CN118086253A - Hyaluronidase, gene thereof, engineering bacteria thereof and production method thereof - Google Patents

Abstract

The invention provides a hyaluronic acid hydrolase and a method for genetic design, leading into engineering bacteria and successfully expressing. The catalytic efficiency of the hyaluronidase provided by the invention is higher than that of the prior art. The engineering bacteria can be fermented repeatedly, and the enzyme activity can be maintained at a high level.

Description

Hyaluronidase, gene thereof, engineering bacteria thereof and production method thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a hyaluronic acid hydrolase, a gene thereof, engineering bacteria thereof and a production method.

Background

Hyaluronidase (Hyaluronidases, abbreviated as HAase) is a generic term for a widely distributed enzyme capable of degrading Hyaluronic Acid (HA), an enzyme capable of reducing the activity of hyaluronic acid in vivo, thereby improving the fluid permeability in tissues. Hyaluronic acid is a component in tissue matrix with the function of limiting the diffusion of moisture and other extracellular substances, and hyaluronidase can temporarily reduce the viscosity of cell interstitium in human body, promote the diffusion of exudates or blood of subcutaneous infusion and local accumulation and is beneficial to absorption, and is an important medicine diffusion agent. Clinically used as a drug penetrating agent, promotes the absorption of drugs and promotes the dissipation of local oedema or hematoma after surgery and trauma.

HAase is classified into three types according to the mechanism of action of hyaluronic acid: (a) Lactam- β -N-acetyl-D-aminoglucosidase: the enzyme belongs to hydrolytic enzymes, a high molecular weight substrate (HA) acts on beta-1, 4 glycosidic bonds in an inscribed way to hydrolyze, the end product obtained after degradation is mainly tetraose, hyaluronidase from animal sources such as Hymenoptera venom and mammalian sperms belongs to the class, and the enzyme is different from the latter two hyaluronidases in that the enzyme acts on not only HA but also chondroitin sulfate, and is also the enzyme which is industrially applied in the first place. (b) beta-glucosidase: is derived from leech and ancylostoma, belongs to hydrolase, acts on beta-1, 3 glycosidic bond through an inscription mode, and the end product obtained after degradation is tetraose, and the enzyme is specifically degraded HA. (c) Hyaluronan lyase (hyaluronate lyase, HL for short): most are represented by bacteria, and also include a group of enzymes of fungal and viral origin that act on beta-1, 4 glycosidic linkages by the action of N-acetylhexosaminidase, a beta-elimination mechanism, introducing an unsaturated bond between C-4 and C-5. Unlike the first two HAase, the final product of HL is a disaccharide. HLs of different genus sources are different in substrate specificity.

In the embodiment, CN114350639B introduces the hyaluronidase genes derived from 7 different animal venom into engineering bacteria for expression, and only recombinant hyaluronidase derived from the mountain big-teeth ant has hydrolytic activity as a result, and the result proves that the hyaluronidase genes derived from animals do not have hydrolytic activity after being introduced into the engineering bacteria. Therefore, although there are various genes encoding hyaluronan hydrolase in animals, engineering bacteria are constructed and successfully express enzymes with hydrolytic activity with contingency, and the inventors have inadvertently found that recombinantly expressed xenopus laevis hyaluronidase has hydrolytic activity and that the activity is greatly improved compared with wild type by sequence mutation, and in addition, the engineering bacteria constructed can be efficiently expressed.

Disclosure of Invention

In order to obtain the high-catalytic-activity hyaluronic acid hydrolase, the invention provides the hyaluronic acid hydrolase which comprises an amino acid sequence shown as SEQ ID NO. 11.

It will be appreciated by those skilled in the art that the amino acid sequence shown in SEQ ID NO.11 is the core functional sequence of the hyaluronan hydrolase that exerts hyaluronan hydrolyzing activity.

The invention provides another hyaluronic acid hydrolase, which comprises an amino acid sequence shown as SEQ ID NO.11 and a purification tag.

The amino acid sequence shown in SEQ ID NO.11 is obtained through genetic engineering. Those skilled in the art can introduce purification tags (purified proteins or tagged proteins) to facilitate subsequent purification.

After the amino acid sequence shown in SEQ ID NO.11 is known by a person skilled in the art, corresponding genes, expression vectors (recombinant vectors) and engineering cells (engineering bacteria) can be reasonably designed according to different chassis cells.

Preferably, the amino acid sequence shown as SEQ ID NO. 2.

The invention also provides a hyaluronic acid hydrolase precursor, which comprises the hyaluronic acid hydrolase and a signal peptide.

Preferably, the sequence as shown in SEQ ID NO. 14.

The invention also provides a gene for expressing the hyaluronic acid hydrolase or the precursor thereof.

The invention also provides a gene, which comprises a nucleotide sequence for expressing the hyaluronic acid hydrolase, wherein the nucleotide sequence is shown as SEQ ID NO.1, or as any one of the nucleotide sequences shown as SEQ ID NO. 8-10, or as SEQ ID NO.12, or as SEQ ID NO.13, or as SEQ ID NO. 15.

The invention also provides a recombinant vector comprising the gene.

Preferably, the framework of the vector is PPIC9 plasmid

The invention also provides an engineering cell comprising the gene of claim 6, or comprising the gene of claim 7, or comprising the vector of claim 8.

The engineering cell (engineering bacterium) in the present invention refers to a working cell constructed by genetic engineering means for producing a designed protein (e.g., enzyme), and can be constructed from the following chassis cells: including but not limited to bacterial cells such as E.coli (E.coli), streptomyces (streptomyces), salmonella typhimurium (salmonella typhimurium), and the like; a yeast cell; fungal cells such as Pichia pastoris (Pichia pastoris) and the like; insect cells such as drosophila, spodoptera litura Sf9 (spodoptera Sf 9) cells, and the like; animal cells such as chinese hamster ovary Cells (CHO), SP2/0 (mouse myeloma), human lymphoblastic cells, COS, NSO (mouse myeloma), 293T, arcuately melanoma cells, HT-1080, baby hamster kidney cells (BHK), human embryonic kidney cells (HEK), perc.6 (human retinal cells), and the like; or a plant cell.

Preferably, the chassis cells used are selected from pichia or e.

The invention also provides application of the hyaluronic acid hydrolase, and the hyaluronic acid hydrolase or a precursor thereof, a gene thereof, an expression vector thereof or an engineering cell thereof is used for hydrolyzing hyaluronic acid.

The invention also provides a method for constructing engineering cells, which comprises the steps of introducing genes or recombinant vectors into the basal cells; the gene is the gene; the recombinant vector is the vector.

Preferably, in the method, the chassis cell is selected from pichia or escherichia coli.

Preferably, the pichia pastoris is pichia pastoris KM71H or pichia pastoris GS115.

The invention also provides a method for producing the hyaluronic acid hydrolase, which comprises the step of fermenting the engineering cell.

Preferably, the fermentation process comprises glycerol control.

Preferably, the glycerol residual amount is controlled to be more than or equal to 2 percent.

Preferably, the fermentation process comprises temperature control.

Preferably, the fermentation temperature is no more than 35 ℃, or no more than 34 ℃, or no more than 33 ℃, or no more than 32 ℃, or no more than 31 ℃.

Herein, "signal peptide" means a short peptide present at the N-terminus of most newly synthesized proteins intended to enter the secretory pathway. It may also be referred to as a signal sequence, targeting signal, localization sequence, transit peptide, leader sequence or leader peptide. The signal peptide is typically cleaved from the protein by a signal peptidase. The signal peptide hydrolase in the present invention is secreted extracellularly, and then the signal peptide is cleaved by the signal peptidase.

By "hyaluronan hydrolase precursor" is meant a hyaluronan hydrolase to which a signal peptide is attached, and specifically to the present invention, the precursor is secreted by an engineering bacterium, and after further cleavage of the signal peptide by the engineering bacterium, a hyaluronan hydrolase is produced.

The signal peptide and the hyaluronan hydrolase may be directly linked or may be linked via a cleavable linker peptide.

Preferably, when the signal peptide is directly linked to the hyaluronan hydrolase, the signal peptide contains a separately cleavable moiety.

Preferably, the signal peptide on the precursor of the hyaluronidase is cleaved to remove residues remaining on the hyaluronidase without substantially affecting the activity of the hyaluronidase.

As a specific example of the amino acid residues remaining on the hyaluronidase, a hyaluronidase precursor comprising the sequence shown in SEQ ID NO.11 is formed in an engineering bacterium, and the signal peptide of the precursor is cleaved to form an amino acid sequence shown in SEQ ID NO.2, which has an amino acid residue "LE" more at the N-terminus than SEQ ID NO. 11.

"Tag protein" or "purified protein" or "purification tag" means a class of protein molecules that can bind to a particular substrate. The protein has the function of being combined with a substrate capable of recognizing the protein during purification, thereby playing the role of purifying hydrolase.

The hyaluronan hydrolase herein may comprise a tag protein, and after purification, whether the tag protein on the hydrolase is cleaved or not does not affect the activity of the hydrolase. The tag protein on the hydrolase is not usually cut in the preparation for the purpose of simplifying the process and reducing the production cost.

Preferably, the tag protein is selected from the group consisting of tag proteins known to those skilled in the art or computer-programmed tag proteins capable of specifically binding to a known substrate.

Further preferably, the tag protein is selected from, but not limited to, the following proteins: glutathione S-transferase (GSTs), C-myc, chitin binding domain, maltose Binding Protein (MBP), SUMO heterologous affinity moiety, monoclonal antibody or protein A, streptavidin Binding Protein (SBP), cellulose binding domain, calmodulin binding peptide, S tag, strep tag II, FLA, protein A, protein G, histidine Affinity Tag (HAT), polyhistidine.

Preferably, the tag protein is located at the N-terminus or the C-terminus of the hydrolase.

Preferably, the tag protein is a histidine tag.

Preferably, the sequence of the tag protein is His-His-His-His-His-His.

Preferably, a cleavable or non-cleavable linking short peptide is linked between the tag protein and the hydrolase.

Preferably, the cleavable or non-cleavable linking short peptide is not recognized and cleaved by a protease of the host cell after expression.

Preferably, the tag protein is not linked to the hydrolase by a linking short peptide.

Preferably, the sequence of the linking short peptide is four aspartic acid lysine carboxyl terminal peptide bonds: aspartic acid-lysine (DDDDK)

As a preferred example, the amino acid sequence of the tag protein introduced based on SEQ ID NO.11 is shown in SEQ ID NO. 2.

The invention has the beneficial effects that:

according to the invention, the hydrolase gene of the animal is inserted into the engineering cell through proper gene mutation, and the hyaluronidase is obtained through successful fermentation, so that the catalytic efficiency of the hyaluronidase is higher than that of the prior art.

The engineered cells of the invention can be fermented repeatedly and the enzyme activity can be maintained at high levels.

Detailed Description

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents, and the like used in the following examples are commercially available products unless otherwise specified.

The invention will be further described by way of the following examples, which are not intended to limit the scope of the invention in any way. It will be appreciated by those skilled in the art that equivalent substitutions and modifications may be made to the teachings of the present invention, and that such modifications may still fall within the scope of the present invention.

Enzyme activity detection method (DNS method): the principle of the 3, 5-dinitrosalicylic acid method (3, 5-DINITRSALICYLIC, DNS method) is that DNS reacts with the reducing end of degradation products of hyaluronidase in alkaline environment, the reaction products are red brown after boiling, the color depth is in linear relation with the content of reducing sugar in a certain range, the higher the content of reducing sugar is, the more obvious the color difference is, and the quantity of the reducing sugar obtained by detection at 585nm reflects the enzyme activity. Definition of enzyme activity: the amount of enzyme required to produce 1nmol of reducing sugar per 10min at ph=5.5, 37 ℃ is defined as one enzyme activity unit (U).

Example 1

Design of target DNA sequence

Selecting mRNA (NCBI Reference Sequence:NM_ 001126514.1) of a Xenopus laevis hyaluronidase 2 (hyal 2) coding gene in an NCBI database, synthesizing to obtain a CDS region, deleting a sig_peptide sequence, and performing codon coding optimization on the rest sequence. The finally expressed enzyme is changed from tyrosine to serine (TAC-TCC) at amino acid 238; 268 amino acid, serine to tyrosine (TCT-TAC); 281 amino acid from valine to aspartic acid (GAT-GTT); a sequence for expressing a histidine tag is added at the 3' end, so that the subsequent purification is convenient; xhoI restriction site sequence is added to the 5 'end, and NotI restriction site sequence is added to the 3' end. Finally, the gene sequence SEQ ID NO.1 is constructed and named Hyal2A. The sequence is synthesized and amplified by Shanghai technology Inc., and the obtained sequence is matched with the designed Hyal2A sequence after detection. After the sequence is introduced into engineering bacteria, the hyaluronic acid hydrolase with a purification tag can be obtained through fermentation expression, and the amino acid sequence is shown as SEQ ID NO. 2.

TA cloning of the Hyal2A sequence was performed using pMD ^TM 18-T Vector Cloning Kit of Takara Bio Inc. to give pTHyal A.

Lactose-deficient E.coli DH5α (ELK Biotechnonogy cat. EC 001-01) was used as the basal cell, and pTHyal A was introduced. Screening recombinant cells containing a target gene, culturing in LB medium containing ampicillin until turbidity, and mixing with 40% glycerol 1:1, mixing and preserving for standby.

Example 2

PGAPH alpha-Hyal 2A sequence construction

Referring to Song Qingfeng et al, construction and functional verification of a novel Pichia pastoris secretory expression vector, a PGAPH alpha plasmid is constructed, and the steps are as follows:

The genome of Pichia pastoris is amplified by using GAP promoter primers SEQ ID NO.3 and SEQ ID NO.4, and EcoT 22I and BamH I enzyme cutting site sequences are respectively added at two ends, wherein the electrophoresis band of the amplified product of the GAP promoter is about 500bp, and the amplified product is sequenced to SEQ ID NO.5.

GAP promoter sequence is recombined on pMD ^TM -T plasmid, and the recombined vector is introduced into E.coli DH5α to complete TA cloning.

The recombinant vector is extracted and purified from recombinant escherichia coli, and is digested by double digestion with EcoT 22I and BamH I enzyme together with PPIC9 plasmid, and is connected by T4 ligase, named PGAPH α vector, and is introduced into escherichia coli E.coliDH5α for standby.

The GAP promoter is used in PGAPH alpha plasmid, so that the aim gene can be transcribed and translated in large quantity without methanol, and proper secretion signal peptide is selected, thus facilitating extracellular secretion and increasing the yield of hydrolase.

The PGAPH α -Hyal2A sequence was constructed as follows:

extracting pTHyal A and PGAPH alpha prepared above, double-enzyme-cutting two plasmids by XhoI enzyme and NotI enzyme, and running gel by electrophoresis to recover 1413bp and 8256bp bands, respectively, using NEB Gibson And (3) connecting a Master Mix kit to obtain a recombinant vector, wherein a part of the recombinant vector is introduced into E.coli DH5α for preservation, and the other part of the recombinant vector is subjected to linearization treatment by using SacI endonuclease. And (3) carrying out PCR amplification by using a primer pair linearization PGAPH alpha-Hyal 2A recombinant vector at the upstream and downstream of SEQ ID NO.6 and SEQ ID NO.7, and sequencing to obtain a detection result which accords with SEQ ID NO.8, wherein the target gene and the vector are proved to be recombined.

Example 3

Introduction of expression vectors into Chassis cells

1) Pichia pastoris KM71H frozen stock solution is subjected to coating culture on a YPD solid medium plate, inoculated into 50ml of YPD liquid medium and cultured for 10 hours at 30 ℃. The cells were obtained by centrifugation at 4℃and washed 2-3 times with pre-chilled sterile physiological saline, resuspended in 1ml pre-chilled 1mol/L sorbitol solution and placed on ice for use.

2) Adding the linearized PGAPH alpha-Hyal 2A carrier into 1ml pichia pastoris cell suspension placed in an ice bath, shaking the ice bath uniformly for 5-10min, adding 0.2ml of the bacterial suspension into a shock conversion cup, treating with 2000V high pressure 5 ms shock conversion time, immediately adding 1ml of precooled 1mol/L sorbitol solution after the shock is finished, and placing the mixture in a 30 ℃ incubator at constant temperature for 1.5h. The cultured cell plasmid mixture is coated on a yeast defect culture medium SD-His (Beijing Soy Bao technology Co., ltd.) and is cultured for 12 hours at a constant temperature of 30 ℃, and the single colony is the positive recombinant Pichia pastoris cell of PGAPH α -Hyal2A which is successfully transformed, and the cell is protected by glycerol and frozen for standby.

3) Meanwhile, the genes in the single colony are sequenced, and the result shows that the sequence of the target gene is met, so far, the established recombinant expression vector PGAPH alpha-Hyal 2A is integrated into a Pichia pastoris KM71H chromosome in a gene recombination mode.

Example 4

Engineering bacteria fermentation

Flat screen

A solid agar plate was prepared using a yeast-deficient medium SD-His (Beijing Soy Bao technology Co., ltd.) according to the procedure of the specification, 200ul of the frozen stock solution was spread on the plate, and the plate was cultured upside down at 30℃for 10-12 hours.

Shake flask culture

YPD medium was used, 0.2g/L histidine and 50ug/ml ampicillin were added in addition, and the flask was filled with 100ml/500ml triangular flask and sterilized for use. Two seeds are inoculated in each bottle of culture medium, the temperature is 30 ℃, the rpm/min is 220, the shake culture is carried out for 20 hours, and the OD600 is more than or equal to 12.

Seed pot culture (30L/50L)

The seed tank adopts YPD culture medium, the inoculation amount is 0.5-1.5%, the initial stirring rotation speed is 200rpm/min, the air quantity is 1VVM, the dissolved oxygen is controlled to be more than or equal to 50%, the tank pressure is 0.05mpa, the culture is carried out for 16-20h, the OD600 is more than or equal to 20, and the culture is finished.

Fermentation culture (100L/200L)

The preparation method of the fermentation medium comprises the following steps:

Material	Proportion (%)
		Glycerol	4.5
Potassium sulfate	1.2
		Magnesium sulfate heptahydrate	1.2
Potassium hydroxide	0.2
		Calcium chloride dihydrate	0.1
85% Phosphoric acid	15ml/L
		PTM	1ml/L
Histidine	0.2g/L

Sterilizing at 121 ℃ for 15min, adding 20g of histidine mother liquor with a film, transferring 10% -15%, culturing at 30+ -1 ℃ with air flow rate of 0.5vvm, controlling pH at 5.0-5.1 with ammonia water, DO not less than 50%, stirring at a rotating speed: 200-300rpm, tank pressure: 0.05 plus or minus 0.01Mpa.

Culturing for 14-20h, adding sterilized glycerol at the rate of OD600 of more than or equal to 30 (wet weight of 50-100 g/L), controlling glycerol residue of more than or equal to 2%, adjusting DO control of more than or equal to 30%, stirring at the speed of 250-550rpm, adding glycerol for 12h, and adding glycerol at the speed of 200-300ml/h; the adding speed is 400-600ml/h for 12-36 h; the supplementing speed is 800-1000ml/h for 36-60 h; the feeding speed is 1200-1400ml/h from 60h to 100h, and the total culture time is 96-120h.

Adding glycerol for 60h, and cooling and culturing at 26-28deg.C.

The enzyme activity of the fermentation broth in the tank is detected to be 133 ten thousand U/ml by a DNS method, the volume of the fermentation broth in the tank is 130L, and the wet weight of the fermentation broth in the tank is 400g/L.

According to an SDS-PAGE gel electrophoresis operation manual, using a protein 170Kda Marker as a Marker, carrying out sample loading treatment, wherein a sample is subjected to high-speed centrifugation at 14000rpm/min and at 4 ℃ for 10min, passes through a 0.22um aqueous phase membrane, is loaded with dye, and shows that a clear protein band appears at about 50Kda by protein running gel, thus indicating that the cell expresses hyaluronidase protein.

Repeated culture of bacterial strain

Separating thalli by a tube centrifuge, collecting thalli, re-suspending by using 100L of sterilization fermentation culture medium, wherein the culture temperature is 30+/-1 ℃, the air flow rate is 0.5vvm, the PH is controlled to be 5.0-5.1 by using ammonia water, the DO is more than or equal to 50 percent, and the stirring rotating speed is that: 200-300rpm, tank pressure: culturing at 0.05+ -0.01 Mpa for 8-12 hr, adding sterilized glycerol, controlling glycerol residue not less than 2%, adjusting DO control not less than 30%, stirring at 250-550rpm, and adding glycerol at 0-24 hr and 600-800 ml/hr; and the total culture time is 56-60h after 24h to the tank filling speed of 1000-1200 ml/h.

Adding glycerol for 24h, and cooling and culturing at 26-28deg.C.

The enzyme activity of the fermentation broth in the tank is detected to be 85 ten thousand U/ml by a DNS method, the volume of the fermentation broth in the tank is 120L, and the wet weight of the fermentation broth in the tank is 380g/L.

Example 5

Filtration and purification of enzymes

Ceramic membrane filtration

The supernatants from the two fermentations were combined and filtered at low temperature using a 50nm pore size ceramic membrane and top washed with 1 supernatant volume of purified water.

Salting out

Adjusting pH of the effluent with phosphoric acid to 3.5-4.5, slowly adding ammonium sulfate into ice bath at low temperature until protein is no longer separated out, collecting crude protein precipitate, and redissolving with purified water.

Purification of Ni-NTA affinity purification histidine-tagged proteins

Desired mobile phase configuration:

wash buffer:50mM NaH2PO4, 300mM Nacl,20mM imidazole, pH8.0

An execution buffer:50mM NaH2PO4, 300mM Nacl,250mM imidazole, pH8.0

1. After centrifugation, the supernatant protein and Ni-NTA are mixed uniformly, the column loading amount is controlled below 5g/L, and the mixture is vibrated for 1 hour in ice water bath, so that the mixture is fully mixed uniformly and combined for adsorption.

2. The mixture was transferred to a chromatographic column and the liquid was allowed to drain naturally, at a slightly slower rate (5-6 seconds/drop) and the effluent was collected. SDS-PAGE can be performed by sampling to see the protein column.

3. The column was washed with Wash buffer in an amount of about 5-10 times the column volume to thoroughly Wash out the contaminating proteins.

4. The column was washed with an elision buffer until a280<0.1.

5. A280 of the collected washes and eluents was measured, and samples from tubes with significant changes in A280 were selected for SDS-PAGE to analyze distribution of histidine-tagged proteins. Tubes with similar A280 were selected and pooled according to A280 and the electropherograms, and tubes without the protein of interest were discarded.

Desalting and concentrating target protein

The desalination treatment of the target protein uses a low-temperature ultrafiltration mode, adopts an ultrafiltration membrane with a molecular weight of 1 ten thousand to remove salt, uses purified water to carry out top washing until the effluent conductance is lower than 30ms/cm, and concentrates the protein solution by 10 times of volume.

Freeze-drying of concentrated proteins

And (3) a freeze dryer with heat conduction by using silicone oil is selected, pre-freezing is performed at a low temperature below minus 50 ℃ firstly, vacuumizing is started after about 2 hours, meanwhile, the temperature is increased to minus 20 ℃ for 0-24 hours, the temperature is gradually increased to 0 ℃ for 24-48 hours, the temperature is gradually increased to 30 ℃ for 48-96 hours, and the freeze drying process is finished.

The enzyme activity of the finished product obtained by detection through a DNS method is 4200 ten thousand U/g, and the hydrolyzed hyaluronic acid is detected through sephadex filtration chromatography, has the molecular weight of about 800Da and accords with the characteristic that the final product after enzymolysis is tetraose.

In addition, other enzymes containing the same core functional sequence (SEQ ID NO. 11) are designed, the signal peptides are distinguished, the expressed genes are all excised by engineering bacteria, as an exemplary embodiment, the designed gene sequences are SEQ ID NO.9 and SEQ ID NO.10, the genes are inserted into a carrier and then introduced into chassis cells according to the method in the embodiment, and finally the enzyme activity of the fermentation broth is measured to be different due to the fact that the different signal peptides cause different enzyme contents in the final fermentation broth, but the enzyme activity of the purified and extracted finished enzyme reaches a similar level.

Comparative example 1

According to the above example, engineering bacteria are constructed to express original hyaluronic acid hydrolase (amino acids 238, 268 and 281 are not mutated), the enzyme activity of the fermentation broth is 15 ten thousand U/ml, and the tank volume is 120L. Purifying and extracting finished enzyme, wherein the enzyme activity is 630 ten thousand U/g.

The original hyaluronidase without mutation is far lower in enzyme activity than the mutated hyaluronidase.

Description of sequence numbering involved in the present invention

SEQ ID NO.1: the final target gene sequence is used for expressing hyaluronic acid hydrolase

SEQ ID NO.2: primary sequence of protein translated from target gene (SEQ ID NO. 1)

SEQ ID NO.3: upstream primer of GAP promoter primer sequence

SEQ ID NO.4: downstream primer of GAP promoter primer sequence

SEQ ID NO.5: GAP promoter sequence

SEQ ID NO.6: upstream primer of PGAPH alpha-Hyal 2A linearization primer

SEQ ID NO.7: downstream primer of PGAPH alpha-Hyal 2A linearization primer

SEQ ID NO.8: PGAPH α -Hyal2A recombinant plasmid sequence

SEQ ID NO.9: gene sequence Hyal2B

SEQ ID NO.10: gene sequence Hyal2C

SEQ ID NO.11: hyaluronan hydrolase sequence without purification tag

SEQ ID NO.12: the hyaluronic acid hydrolase coding gene sequence without purification tag is used for coding the amino acid sequence shown as SEQ ID NO.11

SEQ ID NO.13: coding gene sequence of hyaluronic acid hydrolase with purification tag

SEQ ID NO.14: hyaluronan hydrolase precursor sequences

SEQ ID NO.15: coding gene sequence of hyaluronic acid hydrolase precursor for coding amino acid sequence shown as SEQ ID NO.14

The sequences involved in the present invention are specifically as follows:

SEQ ID NO.1 (Gene sequence of interest)

CTCGAGAACGGTCAATTGTCTGATTCTTGGTTGAACAAGCCAACTTTTAGGCCAGTTTTTACTAGAAGACCATTTATTATTGCCTGGAACGCTCCAACTCAAGATTGTCCACCAAGGTTTAACGTTCATTTGGATTTGAAGTTGTTTGATTTGAACGCTTCTCCAAACGAAGGTTTTGTTGATCAAAACTTGACTATTTTTTACAAGGAAAGATTGGGTATGTACCCATACTACGATGAACATTTGGCTCCAGTTGCTGGTGGTTTGCCACAAAACGCTTCTTTGAGAGCTCATTTGGATAAGTTGCCAGAAGGTATTCAAAAGTACATTAGATCTAGAGATAAGGATGGTTTGGCTGTTATTGATTGGGAAGAATGGAGACCAATTTGGGTTAGAAACTGGCAAAACAAGGATGTTTACAGACAAAACTCTAGAAACTTGGTTTCTTCTAGACATCCAACTTGGCCAAGAGAAAAGGTTGATAAGGAAGCTTTGTACGAATTTGAAAACGCTGCTAGAGAATTTATGACTGAAACTTTGAGACATGCTAAGAACTACAGACCAAGACAATTGTGGGGTTTTTACTTGTTTCCAGATTGTTACAACCATGATTACGTTAAGAACAGAGATTCTTACACTGGTCAATGTCCAGATGTTGAAATTTCTAGAAACGATCAATTGTCTTGGTTGTGGGAAGAATCTACTGCTTTGTCCCCATCTATTTACTTGGATCAAATTTTGGCTTCTTCTGAAAACGGTAGAAAGTTTGTTAGATCTAGAGTTAGAGAAGCTATGAGGATTTACTACAGGCATCATAAGGATTACTCTTTGCCAGTTTTTGATTACACTAGGCCAACTTACATTAGAAAGTTGGATTTTTTGTCTCAAATGGATTTGATTTCTACTATTGGTGAATCTGCTGCTCAAGGTGCTGCTGGTGTTATTTTTTGGGGTGATGCTGAATACACTAAGTCTAAGGAAACTTGTCAAATGATTAAGAAGTACTTGGATGAAGATTTGGGTCATTACATTGTTAACGTTACTACTGCTGCTGAATTGTGTTCTCAATCTTTGTGTAACGGTAACGGTAGATGTTTGAGACAAGAAAACAACACTGATGCCTTTTTGCATTTGAACCCAGCCAACTTTCAAATTGTTTCTGCCCCAAAGGATTTTCAAGGTCCATCTTTGAGAGCTGAAGGTAAGTTGTCTGCTGGTGATATTGCCACTTTGAGATCTCAATTTAGATGTCAATGTTACGTTGATTGGTACGGTGATTCTTGTGGTATTCAAAGGTCTACTAACGGTGGTGCTGTTGCTACTGGTCCATGTGGTATTGTTTTGGTTGTTTCTTTGGTTGCTTTGATTTTGGCTTTGTTGTGCCATCATCATCATCATCATTAAGCGGCCGCT

SEQ ID NO.2 (primary sequence of the protein translated from the target gene)

LENGQLSDSWLNKPTFRPVFTRRPFIIAWNAPTQDCPPRFNVHLDLKLFDLNASPNEGFVDQNLTIFYKERLGMYPYYDEHLAPVAGGLPQNASLRAHLDKLPEGIQKYIRSRDKDGLAVIDWEEWRPIWVRNWQNKDVYRQNSRNLVSSRHPTWPREKVDKEALYEFENAAREFMTETLRHAKNYRPRQLWGFYLFPDCYNHDYVKNRDSYTGQCPDVEISRNDQLSWLWEESTALSPSIYLDQILASSENGRKFVRSRVREAMRIYYRHHKDYSLPVFDYTRPTYIRKLDFLSQMDLISTIGESAAQGAAGVIFWGDAEYTKSKETCQMIKKYLDEDLGHYIVNVTTAAELCSQSLCNGNGRCLRQENNTDAFLHLNPANFQIVSAPKDFQGPSLRAEGKLSAGDIATLRSQFRCQCYVDWYGDSCGIQRSTNGGAVATGPCGIVLVVSLVALILALLCHHHHHH

SEQ ID NO.3 (GAP promoter primer sequence-upstream primer)

5’-ATG CAT GAT CCT TTT TTG TAGAAATG-3’

SEQ ID NO.4 (GAP promoter primer sequence-downstream primer)

5’-GGATCC TGT GTT TTGATAGTT GTT CA-3’

SEQ ID NO.5 (GAP promoter sequence)

ATGCATGATCCTTTTTTGTAGAAATGTCTTGGTGTCCTCGTCCAATCAAGGTAGCCATCTCTGAAATATCTGGCTCCGTTGCAACTCCGAACGACCTGCTGGCAACGTAAAATTCTCCGGGGTAAAACTTAAATGTGGAGTAATGGAACCAGAAACGTCTCTTCCCTTCTCTCTCCTTCCACCGCCCGTTACCGTCCCTAGGAAATTTTACTCTGCTGGAGAGCTTCTTCTACGGCCCCCTTGCAGCAATGCTCTTCCCAGCATTACGTTGCGGGTAAAACGGAGGTCGTGTACCCGACCTAGCAGCCCAGGGATGGAAAAGTCCCGGCCGTCGCTGGCAATAATAGCGGGCGGACGCATGTCATGAGATTATTGGAAACCACCAGAATCGAATATAAAAGGCGAACACCTTTCCCAATTTTGGTTTCTCCTGACCCAAAGACTTTAAATTTAATTTATTTGTCCCTATTTCAATCAATTGAACAACTATCAAAACACAGGATCCA

SEQ ID NO.6 (PGAPH α -Hyal2A linearized primer-upstream primer)

5’-AGCTCG CTCATTCCAATTCCTTCT-3’

SEQ ID NO.7 (PGAPH α -Hyal2A linearized primer-downstream primer)

5’-CCAATCAAGCCCAATAACTGGGCT-3’

SEQ ID NO.8 (PGAPH α -Hyal2A recombinant plasmid sequence)

AGATCTAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCCACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGCCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATTATGCATGATCCTTTTTTGTAGAAATGTCTTGGTGTCCTCGTCCAATCAGGTAGCCATCTCTGAAATATCTGGCTCCGTTGCAACTCCGAACGACCTGCTGGCAACGTAAAATTCTCCGGGGTAAAACTTAAATGTGGAGTAATGGAACCAGAAACGTCTCTTCCCTTCTCTCTCCTTCCACCGCCCGTTACCGTCCCTAGGAAATTTTACTCTGCTGGAGAGCTTCTTCTACGGCCCCCTTGCAGCAATGCTCTTCCCAGCATTACGTTGCGGGTAAAACGGAGGTCGTGTACCCGACCTAGCAGCCCAGGGATGGAAAAGTCCCGGCCGTCGCTGGCAATAATAGCGGGCGGACGCATGTCATGAGATTATTGGAAACCACCAGAATCGAATATAAAAGGCGAACACCTTTCCCAATTTTGGTTTCTCCTGACCCAAAGACTTTAAATTTAATTTATTTGTCCCTATTTCAATCAATTGAACAACTATCAAAACACAGGATCCAAACGATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAACGGTCAATTGTCTGATTCTTGGTTGAACAAGCCAACTTTTAGGCCAGTTTTTACTAGAAGACCATTTATTATTGCCTGGAACGCTCCAACTCAAGATTGTCCACCAAGGTTTAACGTTCATTTGGATTTGAAGTTGTTTGATTTGAACGCTTCTCCAAACGAAGGTTTTGTTGATCAAAACTTGACTATTTTTTACAAGGAAAGATTGGGTATGTACCCATACTACGATGAACATTTGGCTCCAGTTGCTGGTGGTTTGCCACAAAACGCTTCTTTGAGAGCTCATTTGGATAAGTTGCCAGAAGGTATTCAAAAGTACATTAGATCTAGAGATAAGGATGGTTTGGCTGTTATTGATTGGGAAGAATGGAGACCAATTTGGGTTAGAAACTGGCAAAACAAGGATGTTTACAGACAAAACTCTAGAAACTTGGTTTCTTCTAGACATCCAACTTGGCCAAGAGAAAAGGTTGATAAGGAAGCTTTGTACGAATTTGAAAACGCTGCTAGAGAATTTATGACTGAAACTTTGAGACATGCTAAGAACTACAGACCAAGACAATTGTGGGGTTTTTACTTGTTTCCAGATTGTTACAACCATGATTACGTTAAGAACAGAGATTCTTACACTGGTCAATGTCCAGATGTTGAAATTTCTAGAAACGATCAATTGTCTTGGTTGTGGGAAGAATCTACTGCTTTGTACCCATCTATTTACTTGGATCAAATTTTGGCTTCTTCTGAAAACGGTAGAAAGTTTGTTAGATCTAGAGTTAGAGAAGCTATGAGGATTTCTTACAGGCATCATAAGGATTACTCTTTGCCAGTTTTTGTTTACACTAGGCCAACTTACATTAGAAAGTTGGATTTTTTGTCTCAAATGGATTTGATTTCTACTATTGGTGAATCTGCTGCTCAAGGTGCTGCTGGTGTTATTTTTTGGGGTGATGCTGAATACACTAAGTCTAAGGAAACTTGTCAAATGATTAAGAAGTACTTGGATGAAGATTTGGGTCATTACATTGTTAACGTTACTACTGCTGCTGAATTGTGTTCTCAATCTTTGTGTAACGGTAACGGTAGATGTTTGAGACAAGAAAACAACACTGATGCCTTTTTGCATTTGAACCCAGCCAACTTTCAAATTGTTTCTGCCCCAAAGGATTTTCAAGGTCCATCTTTGAGAGCTGAAGGTAAGTTGTCTGCTGGTGATATTGCCACTTTGAGATCTCAATTTAGATGTCAATGTTACGTTGATTGGTACGGTGATTCTTGTGGTATTCAAAGGTCTACTAACGGTGGTGCTGTTGCTACTGGTCCATGTGGTATTGTTTTGGTTGTTTCTTTGGTTGCTTTGATTTTGGCTTTGTTGTGACATCATCATCATCATCATTAAGCGGCCGCGAATTAATTCGCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTTATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCTATCGAATCTAAATGTAAGTTAAAATCTCTAAATAATTAAATAAGTCCCAGTTTCTCCATACGAACCTTAACAGCATTGCGGTGAGCATCTAGACCTTCAACAGCAGCCAGATCCATCACTGCTTGGCCAATATGTTTCAGTCCCTCAGGAGTTACGTCTTGTGAAGTGATGAACTTCTGGAAGGTTGCAGTGTTAACTCCGCTGTATTGACGGGCATATCCGTACGTTGGCAAAGTGTGGTTGGTACCGGAGGAGTAATCTCCACAACTCTCTGGAGAGTAGGCACCAACAAACACAGATCCAGCGTGTTGTACTTGATCAACATAAGAAGAAGCATTCTCGATTTGCAGGATCAAGTGTTCAGGAGCGTACTGATTGGACATTTCCAAAGCCTGCTCGTAGGTTGCAACCGATAGGGTTGTAGAGTGTGCAATACACTTGCGTACAATTTCAACCCTTGGCAACTGCACAGCTTGGTTGTGAACAGCATCTTCAATTCTGGCAAGCTCCTTGTCTGTCATATCGACAGCCAACAGAATCACCTGGGAATCAATACCATGTTCAGCTTGAGACAGAAGGTCTGAGGCAACGAAATCTGGATCAGCGTATTTATCAGCAATAACTAGAACTTCAGAAGGCCCAGCAGGCATGTCAATACTACACAGGGCTGATGTGTCATTTTGAACCATCATCTTGGCAGCAGTAACGAACTGGTTTCCTGGACCAAATATTTTGTCACACTTAGGAACAGTTTCTGTTCCGTAAGCCATAGCAGCTACTGCCTGGGCGCCTCCTGCTAGCACGATACACTTAGCACCAACCTTGTGGGCAACGTAGATGACTTCTGGGGTAAGGGTACCATCCTTCTTAGGTGGAGATGCAAAAACAATTTCTTTGCAACCAGCAACTTTGGCAGGAACACCCAGCATCAGGGAAGTGGAAGGCAGAATTGCGGTTCCACCAGGAATATAGAGGCCAACTTTCTCAATAGGTCTTGCAAAACGAGAGCAGACTACACCAGGGCAAGTCTCAACTTGCAACGTCTCCGTTAGTTGAGCTTCATGGAATTTCCTGACGTTATCTATAGAGAGATCAATGGCTCTCTTAACGTTATCTGGCAATTGCATAAGTTCCTCTGGGAAAGGAGCTTCTAACACAGGTGTCTTCAAAGCGACTCCATCAAACTTGGCAGTTAGTTCTAAAAGGGCTTTGTCACCATTTTGACGAACATTGTCGACAATTGGTTTGACTAATTCCATAATCTGTTCCGTTTTCTGGATAGGACGACGAAGGGCATCTTCAATTTCTTGTGAGGAGGCCTTAGAAACGTCAATTTTGCACAATTCAATACGACCTTCAGAAGGGACTTCTTTAGGTTTGGATTCTTCTTTAGGTTGTTCCTTGGTGTATCCTGGCTTGGCATCTCCTTTCCTTCTAGTGACCTTTAGGGACTTCATATCCAGGTTTCTCTCCACCTCGTCCAACGTCACACCGTACTTGGCACATCTAACTAATGCAAAATAAAATAAGTCAGCACATTCCCAGGCTATATCTTCCTTGGATTTAGCTTCTGCAAGTTCATCAGCTTCCTCCCTAATTTTAGCGTTCAACAAAACTTCGTCGTCAAATAACCGTTTGGTATAAGAACCTTCTGGAGCATTGCTCTTACGATCCCACAAGGTGGCTTCCATGGCTCTAAGACCCTTTGATTGGCCAAAACAGGAAGTGCGTTCCAAGTGACAGAAACCAACACCTGTTTGTTCAACCACAAATTTCAAGCAGTCTCCATCACAATCCAATTCGATACCCAGCAACTTTTGAGTTGCTCCAGATGTAGCACCTTTATACCACAAACCGTGACGACGAGATTGGTAGACTCCAGTTTGTGTCCTTATAGCCTCCGGAATAGACTTTTTGGACGAGTACACCAGGCCCAACGAGTAATTAGAAGAGTCAGCCACCAAAGTAGTGAATAGACCATCGGGGCGGTCAGTAGTCAAAGACGCCAACAAAATTTCACTGACAGGGAACTTTTTGACATCTTCAGAAAGTTCGTATTCAGTAGTCAATTGCCGAGCATCAATAATGGGGATTATACCAGAAGCAACAGTGGAAGTCACATCTACCAACTTTGCGGTCTCAGAAAAAGCATAAACAGTTCTACTACCGCCATTAGTGAAACTTTTCAAATCGCCCAGTGGAGAAGAAAAAGGCACAGCGATACTAGCATTAGCGGGCAAGGATGCAACTTTATCAACCAGGGTCCTATAGATAACCCTAGCGCCTGGGATCATCCTTTGGACAACTCTTTCTGCCAAATCTAGGTCCAAAATCACTTCATTGATACCATTATTGTACAACTTGAGCAAGTTGTCGATCAGCTCCTCAAATTGGTCCTCTGTAACGGATGACTCAACTTGCACATTAACTTGAAGCTCAGTCGATTGAGTGAACTTGATCAGGTTGTGCAGCTGGTCAGCAGCATAGGGAAACACGGCTTTTCCTACCAAACTCAAGGAATTATCAAACTCTGCAACACTTGCGTATGCAGGTAGCAAGGGAAATGTCATACTTGAAGTCGGACAGTGAGTGTAGTCTTGAGAAATTCTGAAGCCGTATTTTTATTATCAGTGAGTCAGTCATCAGGAGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGAGTATCTATGATTGGAAGTATGGGAATGGTGATACCCGCATTCTTCAGTGTCTTGAGGTCTCCTATCAGATTATGCCCAACTAAAGCAACCGGAGGAGGAGATTTCATGGTAAATTTCTCTGACTTTTGGTCATCAGTAGACTCGAACTGTGAGACTATCTCGGTTATGACAGCAGAAATGTCCTTCTTGGAGACAGTAAATGAAGTCCCACCAATAAAGAAATCCTTGTTATCAGGAACAAACTTCTTGTTTCGAACTTTTTCGGTGCCTTGAACTATAAAATGTAGAGTGGATATGTCGGGTAGGAATGGAGCGGGCAAATGCTTACCTTCTGGACCTTCAAGAGGTATGTAGGGTTTGTAGATACTGATGCCAACTTCAGTGACAACGTTGCTATTTCGTTCAAACCATTCCGAATCCAGAGAAATCAAAGTTGTTTGTCTACTATTGATCCAAGCCAGTGCGGTCTTGAAACTGACAATAGTGTGCTCGTGTTTTGAGGTCATCTTTGTATGAATAAATCTAGTCTTTGATCTAAATAATCTTGACGAGCCAAGGCGATAAATACCCAAATCTAAAACTCTTTTAAAACGTTAAAAGGACAAGTATGTCTGCCTGTATTAAACCCCAAATCAGCTCGTAGTCTGATCCTCATCAACTTGAGGGGCACTATCTTGTTTTAGAGAAATTTGCGGAGATGCGATATCGAGAAAAAGGTACGCTGATTTTAAACGTGAAATTTATCTCAAGATCTCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTAATTCTCATGTTTGACAGCTTATCATCGATAAGCTGACTCATGTTGGTATTGTGAAATAGACGCAGATCGGGAACACTGAAAAATAACAGTTATTATTCG

SEQ ID NO.9 Gene sequence Hyal2B

GGATCCATGCCTTGCTGCCTTTCCTTCCTGCCTGCCTTCCTGTGGCTTTTCCTTGGAGCTGCGGCCAACGGTCAATTGTCTGATTCTTGGTTGAACAAGCCAACTTTTAGGCCAGTTTTTACTAGAAGACCATTTATTATTGCCTGGAACGCTCCAACTCAAGATTGTCCACCAAGGTTTAACGTTCATTTGGATTTGAAGTTGTTTGATTTGAACGCTTCTCCAAACGAAGGTTTTGTTGATCAAAACTTGACTATTTTTTACAAGGAAAGATTGGGTATGTACCCATACTACGATGAACATTTGGCTCCAGTTGCTGGTGGTTTGCCACAAAACGCTTCTTTGAGAGCTCATTTGGATAAGTTGCCAGAAGGTATTCAAAAGTACATTAGATCTAGAGATAAGGATGGTTTGGCTGTTATTGATTGGGAAGAATGGAGACCAATTTGGGTTAGAAACTGGCAAAACAAGGATGTTTACAGACAAAACTCTAGAAACTTGGTTTCTTCTAGACATCCAACTTGGCCAAGAGAAAAGGTTGATAAGGAAGCTTTGTACGAATTTGAAAACGCTGCTAGAGAATTTATGACTGAAACTTTGAGACATGCTAAGAACTACAGACCAAGACAATTGTGGGGTTTTTACTTGTTTCCAGATTGTTACAACCATGATTACGTTAAGAACAGAGATTCTTACACTGGTCAATGTCCAGATGTTGAAATTTCTAGAAACGATCAATTGTCTTGGTTGTGGGAAGAATCTACTGCTTTGTCCCCATCTATTTACTTGGATCAAATTTTGGCTTCTTCTGAAAACGGTAGAAAGTTTGTTAGATCTAGAGTTAGAGAAGCTATGAGGATTTACTACAGGCATCATAAGGATTACTCTTTGCCAGTTTTTGATTACACTAGGCCAACTTACATTAGAAAGTTGGATTTTTTGTCTCAAATGGATTTGATTTCTACTATTGGTGAATCTGCTGCTCAAGGTGCTGCTGGTGTTATTTTTTGGGGTGATGCTGAATACACTAAGTCTAAGGAAACTTGTCAAATGATTAAGAAGTACTTGGATGAAGATTTGGGTCATTACATTGTTAACGTTACTACTGCTGCTGAATTGTGTTCTCAATCTTTGTGTAACGGTAACGGTAGATGTTTGAGACAAGAAAACAACACTGATGCCTTTTTGCATTTGAACCCAGCCAACTTTCAAATTGTTTCTGCCCCAAAGGATTTTCAAGGTCCATCTTTGAGAGCTGAAGGTAAGTTGTCTGCTGGTGATATTGCCACTTTGAGATCTCAATTTAGATGTCAATGTTACGTTGATTGGTACGGTGATTCTTGTGGTATTCAAAGGTCTACTAACGGTGGTGCTGTTGCTACTGGTCCATGTGGTATTGTTTTGGTTGTTTCTTTGGTTGCTTTGATTTTGGCTTTGTTGTGCCATCATCATCATCATCATTAAGCGGCCGCT

SEQ ID NO.10(Hyal2C)

GGATCCATGGTGCCACCCAAATTGCATGTGCTTTTCTGCCTCTGCGGCTGCCTGGCTGTGGTTTATCCTATGCCTTGCTGCCTTTCCTTCCTGCCTGCCTTCCTGTGGCTTTTCCTTGGAGCTGCGGCCAACGGTCAATTGTCTGATTCTTGGTTGAACAAGCCAACTTTTAGGCCAGTTTTTACTAGAAGACCATTTATTATTGCCTGGAACGCTCCAACTCAAGATTGTCCACCAAGGTTTAACGTTCATTTGGATTTGAAGTTGTTTGATTTGAACGCTTCTCCAAACGAAGGTTTTGTTGATCAAAACTTGACTATTTTTTACAAGGAAAGATTGGGTATGTACCCATACTACGATGAACATTTGGCTCCAGTTGCTGGTGGTTTGCCACAAAACGCTTCTTTGAGAGCTCATTTGGATAAGTTGCCAGAAGGTATTCAAAAGTACATTAGATCTAGAGATAAGGATGGTTTGGCTGTTATTGATTGGGAAGAATGGAGACCAATTTGGGTTAGAAACTGGCAAAACAAGGATGTTTACAGACAAAACTCTAGAAACTTGGTTTCTTCTAGACATCCAACTTGGCCAAGAGAAAAGGTTGATAAGGAAGCTTTGTACGAATTTGAAAACGCTGCTAGAGAATTTATGACTGAAACTTTGAGACATGCTAAGAACTACAGACCAAGACAATTGTGGGGTTTTTACTTGTTTCCAGATTGTTACAACCATGATTACGTTAAGAACAGAGATTCTTACACTGGTCAATGTCCAGATGTTGAAATTTCTAGAAACGATCAATTGTCTTGGTTGTGGGAAGAATCTACTGCTTTGTCCCCATCTATTTACTTGGATCAAATTTTGGCTTCTTCTGAAAACGGTAGAAAGTTTGTTAGATCTAGAGTTAGAGAAGCTATGAGGATTTACTACAGGCATCATAAGGATTACTCTTTGCCAGTTTTTGATTACACTAGGCCAACTTACATTAGAAAGTTGGATTTTTTGTCTCAAATGGATTTGATTTCTACTATTGGTGAATCTGCTGCTCAAGGTGCTGCTGGTGTTATTTTTTGGGGTGATGCTGAATACACTAAGTCTAAGGAAACTTGTCAAATGATTAAGAAGTACTTGGATGAAGATTTGGGTCATTACATTGTTAACGTTACTACTGCTGCTGAATTGTGTTCTCAATCTTTGTGTAACGGTAACGGTAGATGTTTGAGACAAGAAAACAACACTGATGCCTTTTTGCATTTGAACCCAGCCAACTTTCAAATTGTTTCTGCCCCAAAGGATTTTCAAGGTCCATCTTTGAGAGCTGAAGGTAAGTTGTCTGCTGGTGATATTGCCACTTTGAGATCTCAATTTAGATGTCAATGTTACGTTGATTGGTACGGTGATTCTTGTGGTATTCAAAGGTCTACTAACGGTGGTGCTGTTGCTACTGGTCCATGTGGTATTGTTTTGGTTGTTTCTTTGGTTGCTTTGATTTTGGCTTTGTTGTGCCATCATCATCATCATCATTAAGCGGCCGCT

SEQ ID NO.11 (hyaluronidase without purification tag)

NGQLSDSWLNKPTFRPVFTRRPFIIAWNAPTQDCPPRFNVHLDLKLFDLNASPNEGFVDQNLTIFYKERLGMYPYYDEHLAPVAGGLPQNASLRAHLDKLPEGIQKYIRSRDKDGLAVIDWEEWRPIWVRNWQNKDVYRQNSRNLVSSRHPTWPREKVDKEALYEFENAAREFMTETLRHAKNYRPRQLWGFYLFPDCYNHDYVKNRDSYTGQCPDVEISRNDQLSWLWEESTALSPSIYLDQILASSENGRKFVRSRVREAMRIYYRHHKDYSLPVFDYTRPTYIRKLDFLSQMDLISTIGESAAQGAAGVIFWGDAEYTKSKETCQMIKKYLDEDLGHYIVNVTTAAELCSQSLCNGNGRCLRQENNTDAFLHLNPANFQIVSAPKDFQGPSLRAEGKLSAGDIATLRSQFRCQCYVDWYGDSCGIQRSTNGGAVATGPCGIVLVVSLVALILALL

SEQ ID NO.12 (hyaluronidase encoding Gene without purification tag)

AACGGTCAATTGTCTGATTCTTGGTTGAACAAGCCAACTTTTAGGCCAGTTTTTACTAGAAGACCATTTATTATTGCCTGGAACGCTCCAACTCAAGATTGTCCACCAAGGTTTAACGTTCATTTGGATTTGAAGTTGTTTGATTTGAACGCTTCTCCAAACGAAGGTTTTGTTGATCAAAACTTGACTATTTTTTACAAGGAAAGATTGGGTATGTACCCATACTACGATGAACATTTGGCTCCAGTTGCTGGTGGTTTGCCACAAAACGCTTCTTTGAGAGCTCATTTGGATAAGTTGCCAGAAGGTATTCAAAAGTACATTAGATCTAGAGATAAGGATGGTTTGGCTGTTATTGATTGGGAAGAATGGAGACCAATTTGGGTTAGAAACTGGCAAAACAAGGATGTTTACAGACAAAACTCTAGAAACTTGGTTTCTTCTAGACATCCAACTTGGCCAAGAGAAAAGGTTGATAAGGAAGCTTTGTACGAATTTGAAAACGCTGCTAGAGAATTTATGACTGAAACTTTGAGACATGCTAAGAACTACAGACCAAGACAATTGTGGGGTTTTTACTTGTTTCCAGATTGTTACAACCATGATTACGTTAAGAACAGAGATTCTTACACTGGTCAATGTCCAGATGTTGAAATTTCTAGAAACGATCAATTGTCTTGGTTGTGGGAAGAATCTACTGCTTTGTCCCCATCTATTTACTTGGATCAAATTTTGGCTTCTTCTGAAAACGGTAGAAAGTTTGTTAGATCTAGAGTTAGAGAAGCTATGAGGATTTACTACAGGCATCATAAGGATTACTCTTTGCCAGTTTTTGATTACACTAGGCCAACTTACATTAGAAAGTTGGATTTTTTGTCTCAAATGGATTTGATTTCTACTATTGGTGAATCTGCTGCTCAAGGTGCTGCTGGTGTTATTTTTTGGGGTGATGCTGAATACACTAAGTCTAAGGAAACTTGTCAAATGATTAAGAAGTACTTGGATGAAGATTTGGGTCATTACATTGTTAACGTTACTACTGCTGCTGAATTGTGTTCTCAATCTTTGTGTAACGGTAACGGTAGATGTTTGAGACAAGAAAACAACACTGATGCCTTTTTGCATTTGAACCCAGCCAACTTTCAAATTGTTTCTGCCCCAAAGGATTTTCAAGGTCCATCTTTGAGAGCTGAAGGTAAGTTGTCTGCTGGTGATATTGCCACTTTGAGATCTCAATTTAGATGTCAATGTTACGTTGATTGGTACGGTGATTCTTGTGGTATTCAAAGGTCTACTAACGGTGGTGCTGTTGCTACTGGTCCATGTGGTATTGTTTTGGTTGTTTCTTTGGTTGCTTTGATTTTGGCTTTGTTGTGCSEQ ID NO.13( Coding gene of hyaluronic acid hydrolase with purification tag

AACGGTCAATTGTCTGATTCTTGGTTGAACAAGCCAACTTTTAGGCCAGTTTTTACTAGAAGACCATTTATTATTGCCTGGAACGCTCCAACTCAAGATTGTCCACCAAGGTTTAACGTTCATTTGGATTTGAAGTTGTTTGATTTGAACGCTTCTCCAAACGAAGGTTTTGTTGATCAAAACTTGACTATTTTTTACAAGGAAAGATTGGGTATGTACCCATACTACGATGAACATTTGGCTCCAGTTGCTGGTGGTTTGCCACAAAACGCTTCTTTGAGAGCTCATTTGGATAAGTTGCCAGAAGGTATTCAAAAGTACATTAGATCTAGAGATAAGGATGGTTTGGCTGTTATTGATTGGGAAGAATGGAGACCAATTTGGGTTAGAAACTGGCAAAACAAGGATGTTTACAGACAAAACTCTAGAAACTTGGTTTCTTCTAGACATCCAACTTGGCCAAGAGAAAAGGTTGATAAGGAAGCTTTGTACGAATTTGAAAACGCTGCTAGAGAATTTATGACTGAAACTTTGAGACATGCTAAGAACTACAGACCAAGACAATTGTGGGGTTTTTACTTGTTTCCAGATTGTTACAACCATGATTACGTTAAGAACAGAGATTCTTACACTGGTCAATGTCCAGATGTTGAAATTTCTAGAAACGATCAATTGTCTTGGTTGTGGGAAGAATCTACTGCTTTGTCCCCATCTATTTACTTGGATCAAATTTTGGCTTCTTCTGAAAACGGTAGAAAGTTTGTTAGATCTAGAGTTAGAGAAGCTATGAGGATTTACTACAGGCATCATAAGGATTACTCTTTGCCAGTTTTTGATTACACTAGGCCAACTTACATTAGAAAGTTGGATTTTTTGTCTCAAATGGATTTGATTTCTACTATTGGTGAATCTGCTGCTCAAGGTGCTGCTGGTGTTATTTTTTGGGGTGATGCTGAATACACTAAGTCTAAGGAAACTTGTCAAATGATTAAGAAGTACTTGGATGAAGATTTGGGTCATTACATTGTTAACGTTACTACTGCTGCTGAATTGTGTTCTCAATCTTTGTGTAACGGTAACGGTAGATGTTTGAGACAAGAAAACAACACTGATGCCTTTTTGCATTTGAACCCAGCCAACTTTCAAATTGTTTCTGCCCCAAAGGATTTTCAAGGTCCATCTTTGAGAGCTGAAGGTAAGTTGTCTGCTGGTGATATTGCCACTTTGAGATCTCAATTTAGATGTCAATGTTACGTTGATTGGTACGGTGATTCTTGTGGTATTCAAAGGTCTACTAACGGTGGTGCTGTTGCTACTGGTCCATGTGGTATTGTTTTGGTTGTTTCTTTGGTTGCTTTGATTTTGGCTTTGTTGTGCCATCATCATCATCATCAT

SEQ ID NO.14 (hyaluronidase precursor)

MRFPSIFTAVLFAASSALAAPVNTTTEDETAQIPAEAVIGYSDLEGDFDVAVLPFSNSTNNGLLFINTTIASIAAKEEGVSLENGQLSDSWLNKPTFRPVFTRRPFIIAWNAPTQDCPPRFNVHLDLKLFDLNASPNEGFVDQNLTIFYKERLGMYPYYDEHLAPVAGGLPQNASLRAHLDKLPEGIQKYIRSRDKDGLAVIDWEEWRPIWVRNWQNKDVYRQNSRNLVSSRHPTWPREKVDKEALYEFENAAREFMTETLRHAKNYRPRQLWGFYLFPDCYNHDYVKNRDSYTGQCPDVEISRNDQLSWLWEESTALSPSIYLDQILASSENGRKFVRSRVREAMRIYYRHHKDYSLPVFDYTRPTYIRKLDFLSQMDLISTIGESAAQGAAGVIFWGDAEYTKSKETCQMIKKYLDEDLGHYIVNVTTAAELCSQSLCNGNGRCLRQENNTDAFLHLNPANFQIVSAPKDFQGPSLRAEGKLSAGDIATLRSQFRCQCYVDWYGDSCGIQRSTNGGAVATGPCGIVLVVSLVALILALLCHHHHHH

SEQ ID NO.15 (encoding Gene of hyaluronidase precursor)

AACGATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAACGGTCAATTGTCTGATTCTTGGTTGAACAAGCCAACTTTTAGGCCAGTTTTTACTAGAAGACCATTTATTATTGCCTGGAACGCTCCAACTCAAGATTGTCCACCAAGGTTTAACGTTCATTTGGATTTGAAGTTGTTTGATTTGAACGCTTCTCCAAACGAAGGTTTTGTTGATCAAAACTTGACTATTTTTTACAAGGAAAGATTGGGTATGTACCCATACTACGATGAACATTTGGCTCCAGTTGCTGGTGGTTTGCCACAAAACGCTTCTTTGAGAGCTCATTTGGATAAGTTGCCAGAAGGTATTCAAAAGTACATTAGATCTAGAGATAAGGATGGTTTGGCTGTTATTGATTGGGAAGAATGGAGACCAATTTGGGTTAGAAACTGGCAAAACAAGGATGTTTACAGACAAAACTCTAGAAACTTGGTTTCTTCTAGACATCCAACTTGGCCAAGAGAAAAGGTTGATAAGGAAGCTTTGTACGAATTTGAAAACGCTGCTAGAGAATTTATGACTGAAACTTTGAGACATGCTAAGAACTACAGACCAAGACAATTGTGGGGTTTTTACTTGTTTCCAGATTGTTACAACCATGATTACGTTAAGAACAGAGATTCTTACACTGGTCAATGTCCAGATGTTGAAATTTCTAGAAACGATCAATTGTCTTGGTTGTGGGAAGAATCTACTGCTTTGTCCCCATCTATTTACTTGGATCAAATTTTGGCTTCTTCTGAAAACGGTAGAAAGTTTGTTAGATCTAGAGTTAGAGAAGCTATGAGGATTTACTACAGGCATCATAAGGATTACTCTTTGCCAGTTTTTGATTACACTAGGCCAACTTACATTAGAAAGTTGGATTTTTTGTCTCAAATGGATTTGATTTCTACTATTGGTGAATCTGCTGCTCAAGGTGCTGCTGGTGTTATTTTTTGGGGTGATGCTGAATACACTAAGTCTAAGGAAACTTGTCAAATGATTAAGAAGTACTTGGATGAAGATTTGGGTCATTACATTGTTAACGTTACTACTGCTGCTGAATTGTGTTCTCAATCTTTGTGTAACGGTAACGGTAGATGTTTGAGACAAGAAAACAACACTGATGCCTTTTTGCATTTGAACCCAGCCAACTTTCAAATTGTTTCTGCCCCAAAGGATTTTCAAGGTCCATCTTTGAGAGCTGAAGGTAAGTTGTCTGCTGGTGATATTGCCACTTTGAGATCTCAATTTAGATGTCAATGTTACGTTGATTGGTACGGTGATTCTTGTGGTATTCAAAGGTCTACTAACGGTGGTGCTGTTGCTACTGGTCCATGTGGTATTGTTTTGGTTGTTTCTTTGGTTGCTTTGATTTTGGCTTTGTTGTGCCATCATCATCATCATCATTA

Claims (14)

1. A hyaluronan hydrolase, characterized by:

comprises an amino acid sequence shown as SEQ ID NO. 11.

2. A hyaluronan hydrolase, characterized by:

Comprises an amino acid sequence shown as SEQ ID NO.11 and a purification tag.

3. The hyaluronan hydrolase according to claim 2, characterized in that:

Comprises an amino acid sequence shown as SEQ ID NO. 2.

4. A hyaluronic acid hydrolase precursor, characterized in that:

comprising the hyaluronan hydrolase according to any of claims 1 to 3 and a signal peptide.

5. The hyaluronan hydrolase precursor of claim 4, wherein:

Comprising the sequence shown in SEQ ID NO. 14.

6. A gene, characterized in that:

a method for expressing the hyaluronan hydrolase according to any one of claims 1 to 5 or a precursor thereof.

7. A gene, characterized in that:

Comprises a nucleotide sequence for expressing hyaluronic acid hydrolase, wherein the nucleotide sequence is shown as SEQ ID NO.1, or as any one of the nucleotide sequences shown as SEQ ID NO. 8-10, or as SEQ ID NO.12, or as SEQ ID NO.13, or as SEQ ID NO. 15.

8. A recombinant vector, characterized in that:

comprising the gene of claim 6 or comprising the gene of claim 7.

9. An engineered cell, characterized in that:

Comprising the gene of claim 6, or comprising the gene of claim 7, or comprising the vector of claim 8.

10. The engineered cell of claim 9, wherein:

the chassis cells used are selected from Pichia pastoris or E.coli.

11. An application of a hyaluronan hydrolase, which is characterized in that:

the use of the hyaluronan hydrolase or a precursor thereof, or a gene thereof, or an expression vector thereof, or an engineered cell thereof according to any one of claims 1 to 10 for hydrolyzing hyaluronan.

12. A method of constructing an engineered cell, comprising:

introducing a gene or recombinant vector into a basal cell;

the gene is the gene of claim 6 or the gene of claim 7;

the recombinant vector is the vector of claim 8.

13. The method according to claim 9, wherein:

The chassis cell is selected from Pichia pastoris or colibacillus.

14. A method for producing a hyaluronan hydrolase, characterized by: obtained by fermentation with the engineered cell of claim 9 or 10.