGFP of example 4, the finished product virus purified from the initial mixture of the recombinant adeno-associated virus R0334-AAV8-EGFP of example 8, the finished product virus purified from the initial mixture of the recombinant adeno-associated virus R0335-AAV8-EGFP of example 9 and the finished product virus purified from the initial mixture of recombinant adeno-associated virus R0336-AAV8-EGFP of example 10, the loading amounts are 20. Mu.L, the finished product virus purified from the initial mixture of recombinant adeno-associated virus R0336-AAV8-EGFP of example 10 is low in titer, and the light shadow of VP1 and VP2 is visible.

Based on the above examples of the present application, it can be seen that the present application screens out new insertion sites OB1, OB2 and OB3 in the recombinant Baculovirus (BEV) genome, which can allow stable expression of foreign genes, loads Luciferase (Luciferase) reporter gene expression cassette and essential functional elements for loading recombinant adeno-associated virus on the new sites, so that BEV of the recombinant baculovirus genome can be packaged based on one, two or more constitutive versions of baculovirus system at three sites; the application also discloses a novel method for measuring the infection titer of the recombinant baculovirus based on the Luciferase reporter gene expressed by the very early promoter, when the recombinant baculovirus constructed by the method is used for measuring the titer, a virus sample can be undiluted, the virus titer is measured within 4 hours after the liquid is changed 2 hours after the cells are infected, cytopathy, fluorescence or staining is not required to be observed, the operation is simple, the time consumption is short, and the cost is low.

In summary, the application is based on the concept of the recombinant baculovirus conserved gene locus, uses the point positions of the conserved gene locus with reverse overlapping stop codons, direct connection or connection sequences to insert exogenous genes, and minimally avoids damaging the expression of original known and unknown functional elements, explores and screens new recombinant baculovirus genome insertion sites capable of stably carrying exogenous genes, and obtains a recombinant baculovirus system with higher flexibility and compatibility by using the new insertion sites; the method for measuring the infection titer has the characteristics of convenience, accuracy and low cost.

SEQ ID NO.1:

Aacatgtataattgaaataaatatattatttaataaaatgttttttat。

SEQ ID NO.2:

GCCGCCctgGCTGCCGACGGTTATCTACCCGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCGCGAGTGGTGGGCCCTCAAACCCGGCGCTCCTAAGCCAAAGGCTAACCAACAGAAACAAGACGACGGACGCGGCCTGGTTCTCCCCGGTTACAAATACCTAGGACCCTTCAACGGGCTGGACAAGGGCGAACCCGTGAACGCTGCGGACGCCGCTGCCCTTGAGCACGATAAGGCTTACGACCAGCAACTGCAGGCCGGCGACAACCCTTACCTTCGTTATAACCACGCCGACGCTGAATTCCAGGAGCGTCTGCAAGAAGATACGTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGAAGCGGGTTCTCGAACCTCTCGGTCTGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAGAGACCGGTAGAGCCATCACCCCAGCGTTCTCCAGACTCCTCTACGGGCATCGGCAAGAAAGGCCAACAGCCCGCCAGAAAAAGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGTTCCAGACCCTCAACCTCTCGGAGAACCTCCAGCAGCGCCCTCTGGTGTGGGACCTAATACAATGGCTGCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGGCGCCGACGGAGTGGGTAGTTCCTCGGGAAATTGGCATTGCGATTCCACATGGCTGGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACCTCTACAAGCAAATCTCCAACGGGACATCGGGAGGAGCCACCAACGACAACACCTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGACTTTAACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCCAAGAGACTCAGCTTCAAGCTCTTCAACATCCAGGTCAAGGAGGTCACGCAGAATGAAGGCACCAAGACCATCGCCAATAACCTCACCAGCACCATCCAGGTGTTTACGGACTCGGAGTACCAGCTGCCGTACGTTCTCGGCTCTGCCCACCAGGGCTGCCTGCCTCCGTTCCCGGCGGACGTGTTCATGATTCCCCAGTACGGCTACCTAACACTCAACAACGGTAGTCAGGCCGTGGGACGCTCCTCCTTCTACTGCCTGGAATACTTTCCTTCGCAGATGCTGAGAACCGGCAACAACTTCCAGTTTACTTACACCTTCGAGGACGTGCCTTTCCACAGCAGCTACGCCCACAGCCAGAGCTTGGACCGGCTGATGAATCCTCTGATTGACCAGTACCTGTACTACTTGTCTCGGACTCAAACAACAGGAGGCACGGCAAATACGCAGACTCTGGGCTTCAGCCAAGGTGGGCCTAATACAATGGCCAATCAGGCAAAGAACTGGCTGCCAGGACCCTGTTACCGCCAACAACGCGTCTCAACGACAACCGGGCAAAACAACAATAGCAACTTTGCCTGGACTGCTGGGACCAAATACCATCTGAATGGAAGAAATTCATTGGCTAATCCTGGCATCGCTATGGCAACACACAAAGACGACGAGGAGCGTTTTTTTCCCAGTAACGGGATCCTGATTTTTGGCAAACAAAATGCTGCCAGAGACAATGCGGATTACAGCGATGTCATGCTCACCAGCGAGGAAGAAATCAAAACCACTAACCCTGTGGCTACAGAGGAATACGGTATCGTGGCAGATAACTTGCAGCAGCAAAACACGGCTCCTCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAACCGGGACGTGTACCTGCAGGGTCCCATCTGGGCCAAGATTCCTCACACGGACGGCAACTTCCACCCGTCTCCGCTGATGGGCGGCTTTGGCCTGAAACATCCTCCGCCTCAGATCCTGATCAAGAACACGCCTGTACCTGCGGATCCTCCGACCACCTTCAACCAGTCAAAGCTGAACTCTTTCATCACGCAATACAGCACCGGACAGGTCAGCGTGGAAATTGAATGGGAGCTGCAGAAGGAAAACAGCAAGCGCTGGAACCCCGAGATCCAGTACACCTCCAACTACTACAAATCTACAAGTGTGGACTTTGCTGTTAATACAGAAGGCGTGTACTCTGAACCCCGCCCCATTGGCACCCGTTACCTCACCCGTAATCTGTAA.

SEQ ID NO.3:gccgccCtgGcggggttttacgagattgtgattaaggtccccagcgaccttgacgagcatctgcccggcatttctgacagctttgtgaactgggtggccgagaaggaGtgggagttgccgccagattctgacTtggatctgaatctgattgagcaggcacccctgaccgtggccgagaagctgcagcgcgactttctgacggaGtggcgccgtgtgagtaaggccccggaggctcttttctttgtgcaatttgagaagggagagagctacttccacTtgcacgtgctcgtggaaaccaccggggtgaaatccTtggttttgggacgtttcctgagtcagattcgcgaaaaactgattcagagaatttaccgcgggatcgagccgactttgccaaactggttcgcggtcacaaagaccagaaaCggcgccggaggcgggaacaaggtggtggaCgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatTtggaacagtatttaagcgcctgtttgaatctcacggagcgtaaacggttggtggcgcagcatctgacgcacgtgtcgcagacgcaggagcagaacaaagagaatcagaatcccaattctgaCgcgccggtgatcagatcaaaaacttcagccaggtacatggagctggtcgggtggctcgtggacaaggggattacctcggagaagcagtggatTcaggaggaccaggcctcatacatctccttcaatgcggcctccaactcgcggtcccaaatcaaggctgccttggacaatgcgggaaagattatgagcctgactaaaaccgcccccgactacctggtgggccagcagcccgtggaggacatttccagcaatcggatttataaaattttggaactaaacgggtacgatccccaatatgcggcttccgtctttctgggatgggccacgaaaaagttcggcaagaggaacaccatctggctgtttgggcctgcaactaccgggaagaccaacatcgcggaggccatagcccacactgtgcccttctacgggtgcgtaaactggaccaatgagaactttcccttcaacgactgtgtcgacaagatggtgatctggtgggaggaggggaagatgaccgccaaggtcgtggagtcggccaaagccattctcggaggaagcaaggtgcgcgtggaccagaaatgcaagtcctcggcccagatagacccgactcccgtgatcgtcacctccaacaccaacatgtgcgccgtgattgacgggaactcaacgaccttcgaacaccagcagccgttgcaagaccggatgttcaaatttgaactcacccgccgtctggatcatgactttgggaaggtcaccaagcaggaagtcaaagactttttccggtgggcaaaggatcacgtggttgaggtggagcatgaattctacgtcaaaaagggtggagccaagaaaagacccgcccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgcggaGgcttcgatcaactacgcagacaggtaccaaaacaaatgttctcgtcacgtgggcatgaatctgatgctgtttccctgcagacaatgcgagagaatgaatcagaattcaaatatctgcttcactcacggacagaaagactgtttagagtgctttcccgtgtcagaatctcaacccgtttctgtcgtcaaaaaggcgtatcagaaactgtgctacattcatcatatcatgggaaaggtgccagacgcttgcactgcctgcgatctggtcaatgtggatttggatgactgcatctttgaacaataa.

SEQ ID No.4：

Cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct.

SEQ ID No.5：

Aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg.

SEQ ID NO.6：

cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgcacgcgtgtgtctagaacgcgtggagctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggtaccgaaaaccccggtccggctagcgccaccggatccggcggatctggcatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggctccggagactacaaggatgacgatgacaaggattacaaagacgacgatgataaggactataaggatgatgacgacaaataaaagctttaaaccggttatcgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccggaactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctatgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgataccgagcgctgctcgagagatctacgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtccttctgattttgtaggtaaccacgtgcggaccgagcggccgcaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg.

SEQ ID NO.7：

GggtgtacaggtaacggccaattcaacgtgacgatgcgcacgtcctcgggtatgcatttgttaaaaaacacacagctcgctttaccaaacgaaagcaaaggtactaaatatggcgccattggctgatttgttattccaagataattacaaataaactgatccgtcgtggggtgataactggcaggtgtcagctttaaataatcttcaacgttgttgtcgcgcaaaagtctgcattttacacgcgttgttaatcccacgacttttgcatgtaaaatcggatccaaatactgcagaatcgtgtctataatttctaatggtaaacgtatgcgttttgctcgtgggcgctttgtaacgctcgacatcctaataacaactaacacaaaactaaaatgatactcaatatattgcttCCCGGGGGGA.

SEQ ID NO.8：ACATGcatgctctcaacacactcgctatttggaacataatcatatcgtctcagtagctcaaggtagagcgtagcgctctggatcgtatagatcttgctaaggttgtgagttcaagtctcgcctgagatattaaaaaactttgtaattttaaaaattttattttataatatacaattaaaaactatacaattttttattattacattaataatgatacaatttttattattacatttaatattgtctattacggtttctaatcatacagtacaaaaataaaatcacaattaatataattacaaagttaactacatgaccaaacatgaacgaagtcaatttagcggccaattcgccttcagccatggaagtgatgtcgctcagactggtgccgacgccgccaaacttggtgttctccagtttaaacaaagct.

SEQ ID NO.9：

ctaGCTAGCgtgtaggctggagctgcttcgaagttcctatactttctagagaataggaacttcggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgccgaagttcctatactttctagagaataggaacttcggaataggaactaaggaggatattcatatggaccatggctaattcccatAAGCTTggg.

SEQ ID NO.10：

ccaAtgcattcatacgctatagatccggtgacggccatcgaatgtataaactacatgaacaacaacgtgcaaagcgtcacgttgaccgacacttgccccgcaattgaattgcggtttcagcaattttttgatccaccgctacagcagagcaattacatgaccgtgtccgtggacgggtatgtcgtgctcgacaccgagttgagatacgtcaaatataaatggatgccaacaaccgagttagagtatgacgccgtgaataagtcgtttaacacactcaatgggccattgaacggtctcatgattttaaccgacttgccggagttactgcacgaaaacatttacgaatgtgtaatcacggacacgacaataaacgtgttgaaacatcgtcgcgaccgaatcgtgccaaattaacccgggggt.

SEQ ID NO.11：

acatGcatgcttaaagcacgttaagcggatacaacgggcagtccgagctgttaaagtcaatacaaccatcgttaacaaacgaatacgcattgttgtgacagctgaggatataaaaaggaatagagaagtaattgcaatgaaatatcccgttacaattccacggcacagcgtatgttgctcgagttctatcagttgcacacaacggcctaagaaaatttattaatgcttcatttgtatctatattagaaggataatacataggttcgcccaaaggactgggagaaggcggcggcgaaggtgtaggtgtaggaggaataggagaaggtggag gtttaaacaaagct.

SEQ ID NO.12：

CCTCGAGGcgccggcggtcgaaggcactcgcttcgatcaatggacaaagaatcaatcgttcgtaggcaacagaatgtcggaaagtttgcattggatgcgcggcgggtccaacttgccgcaaaactgcggcgagttcaacgtggtgtccagcctgttgatgtgcaacaatacgataatgaaaaattgataacgcttgcacgattgcaaacatgcacgctcggttgaataaaagctcgcatcgtcgtcgtaaaattagttgtatcaaagagcagctgcaattagaatcactgctaaaaAGATCTGCCGCCATGGGAGTCAAAGTTCTGTTTGCCCTGATCTGCATCGCTGTGGCCGAGGCCAAGCCCACCGAGAACAACGAAGACTTCAACATCGTGGCCGTGGCCAGCAACTTCGCGACCACGGATCTCGATGCTGACCGCGGGAAGTTGCCCGGCAAGAAGCTGCCGCTGGAGGTGCTCAAAGAGTTGGAAGCCAATGCCCGGAAAGCTGGCTGCACCAGGGGCTGTCTGATCTGCCTGTCCCACATCAAGTGCACGCCCAAGATGAAGAAGTTCATCCCAGGACGCTGCCACACCTACGAAGGCGACAAAGAGTCCGCACAGGGCGGCATAGGCGAGGCGATCGTCGACATTCCTGAGATTCCTGGGTTCAAGGACTTGGAGCCCTTGGAGCAGTTCATCGCACAGGTCGATCTGTGTGTGGACTGCACAACTGGCTGCCTCAAAGGGCTTGCCAACGTGCAGTGTTCTGACCTGCTCAAGAAGTGGCTGCCGCAACGCTGTGCGACCTTTGCCAGCAAGATCCAGGGCCAGGTGGACAAGATCAAGGGGGCCGGTGGTGACTAATCTAGAGTCGGGGCGGCCGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTGATATCGCGGCCGCGCTAGCGcatgc.

SEQ ID NO.13：

cctaggctcgaggcatgcAGATCTGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGTACTTCTCGACacctgatttaaatcatttattgttcaaagatgcagtcatccaaatccacattgaccagatcgcaggcagtgcaagcgtctggcacctttcccatgatatgatgaatgtagcacagtttctgatacgcctttttgacgacagaaacgggttgagattctgacacgggaaagcactctaaacagtctttctgtccgtgagtgaagcagatatttgaattctgattcattctctcgcattgtctgcagggaaacagcatcagattcatgcccacgtgacgagaacatttgttttggtacctgtctgcgtagttgatcgaagcCtccgcgtctgacgtcgatggctgcgcaactgactcgcgcacccgtttgggctcacttatatctgcgtcactgggggcgggtcttttcttggctccaccctttttgacgtagaattcatgctccacctcaaccacgtgatcctttgcccaccggaaaaagtctttgacttcctgcttggtgaccttcccaaagtcatgatccagacggcgggtgagttcaaatttgaacatccggtcttgcaacggctgctggtgttcgaaggtcgttgagttcccgtcaatcacggcgcacatgttggtgttggaggtgacgatcacgggagtcgggtctatctgggccgaggacttgcatttctggtccacgcgcaccttgcttcctccgagaatggctttggccgactccacgaccttggcggtcatcttcccctcctcccaccagatcaccatcttgtcgacacagtcgttgaagggaaagttctcattggtccagtttacgcacccgtagaagggcacagtgtgggctatggcctccgcgatgttggtcttcccggtagttgcaggcccaaacagccagatggtgttcctcttgccgaactttttcgtggcccatcccagaaagacggaagccgcatattggggatcgtacccgtttagttccaaaattttataaatccgattgctggaaatgtcctccacgggctgctggcccaccaggtagtcgggggcggttttagtcaggctcataatctttcccgcattgtccaaggcagccttgatttgggaccgcgagttggaggccgcattgaaggagatgtatgaggcctggtcctcctgAatccactgcttctccgaggtaatccccttgtccacgagccacccgaccagctccatgtacctggctgaagtttttgatctgatcaccggcgcGtcagaattgggattctgattctctttgttctgctcctgcgtctgcgacacgtgcgtcagatgctgcgccaccaaccgtttacgctccgtgagattcaaacaggcgcttaaatactgttccaAattagtccacgcccactggagctcaggctgggttttggggagcaagtaattggggatgtagcactcGtccaccaccttgttcccgcctccggcgccGtttctggtctttgtgaccgcgaaccagtttggcaaagtcggctcgatcccgcggtaaattctctgaatcagtttttcgcgaatctgactcaggaaacgtcccaaaaccaAggatttcaccccggtggtttccacgagcacgtgcaAgtggaagtagctctctcccttctcaaattgcacaaagaaaagagcctccggggccttactcacacggcgccaCtccgtcagaaagtcgcgctgcagcttctcggccacggtcaggggtgcctgctcaatcagattcagatccaAgtcagaatctggcggcaactcccaCtccttctcggccacccagttcacaaagctgtcagaaatgccgggcagatgctcgtcaaggtcgctggggaccttaatcacaatctcgtaaaaccccgCcaGggcggcGACCGCGCCCGATGGTGGGACGGTATGAATAATCCGTATTTATAGGTTTTTTTATTACAAAACTGTTACGAAAACAGTAAAATACTTATTTATTTGCGAGATGGTTATCATTTTAATTATCTCCATGATCTATTAATATTCCTGCAGGCCGGAGTATACGGACCTTTAATTCAACCCAACACAATATATTATAGTTAAATAAGAATTATTATCAAATCATTTGTATATTAATTAAAATACTATACTGTAAATTACATTTTATTTACAATCACTCGACcAAGACTTACACCCGGGggTtccgttaagGCCGCCACGGCTGCCGACGGTTATCTACCCGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCGCGAGTGGTGGGCtCTCAAACCCGGCGCTCCTAAGCCAAAGGCTAACCAACAGAAACAAGACGACGGcCGCGGCCTtGTTCTCCCCGGTTACAAATACCTcGGACCCTTCAACGGGCTcGACAAGGGCGAACCCGTGAACGCgGCGGACGCCGCgGCCCTTGAGCACGATAAGGCTTACGACCAaCAACTcCAGGCCGGCGACAACCCTTACCTTCGTTATAACCACGCCGACGCcGAATTCCAGGAGCGTCTcCAAGAAGATACcTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGAAGCGGGTTCTCGAACCTCTCGGTCTGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAGAGACCGGTAGAGCCATCACCCCAGCGTTCTCCAGACTCCTCTACGGGCATCGGCAAGAAAGGCCAACAGCCCGCCAGAAAAAGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGTTCCAGACCCTCAACCTCTCGGAGAACCTCCAGCAGCGCCCTCTGGTGTGGGACCTAATACAATGGCTGCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGGCGCCGACGGAGTGGGTAGTTCCTCGGGAAATTGGCATTGCGATTCCACATGGCTGGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACCTCTACAAGCAAATCTCCAACGGGACATCGGGAGGAGCCACCAACGACAACACCTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGACTTTAACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCCAAGAGACTCAGCTTCAAGCTCTTCAACATCCAGGTCAAGGAGGTCACGCAGAATGAAGGCACCAAGACCATCGCCAATAACCTCACCAGCACCATCCAGGTGTTTACGGACTCGGAGTACCAGCTGCCGTACGTTCTCGGCTCTGCCCACCAGGGCTGCCTGCCTCCGTTCCCGGCGGACGTGTTCATGATTCCCCAGTACGGCTACCTAACACTCAACAACGGTAGTCAGGCCGTGGGACGCTCCTCCTTCTACTGCCTGGAATACTTTCCTTCGCAGATGCTGAGAACCGGCAACAACTTCCAGTTTACTTACACCTTCGAGGACGTGCCTTTCCACAGCAGCTACGCCCACAGCCAGAGCTTGGACCGGCTGATGAATCCTCTGATTGACCAGTACCTGTACTACTTGTCTCGGACTCAAACAACAGGAGGCACGGCAAATACGCAGACTCTGGGCTTCAGCCAAGGTGGGCCTAATACAATGGCCAATCAGGCAAAGAACTGGCTGCCAGGACCCTGTTACCGCCAACAACGCGTCTCAACGACAACCGGGCAAAACAACAATAGCAACTTTGCCTGGACTGCTGGGACCAAATACCATCTGAATGGAAGAAATTCATTGGCTAATCCTGGCATCGCTATGGCAACACACAAAGACGACGAGGAGCGTTTTTTTCCCAGTAACGGGATCCTGATTTTTGGCAAACAAAATGCTGCCAGAGACAATGCGGATTACAGCGATGTCATGCTCACCAGCGAGGAAGAAATCAAAACCACTAACCCTGTGGCTACAGAGGAATACGGTATCGTGGCAGATAACTTGCAGCAGCAAAACACGGCTCCTCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAACCGGGACGTGTACCTGCAGGGTCCCATCTGGGCCAAGATTCCTCACACGGACGGCAACTTCCACCCGTCTCCGCTGATGGGCGGCTTTGGCCTGAAACATCCTCCGCCTCAGATCCTGATCAAGAACACGCCTGTACCTGCGGATCCTCCGACCACCTTCAACCAGTCAAAGCTGAACTCTTTCATCACGCAATACAGCACCGGACAGGTCAGCGTGGAAATTGAATGGGAGCTGCAGAAGGAAAACAGCAAGCGCTGGAACCCCGAGATCCAGTACACCTCCAACTACTACAAATCTACAAGTGTGGACTTTGCTGTTAATACAGAAGGCGTGTACTCTGAACCCCGCCCCATTGGCACCCGTTACCTCACCCGTAATCTGTAAAGCTGGGGAGATGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCCCTCGAcgcgccggcgacatgtcctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgcacgcgtgtgtctagaacgcgtggagctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggtaccgaaaaccccggtccggctagcgccaccggatccggcggatctggcatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggctccggagactacaaggatgacgatgacaaggattacaaagacgacgatgataaggactataaggatgatgacgacaaataaaagctttaaaccggttatcgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccggaactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctatgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgataccgagcgctgctcgagagatctacgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtccttctgattttgtaggtaaccacgtgcggaccgagcggccgcaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggcgcccctcgagg.

SEQ ID NO.14：

cctaggctcgaggcatgcAGATCTGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGTACTTCTCGACacctgatttaaatcatttattgttcaaagatgcagtcatccaaatccacattgaccagatcgcaggcagtgcaagcgtctggcacctttcccatgatatgatgaatgtagcacagtttctgatacgcctttttgacgacagaaacgggttgagattctgacacgggaaagcactctaaacagtctttctgtccgtgagtgaagcagatatttgaattctgattcattctctcgcattgtctgcagggaaacagcatcagattcatgcccacgtgacgagaacatttgttttggtacctgtctgcgtagttgatcgaagcCtccgcgtctgacgtcgatggctgcgcaactgactcgcgcacccgtttgggctcacttatatctgcgtcactgggggcgggtcttttcttggctccaccctttttgacgtagaattcatgctccacctcaaccacgtgatcctttgcccaccggaaaaagtctttgacttcctgcttggtgaccttcccaaagtcatgatccagacggcgggtgagttcaaatttgaacatccggtcttgcaacggctgctggtgttcgaaggtcgttgagttcccgtcaatcacggcgcacatgttggtgttggaggtgacgatcacgggagtcgggtctatctgggccgaggacttgcatttctggtccacgcgcaccttgcttcctccgagaatggctttggccgactccacgaccttggcggtcatcttcccctcctcccaccagatcaccatcttgtcgacacagtcgttgaagggaaagttctcattggtccagtttacgcacccgtagaagggcacagtgtgggctatggcctccgcgatgttggtcttcccggtagttgcaggcccaaacagccagatggtgttcctcttgccgaactttttcgtggcccatcccagaaagacggaagccgcatattggggatcgtacccgtttagttccaaaattttataaatccgattgctggaaatgtcctccacgggctgctggcccaccaggtagtcgggggcggttttagtcaggctcataatctttcccgcattgtccaaggcagccttgatttgggaccgcgagttggaggccgcattgaaggagatgtatgaggcctggtcctcctgAatccactgcttctccgaggtaatccccttgtccacgagccacccgaccagctccatgtacctggctgaagtttttgatctgatcaccggcgcGtcagaattgggattctgattctctttgttctgctcctgcgtctgcgacacgtgcgtcagatgctgcgccaccaaccgtttacgctccgtgagattcaaacaggcgcttaaatactgttccaAattagtccacgcccactggagctcaggctgggttttggggagcaagtaattggggatgtagcactcGtccaccaccttgttcccgcctccggcgccGtttctggtctttgtgaccgcgaaccagtttggcaaagtcggctcgatcccgcggtaaattctctgaatcagtttttcgcgaatctgactcaggaaacgtcccaaaaccaAggatttcaccccggtggtttccacgagcacgtgcaAgtggaagtagctctctcccttctcaaattgcacaaagaaaagagcctccggggccttactcacacggcgccaCtccgtcagaaagtcgcgctgcagcttctcggccacggtcaggggtgcctgctcaatcagattcagatccaAgtcagaatctggcggcaactcccaCtccttctcggccacccagttcacaaagctgtcagaaatgccgggcagatgctcgtcaaggtcgctggggaccttaatcacaatctcgtaaaaccccgCcaGggcggcGACCGCGCCCGATGGTGGGACGGTATGAATAATCCGTATTTATAGGTTTTTTTATTACAAAACTGTTACGAAAACAGTAAAATACTTATTTATTTGCGAGATGGTTATCATTTTAATTATCTCCATGATCTATTAATATTCCTGCAGGCCGGAGTATACGGACCTTTAATTCAACCCAACACAATATATTATAGTTAAATAAGAATTATTATCAAATCATTTGTATATTAATTAAAATACTATACTGTAAATTACATTTTATTTACAATCACTCGACcAAGACTTACACCCGGGggTtccgttaagGCCGCCACGGCTGCCGACGGTTATCTACCCGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCGCGAGTGGTGGGCtCTCAAACCCGGCGCTCCTAAGCCAAAGGCTAACCAACAGAAACAAGACGACGGcCGCGGCCTtGTTCTCCCCGGTTACAAATACCTcGGACCCTTCAACGGGCTcGACAAGGGCGAACCCGTGAACGCgGCGGACGCCGCgGCCCTTGAGCACGATAAGGCTTACGACCAaCAACTcCAGGCCGGCGACAACCCTTACCTTCGTTATAACCACGCCGACGCcGAATTCCAGGAGCGTCTcCAAGAAGATACcTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGAAGCGGGTTCTCGAACCTCTCGGTCTGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAGAGACCGGTAGAGCCATCACCCCAGCGTTCTCCAGACTCCTCTACGGGCATCGGCAAGAAAGGCCAACAGCCCGCCAGAAAAAGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGTTCCAGACCCTCAACCTCTCGGAGAACCTCCAGCAGCGCCCTCTGGTGTGGGACCTAATACAATGGCTGCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGGCGCCGACGGAGTGGGTAGTTCCTCGGGAAATTGGCATTGCGATTCCACATGGCTGGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACCTCTACAAGCAAATCTCCAACGGGACATCGGGAGGAGCCACCAACGACAACACCTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGACTTTAACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCCAAGAGACTCAGCTTCAAGCTCTTCAACATCCAGGTCAAGGAGGTCACGCAGAATGAAGGCACCAAGACCATCGCCAATAACCTCACCAGCACCATCCAGGTGTTTACGGACTCGGAGTACCAGCTGCCGTACGTTCTCGGCTCTGCCCACCAGGGCTGCCTGCCTCCGTTCCCGGCGGACGTGTTCATGATTCCCCAGTACGGCTACCTAACACTCAACAACGGTAGTCAGGCCGTGGGACGCTCCTCCTTCTACTGCCTGGAATACTTTCCTTCGCAGATGCTGAGAACCGGCAACAACTTCCAGTTTACTTACACCTTCGAGGACGTGCCTTTCCACAGCAGCTACGCCCACAGCCAGAGCTTGGACCGGCTGATGAATCCTCTGATTGACCAGTACCTGTACTACTTGTCTCGGACTCAAACAACAGGAGGCACGGCAAATACGCAGACTCTGGGCTTCAGCCAAGGTGGGCCTAATACAATGGCCAATCAGGCAAAGAACTGGCTGCCAGGACCCTGTTACCGCCAACAACGCGTCTCAACGACAACCGGGCAAAACAACAATAGCAACTTTGCCTGGACTGCTGGGACCAAATACCATCTGAATGGAAGAAATTCATTGGCTAATCCTGGCATCGCTATGGCAACACACAAAGACGACGAGGAGCGTTTTTTTCCCAGTAACGGGATCCTGATTTTTGGCAAACAAAATGCTGCCAGAGACAATGCGGATTACAGCGATGTCATGCTCACCAGCGAGGAAGAAATCAAAACCACTAACCCTGTGGCTACAGAGGAATACGGTATCGTGGCAGATAACTTGCAGCAGCAAAACACGGCTCCTCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAACCGGGACGTGTACCTGCAGGGTCCCATCTGGGCCAAGATTCCTCACACGGACGGCAACTTCCACCCGTCTCCGCTGATGGGCGGCTTTGGCCTGAAACATCCTCCGCCTCAGATCCTGATCAAGAACACGCCTGTACCTGCGGATCCTCCGACCACCTTCAACCAGTCAAAGCTGAACTCTTTCATCACGCAATACAGCACCGGACAGGTCAGCGTGGAAATTGAATGGGAGCTGCAGAAGGAAAACAGCAAGCGCTGGAACCCCGAGATCCAGTACACCTCCAACTACTACAAATCTACAAGTGTGGACTTTGCTGTTAATACAGAAGGCGTGTACTCTGAACCCCGCCCCATTGGCACCCGTTACCTCACCCGTAATCTGTAAAGCTGGGGAGATGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCCCTCGAcgcgccggcg.

SEQ ID NO.15：

ccattcgccattcaggctgcaaataagcgttgatattcagtcaattacaaacattaataacgaagagatgacagaaaaattttcattctgtgacagagaaaaagtagccgaagatgacggtttgtcacatggagttggcaggatgtttgattaaaaacataacaggaagaaaaatgccccgctgtgggcggacaaaatagttgggaactgggaggggtggaaatggagtttttaaggattatttagggaagagtgacaaaatagatgggaactgggtgtagcgtcgtaagctaatacgaaaattaaaaatgacaaaatagtttggaactagatttcacttatctggttcggatctcctaggggcgcgcccgtcgacgcgccggcgacatgtcctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgcacgcgtgtgtctagaacgcgtggagctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggtaccgaaaaccccggtccggctagcgccaccggatccggcggatctggcatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggctccggagactacaaggatgacgatgacaaggattacaaagacgacgatgataaggactataaggatgatgacgacaaataaaagctttaaaccggttatcgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccggaactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctatgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgataccgagcgctgctcgagagatctacgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtccttctgattttgtaggtaaccacgtgcggaccgagcggccgcaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggcgcccctcgaggactagtgaattcgtcgacctattaatattccggagtatacgtagccaaccactagaactatagctagagtcctgggcgaacaaacgatgctcgccttccagaaaaccgaggatgcgaaccacttcatccggggtcagcaccaccggcaagcgccgcgacggccgaggtcttccgatctcctgaagccagggcagatccgtgcacagcaccttgccgtagaagaacagcaaggccgccaatgcctgacgatgcgtggagaccgaaaccttgcgctcgttcgccagccaggacagaaatgcctcgacttcgctgctgcccaaggttgccgggtgacgcacaccgtggaaacggatgaaggcacgaacccagttgacataagcctgttcggttcgtaaactgtaatgcaagtagcgtatgcgctcacgcaactggtccagaaccttgaccgaacgcagcggtggtaacggcgcagtggcggttttcatggcttgttatgactgtttttttgtacagtctatgcctcgggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggtggctcaagtatgggcatcattcgcacatgtaggctcggccctgaccaagtcaaatccatgcgggctgctcttgatcttttcggtcgtgagttcggagacgtagccacctactcccaacatcagccggactccgattacctcgggaacttgctccgtagtaagacattcatcgcgcttgctgccttcgaccaagaagcggttgttggcgctctcgcggcttacgttctgcccaggtttgagcagccgcgtagtgagatctatatctatgatctcgcagtctccggcgagcaccggaggcagggcattgccaccgcgctcatcaatctcctcaagcatgaggccaacgcgcttggtgcttatgtgatctacgtgcaagcagattacggtgacgatcccgcagtggctctctatacaaagttgggcatacgggaagaagtgatgcactttgatatcgacccaagtaccgccacctaacaattcgttcaagccgagatcggcttcccggccgcggagttgttcggtaaattgtcacaacgccgcgaatatagtctttaccatgcccttggccacgcccctctttaatacgacgggcaatttgcacttcagaaaatgaagagtttgctttagccataacaaaagtccagtatgctttttcacagcataactggactgatttcagtttacaactattctgtctagtttaagactttattgtcatagtttagatctattttgttcagtttaagactttattgtccgcccacacccgcttacgcagggcatccatttattactcaaccgtaaccgattttgccaggttacgcggctggtctgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtc.

SEQ ID NO.16：

ATGCATtaccatcgcatacaacattatgaatacaaggggttgtgttaataataataaaatgatatttatgaatgctttgggcttgcaacctcaaagtaaattgaaaattattgcacataaaatactagaaaaatgtaaacgtgacgcgtacacgcgtttcaagggcgtaaaggcgatcaagaatgaactaaaaacatacaatcttacgttgcaacaatacaacgaggcgctcaatcagtgcgctttaaacgatagccgatggcgcgacacaaataattggcatcacgatattgaagaaggtgtgaaaataaacaagagacatatatatagagttaattttaattctaaaacccaagaaattgaagaatattattacattaaagtagaatgttatgtaaacagttaaACTAGT.

SEQ ID NO.17：

Gcatgcttaatctacatttattgtaacatttgtggtaatagtggcgttggttatacatttatatgattgtaatgttgtgtactcgttttgtaataaatttttgtgtttaatcaattcaatatttttatttgataaaaccttattttcgctactcaatttggcgtttttagacgcaagttttgcgtaatcgtcattgagcgattttagcgccttttcagttgtaattcgtttcagttgcaattctttaaaagatttatgcatgttgttgtagtcgcttttaattttgtctaacttttcttgcatagaaacgcttgtttgttgtaatttgtctaaatctaattgttgtttaatgttgagctgcgtttgttcggcaatgtctacctgtagtttttttagtatcgcttgtgcttcagacagcatagtgtcgtcggcatttgcgttgttgtcttcgtttaaac.

SEQ ID NO.18：478bp

AtgcatCGCGCGCGacattaaagattacacatcgacgccccatcattttttccatcagtctaaaatttacaccaacagcgcggcgcccgacgaagactcgcaagacgacagtaataccaccgtggtaattatcgctattgtcgctgcaatgatcctattctgtggattattgttatttttgttttgctgtataaaaaaacggtgtcatcaatcaaataacgtggttgtgcaatacaaaaataacaatgaatttgtcacaatttgcaataatttagaagacaatcgagcatacattaatttacctaatgaatacgatagcgatgatatgccaaaaccattgtaccctttacttggctttaatgatgatttgttaaaagatgataaacctgtgttgtaccctatgattatagaaagaataaaataaaacatgtataattgaaataaatatattatttaataaaatgttttttatactagt.

SEQ ID NO.19：

Gcatgcaatgttttttatttatatactattttctattacatattccaatgcacacaaatgtttaatggctatcagttttaattttactaattcgtctaaacaaaaattattcacttgctgtttttcatccatttgacatatggcgtttataaataattcgctgtgttttatgaacgaatcgtaaaccgctgcctgggccttcagcacggtcggcgcattgtatttttgggtaaagtacgcaatatttttagtcaaacacagagattttaaatctttttcatttatatccaagtcggaacaatcgtatacaaaatctagcttttcactttcgggcgcgcccagatactggtttacgagttcgagctgctccacttggcctttgatatcggccgctatgcacaacattttgtcgattgcagtgtttaaac.

SEQ ID NO.44（5644bp）

tggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcgtttaaacctccaccttctcctattcctcctacacctacaccttcgccgccgccttctcccagtcctttgggcgaacctatgtattatccttctaatatagatacaaatgaagcattaataaattttcttaggccgttgtgtgcaactgatagaactcgagcaacatacgctgtgccgtggaattgtaacgggatatttcattgcaattacttctctattcctttttatatcctcagctgtcacaacaatgcgtattcgtttgttaacgatggttgtattgactttaacagctcggactgcccgttgtatccgcttaacgtgctttaacccgggactagtaagcttatgggaattagccatggtccatatgaatatcctccttagttcctattccgaagttcctattctctagaaagtataggaacttcggcgcgcctacctgtgacggaagatcacttcgcagaataaataaatcctggtgtccctgttgataccgggaagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttgtcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattacgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaggcgcgccatttaaatgaagttcctattccgaagttcctattctctagaaagtataggaacttcgaagcagctccagcctacacgctagctccggaatattaatagCCTCGAGGcgccggcggtcgaaggcactcgcttcgatcaatggacaaagaatcaatcgttcgtaggcaacagaatgtcggaaagtttgcattggatgcgcggcgggtccaacttgccgcaaaactgcggcgagttcaacgtggtgtccagcctgttgatgtgcaacaatacgataatgaaaaattgataacgcttgcacgattgcaaacatgcacgctcggttgaataaaagctcgcatcgtcgtcgtaaaattagttgtatcaaagagcagctgcaattagaatcactgctaaaaAGATCTGCCGCCATGGGAGTCAAAGTTCTGTTTGCCCTGATCTGCATCGCTGTGGCCGAGGCCAAGCCCACCGAGAACAACGAAGACTTCAACATCGTGGCCGTGGCCAGCAACTTCGCGACCACGGATCTCGATGCTGACCGCGGGAAGTTGCCCGGCAAGAAGCTGCCGCTGGAGGTGCTCAAAGAGTTGGAAGCCAATGCCCGGAAAGCTGGCTGCACCAGGGGCTGTCTGATCTGCCTGTCCCACATCAAGTGCACGCCCAAGATGAAGAAGTTCATCCCAGGACGCTGCCACACCTACGAAGGCGACAAAGAGTCCGCACAGGGCGGCATAGGCGAGGCGATCGTCGACATTCCTGAGATTCCTGGGTTCAAGGACTTGGAGCCCTTGGAGCAGTTCATCGCACAGGTCGATCTGTGTGTGGACTGCACAACTGGCTGCCTCAAAGGGCTTGCCAACGTGCAGTGTTCTGACCTGCTCAAGAAGTGGCTGCCGCAACGCTGTGCGACCTTTGCCAGCAAGATCCAGGGCCAGGTGGACAAGATCAAGGGGGCCGGTGGTGACTAATCTAGAGTCGGGGCGGCCGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTGATATCGCGGCCGCGCTAGCGcatgcttaatttggcacgattcggtcgcgacgatgtttcaacacgtttattgtcgtgtccgtgattacacattcgtaaatgttttcgtgcagtaactccggcaagtcggttaaaatcatgagaccgttcaatggcccattgagtgtgttaaacgacttattcacggcgtcatactctaactcggttgttggcatccatttatatttgacgtatctcaactcggtgtcgagcacgacatacccgtccacggacacggtcatgtaattgctctgctgtagcggtggatcaaaaaattgctgaaaccgcaattcaattgcggggcaagtgtcggtcaacgtgacgctttgcacgttgttgttcatgtagtttatacattcgatggccgtcaccggatctatagcgtatgaatgcaTgacttcacccacacacttggagtcgtggttgtagaaatgcgtcagagccttgattaaacatcggttttcacacttggcacacgaaaccacgtttgcaatgtaacagtttagtataaacctcttcctgtacataccgccgcgcggtacattgttttctttcaaatcgttcaatattttttttatacacggaggcatattaatcttgttgttcagcatgtcgacgacatttttctttccttctacgcattctttcatacaaatgtttctcttgctgcgttttttaaaattggaatttttaatttcattaatagtgggcggagccgttcc.2467..2778=312bp：HAR(ORF91) A homology arm; 4913. 5311=399 bp: HAL (lef 4) homology arm; the area between taa and tta of the font identification is bolded: 2782. 4909=2128 bp inserted exogenous gene.

SEQ ID NO.45（12097bp）

ccattcgccattcaggctgcaaataagcgttgatattcagtcaattacaaacattaataacgaagagatgacagaaaaattttcattctgtgacagagaaaaagtagccgaagatgacggtttgtcacatggagttggcaggatgtttgattaaaaacataacaggaagaaaaatgccccgctgtgggcggacaaaatagttgggaactgggaggggtggaaatggagtttttaaggattatttagggaagagtgacaaaatagatgggaactgggtgtagcgtcgtaagctaatacgaaaattaaaaatgacaaaatagtttggaactagatttcacttatctggttcggatctcctaggctcgaggcatgcAGATCTGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGTACTTCTCGACacctgatttaaatcatttattgttcaaagatgcagtcatccaaatccacattgaccagatcgcaggcagtgcaagcgtctggcacctttcccatgatatgatgaatgtagcacagtttctgatacgcctttttgacgacagaaacgggttgagattctgacacgggaaagcactctaaacagtctttctgtccgtgagtgaagcagatatttgaattctgattcattctctcgcattgtctgcagggaaacagcatcagattcatgcccacgtgacgagaacatttgttttggtacctgtctgcgtagttgatcgaagcCtccgcgtctgacgtcgatggctgcgcaactgactcgcgcacccgtttgggctcacttatatctgcgtcactgggggcgggtcttttcttggctccaccctttttgacgtagaattcatgctccacctcaaccacgtgatcctttgcccaccggaaaaagtctttgacttcctgcttggtgaccttcccaaagtcatgatccagacggcgggtgagttcaaatttgaacatccggtcttgcaacggctgctggtgttcgaaggtcgttgagttcccgtcaatcacggcgcacatgttggtgttggaggtgacgatcacgggagtcgggtctatctgggccgaggacttgcatttctggtccacgcgcaccttgcttcctccgagaatggctttggccgactccacgaccttggcggtcatcttcccctcctcccaccagatcaccatcttgtcgacacagtcgttgaagggaaagttctcattggtccagtttacgcacccgtagaagggcacagtgtgggctatggcctccgcgatgttggtcttcccggtagttgcaggcccaaacagccagatggtgttcctcttgccgaactttttcgtggcccatcccagaaagacggaagccgcatattggggatcgtacccgtttagttccaaaattttataaatccgattgctggaaatgtcctccacgggctgctggcccaccaggtagtcgggggcggttttagtcaggctcataatctttcccgcattgtccaaggcagccttgatttgggaccgcgagttggaggccgcattgaaggagatgtatgaggcctggtcctcctgAatccactgcttctccgaggtaatccccttgtccacgagccacccgaccagctccatgtacctggctgaagtttttgatctgatcaccggcgcGtcagaattgggattctgattctctttgttctgctcctgcgtctgcgacacgtgcgtcagatgctgcgccaccaaccgtttacgctccgtgagattcaaacaggcgcttaaatactgttccaAattagtccacgcccactggagctcaggctgggttttggggagcaagtaattggggatgtagcactcGtccaccaccttgttcccgcctccggcgccGtttctggtctttgtgaccgcgaaccagtttggcaaagtcggctcgatcccgcggtaaattctctgaatcagtttttcgcgaatctgactcaggaaacgtcccaaaaccaAggatttcaccccggtggtttccacgagcacgtgcaAgtggaagtagctctctcccttctcaaattgcacaaagaaaagagcctccggggccttactcacacggcgccaCtccgtcagaaagtcgcgctgcagcttctcggccacggtcaggggtgcctgctcaatcagattcagatccaAgtcagaatctggcggcaactcccaCtccttctcggccacccagttcacaaagctgtcagaaatgccgggcagatgctcgtcaaggtcgctggggaccttaatcacaatctcgtaaaaccccgCcaGggcggcGACCGCGCCCGATGGTGGGACGGTATGAATAATCCGTATTTATAGGTTTTTTTATTACAAAACTGTTACGAAAACAGTAAAATACTTATTTATTTGCGAGATGGTTATCATTTTAATTATCTCCATGATCTATTAATATTCCTGCAGGCCGGAGTATACGGACCTTTAATTCAACCCAACACAATATATTATAGTTAAATAAGAATTATTATCAAATCATTTGTATATTAATTAAAATACTATACTGTAAATTACATTTTATTTACAATCACTCGACcAAGACTTACACCCGGGggTtccgttaagGCCGCCACGGCTGCCGACGGTTATCTACCCGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCGCGAGTGGTGGGCtCTCAAACCCGGCGCTCCTAAGCCAAAGGCTAACCAACAGAAACAAGACGACGGcCGCGGCCTtGTTCTCCCCGGTTACAAATACCTcGGACCCTTCAACGGGCTcGACAAGGGCGAACCCGTGAACGCgGCGGACGCCGCgGCCCTTGAGCACGATAAGGCTTACGACCAaCAACTcCAGGCCGGCGACAACCCTTACCTTCGTTATAACCACGCCGACGCcGAATTCCAGGAGCGTCTcCAAGAAGATACcTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGAAGCGGGTTCTCGAACCTCTCGGTCTGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAGAGACCGGTAGAGCCATCACCCCAGCGTTCTCCAGACTCCTCTACGGGCATCGGCAAGAAAGGCCAACAGCCCGCCAGAAAAAGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGTTCCAGACCCTCAACCTCTCGGAGAACCTCCAGCAGCGCCCTCTGGTGTGGGACCTAATACAATGGCTGCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGGCGCCGACGGAGTGGGTAGTTCCTCGGGAAATTGGCATTGCGATTCCACATGGCTGGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACCTCTACAAGCAAATCTCCAACGGGACATCGGGAGGAGCCACCAACGACAACACCTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGACTTTAACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCCAAGAGACTCAGCTTCAAGCTCTTCAACATCCAGGTCAAGGAGGTCACGCAGAATGAAGGCACCAAGACCATCGCCAATAACCTCACCAGCACCATCCAGGTGTTTACGGACTCGGAGTACCAGCTGCCGTACGTTCTCGGCTCTGCCCACCAGGGCTGCCTGCCTCCGTTCCCGGCGGACGTGTTCATGATTCCCCAGTACGGCTACCTAACACTCAACAACGGTAGTCAGGCCGTGGGACGCTCCTCCTTCTACTGCCTGGAATACTTTCCTTCGCAGATGCTGAGAACCGGCAACAACTTCCAGTTTACTTACACCTTCGAGGACGTGCCTTTCCACAGCAGCTACGCCCACAGCCAGAGCTTGGACCGGCTGATGAATCCTCTGATTGACCAGTACCTGTACTACTTGTCTCGGACTCAAACAACAGGAGGCACGGCAAATACGCAGACTCTGGGCTTCAGCCAAGGTGGGCCTAATACAATGGCCAATCAGGCAAAGAACTGGCTGCCAGGACCCTGTTACCGCCAACAACGCGTCTCAACGACAACCGGGCAAAACAACAATAGCAACTTTGCCTGGACTGCTGGGACCAAATACCATCTGAATGGAAGAAATTCATTGGCTAATCCTGGCATCGCTATGGCAACACACAAAGACGACGAGGAGCGTTTTTTTCCCAGTAACGGGATCCTGATTTTTGGCAAACAAAATGCTGCCAGAGACAATGCGGATTACAGCGATGTCATGCTCACCAGCGAGGAAGAAATCAAAACCACTAACCCTGTGGCTACAGAGGAATACGGTATCGTGGCAGATAACTTGCAGCAGCAAAACACGGCTCCTCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAACCGGGACGTGTACCTGCAGGGTCCCATCTGGGCCAAGATTCCTCACACGGACGGCAACTTCCACCCGTCTCCGCTGATGGGCGGCTTTGGCCTGAAACATCCTCCGCCTCAGATCCTGATCAAGAACACGCCTGTACCTGCGGATCCTCCGACCACCTTCAACCAGTCAAAGCTGAACTCTTTCATCACGCAATACAGCACCGGACAGGTCAGCGTGGAAATTGAATGGGAGCTGCAGAAGGAAAACAGCAAGCGCTGGAACCCCGAGATCCAGTACACCTCCAACTACTACAAATCTACAAGTGTGGACTTTGCTGTTAATACAGAAGGCGTGTACTCTGAACCCCGCCCCATTGGCACCCGTTACCTCACCCGTAATCTGTAAAGCTGGGGAGATGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCCCTCGAcgcgccggcgacatgtcctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgcacgcgtgtgtctagaacgcgtggagctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggtaccgaaaaccccggtccggctagcgccaccggatccggcggatctggcatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggctccggagactacaaggatgacgatgacaaggattacaaagacgacgatgataaggactataaggatgatgacgacaaataaaagctttaaaccggttatcgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccggaactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctatgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgataccgagcgctgctcgagagatctacgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtccttctgattttgtaggtaaccacgtgcggaccgagcggccgcaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggcgcccctcgaggactagtgaattcgtcgacctattaatattccggagtatacgtagccaaccactagaactatagctagagtcctgggcgaacaaacgatgctcgccttccagaaaaccgaggatgcgaaccacttcatccggggtcagcaccaccggcaagcgccgcgacggccgaggtcttccgatctcctgaagccagggcagatccgtgcacagcaccttgccgtagaagaacagcaaggccgccaatgcctgacgatgcgtggagaccgaaaccttgcgctcgttcgccagccaggacagaaatgcctcgacttcgctgctgcccaaggttgccgggtgacgcacaccgtggaaacggatgaaggcacgaacccagttgacataagcctgttcggttcgtaaactgtaatgcaagtagcgtatgcgctcacgcaactggtccagaaccttgaccgaacgcagcggtggtaacggcgcagtggcggttttcatggcttgttatgactgtttttttgtacagtctatgcctcgggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggtggctcaagtatgggcatcattcgcacatgtaggctcggccctgaccaagtcaaatccatgcgggctgctcttgatcttttcggtcgtgagttcggagacgtagccacctactcccaacatcagccggactccgattacctcgggaacttgctccgtagtaagacattcatcgcgcttgctgccttcgaccaagaagcggttgttggcgctctcgcggcttacgttctgcccaggtttgagcagccgcgtagtgagatctatatctatgatctcgcagtctccggcgagcaccggaggcagggcattgccaccgcgctcatcaatctcctcaagcatgaggccaacgcgcttggtgcttatgtgatctacgtgcaagcagattacggtgacgatcccgcagtggctctctatacaaagttgggcatacgggaagaagtgatgcactttgatatcgacccaagtaccgccacctaacaattcgttcaagccgagatcggcttcccggccgcggagttgttcggtaaattgtcacaacgccgcgaatatagtctttaccatgcccttggccacgcccctctttaatacgacgggcaatttgcacttcagaaaatgaagagtttgctttagccataacaaaagtccagtatgctttttcacagcataactggactgatttcagtttacaactattctgtctagtttaagactttattgtcatagtttagatctattttgttcagtttaagactttattgtccgcccacacccgcttacgcagggcatccatttattactcaaccgtaaccgattttgccaggttacgcggctggtctgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtc.9363..9587=225bp：Tn7R A homology arm; 348 = 166bp: a Tn7R homology arm; the area between the two: 34962=9014 bp inserted exogenous gene.

SEQ ID NO.46（12716bp）

tggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcgtttaaacctccaccttctcctattcctcctacacctacaccttcgccgccgccttctcccagtcctttgggcgaacctatgtattatccttctaatatagatacaaatgaagcattaataaattttcttaggccgttgtgtgcaactgatagaactcgagcaacatacgctgtgccgtggaattgtaacgggatatttcattgcaattacttctctattcctttttatatcctcagctgtcacaacaatgcgtattcgtttgttaacgatggttgtattgactttaacagctcggactgcccgttgtatccgcttaacgtgctttaagcatgCAGATCTGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGTACTTCTCGACacctgatttaaatcatttattgttcaaagatgcagtcatccaaatccacattgaccagatcgcaggcagtgcaagcgtctggcacctttcccatgatatgatgaatgtagcacagtttctgatacgcctttttgacgacagaaacgggttgagattctgacacgggaaagcactctaaacagtctttctgtccgtgagtgaagcagatatttgaattctgattcattctctcgcattgtctgcagggaaacagcatcagattcatgcccacgtgacgagaacatttgttttggtacctgtctgcgtagttgatcgaagcCtccgcgtctgacgtcgatggctgcgcaactgactcgcgcacccgtttgggctcacttatatctgcgtcactgggggcgggtcttttcttggctccaccctttttgacgtagaattcatgctccacctcaaccacgtgatcctttgcccaccggaaaaagtctttgacttcctgcttggtgaccttcccaaagtcatgatccagacggcgggtgagttcaaatttgaacatccggtcttgcaacggctgctggtgttcgaaggtcgttgagttcccgtcaatcacggcgcacatgttggtgttggaggtgacgatcacgggagtcgggtctatctgggccgaggacttgcatttctggtccacgcgcaccttgcttcctccgagaatggctttggccgactccacgaccttggcggtcatcttcccctcctcccaccagatcaccatcttgtcgacacagtcgttgaagggaaagttctcattggtccagtttacgcacccgtagaagggcacagtgtgggctatggcctccgcgatgttggtcttcccggtagttgcaggcccaaacagccagatggtgttcctcttgccgaactttttcgtggcccatcccagaaagacggaagccgcatattggggatcgtacccgtttagttccaaaattttataaatccgattgctggaaatgtcctccacgggctgctggcccaccaggtagtcgggggcggttttagtcaggctcataatctttcccgcattgtccaaggcagccttgatttgggaccgcgagttggaggccgcattgaaggagatgtatgaggcctggtcctcctgAatccactgcttctccgaggtaatccccttgtccacgagccacccgaccagctccatgtacctggctgaagtttttgatctgatcaccggcgcGtcagaattgggattctgattctctttgttctgctcctgcgtctgcgacacgtgcgtcagatgctgcgccaccaaccgtttacgctccgtgagattcaaacaggcgcttaaatactgttccaAattagtccacgcccactggagctcaggctgggttttggggagcaagtaattggggatgtagcactcGtccaccaccttgttcccgcctccggcgccGtttctggtctttgtgaccgcgaaccagtttggcaaagtcggctcgatcccgcggtaaattctctgaatcagtttttcgcgaatctgactcaggaaacgtcccaaaaccaAggatttcaccccggtggtttccacgagcacgtgcaAgtggaagtagctctctcccttctcaaattgcacaaagaaaagagcctccggggccttactcacacggcgccaCtccgtcagaaagtcgcgctgcagcttctcggccacggtcaggggtgcctgctcaatcagattcagatccaAgtcagaatctggcggcaactcccaCtccttctcggccacccagttcacaaagctgtcagaaatgccgggcagatgctcgtcaaggtcgctggggaccttaatcacaatctcgtaaaaccccgCcaGggcggcGACCGCGCCCGATGGTGGGACGGTATGAATAATCCGTATTTATAGGTTTTTTTATTACAAAACTGTTACGAAAACAGTAAAATACTTATTTATTTGCGAGATGGTTATCATTTTAATTATCTCCATGATCTATTAATATTCCTGCAGGCCGGAGTATACGGACCTTTAATTCAACCCAACACAATATATTATAGTTAAATAAGAATTATTATCAAATCATTTGTATATTAATTAAAATACTATACTGTAAATTACATTTTATTTACAATCACTCGACcAAGACTTACACCCGGGggTtccgttaagGCCGCCACGGCTGCCGACGGTTATCTACCCGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCGCGAGTGGTGGGCtCTCAAACCCGGCGCTCCTAAGCCAAAGGCTAACCAACAGAAACAAGACGACGGcCGCGGCCTtGTTCTCCCCGGTTACAAATACCTcGGACCCTTCAACGGGCTcGACAAGGGCGAACCCGTGAACGCgGCGGACGCCGCgGCCCTTGAGCACGATAAGGCTTACGACCAaCAACTcCAGGCCGGCGACAACCCTTACCTTCGTTATAACCACGCCGACGCcGAATTCCAGGAGCGTCTcCAAGAAGATACcTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGAAGCGGGTTCTCGAACCTCTCGGTCTGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAGAGACCGGTAGAGCCATCACCCCAGCGTTCTCCAGACTCCTCTACGGGCATCGGCAAGAAAGGCCAACAGCCCGCCAGAAAAAGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGTTCCAGACCCTCAACCTCTCGGAGAACCTCCAGCAGCGCCCTCTGGTGTGGGACCTAATACAATGGCTGCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGGCGCCGACGGAGTGGGTAGTTCCTCGGGAAATTGGCATTGCGATTCCACATGGCTGGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACCTCTACAAGCAAATCTCCAACGGGACATCGGGAGGAGCCACCAACGACAACACCTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGACTTTAACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCCAAGAGACTCAGCTTCAAGCTCTTCAACATCCAGGTCAAGGAGGTCACGCAGAATGAAGGCACCAAGACCATCGCCAATAACCTCACCAGCACCATCCAGGTGTTTACGGACTCGGAGTACCAGCTGCCGTACGTTCTCGGCTCTGCCCACCAGGGCTGCCTGCCTCCGTTCCCGGCGGACGTGTTCATGATTCCCCAGTACGGCTACCTAACACTCAACAACGGTAGTCAGGCCGTGGGACGCTCCTCCTTCTACTGCCTGGAATACTTTCCTTCGCAGATGCTGAGAACCGGCAACAACTTCCAGTTTACTTACACCTTCGAGGACGTGCCTTTCCACAGCAGCTACGCCCACAGCCAGAGCTTGGACCGGCTGATGAATCCTCTGATTGACCAGTACCTGTACTACTTGTCTCGGACTCAAACAACAGGAGGCACGGCAAATACGCAGACTCTGGGCTTCAGCCAAGGTGGGCCTAATACAATGGCCAATCAGGCAAAGAACTGGCTGCCAGGACCCTGTTACCGCCAACAACGCGTCTCAACGACAACCGGGCAAAACAACAATAGCAACTTTGCCTGGACTGCTGGGACCAAATACCATCTGAATGGAAGAAATTCATTGGCTAATCCTGGCATCGCTATGGCAACACACAAAGACGACGAGGAGCGTTTTTTTCCCAGTAACGGGATCCTGATTTTTGGCAAACAAAATGCTGCCAGAGACAATGCGGATTACAGCGATGTCATGCTCACCAGCGAGGAAGAAATCAAAACCACTAACCCTGTGGCTACAGAGGAATACGGTATCGTGGCAGATAACTTGCAGCAGCAAAACACGGCTCCTCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAACCGGGACGTGTACCTGCAGGGTCCCATCTGGGCCAAGATTCCTCACACGGACGGCAACTTCCACCCGTCTCCGCTGATGGGCGGCTTTGGCCTGAAACATCCTCCGCCTCAGATCCTGATCAAGAACACGCCTGTACCTGCGGATCCTCCGACCACCTTCAACCAGTCAAAGCTGAACTCTTTCATCACGCAATACAGCACCGGACAGGTCAGCGTGGAAATTGAATGGGAGCTGCAGAAGGAAAACAGCAAGCGCTGGAACCCCGAGATCCAGTACACCTCCAACTACTACAAATCTACAAGTGTGGACTTTGCTGTTAATACAGAAGGCGTGTACTCTGAACCCCGCCCCATTGGCACCCGTTACCTCACCCGTAATCTGTAAAGCTGGGGAGATGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCCCTCGAcgcgccggcGacatgtcctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgcacgcgtgtgtctagaacgcgtggagctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggtaccgaaaaccccggtccggctagcgccaccggatccggcggatctggcatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggctccggagactacaaggatgacgatgacaaggattacaaagacgacgatgataaggactataaggatgatgacgacaaataaaagctttaaaccggttatcgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccggaactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctatgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgataccgagcgctgctcgagagatctacgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtccttctgattttgtaggtaaccacgtgcggaccgagcggccgcaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggcgccCCTCGAGGctattaatattccggagctagcgtgtaggctggagctgcttcgaagttcctatactttctagagaataggaacttcggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgccgaagttcctatactttctagagaataggaacttcggaataggaactaaggaggatattcatatggaccatggctaattcccataagcttctgcagggatcccgcggagtgatggtggtgatgatggaccatggtgcttgtgtgttccttattgaagccttggtgtgactgatttactagtagcgttgaggcgtcttatatacccgaccgttatctggcctacgtgacacaaggcacgttgttagattaataatcttatctttttatcttaattgataagattatttttatctggctgttataaaaacgggataaaatgtaatttacagtatagtattttaattaatatacaaatgatttgataataattcttatttaactataatatattgtgttgggttgaattaaaggtcccgggttaatttggcacgattcggtcgcgacgatgtttcaacacgtttattgtcgtgtccgtgattacacattcgtaaatgttttcgtgcagtaactccggcaagtcggttaaaatcatgagaccgttcaatggcccattgagtgtgttaaacgacttattcacggcgtcatactctaactcggttgttggcatccatttatatttgacgtatctcaactcggtgtcgagcacgacatacccgtccacggacacggtcatgtaattgctctgctgtagcggtggatcaaaaaattgctgaaaccgcaattcaattgcggggcaagtgtcggtcaacgtgacgctttgcacgttgttgttcatgtagtttatacattcgatggccgtcaccggatctatagcgtatgaatgcaTgacttcacccacacacttggagtcgtggttgtagaaatgcgtcagagccttgattaaacatcggttttcacacttggcacacgaaaccacgtttgcaatgtaacagtttagtataaacctcttcctgtacataccgccgcgcggtacattgttttctttcaaatcgttcaatattttttttatacacggaggcatattaatcttgttgttcagcatgtcgacgacatttttctttccttctacgcattctttcatacaaatgtttctcttgctgcgttttttaaaattggaatttttaatttcattaatagtgggcggagccgttcc.2467..2778=312bp：HAR(ORF91) A homology arm; 11985. 12383=399 bp: HAL (lef 4) homology arm; the area between taa and tta of the font identification is bolded: 2782. 11981=9200 bp inserted exogenous gene; 7602=2510bp p10-Cap8-PA, 5252 therein 7468=2217bp Cap8.

SEQ ID NO.47（9720bp）

tggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcgtttaaacctccaccttctcctattcctcctacacctacaccttcgccgccgccttctcccagtcctttgggcgaacctatgtattatccttctaatatagatacaaatgaagcattaataaattttcttaggccgttgtgtgcaactgatagaactcgagcaacatacgctgtgccgtggaattgtaacgggatatttcattgcaattacttctctattcctttttatatcctcagctgtcacaacaatgcgtattcgtttgttaacgatggttgtattgactttaacagctcggactgcccgttgtatccgcttaacgtgctttaagcatgCAGATCTGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGTACTTCTCGACacctgatttaaatcatttattgttcaaagatgcagtcatccaaatccacattgaccagatcgcaggcagtgcaagcgtctggcacctttcccatgatatgatgaatgtagcacagtttctgatacgcctttttgacgacagaaacgggttgagattctgacacgggaaagcactctaaacagtctttctgtccgtgagtgaagcagatatttgaattctgattcattctctcgcattgtctgcagggaaacagcatcagattcatgcccacgtgacgagaacatttgttttggtacctgtctgcgtagttgatcgaagcCtccgcgtctgacgtcgatggctgcgcaactgactcgcgcacccgtttgggctcacttatatctgcgtcactgggggcgggtcttttcttggctccaccctttttgacgtagaattcatgctccacctcaaccacgtgatcctttgcccaccggaaaaagtctttgacttcctgcttggtgaccttcccaaagtcatgatccagacggcgggtgagttcaaatttgaacatccggtcttgcaacggctgctggtgttcgaaggtcgttgagttcccgtcaatcacggcgcacatgttggtgttggaggtgacgatcacgggagtcgggtctatctgggccgaggacttgcatttctggtccacgcgcaccttgcttcctccgagaatggctttggccgactccacgaccttggcggtcatcttcccctcctcccaccagatcaccatcttgtcgacacagtcgttgaagggaaagttctcattggtccagtttacgcacccgtagaagggcacagtgtgggctatggcctccgcgatgttggtcttcccggtagttgcaggcccaaacagccagatggtgttcctcttgccgaactttttcgtggcccatcccagaaagacggaagccgcatattggggatcgtacccgtttagttccaaaattttataaatccgattgctggaaatgtcctccacgggctgctggcccaccaggtagtcgggggcggttttagtcaggctcataatctttcccgcattgtccaaggcagccttgatttgggaccgcgagttggaggccgcattgaaggagatgtatgaggcctggtcctcctgAatccactgcttctccgaggtaatccccttgtccacgagccacccgaccagctccatgtacctggctgaagtttttgatctgatcaccggcgcGtcagaattgggattctgattctctttgttctgctcctgcgtctgcgacacgtgcgtcagatgctgcgccaccaaccgtttacgctccgtgagattcaaacaggcgcttaaatactgttccaAattagtccacgcccactggagctcaggctgggttttggggagcaagtaattggggatgtagcactcGtccaccaccttgttcccgcctccggcgccGtttctggtctttgtgaccgcgaaccagtttggcaaagtcggctcgatcccgcggtaaattctctgaatcagtttttcgcgaatctgactcaggaaacgtcccaaaaccaAggatttcaccccggtggtttccacgagcacgtgcaAgtggaagtagctctctcccttctcaaattgcacaaagaaaagagcctccggggccttactcacacggcgccaCtccgtcagaaagtcgcgctgcagcttctcggccacggtcaggggtgcctgctcaatcagattcagatccaAgtcagaatctggcggcaactcccaCtccttctcggccacccagttcacaaagctgtcagaaatgccgggcagatgctcgtcaaggtcgctggggaccttaatcacaatctcgtaaaaccccgCcaGggcggcGACCGCGCCCGATGGTGGGACGGTATGAATAATCCGTATTTATAGGTTTTTTTATTACAAAACTGTTACGAAAACAGTAAAATACTTATTTATTTGCGAGATGGTTATCATTTTAATTATCTCCATGATCTATTAATATTCCTGCAGGCCGGAGTATACGGACCTTTAATTCAACCCAACACAATATATTATAGTTAAATAAGAATTATTATCAAATCATTTGTATATTAATTAAAATACTATACTGTAAATTACATTTTATTTACAATCACTCGACcAAGACTTACACCCGGGggTtccgttaagGCCGCCACGGCTGCCGACGGTTATCTACCCGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCGCGAGTGGTGGGCtCTCAAACCCGGCGCTCCTAAGCCAAAGGCTAACCAACAGAAACAAGACGACGGcCGCGGCCTtGTTCTCCCCGGTTACAAATACCTcGGACCCTTCAACGGGCTcGACAAGGGCGAACCCGTGAACGCgGCGGACGCCGCgGCCCTTGAGCACGATAAGGCTTACGACCAaCAACTcCAGGCCGGCGACAACCCTTACCTTCGTTATAACCACGCCGACGCcGAATTCCAGGAGCGTCTcCAAGAAGATACcTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGAAGCGGGTTCTCGAACCTCTCGGTCTGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAGAGACCGGTAGAGCCATCACCCCAGCGTTCTCCAGACTCCTCTACGGGCATCGGCAAGAAAGGCCAACAGCCCGCCAGAAAAAGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGTTCCAGACCCTCAACCTCTCGGAGAACCTCCAGCAGCGCCCTCTGGTGTGGGACCTAATACAATGGCTGCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGGCGCCGACGGAGTGGGTAGTTCCTCGGGAAATTGGCATTGCGATTCCACATGGCTGGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACCTCTACAAGCAAATCTCCAACGGGACATCGGGAGGAGCCACCAACGACAACACCTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGACTTTAACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCCAAGAGACTCAGCTTCAAGCTCTTCAACATCCAGGTCAAGGAGGTCACGCAGAATGAAGGCACCAAGACCATCGCCAATAACCTCACCAGCACCATCCAGGTGTTTACGGACTCGGAGTACCAGCTGCCGTACGTTCTCGGCTCTGCCCACCAGGGCTGCCTGCCTCCGTTCCCGGCGGACGTGTTCATGATTCCCCAGTACGGCTACCTAACACTCAACAACGGTAGTCAGGCCGTGGGACGCTCCTCCTTCTACTGCCTGGAATACTTTCCTTCGCAGATGCTGAGAACCGGCAACAACTTCCAGTTTACTTACACCTTCGAGGACGTGCCTTTCCACAGCAGCTACGCCCACAGCCAGAGCTTGGACCGGCTGATGAATCCTCTGATTGACCAGTACCTGTACTACTTGTCTCGGACTCAAACAACAGGAGGCACGGCAAATACGCAGACTCTGGGCTTCAGCCAAGGTGGGCCTAATACAATGGCCAATCAGGCAAAGAACTGGCTGCCAGGACCCTGTTACCGCCAACAACGCGTCTCAACGACAACCGGGCAAAACAACAATAGCAACTTTGCCTGGACTGCTGGGACCAAATACCATCTGAATGGAAGAAATTCATTGGCTAATCCTGGCATCGCTATGGCAACACACAAAGACGACGAGGAGCGTTTTTTTCCCAGTAACGGGATCCTGATTTTTGGCAAACAAAATGCTGCCAGAGACAATGCGGATTACAGCGATGTCATGCTCACCAGCGAGGAAGAAATCAAAACCACTAACCCTGTGGCTACAGAGGAATACGGTATCGTGGCAGATAACTTGCAGCAGCAAAACACGGCTCCTCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAACCGGGACGTGTACCTGCAGGGTCCCATCTGGGCCAAGATTCCTCACACGGACGGCAACTTCCACCCGTCTCCGCTGATGGGCGGCTTTGGCCTGAAACATCCTCCGCCTCAGATCCTGATCAAGAACACGCCTGTACCTGCGGATCCTCCGACCACCTTCAACCAGTCAAAGCTGAACTCTTTCATCACGCAATACAGCACCGGACAGGTCAGCGTGGAAATTGAATGGGAGCTGCAGAAGGAAAACAGCAAGCGCTGGAACCCCGAGATCCAGTACACCTCCAACTACTACAAATCTACAAGTGTGGACTTTGCTGTTAATACAGAAGGCGTGTACTCTGAACCCCGCCCCATTGGCACCCGTTACCTCACCCGTAATCTGTAAAGCTGGGGAGATGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCCCTCGAGGctattaatattccggagctagcgtgtaggctggagctgcttcgaagttcctatactttctagagaataggaacttcggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgccgaagttcctatactttctagagaataggaacttcggaataggaactaaggaggatattcatatggaccatggctaattcccataagcttctgcagggatcccgcggagtgatggtggtgatgatggaccatggtgcttgtgtgttccttattgaagccttggtgtgactgatttactagtagcgttgaggcgtcttatatacccgaccgttatctggcctacgtgacacaaggcacgttgttagattaataatcttatctttttatcttaattgataagattatttttatctggctgttataaaaacgggataaaatgtaatttacagtatagtattttaattaatatacaaatgatttgataataattcttatttaactataatatattgtgttgggttgaattaaaggtcccgggttaatttggcacgattcggtcgcgacgatgtttcaacacgtttattgtcgtgtccgtgattacacattcgtaaatgttttcgtgcagtaactccggcaagtcggttaaaatcatgagaccgttcaatggcccattgagtgtgttaaacgacttattcacggcgtcatactctaactcggttgttggcatccatttatatttgacgtatctcaactcggtgtcgagcacgacatacccgtccacggacacggtcatgtaattgctctgctgtagcggtggatcaaaaaattgctgaaaccgcaattcaattgcggggcaagtgtcggtcaacgtgacgctttgcacgttgttgttcatgtagtttatacattcgatggccgtcaccggatctatagcgtatgaatgcaTgacttcacccacacacttggagtcgtggttgtagaaatgcgtcagagccttgattaaacatcggttttcacacttggcacacgaaaccacgtttgcaatgtaacagtttagtataaacctcttcctgtacataccgccgcgcggtacattgttttctttcaaatcgttcaatattttttttatacacggaggcatattaatcttgttgttcagcatgtcgacgacatttttctttccttctacgcattctttcatacaaatgtttctcttgctgcgttttttaaaattggaatttttaatttcattaatagtgggcggagccgttcc.2467..2778=312bp：HAR(ORF91) A homology arm; 9387=399 bp: HAL (lef 4) homology arm; the area between taa and tta of the font identification is bolded: 2782. 8985=6204 bp inserted exogenous gene.

SEQ ID NO.48（9613bp）

tggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcgtttaaacgaagacaacaacgcaaatgccgacgacactatgctgtctgaagcacaagcgatactaaaaaaactacaggtagacattgccgaacaaacgcagctcaacattaaacaacaattagatttagacaaattacaacaaacaagcgtttctatgcaagaaaagttagacaaaattaaaagcgactacaacaacatgcataaatcttttaaagaattgcaactgaaacgaattacaactgaaaaggcgctaaaatcgctcaatgacgattacgcaaaacttgcgtctaaaaacgccaaattgagtagcgaaaataaggttttatcaaataaaaatattgaattgattaaacacaaaaatttattacaaaacgagtacacaacattacaatcatataaatgtataaccaacgccactattaccacaaatgttacaataaatgtagattaagcatgCAGATCTGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGTACTTCTCGACacctgatttaaatcatttattgttcaaagatgcagtcatccaaatccacattgaccagatcgcaggcagtgcaagcgtctggcacctttcccatgatatgatgaatgtagcacagtttctgatacgcctttttgacgacagaaacgggttgagattctgacacgggaaagcactctaaacagtctttctgtccgtgagtgaagcagatatttgaattctgattcattctctcgcattgtctgcagggaaacagcatcagattcatgcccacgtgacgagaacatttgttttggtacctgtctgcgtagttgatcgaagcCtccgcgtctgacgtcgatggctgcgcaactgactcgcgcacccgtttgggctcacttatatctgcgtcactgggggcgggtcttttcttggctccaccctttttgacgtagaattcatgctccacctcaaccacgtgatcctttgcccaccggaaaaagtctttgacttcctgcttggtgaccttcccaaagtcatgatccagacggcgggtgagttcaaatttgaacatccggtcttgcaacggctgctggtgttcgaaggtcgttgagttcccgtcaatcacggcgcacatgttggtgttggaggtgacgatcacgggagtcgggtctatctgggccgaggacttgcatttctggtccacgcgcaccttgcttcctccgagaatggctttggccgactccacgaccttggcggtcatcttcccctcctcccaccagatcaccatcttgtcgacacagtcgttgaagggaaagttctcattggtccagtttacgcacccgtagaagggcacagtgtgggctatggcctccgcgatgttggtcttcccggtagttgcaggcccaaacagccagatggtgttcctcttgccgaactttttcgtggcccatcccagaaagacggaagccgcatattggggatcgtacccgtttagttccaaaattttataaatccgattgctggaaatgtcctccacgggctgctggcccaccaggtagtcgggggcggttttagtcaggctcataatctttcccgcattgtccaaggcagccttgatttgggaccgcgagttggaggccgcattgaaggagatgtatgaggcctggtcctcctgAatccactgcttctccgaggtaatccccttgtccacgagccacccgaccagctccatgtacctggctgaagtttttgatctgatcaccggcgcGtcagaattgggattctgattctctttgttctgctcctgcgtctgcgacacgtgcgtcagatgctgcgccaccaaccgtttacgctccgtgagattcaaacaggcgcttaaatactgttccaAattagtccacgcccactggagctcaggctgggttttggggagcaagtaattggggatgtagcactcGtccaccaccttgttcccgcctccggcgccGtttctggtctttgtgaccgcgaaccagtttggcaaagtcggctcgatcccgcggtaaattctctgaatcagtttttcgcgaatctgactcaggaaacgtcccaaaaccaAggatttcaccccggtggtttccacgagcacgtgcaAgtggaagtagctctctcccttctcaaattgcacaaagaaaagagcctccggggccttactcacacggcgccaCtccgtcagaaagtcgcgctgcagcttctcggccacggtcaggggtgcctgctcaatcagattcagatccaAgtcagaatctggcggcaactcccaCtccttctcggccacccagttcacaaagctgtcagaaatgccgggcagatgctcgtcaaggtcgctggggaccttaatcacaatctcgtaaaaccccgCcaGggcggcGACCGCGCCCGATGGTGGGACGGTATGAATAATCCGTATTTATAGGTTTTTTTATTACAAAACTGTTACGAAAACAGTAAAATACTTATTTATTTGCGAGATGGTTATCATTTTAATTATCTCCATGATCTATTAATATTCCTGCAGGCCGGAGTATACGGACCTTTAATTCAACCCAACACAATATATTATAGTTAAATAAGAATTATTATCAAATCATTTGTATATTAATTAAAATACTATACTGTAAATTACATTTTATTTACAATCACTCGACcAAGACTTACACCCGGGggTtccgttaagGCCGCCACGGCTGCCGACGGTTATCTACCCGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCGCGAGTGGTGGGCtCTCAAACCCGGCGCTCCTAAGCCAAAGGCTAACCAACAGAAACAAGACGACGGcCGCGGCCTtGTTCTCCCCGGTTACAAATACCTcGGACCCTTCAACGGGCTcGACAAGGGCGAACCCGTGAACGCgGCGGACGCCGCgGCCCTTGAGCACGATAAGGCTTACGACCAaCAACTcCAGGCCGGCGACAACCCTTACCTTCGTTATAACCACGCCGACGCcGAATTCCAGGAGCGTCTcCAAGAAGATACcTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGAAGCGGGTTCTCGAACCTCTCGGTCTGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAGAGACCGGTAGAGCCATCACCCCAGCGTTCTCCAGACTCCTCTACGGGCATCGGCAAGAAAGGCCAACAGCCCGCCAGAAAAAGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGTTCCAGACCCTCAACCTCTCGGAGAACCTCCAGCAGCGCCCTCTGGTGTGGGACCTAATACAATGGCTGCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGGCGCCGACGGAGTGGGTAGTTCCTCGGGAAATTGGCATTGCGATTCCACATGGCTGGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACCTCTACAAGCAAATCTCCAACGGGACATCGGGAGGAGCCACCAACGACAACACCTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGACTTTAACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCCAAGAGACTCAGCTTCAAGCTCTTCAACATCCAGGTCAAGGAGGTCACGCAGAATGAAGGCACCAAGACCATCGCCAATAACCTCACCAGCACCATCCAGGTGTTTACGGACTCGGAGTACCAGCTGCCGTACGTTCTCGGCTCTGCCCACCAGGGCTGCCTGCCTCCGTTCCCGGCGGACGTGTTCATGATTCCCCAGTACGGCTACCTAACACTCAACAACGGTAGTCAGGCCGTGGGACGCTCCTCCTTCTACTGCCTGGAATACTTTCCTTCGCAGATGCTGAGAACCGGCAACAACTTCCAGTTTACTTACACCTTCGAGGACGTGCCTTTCCACAGCAGCTACGCCCACAGCCAGAGCTTGGACCGGCTGATGAATCCTCTGATTGACCAGTACCTGTACTACTTGTCTCGGACTCAAACAACAGGAGGCACGGCAAATACGCAGACTCTGGGCTTCAGCCAAGGTGGGCCTAATACAATGGCCAATCAGGCAAAGAACTGGCTGCCAGGACCCTGTTACCGCCAACAACGCGTCTCAACGACAACCGGGCAAAACAACAATAGCAACTTTGCCTGGACTGCTGGGACCAAATACCATCTGAATGGAAGAAATTCATTGGCTAATCCTGGCATCGCTATGGCAACACACAAAGACGACGAGGAGCGTTTTTTTCCCAGTAACGGGATCCTGATTTTTGGCAAACAAAATGCTGCCAGAGACAATGCGGATTACAGCGATGTCATGCTCACCAGCGAGGAAGAAATCAAAACCACTAACCCTGTGGCTACAGAGGAATACGGTATCGTGGCAGATAACTTGCAGCAGCAAAACACGGCTCCTCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAACCGGGACGTGTACCTGCAGGGTCCCATCTGGGCCAAGATTCCTCACACGGACGGCAACTTCCACCCGTCTCCGCTGATGGGCGGCTTTGGCCTGAAACATCCTCCGCCTCAGATCCTGATCAAGAACACGCCTGTACCTGCGGATCCTCCGACCACCTTCAACCAGTCAAAGCTGAACTCTTTCATCACGCAATACAGCACCGGACAGGTCAGCGTGGAAATTGAATGGGAGCTGCAGAAGGAAAACAGCAAGCGCTGGAACCCCGAGATCCAGTACACCTCCAACTACTACAAATCTACAAGTGTGGACTTTGCTGTTAATACAGAAGGCGTGTACTCTGAACCCCGCCCCATTGGCACCCGTTACCTCACCCGTAATCTGTAAAGCTGGGGAGATGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCCCTCGAGGctattaatattccggagctagcgtgtaggctggagctgcttcgaagttcctatactttctagagaataggaacttcggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgccgaagttcctatactttctagagaataggaacttcggaataggaactaaggaggatattcatatggaccatggctaattcccataagcttctgcagggatcccgcggagtgatggtggtgatgatggaccatggtgcttgtgtgttccttattgaagccttggtgtgactgatttactagtttaactgtttacataacattctactttaatgtaataatattcttcaatttcttgggttttagaattaaaattaactctatatatatgtctcttgtttattttcacaccttcttcaatatcgtgatgccaattatttgtgtcgcgccatcggctatcgtttaaagcgcactgattgagcgcctcgttgtattgttgcaacgtaagattgtatgtttttagttcattcttgatcgcctttacgcccttgaaacgcgtgtacgcgtcacgtttacatttttctagtattttatgtgcaataattttcaatttactttgaggttgcaagcccaaagcattcataaatatcattttattattattaacacaaccccttgtattcataatgttgtatgcgatggtaCGCGCGCGatgcaTgacttcacccacacacttggagtcgtggttgtagaaatgcgtcagagccttgattaaacatcggttttcacacttggcacacgaaaccacgtttgcaatgtaacagtttagtataaacctcttcctgtacataccgccgcgcggtacattgttttctttcaaatcgttcaatattttttttatacacggaggcatattaatcttgttgttcagcatgtcgacgacatttttctttccttctacgcattctttcatacaaatgtttctcttgctgcgttttttaaaattggaatttttaatttcattaatagtgggcggagccgttcc.2462..2902=441bp：HAR(cg30) A homology arm; 9272=397 bp: HAL (p 15) homology arm; the area between taa and tta of the font identification is bolded: 2906. 8872=5967 bp inserted exogenous gene.

SEQ ID NO.49（9629bp）

tggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcgtttaaacactgcaatcgacaaaatgttgtgcatagcggccgatatcaaaggccaagtggagcagctcgaactcgtaaaccagtatctgggcgcgcccgaaagtgaaaagctagattttgtatacgattgttccgacttggatataaatgaaaaagatttaaaatctctgtgtttgactaaaaatattgcgtactttacccaaaaatacaatgcgccgaccgtgctgaaggcccaggcagcggtttacgattcgttcataaaacacagcgaattatttataaacgccatatgtcaaatggatgaaaaacagcaagtgaataatttttgtttagacgaattagtaaaattaaaactgatagccattaaacatttgtgtgcattggaatatgtaatagaaaatagtatataagcatgCAGATCTGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGTACTTCTCGACacctgatttaaatcatttattgttcaaagatgcagtcatccaaatccacattgaccagatcgcaggcagtgcaagcgtctggcacctttcccatgatatgatgaatgtagcacagtttctgatacgcctttttgacgacagaaacgggttgagattctgacacgggaaagcactctaaacagtctttctgtccgtgagtgaagcagatatttgaattctgattcattctctcgcattgtctgcagggaaacagcatcagattcatgcccacgtgacgagaacatttgttttggtacctgtctgcgtagttgatcgaagcCtccgcgtctgacgtcgatggctgcgcaactgactcgcgcacccgtttgggctcacttatatctgcgtcactgggggcgggtcttttcttggctccaccctttttgacgtagaattcatgctccacctcaaccacgtgatcctttgcccaccggaaaaagtctttgacttcctgcttggtgaccttcccaaagtcatgatccagacggcgggtgagttcaaatttgaacatccggtcttgcaacggctgctggtgttcgaaggtcgttgagttcccgtcaatcacggcgcacatgttggtgttggaggtgacgatcacgggagtcgggtctatctgggccgaggacttgcatttctggtccacgcgcaccttgcttcctccgagaatggctttggccgactccacgaccttggcggtcatcttcccctcctcccaccagatcaccatcttgtcgacacagtcgttgaagggaaagttctcattggtccagtttacgcacccgtagaagggcacagtgtgggctatggcctccgcgatgttggtcttcccggtagttgcaggcccaaacagccagatggtgttcctcttgccgaactttttcgtggcccatcccagaaagacggaagccgcatattggggatcgtacccgtttagttccaaaattttataaatccgattgctggaaatgtcctccacgggctgctggcccaccaggtagtcgggggcggttttagtcaggctcataatctttcccgcattgtccaaggcagccttgatttgggaccgcgagttggaggccgcattgaaggagatgtatgaggcctggtcctcctgAatccactgcttctccgaggtaatccccttgtccacgagccacccgaccagctccatgtacctggctgaagtttttgatctgatcaccggcgcGtcagaattgggattctgattctctttgttctgctcctgcgtctgcgacacgtgcgtcagatgctgcgccaccaaccgtttacgctccgtgagattcaaacaggcgcttaaatactgttccaAattagtccacgcccactggagctcaggctgggttttggggagcaagtaattggggatgtagcactcGtccaccaccttgttcccgcctccggcgccGtttctggtctttgtgaccgcgaaccagtttggcaaagtcggctcgatcccgcggtaaattctctgaatcagtttttcgcgaatctgactcaggaaacgtcccaaaaccaAggatttcaccccggtggtttccacgagcacgtgcaAgtggaagtagctctctcccttctcaaattgcacaaagaaaagagcctccggggccttactcacacggcgccaCtccgtcagaaagtcgcgctgcagcttctcggccacggtcaggggtgcctgctcaatcagattcagatccaAgtcagaatctggcggcaactcccaCtccttctcggccacccagttcacaaagctgtcagaaatgccgggcagatgctcgtcaaggtcgctggggaccttaatcacaatctcgtaaaaccccgCcaGggcggcGACCGCGCCCGATGGTGGGACGGTATGAATAATCCGTATTTATAGGTTTTTTTATTACAAAACTGTTACGAAAACAGTAAAATACTTATTTATTTGCGAGATGGTTATCATTTTAATTATCTCCATGATCTATTAATATTCCTGCAGGCCGGAGTATACGGACCTTTAATTCAACCCAACACAATATATTATAGTTAAATAAGAATTATTATCAAATCATTTGTATATTAATTAAAATACTATACTGTAAATTACATTTTATTTACAATCACTCGACcAAGACTTACACCCGGGggTtccgttaagGCCGCCACGGCTGCCGACGGTTATCTACCCGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCGCGAGTGGTGGGCtCTCAAACCCGGCGCTCCTAAGCCAAAGGCTAACCAACAGAAACAAGACGACGGcCGCGGCCTtGTTCTCCCCGGTTACAAATACCTcGGACCCTTCAACGGGCTcGACAAGGGCGAACCCGTGAACGCgGCGGACGCCGCgGCCCTTGAGCACGATAAGGCTTACGACCAaCAACTcCAGGCCGGCGACAACCCTTACCTTCGTTATAACCACGCCGACGCcGAATTCCAGGAGCGTCTcCAAGAAGATACcTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGAAGCGGGTTCTCGAACCTCTCGGTCTGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAGAGACCGGTAGAGCCATCACCCCAGCGTTCTCCAGACTCCTCTACGGGCATCGGCAAGAAAGGCCAACAGCCCGCCAGAAAAAGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGTTCCAGACCCTCAACCTCTCGGAGAACCTCCAGCAGCGCCCTCTGGTGTGGGACCTAATACAATGGCTGCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGGCGCCGACGGAGTGGGTAGTTCCTCGGGAAATTGGCATTGCGATTCCACATGGCTGGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACCTCTACAAGCAAATCTCCAACGGGACATCGGGAGGAGCCACCAACGACAACACCTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGACTTTAACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCCAAGAGACTCAGCTTCAAGCTCTTCAACATCCAGGTCAAGGAGGTCACGCAGAATGAAGGCACCAAGACCATCGCCAATAACCTCACCAGCACCATCCAGGTGTTTACGGACTCGGAGTACCAGCTGCCGTACGTTCTCGGCTCTGCCCACCAGGGCTGCCTGCCTCCGTTCCCGGCGGACGTGTTCATGATTCCCCAGTACGGCTACCTAACACTCAACAACGGTAGTCAGGCCGTGGGACGCTCCTCCTTCTACTGCCTGGAATACTTTCCTTCGCAGATGCTGAGAACCGGCAACAACTTCCAGTTTACTTACACCTTCGAGGACGTGCCTTTCCACAGCAGCTACGCCCACAGCCAGAGCTTGGACCGGCTGATGAATCCTCTGATTGACCAGTACCTGTACTACTTGTCTCGGACTCAAACAACAGGAGGCACGGCAAATACGCAGACTCTGGGCTTCAGCCAAGGTGGGCCTAATACAATGGCCAATCAGGCAAAGAACTGGCTGCCAGGACCCTGTTACCGCCAACAACGCGTCTCAACGACAACCGGGCAAAACAACAATAGCAACTTTGCCTGGACTGCTGGGACCAAATACCATCTGAATGGAAGAAATTCATTGGCTAATCCTGGCATCGCTATGGCAACACACAAAGACGACGAGGAGCGTTTTTTTCCCAGTAACGGGATCCTGATTTTTGGCAAACAAAATGCTGCCAGAGACAATGCGGATTACAGCGATGTCATGCTCACCAGCGAGGAAGAAATCAAAACCACTAACCCTGTGGCTACAGAGGAATACGGTATCGTGGCAGATAACTTGCAGCAGCAAAACACGGCTCCTCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAACCGGGACGTGTACCTGCAGGGTCCCATCTGGGCCAAGATTCCTCACACGGACGGCAACTTCCACCCGTCTCCGCTGATGGGCGGCTTTGGCCTGAAACATCCTCCGCCTCAGATCCTGATCAAGAACACGCCTGTACCTGCGGATCCTCCGACCACCTTCAACCAGTCAAAGCTGAACTCTTTCATCACGCAATACAGCACCGGACAGGTCAGCGTGGAAATTGAATGGGAGCTGCAGAAGGAAAACAGCAAGCGCTGGAACCCCGAGATCCAGTACACCTCCAACTACTACAAATCTACAAGTGTGGACTTTGCTGTTAATACAGAAGGCGTGTACTCTGAACCCCGCCCCATTGGCACCCGTTACCTCACCCGTAATCTGTAAAGCTGGGGAGATGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCCCTCGAGGctattaatattccggagctagcgtgtaggctggagctgcttcgaagttcctatactttctagagaataggaacttcggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgccgaagttcctatactttctagagaataggaacttcggaataggaactaaggaggatattcatatggaccatggctaattcccataagcttctgcagggatcccgcggagtgatggtggtgatgatggaccatggtgcttgtgtgttccttattgaagccttggtgtgactgatttactagtataaaaaacattttattaaataatatatttatttcaattatacatgttttattttattctttctataatcatagggtacaacacaggtttatcatcttttaacaaatcatcattaaagccaagtaaagggtacaatggttttggcatatcatcgctatcgtattcattaggtaaattaatgtatgctcgattgtcttctaaattattgcaaattgtgacaaattcattgttatttttgtattgcacaaccacgttatttgattgatgacaccgtttttttatacagcaaaacaaaaataacaataatccacagaataggatcattgcagcgacaatagcgataattaccacggtggtattactgtcgtcttgcgagtcttcgtcgggcgccgcgctgttggtgtaaattttagactgatggaaaaaatgatggggcgtcgatgtgtaatctttaatgtCGCGCGCGatgcaTgacttcacccacacacttggagtcgtggttgtagaaatgcgtcagagccttgattaaacatcggttttcacacttggcacacgaaaccacgtttgcaatgtaacagtttagtataaacctcttcctgtacataccgccgcgcggtacattgttttctttcaaatcgttcaatattttttttatacacggaggcatattaatcttgttgttcagcatgtcgacgacatttttctttccttctacgcattctttcatacaaatgtttctcttgctgcgttttttaaaattggaatttttaatttcattaatagtgggcggagccgttcc.2462..2860=399bp：HAR(pkip) A homology arm; 8882. 9288=407 bp: HAL (port) homology arms; the area between taa and tta of the bold font identification includes: 2864 inserted foreign gene 8830=5967 bp, and 8831..8878=48 bp non-encoded 48bp.

SEQ ID NO.50（7770bp）

ggaacggctccgcccactattaatgaaattaaaaattccaattttaaaaaacgcagcaagagaaacatttgtatgaaagaatgcgtagaaggaaagaaaaatgtcgtcgacatgctgaacaacaagattaatatgcctccgtgtataaaaaaaatattgaacgatttgaaagaaaacaatgtaccgcgcggcggtatgtacaggaagaggtttatactaaactgttacattgcaaacgtggtttcgtgtgccaagtgtgaaaaccgatgtttaatcaaggctctgacgcatttctacaaccacgactccaagtgtgtgggtgaagtcAtgcatCGCGCGCGacattaaagattacacatcgacgccccatcattttttccatcagtctaaaatttacaccaacagcgcggcgcccgacgaagactcgcaagacgacagtaataccaccgtggtaattatcgctattgtcgctgcaatgatcctattctgtggattattgttatttttgttttgctgtataaaaaaacggtgtcatcaatcaaataacgtggttgtgcaatacaaaaataacaatgaatttgtcacaatttgcaataatttagaagacaatcgagcatacattaatttacctaatgaatacgatagcgatgatatgccaaaaccattgtaccctttacttggctttaatgatgatttgttaaaagatgataaacctgtgttgtaccctatgattatagaaagaataaaataaactagtaaatcagtcacaccaaggcttcaataaggaacacacaagcaccatggtccatcatcaccaccatcactccgcgggatccctgcagaagcttatgggaattagccatggtccatatgaatatcctccttagttcctattccgaagttcctattctctagaaagtataggaacttcggcgcgcctacctgtgacggaagatcacttcgcagaataaataaatcctggtgtccctgttgataccgggaagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttgtcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattacgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaggcgcgccatttaaatgaagttcctattccgaagttcctattctctagaaagtataggaacttcgaagcagctccagcctacacgctagctccggaatattaatagCCTCGAGGggcgcccctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcggtccgcacgtggttacctacaaaatcagaaggacagggaagggagcagtggttcacgcctgtaatcccagcaatttgggaggccaaggtgggtagatcacctgagattaggagttggagaccagcctggccaatatggtgaaaccccgtctctaccaaaaaaacaaaaattagctgagcctggtcatgcatgcctggaatcccaacaactcgggaggctgaggcaggagaatcgcttgaacccaggaggcggagattgcagtgagccaagattgtgccactgcactccagcttggttcccaatagaccccgcaggccctacaggttgtcttcccaacttgccccttgctccataccacccccctccaccccataatattatagaaggacacctagtcagacaaaatgatgcaacttaattttattaggacaaggctggtgggcactggagtggcaacttccagggccaggagaggcactggggaggggtcacagggatgccacccgtagatctctcgagcagcgctcggtatcgatgcggggaggcggcccaaagggagatccgactcgtctgagggcgaaggcgaagacgcggaagaggccgcagagccggcagcaggccgcgggaaggaaggtccgctggattgagggccgaagggacgtagcagaaggacgtcccgcgcagaatccaggtggcaacataggcgagcagccaaggaaaggacgatgatttccccgacaacaccacggaattgtcagtgcccaacagccgagcccctgtccagcagcgggcaaggcaggcggcgatgagttccgccgtggcaatagggagggggaaagcgaaagttccggaaaggagctgacaggtggtggcaatgccccaaccagtgggggttgcgtcagcaaacacagtgcacaccacgccacgttgcctgacaacgggccacaactcctcataaagagacagcaaccaggatttatacaaggaggagaaaatgaaagccatacgggaagcaatagcatgatacaaaggcattaaagcagcgtatccacatagcgtaaaaggagcaacatagttaagaataccagtcaatctttcacaaattttgtaatccagaggttgattatcgataaccggtttaaagcttttatttgtcgtcatcatccttatagtccttatcatcgtcgtctttgtaatccttgtcatcgtcatccttgtagtctccggagcccttgtacagctcgtccatgccgagagtgatcccggcggcggtcacgaactccagcaggaccatgtgatcgcgcttctcgttggggtctttgctcagggcggactgggtgctcaggtagtggttgtcgggcagcagcacggggccgtcgccgatgggggtgttctgctggtagtggtcggcgagctgcacgctgccgtcctcgatgttgtggcggatcttgaagttcaccttgatgccgttcttctgcttgtcggccatgatatagacgttgtggctgttgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgcccttcagctcgatgcggttcaccagggtgtcgccctcgaacttcacctcggcgcgggtcttgtagttgccgtcgtccttgaagaagatggtgcgctcctggacgtagccttcgggcatggcggacttgaagaagtcgtgctgcttcatgtggtcggggtagcggctgaagcactgcacgccgtaggtcagggtggtcacgagggtgggccagggcacgggcagcttgccggtggtgcagatgaacttcagggtcagcttgccgtaggtggcatcgccctcgccctcgccggacacgctgaacttgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccaccccggtgaacagctcctcgcccttgctcaccatgccagatccgccggatccggtggcgctagccggaccggggttttcggtaccggaggctggatcggtcccggtgtcttctatggaggtcaaaacagcgtggatggcgtctccaggcgatctgacggttcactaaacgagctctgcttatatagacctcccaccgtacacgcctaccgcccatttgcgtcaatggggcggagttgttacgacattttggaaagtcccgttgattttggtgccaaaacaaactcccattgacgtcaatggggtggagacttggaaatccccgtgagtcaaaccgctatccacgcccattgatgtactgccaaaaccgcatcaccatggtaatagcgatgactaatacgtagatgtactgccaagtaggaaagtcccataaggtcatgtactgggcataatgccaggcgggccatttaccgtcattgacgtcaatagggggcgtacttggcatatgatacacttgatgtactgccaagtgggcagtttaccgtaaatactccacccattgacgtcaatggaaagtccctattggcgttactatgggaacatacgtcattattgacgtcaatgggcgggggtcgttgggcggtcagccaggcgggccatttaccgtaagttatgtaacgcggaactccatatatgggctatgaactaatgaccccgtaattgattactattaataactagctccacgcgttctagacacacgcgtgcggccgcaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggacatgtcgccggcgGcatgcttatatactattttctattacatattccaatgcacacaaatgtttaatggctatcagttttaattttactaattcgtctaaacaaaaattattcacttgctgtttttcatccatttgacatatggcgtttataaataattcgctgtgttttatgaacgaatcgtaaaccgctgcctgggccttcagcacggtcggcgcattgtatttttgggtaaagtacgcaatatttttagtcaaacacagagattttaaatctttttcatttatatccaagtcggaacaatcgtatacaaaatctagcttttcactttcgggcgcgcccagatactggtttacgagttcgagctgctccacttggcctttgatatcggccgctatgcacaacattttgtcgattgcagtgtttaaacgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgcca.342..748=407bp：HAL(prot) A homology arm; 4911. 5309=399 bp: HAR (pkip) homology arms; the area between taa and tta of the font identification is bolded: 752. 4907=4156 bp inserted exogenous gene.

SEQ ID NO.51（930bp）

Actagtaaatcagtcacaccaaggcttcaataaggaacacacaagcaccatggtccatcatcaccaccatcactccgcgggatccctgcagaagcttatgggaattagccatggtccatatgaatatcctccttagttcctattccgaagttcctattctctagaaagtataggaacttcggcgcgcctacctgtgacggaagatcacttcgcagaataaataaatcctggtgtccctgttgataccgggaagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttgtcgagattttcaggagctaaggaagctaaaatgttacgcagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggtggctcaagtatgggcatcattcgcacatgtaggctcggccctgaccaagtcaaatccatgcgggctgctcttgatcttttcggtcgtgagttcggagacgtagccacctactcccaacatcagccggactccgattacctcgggaacttgctccgtagtaagacattcatcgcgcttgctgccttcgaccaagaagcggttgttggcgctctcgcggcttacgttctgcccaggtttgagcagccgcgtagtgagatctatatctatgatctcgcagtctccggcgagcaccggaggcagggcattgccaccgcgctcatcaatctcctcaagcatgaggccaacgcgcttggtgcttatgtgatctacgtgcaagcagattacggtgacgatcccgcagtggctctctatacaaagttgggcatacgggaagaagtgatgcactttgatatcgacccaagtaccgccacctaaatttaaat.

SEQ ID NO.52（7636bp）

ggaacggctccgcccactattaatgaaattaaaaattccaattttaaaaaacgcagcaagagaaacatttgtatgaaagaatgcgtagaaggaaagaaaaatgtcgtcgacatgctgaacaacaagattaatatgcctccgtgtataaaaaaaatattgaacgatttgaaagaaaacaatgtaccgcgcggcggtatgtacaggaagaggtttatactaaactgttacattgcaaacgtggtttcgtgtgccaagtgtgaaaaccgatgtttaatcaaggctctgacgcatttctacaaccacgactccaagtgtgtgggtgaagtcAtgcatCGCGCGCGacattaaagattacacatcgacgccccatcattttttccatcagtctaaaatttacaccaacagcgcggcgcccgacgaagactcgcaagacgacagtaataccaccgtggtaattatcgctattgtcgctgcaatgatcctattctgtggattattgttatttttgttttgctgtataaaaaaacggtgtcatcaatcaaataacgtggttgtgcaatacaaaaataacaatgaatttgtcacaatttgcaataatttagaagacaatcgagcatacattaatttacctaatgaatacgatagcgatgatatgccaaaaccattgtaccctttacttggctttaatgatgatttgttaaaagatgataaacctgtgttgtaccctatgattatagaaagaataaaataaactagtaaatcagtcacaccaaggcttcaataaggaacacacaagcaccatggtccatcatcaccaccatcactccgcgggatccctgcagaagcttatgggaattagccatggtccatatgaatatcctccttagttcctattccgaagttcctattctctagaaagtataggaacttcggcgcgcctacctgtgacggaagatcacttcgcagaataaataaatcctggtgtccctgttgataccgggaagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttgtcgagattttcaggagctaaggaagctaaaatgttacgcagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggtggctcaagtatgggcatcattcgcacatgtaggctcggccctgaccaagtcaaatccatgcgggctgctcttgatcttttcggtcgtgagttcggagacgtagccacctactcccaacatcagccggactccgattacctcgggaacttgctccgtagtaagacattcatcgcgcttgctgccttcgaccaagaagcggttgttggcgctctcgcggcttacgttctgcccaggtttgagcagccgcgtagtgagatctatatctatgatctcgcagtctccggcgagcaccggaggcagggcattgccaccgcgctcatcaatctcctcaagcatgaggccaacgcgcttggtgcttatgtgatctacgtgcaagcagattacggtgacgatcccgcagtggctctctatacaaagttgggcatacgggaagaagtgatgcactttgatatcgacccaagtaccgccacctaaatttaaatgaagttcctattccgaagttcctattctctagaaagtataggaacttcgaagcagctccagcctacacgctagctccggaatattaatagCCTCGAGGggcgcccctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcggtccgcacgtggttacctacaaaatcagaaggacagggaagggagcagtggttcacgcctgtaatcccagcaatttgggaggccaaggtgggtagatcacctgagattaggagttggagaccagcctggccaatatggtgaaaccccgtctctaccaaaaaaacaaaaattagctgagcctggtcatgcatgcctggaatcccaacaactcgggaggctgaggcaggagaatcgcttgaacccaggaggcggagattgcagtgagccaagattgtgccactgcactccagcttggttcccaatagaccccgcaggccctacaggttgtcttcccaacttgccccttgctccataccacccccctccaccccataatattatagaaggacacctagtcagacaaaatgatgcaacttaattttattaggacaaggctggtgggcactggagtggcaacttccagggccaggagaggcactggggaggggtcacagggatgccacccgtagatctctcgagcagcgctcggtatcgatgcggggaggcggcccaaagggagatccgactcgtctgagggcgaaggcgaagacgcggaagaggccgcagagccggcagcaggccgcgggaaggaaggtccgctggattgagggccgaagggacgtagcagaaggacgtcccgcgcagaatccaggtggcaacataggcgagcagccaaggaaaggacgatgatttccccgacaacaccacggaattgtcagtgcccaacagccgagcccctgtccagcagcgggcaaggcaggcggcgatgagttccgccgtggcaatagggagggggaaagcgaaagttccggaaaggagctgacaggtggtggcaatgccccaaccagtgggggttgcgtcagcaaacacagtgcacaccacgccacgttgcctgacaacgggccacaactcctcataaagagacagcaaccaggatttatacaaggaggagaaaatgaaagccatacgggaagcaatagcatgatacaaaggcattaaagcagcgtatccacatagcgtaaaaggagcaacatagttaagaataccagtcaatctttcacaaattttgtaatccagaggttgattatcgataaccggtttaaagcttttatttgtcgtcatcatccttatagtccttatcatcgtcgtctttgtaatccttgtcatcgtcatccttgtagtctccggagcccttgtacagctcgtccatgccgagagtgatcccggcggcggtcacgaactccagcaggaccatgtgatcgcgcttctcgttggggtctttgctcagggcggactgggtgctcaggtagtggttgtcgggcagcagcacggggccgtcgccgatgggggtgttctgctggtagtggtcggcgagctgcacgctgccgtcctcgatgttgtggcggatcttgaagttcaccttgatgccgttcttctgcttgtcggccatgatatagacgttgtggctgttgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgcccttcagctcgatgcggttcaccagggtgtcgccctcgaacttcacctcggcgcgggtcttgtagttgccgtcgtccttgaagaagatggtgcgctcctggacgtagccttcgggcatggcggacttgaagaagtcgtgctgcttcatgtggtcggggtagcggctgaagcactgcacgccgtaggtcagggtggtcacgagggtgggccagggcacgggcagcttgccggtggtgcagatgaacttcagggtcagcttgccgtaggtggcatcgccctcgccctcgccggacacgctgaacttgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccaccccggtgaacagctcctcgcccttgctcaccatgccagatccgccggatccggtggcgctagccggaccggggttttcggtaccggaggctggatcggtcccggtgtcttctatggaggtcaaaacagcgtggatggcgtctccaggcgatctgacggttcactaaacgagctctgcttatatagacctcccaccgtacacgcctaccgcccatttgcgtcaatggggcggagttgttacgacattttggaaagtcccgttgattttggtgccaaaacaaactcccattgacgtcaatggggtggagacttggaaatccccgtgagtcaaaccgctatccacgcccattgatgtactgccaaaaccgcatcaccatggtaatagcgatgactaatacgtagatgtactgccaagtaggaaagtcccataaggtcatgtactgggcataatgccaggcgggccatttaccgtcattgacgtcaatagggggcgtacttggcatatgatacacttgatgtactgccaagtgggcagtttaccgtaaatactccacccattgacgtcaatggaaagtccctattggcgttactatgggaacatacgtcattattgacgtcaatgggcgggggtcgttgggcggtcagccaggcgggccatttaccgtaagttatgtaacgcggaactccatatatgggctatgaactaatgaccccgtaattgattactattaataactagctccacgcgttctagacacacgcgtgcggccgcaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggacatgtcgccggcgGcatgcttatatactattttctattacatattccaatgcacacaaatgtttaatggctatcagttttaattttactaattcgtctaaacaaaaattattcacttgctgtttttcatccatttgacatatggcgtttataaataattcgctgtgttttatgaacgaatcgtaaaccgctgcctgggccttcagcacggtcggcgcattgtatttttgggtaaagtacgcaatatttttagtcaaacacagagattttaaatctttttcatttatatccaagtcggaacaatcgtatacaaaatctagcttttcactttcgggcgcgcccagatactggtttacgagttcgagctgctccacttggcctttgatatcggccgctatgcacaacattttgtcgattgcagtgtttaaacgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgcca.

748=407 Bp: HAL (prot) homology arms; 4777 5175=399 bp: HAR (pkip) homology arms; the area between taa and tta of the font identification is bolded: 752. 4773=4022 bp inserted exogenous gene.

SEQ ID NO.53（7668bp）

tggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcgtttaaacgaagacaacaacgcaaatgccgacgacactatgctgtctgaagcacaagcgatactaaaaaaactacaggtagacattgccgaacaaacgcagctcaacattaaacaacaattagatttagacaaattacaacaaacaagcgtttctatgcaagaaaagttagacaaaattaaaagcgactacaacaacatgcataaatcttttaaagaattgcaactgaaacgaattacaactgaaaaggcgctaaaatcgctcaatgacgattacgcaaaacttgcgtctaaaaacgccaaattgagtagcgaaaataaggttttatcaaataaaaatattgaattgattaaacacaaaaatttattacaaaacgagtacacaacattacaatcatataaatgtataaccaacgccactattaccacaaatgttacaataaatgtagattaagcatgCcgccggcgacatgtcctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgcacgcgtgtgtctagaacgcgtggagctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggtaccgaaaaccccggtccggctagcgccaccggatccggcggatctggcatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggctccggagactacaaggatgacgatgacaaggattacaaagacgacgatgataaggactataaggatgatgacgacaaataaaagctttaaaccggttatcgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccggaactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctatgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgataccgagcgctgctcgagagatctacgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtccttctgattttgtaggtaaccacgtgcggaccgagcggccgcaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggcgccCCTCGAGGctattaatattccggagctagcgtgtaggctggagctgcttcgaagttcctatactttctagagaataggaacttcggaataggaacttcatttaaatttaggtggcggtacttgggtcgatatcaaagtgcatcacttcttcccgtatgcccaactttgtatagagagccactgcgggatcgtcaccgtaatctgcttgcacgtagatcacataagcaccaagcgcgttggcctcatgcttgaggagattgatgagcgcggtggcaatgccctgcctccggtgctcgccggagactgcgagatcatagatatagatctcactacgcggctgctcaaacctgggcagaacgtaagccgcgagagcgccaacaaccgcttcttggtcgaaggcagcaagcgcgatgaatgtcttactacggagcaagttcccgaggtaatcggagtccggctgatgttgggagtaggtggctacgtctccgaactcacgaccgaaaagatcaagagcagcccgcatggatttgacttggtcagggccgagcctacatgtgcgaatgatgcccatacttgagccacctaactttgttttagggcgactgccctgctgcgtaacatcgttgctgctgcgtaacattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgccgaagttcctatactttctagagaataggaacttcggaataggaactaaggaggatattcatatggaccatggctaattcccataagcttctgcagggatcccgcggagtgatggtggtgatgatggaccatggtgcttgtgtgttccttattgaagccttggtgtgactgatttactagtttaactgtttacataacattctactttaatgtaataatattcttcaatttcttgggttttagaattaaaattaactctatatatatgtctcttgtttattttcacaccttcttcaatatcgtgatgccaattatttgtgtcgcgccatcggctatcgtttaaagcgcactgattgagcgcctcgttgtattgttgcaacgtaagattgtatgtttttagttcattcttgatcgcctttacgcccttgaaacgcgtgtacgcgtcacgtttacatttttctagtattttatgtgcaataattttcaatttactttgaggttgcaagcccaaagcattcataaatatcattttattattattaacacaaccccttgtattcataatgttgtatgcgatggtaCGCGCGCGatgcaTgacttcacccacacacttggagtcgtggttgtagaaatgcgtcagagccttgattaaacatcggttttcacacttggcacacgaaaccacgtttgcaatgtaacagtttagtataaacctcttcctgtacataccgccgcgcggtacattgttttctttcaaatcgttcaatattttttttatacacggaggcatattaatcttgttgttcagcatgtcgacgacatttttctttccttctacgcattctttcatacaaatgtttctcttgctgcgttttttaaaattggaatttttaatttcattaatagtgggcggagccgttcc.

2462. 2902=441 Bp: HAR (cg 30) homology arm sequences; 6931 7327=397 bp: HAL (p 15) homology arm sequence; the area between taa and tta of the font identification is bolded: 2906. 6927=4022 bp.

SEQ ID NO.54（2501bp）

gtatacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatcactcgacACTCGACGAAGACTTGATCACCCGGGGCCGCCCTGGCTGCCGACGGTTATCTACCCGATTGGCTCGAGGACAACCTTAGTGAAGGAATTCGCGAGTGGTGGGCTTTGAAACCTGGAGCCCCTCAACCCAAGGCAAATCAACAACATCAAGACAACGCTCGAGGTCTTGTGCTTCCGGGTTACAAATACCTTGGACCCGGCAACGGACTCGACAAGGGGGAGCCGGTCAACGCAGCAGACGCGGCGGCCCTCGAGCACGACAAGGCCTACGACCAGCAGCTCAAGGCCGGAGACAACCCGTACCTCAAGTACAACCACGCCGACGCCGAGTTCCAGGAGCGGCTCAAAGAAGATACGTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAAAAGAGGCTTCTTGAACCTCTTGGTCTGGTTGAGGAAGCGGCTAAGACGGCTCCTGGAAAGAAGAGGCCTGTAGAGCAGTCTCCTCAGGAACCGGACTCCTCCGCGGGTATTGGCAAATCGGGTGCACAGCCCGCTAAAAAGAGACTCAATTTCGGTCAGACTGGCGACACAGAGTCAGTCCCAGACCCTCAACCAATCGGAGAACCTCCCGCAGCCCCCTCAGGTGTGGGATCTCTTACAATGGCTTCAGGTGGTGGCGCACCAGTGGCAGACAATAACGAAGGTGCCGATGGAGTGGGTAGTTCCTCGGGAAATTGGCATTGCGATTCCCAATGGCTGGGGGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAATCACCTCTACAAGCAAATCTCCAACAGCACATCTGGAGGATCTTCAAATGACAACGCCTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGACTTCAACAGATTCCACTGCCACTTCTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCTAAGCGACTCAACTTCAAGCTCTTCAACATTCAGGTCAAAGAGGTTACGGACAACAATGGAGTCAAGACCATCGCCAATAACCTTACCAGCACGGTCCAGGTCTTCACGGACTCAGACTATCAGCTCCCGTACGTGCTCGGGTCGGCTCACGAGGGCTGCCTCCCGCCGTTCCCAGCGGACGTTTTCATGATTCCTCAGTACGGGTATCTGACGCTTAATGATGGAAGCCAGGCCGTGGGTCGTTCGTCCTTTTACTGCCTGGAATATTTCCCGTCGCAAATGCTAAGAACGGGTAACAACTTCCAGTTCAGCTACGAGTTTGAGAACGTACCTTTCCATAGCAGCTACGCTCACAGCCAAAGCCTGGACCGACTAATGAATCCACTCATCGACCAATACTTGTACTATCTCTCAAAGACTATTAACGGTTCTGGACAGAATCAACAAACGCTAAAATTCAGTGTGGCCGGACCCAGCAACATGGCTGTCCAGGGAAGAAACTACATACCTGGACCCAGCTACCGACAACAACGTGTCTCAACCACTGTGACTCAAAACAACAACAGCGAATTTGCTTGGCCTGGAGCTTCTTCTTGGGCTCTCAATGGACGTAATAGCTTGATGAATCCTGGACCTGCTATGGCCAGCCACAAAGAAGGAGAGGACCGTTTCTTTCCTTTGTCTGGATCTTTAATTTTTGGCAAACAAGGAACTGGAAGAGACAACGTGGATGCGGACAAAGTCATGATAACCAACGAAGAAGAAATTAAAACTACTAACCCGGTAGCAACGGAGTCCTATGGACAAGTGGCCACAAACCACCAGAGTGCCCAAGCACAGGCGCAGACCGGCTGGGTTCAAAACCAAGGAATACTTCCGGGTATGGTTTGGCAGGACAGAGATGTGTACCTGCAAGGACCCATTTGGGCCAAAATTCCTCACACGGACGGCAACTTTCACCCTTCTCCGCTGATGGGAGGGTTTGGAATGAAGCACCCGCCTCCTCAGATCCTCATCAAAAACACACCTGTACCTGCGGATCCTCCAACGGCCTTCAACAAGGACAAGCTGAACTCTTTCATCACCCAGTATTCTACTGGCCAAGTCAGCGTGGAGATCGAGTGGGAGCTGCAGAAGGAAAACAGCAAGCGCTGGAACCCGGAGATCCAGTACACTTCCAACTATTACAAGTCTAATAATGTTGAATTTGCTGTTAATACTGAAGGTGTATATAGTGAACCCCGCCCCATTGGCACCAGATACCTGACTCGTAATCTGTAAAGCTGGGGAGATGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCCCTCGAcgcgccggcG.157..2367=2211bp：Cap9 Sequence.

SEQ ID NO.55（2465bp）

gtatacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatcactcgacACTCGACGAAGACTTGATCACCCGGGGCCGCCCTGGCTTTTGTTGATCACCCaCCcGATTGGTTGGAAGAAGTTGGTGAAGGTCTTCGCGAGTTTTTGGGCCTTGAAGCGGGCCCACCGAAACCAAAACCCAATCAGCAGCATCAAGATCAAGCCCGTGGTCTTGTGCTcCCTGGTTATAACTATCTCGGACCCGGAAACGGTCTCGATCGAGGAGAGCCcGTCAACAGGGCAGACGAGGTCGCGCGAGAGCACGACATCTCGTACAACGAGCAGCTTGAGGCGGGAGACAACCCCTACCTCAAGTACAACCACGCGGACGCCGAGTTTCAGGAGAAGCTCGCCGACGACACATCCTTCGGGGGAAACCTCGGAAAGGCAGTCTTTCAGGCCAAGAAAAGGGTTCTCGAACCTTTTGGCCTGGTTGAAGAGGGTGCTAAGACGGCCCCTACCGGAAAGCGGATAGACGACCACTTTCCAAAAAGAAAGAAGGCTCGGACCGAAGAGGACTCCAAGCCTTCCACCTCGTCAGACGCCGAAGCTGGACCCAGCGGATCCCAGCAGCTGCAAATCCCAGCCCAACCAGCCTCAAGTTTGGGAGCTGATACAATGTCTGCGGGAGGTGGCGGCCCATTGGGCGACAATAACCAAGGTGCCGATGGAGTGGGCAATGCCTCGGGAGATTGGCATTGCGATTCCACGTGGATGGGGGACAGAGTCGTCACCAAGTCCACCCGAACCTGGGTGCTGCCCAGCTACAACAACCACCAGTACCGAGAGATCAAAAGCGGCTCCGTCGACGGAAGCAACGCCAACGCCTACTTTGGATACAGCACCCCCTGGGGGTACTTTGACTTTAACCGCTTCCACAGCCACTGGAGCCCCCGAGACTGGCAAAGACTCATCAACAACTACTGGGGCTTCAGACCCCGGTCCCTCAGAGTCAAAATCTTCAACATTCAAGTCAAAGAGGTCACGGTGCAGGACTCCACCACCACCATCGCCAACAACCTCACCTCCACCGTCCAAGTGTTTACGGACGACGACTACCAGCTGCCCTACGTCGTCGGCAACGGGACCGAGGGATGCCTGCCGGCCTTCCCTCCGCAGGTCTTTACGCTGCCGCAGTACGGTTACGCGACGCTGAACCGCGACAACACAGAAAATCCCACCGAGAGGAGCAGCTTCTTCTGCCTAGAGTACTTTCCCAGCAAGATGCTGAGAACGGGCAACAACTTTGAGTTTACCTACAACTTTGAGGAGGTGCCCTTCCACTCCAGCTTCGCTCCCAGTCAGAACCTGTTCAAGCTGGCCAACCCGCTGGTGGACCAGTACTTGTACCGCTTCGTGAGCACAAATAACACTGGCGGAGTCCAGTTCAACAAGAACCTGGCCGGGAGATACGCCAACACCTACAAAAACTGGTTCCCGGGGCCCATGGGCCGAACCCAGGGCTGGAACCTGGGCTCCGGGGTCAACCGCGCCAGTGTCAGCGCCTTCGCCACGACCAATAGGATGGAGCTCGAGGGCGCGAGTTACCAGGTGCCCCCGCAGCCGAACGGCATGACCAACAACCTCCAGGGCAGCAACACCTATGCCCTGGAGAACACTATGATCTTCAACAGCCAGCCGGCGAACCCGGGCACCACCGCCACGTACCTCGAGGGCAACATGCTCATCACCAGCGAGAGCGAGACGCAGCCGGTGAACCGCGTGGCGTACAACGTCGGCGGGCAGATGGCCACCAACAACCAGAGCTCCACCACTGCCCCCGCGACCGGCACGTACAACCTCCAGGAAATCGTGCCCGGCAGCGTGTGGATGGAGAGGGACGTGTACCTCCAAGGACCCATCTGGGCCAAGATCCCAGAGACGGGGGCGCACTTTCACCCCTCTCCGGCCATGGGCGGATTCGGACTCAAACACCCACCGCCCATGATGCTCATCAAGAACACGCCTGTGCCCGGAAATATCACCAGCTTCTCGGACGTGCCCGTCAGCAGCTTCATCACCCAGTACAGCACCGGGCAGGTCACCGTGGAGATGGAGTGGGAGCTCAAGAAGGAAAACTCCAAGAGGTGGAACCCAGAGATCCAGTACACAAACAACTACAACGACCCCCAGTTTGTGGACTTTGCCCCGGACAGCACCGGGGAATACAGAACCACCAGACCTATCGGAACCCGATACCTTACCCGACCCCTTTAAAGCTGGGGAGATGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCCCTCGAcgcgccggcG.157..2331=2175bp：Cap5 Sequence.

SEQ ID NO.56（2501bp）

GTATACGGACCTTTAATTCAACCCAACACAATATATTATAGTTAAATAAGAATTATTATCAAATCATTTGTATATTAATTAAAATACTATACTGTAAATTACATTTTATTTACAATCactcgacACTCGACGAAGACTTGATCACCCGGGGCCGCCCTGgctgccgaCggttatctAccCgattggctcgaggacactctctcCgaaggaataagacagtggtggaagctcaaacctggcccaccaccaccaaagcccgcagagcggcataaggacgacagcaggggtcttgtgcttcctgggtacaagtacctcggacccttcaacggactcgacaagggagagccggtcaacgaggcagacgccgcggccctcgagcacgacaaagcctacgaccggcagctcgacagcggagacaacccgtacctcaagtacaaccacgccgacgcggagtttcaggagcgccttaaagaagatacCtcttttgggggcaacctcggacgagcagtcttccaggcgaaaaagagggttcttgaacctctCggcctggttgaggaacctgttaagacggctccgggaaaaaagaggccggtagagcactctcctgtggagccagactcctcctcgggaaccggaaaggcgggccagcagcctgcaagaaaaagattgaattttggtcagactggagacgcagactcagtacctgacccccagcctctcggacagccaccagcagccccctctggtctgggaactaatacgatggctacaggcagtggcgcaccaatggcagacaataacgagggcgccgacggagtgggtaattcctcgggaaattggcattgcgattccacatggatgggcgacagagtcatcaccaccagcacccgaacctgggccctgcccacctacaacaaccacctctacaaacaaatttccagccaatcaggagcctcgaacgacaatcactactttggctacagcaccccttgggggtattttgacttcaacagattccactgccacttttcaccacgtgactggcaaagactcatcaacaacaactggggattccgacccaagagactcaacttcaagctctttaacattcaagtcaaagaggtcacgcagaatgacggtacgacgacgattgccaataaccttaccagcacggttcaggtgtttactgactcggagtaccagctcccgtacgtcctcggctcggcgcatcaaggatgcctcccgccgttcccagcagacgtcttcatggtgccacagtatggatacctcaccctgaacaacgggagtcaggcagtaggacgctcttcattttactgcctggagtactttccttctcagatgctgcgtaccggaaacaactttaccttcagctacacttttgaggacgttcctttccacagcagctacgctcacagccagagtctggaccgtctcatgaatcctctcatcgaccagtacctgtattacttgagcagaacaaacactccaagtggaaccaccacgcagtcaaggcttcagttttctcaggccggagcgagtgacattcgggaccagtctaggaactggcttcctggaccctgttaccgccagcagcgagtatcaaagacatctgcggataacaacaacagtgaatactcgtggactggagctaccaagtaccacctcaatggcagagactctctggtgaatccgggcccggccatggcaagccacaaggacgatgaagaaaagttttttcctcagagcggggttctcatctttgggaagcaaggctcagagaaaacaaatgtggacattgaaaaggtcatgattacagacgaagaggaaatcaggacaaccaatcccgtggctacggagcagtatggttctgtatctaccaacctccagagaggcaacagacaagcagctaccgcagatgtcaacacacaaggcgttcttccaggcatggtctggcaggacagagatgtgtaccttcaggggcccatctgggcaaagattccacacacggacggacattttcacccctctcccctcatgggtggattcggacttaaacaccctcctccacagattctcatcaagaacaccccggtacctgcgaatccttcgaccaccttcagtgcggcaaagtttgcttccttcatcacacagtactccacgggacaggtcagcgtggagatcgagtgggagctgcagaaggaaaacagcaaacgctggaatcccgaaattcagtacacttccaactacaacaagtctgttaatgtggactttactgtggacactaatggcgtgtattcagagcctcgccccattggcaccagatacctgactcgtaatctgtaaAGCTGGGGAGATGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCCCTCGAcgcgccggcg.157..2367=2211bp：Cap2 Sequence.

The technical features of the above-described embodiments and examples may be combined in any suitable manner, and for brevity of description, all of the possible combinations of the technical features of the above-described embodiments and examples are not described, however, as long as there is no contradiction between the combinations of the technical features, they should be considered to be within the scope described in the present specification.

The above examples merely illustrate a few embodiments of the present application, which are convenient for a specific and detailed understanding of the technical solutions of the present application, but should not be construed as limiting the scope of the claims. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application. Further, it is understood that various changes and modifications of the present application may be made by those skilled in the art after reading the above teachings, and equivalents thereof are intended to fall within the scope of the present application. It should also be understood that, based on the technical solutions provided by the present application, those skilled in the art obtain technical solutions through logical analysis, reasoning or limited experiments, all of which are within the scope of protection of the appended claims. The scope of the patent is therefore intended to be covered by the appended claims, and the description and drawings may be interpreted as illustrative of the contents of the claims.

Claims

1. A nucleic acid molecule, characterized in that the nucleic acid molecule comprises: nucleic acid fragment 1, nucleic acid fragment 2 and an exogenous gene expression cassette for expressing an exogenous fragment located between the nucleic acid fragment 1 and the nucleic acid fragment 2;

2. The nucleic acid molecule of claim 1, wherein the non-coding region satisfies the condition set forth in (1) or (2) below:

(1) The sequence of the non-coding region is taatta, and the exogenous fragment is inserted between taa and tta;

(2) The length of the sequence of the non-coding region is 7bp-200bp.

3. The nucleic acid molecule of claim 1, wherein the tail-to-tail gene pair is from a baculovirus.

4. The nucleic acid molecule of claim 1, wherein the exogenous fragment comprises one or more of a selectable marker gene and a gene of interest.

5. The nucleic acid molecule of claim 4, wherein the exogenous gene expression cassette satisfies one or more of the conditions set forth in 1) and 2) below:

1) The exogenous gene expression frame comprises a promoter for regulating the selectable marker gene, including a baculovirus very early promoter; and

2) The exogenous gene expression cassette includes a promoter that regulates the target gene including a P10 promoter or a PH promoter.

6. The nucleic acid molecule of claim 4, wherein the exogenous fragment satisfies one or more of the following conditions (a) and (B):

(A) The selection marker gene comprises one or more of a luciferase gene, a neomycin resistance gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene and a tryptophan synthetase gene; and

(B) The target gene encodes one or more of an antibody, a polypeptide, an enzyme, a hormone, a growth factor, and a protein receptor.

7. The nucleic acid molecule of any one of claims 1 to 6, wherein the tail-to-tail gene pair comprises any one of the following gene pairs:

8. The nucleic acid molecule of claim 7, wherein the sequence of the non-coding region comprises the sequence set forth in SEQ ID No. 1.

9. The nucleic acid molecule of claim 8, wherein the sequence of the nucleic acid molecule is as shown in 2779bp to 4912bp in SEQ ID NO.44, 2779bp to 11984bp in SEQ ID NO.46, 2779bp to 8988bp in SEQ ID NO.47, 2903bp to 8875bp in SEQ ID NO.48, 2861bp to 8881bp in SEQ ID NO.49, 749bp to 4910bp in SEQ ID NO.50, 749bp to 4776bp in SEQ ID NO.52, or 2903bp to 6930bp in SEQ ID NO. 53.

10. Recombinant plasmid, characterized in that it comprises a nucleic acid molecule according to any one of claims 1 to 9.

11. Recombinant baculovirus, characterized in that the genome of said recombinant baculovirus comprises the nucleic acid molecule as defined in any one of claims 6 to 9.

12. The recombinant baculovirus of claim 11, wherein said recombinant baculovirus satisfies one or more of the following conditions a) and B):

A) The recombinant baculovirus is a alfalfa silver vein moth nuclear polyhedrosis virus, a silkworm nuclear polyhedrosis virus, a yellow fir moth polynuclear capsid type nuclear polyhedrosis virus, a gypsy moth polynuclear capsid type nuclear polyhedrosis virus, a beet armyworm polynuclear capsid type nuclear polyhedrosis virus, a cotton bollworm nuclear polyhedrosis virus or a prodenia litura nuclear polyhedrosis virus; and

B) The recombinant baculovirus genome has inserted at other loci an exogenous gene expression cassette as defined in any one of claims 1 to 9.

13. The recombinant baculovirus of claim 12, wherein said selectable marker gene is inserted at any one of said OB1 site, said OB2 site and said OB3 site.

14. The method of constructing a recombinant baculovirus as defined in any one of claims 11 to 13, comprising the steps of:

The donor plasmid comprises a nucleic acid fragment of the nucleic acid molecule of any one of claims 1 to 9.

15. The method of claim 14, wherein the recombinant enzyme used in homologous recombination is RED, bxb1, ΦC31, cre or FLP.

16. The method of constructing a recombinant baculovirus as defined in any one of claims 14 to 15, wherein said donor plasmid comprises a shuttle plasmid.

17. An adeno-associated virus packaging vector system comprising AAV packaging essential elements comprising one or more of Cap gene, rep gene, and ITR gene; the AAV packaging essential elements are located in the same or different nucleic acid molecules of any one of claims 1 to 9.

18. A method for producing an expression product of an exogenous fragment, said method comprising the steps of:

Culturing after infection of a host cell with the recombinant baculovirus of any one of claims 11 to 13, and isolating the expression product of the exogenous fragment from the resulting culture product.

19. The method of claim 18, wherein the host cell comprises an insect cell line.

20. The method of claim 19, wherein the insect cell line comprises a lepidopteran insect cell line.

21. The method of producing an expression product of an exogenous fragment according to any one of claims 18 to 20, further comprising the step of detecting the titer of the resulting recombinant baculovirus;

The titer is detected by a standard curve method, which comprises the following steps:

22. A method for producing a recombinant adeno-associated virus, wherein the method comprises using the adeno-associated virus packaging vector system of claim 17.