CN118085099B - Monoclonal antibody and efficient iPSC induction method - Google Patents

Abstract

The invention relates to the field of biology, in particular to a monoclonal antibody and a high-efficiency iPSC induction method. In the induction method, a monoclonal antibody aiming at the key protein ALK-2 of the BMP I signal pathway is used, and the antibody can specifically inhibit the activity of the ALK-2 protein so as to influence the BMP signal pathway, further promote the differentiation of iPSC cells to neuronal cells, has better promotion effect than that of small molecular compounds, and has low cost in batch culture of cells and large-scale application.

Description

Monoclonal antibody and efficient iPSC induction method

Technical Field

The application relates to the field of biology, in particular to a monoclonal antibody and a high-efficiency iPSC induction method.

Background

Parkinson's disease is a chronic degenerative disease of the central nervous system that occurs in the middle-aged and elderly, and is named Parkinson DISEASE PD in english. The main pathological changes are that the mesobrain substantia nigra dopamine neurons undergo the variegation, the substantia nigra-striata pathway is damaged, the content of dopamine transported from substantia nigra to striatum is reduced, and thus, the clinical symptoms such as resting tremor, myotonia, gait retardation, posture disorder and the like are caused. The initial drug treatment of PD brings benefits to many patients, but the efficacy is temporary, because levodopa does not prevent progressive loss of dopaminergic neurons, and adverse effects of long-term administration limit its use, especially the rejection of long-term administration, the "on-off" phenomenon that is difficult to resolve by surgery, autonomic nerve dysfunction, etc., which remain very difficult problems in clinical settings. Today, the population of China is seriously aged, the probability of PD of the population above middle-aged and elderly people is increased year by year, and even people worry that the disease can extend the magic claw of the young generation. Therefore, it is urgent to find a method for treating PD. Currently, neural Stem Cell (NSCs) transplantation is considered to be the most potent alternative to neural transplantation.

However, the implementation of scientific research is limited due to the limited source and limited number of neural stem cells. Human induced pluripotent stem cells (ipscs) can differentiate a large number of cell populations of different species, even individual specificities, so that the use of neuronal cells or tissues of iPSC origin as a research platform has good application prospects in such studies. iPSCs immediately become a hotspot for stem cell research as it bypasses the ethical and legal hurdles that embryonic stem cell research has been facing. Researchers have shown a strong interest in such cells and have made related research programs. Research on iPSCs is a new day and a breakthrough progress is made. To date, iPSCs have been studied in species, in mice, rats, humans, rhesus monkeys, pigs, but many have not yet formed chimeras; among the donor cells used in reprogramming studies, in terms of cell types, are fibroblasts, adrenal cells, muscle cells, hematopoietic cells, keratinocytes, intestinal epithelial cells, liver cells, gastric epithelial cells, mature B lymphocytes, neural stem cells, pancreatic beta cells (murine), adult and neonatal skin fibroblasts, foreskin fibroblasts, keratinocytes, peripheral blood T cells, and the like; in the factor introduction route, the progress has been made from the earliest retroviral vectors to lentiviral vectors, adenoviral vectors, expression plasmid-transduced non-viral vectors, transposons, cell penetrating peptides and the like; in terms of the number of factors introduced, the number is reduced from 4 factors to 3 factors and 2 factors, and finally, it is found that only 1 factor is needed to reprogram somatic cells into iPSCs. This makes the acquisition of iPSCs cells particularly convenient, and thus makes research based on iPSCs cell differentiation extremely feasible.

Neuronal cells are the most directly related cells in the pathogenesis of PD disease. Under pathological conditions, neurons are able to activate microglia either directly or indirectly. The microglial cell is co-cultured with the neuron or acted on the microglial cell by using a conditioned medium of the neuron, and substances such as urokinase type plasma zymogen activating factor and the like are found to be released and increased, but the activating effect is different from that of LPS, so that the composition of the activating substances released by the microglial cell is different, and the activating effect have different action mechanisms. In addition, the culture medium of neurons can mediate apoptosis of activated microglia, but certain conditions are satisfied that these neurons are differentiated neurons and blocking glutamate receptors or heat-inactivating the culture medium cannot produce such effects. In contrast, the culture medium of some immature neurons can promote microglial survival, which plays a positive role in brain development. In addition to the activation of microglia by dopaminergic neuron cell membranes modified with dopaminquinone or hydrogen peroxide, it has been found that the release of neurons can also act as an activation. Studies in Alzheimer's disease have found that neuronal released B-amyloid precursor protein (B-APP) is able to activate microglia via the MAOK pathway, B-APP can be dose-dependent activating JNK, ERK, p and inhibition of JNK and p38 can reduce iNOS expression and nitrite accumulation, but inhibition of ERK cannot produce such effects. In addition, full-length a-SYN was found in cerebrospinal fluid of PD patients, suggesting that neurons could also release aSYN extracellularly. And recent studies have shown that aggregated a-SYN has relatively specific dopaminergic neuronal toxicity; microglia can potentiate this toxic effect; the onset of this toxic effect depends on the activation of microglial NADPH oxidase; the a-SYN can also activate microglia, provided that the microglia have an effect of endocytosis of the a-SYN. Thus, we readily envisage the existence of mechanisms under PD pathology whereby damaged dopaminergic neurons undergo degenerative necrosis and release a large amount of toxic aggregated SYN, which in turn activates microglial cells, which engulf extracellular a-SYN, such that the extracellular DAPH-transferase, etc., is activated, producing and releasing toxic cytokines and activated oxygen products which ultimately damage the neurons, thus forming a vicious circle, which worsens the progression of the disease. And the neural precursor cells differentiated by the mouse iPSCs are transplanted into the brain of the fetal mouse, and the cells can migrate and differentiate into glial cells and neuron cells such as glutamine energy neurons, gamma-aminobutyric acid energy neurons, catecholamine energy neurons and the like. And the murine iPSCs are induced to be transplanted into a Parkinsonism (PD) disease model body by dopaminergic neurons, so that the symptoms of the model body can be effectively relieved, and the behavior of the model body can be improved. In addition, studies have found that disease-specific iPSCs are prepared from somatic cells of female patients with Amyotrophic Lateral Sclerosis (ALS) and can be directionally induced to differentiate into motor neurons in vitro. The results show that the iPSCs can treat complex diseases, and bring good news to patients with Parkinson's disease and amyotrophic lateral sclerosis. Disease-specific iPSCs were induced from fibroblasts from patients with inherited diseases including severe combined immunodeficiency associated with adenosine deaminase deficiency, shwachmanBodian-Diamond syndrome, nigella III, du Xian/beck muscular dystrophy, parkinson's disease, etc.

Based on previous studies, it can be found that neuronal cells are key to the treatment of PD, and how to induce neuronal cells by differentiation of iPSCs cells is an important direction of study. Although there have been many successful methods of maturation to differentiate the cells, studies have shown that it is feasible to use DMH-1 (DMH 1) to induce differentiation of iPSCs cells into neuronal cells. DMH-1 (DMH 1) is a potent BMP receptor selective inhibitor, acting on the human BMP type I receptor ALK2, with an IC50 of 107.9 nM, which inhibits BMP signaling. BMP signaling is an important pathway for regulating embryo development. In addition, DMH-1 had no significant inhibitory effect on purified ALK5, AMPK, VEGFR-2 and PDGFR. However, the price of the powder is high, and the powder reaches 1000 yuan in 10mg, so that the powder is not suitable for industrial use. Activin A receptor, type I (ACVR 1), also known as ALK-2, is a Bone Morphogenic Protein (BMP) type I receptor. ACVR1 is involved in a variety of biological processes including development and regulation of bone, heart, cartilage, nerves, and reproductive systems. As members of the BMP/tgfβ receptor family, ACVR1 proteins comprise an extracellular N-terminal ligand binding domain, a Transmembrane (TM) domain, an intracellular glycine-rich serine (GS) domain, and a Protein Kinase (PK) domain. The loop in the helix-loop-helix of the GS domain contains the key residues responsible for ACVR1 activation following phosphorylation. The BMP I signaling pathway can be effectively inhibited by inhibiting ALK-2 activity. However, currently there are few alternative forms of inhibitors of biological activity against ALK-2, and further improvements are desired.

Disclosure of Invention

The present invention overcomes the deficiencies of the prior art by providing a method for specifically inducing differentiation of iPSCs cells into neuronal cells comprising the use of a monoclonal antibody specific for ALK-2.

Further, the light chain variable region sequence of ALK-2-79 monoclonal antibody is shown in SEQ ID NO:1, the heavy chain variable region sequence is shown as SEQ ID NO: 2.

Specifically, the ALK-2-79 monoclonal antibody is prepared by a mouse hybridoma technology, and can be prepared in batches by culturing a large amount of supernatant and purifying.

Furthermore, the variable region sequences of the antibodies may be conservatively substituted, deleted or mutated, but still retain the corresponding antibody binding activity.

As disclosed and claimed herein, SEQ ID NOs:1-2 includes "conservative sequence modifications", i.e., antibody binding properties and amino acid sequence modifications by the amino acid sequence are not significantly affected or altered. Such conservative sequence modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into the SEQ ID NOs by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis: 1-2. Conservative amino acid substitutions include those in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains have been defined in the art. These families include those with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, it is preferred to replace a predetermined nonessential amino acid residue in a human anti-ALK-2-antibody with another amino acid residue of the same side chain family.

Furthermore, the invention also provides the application of the monoclonal antibody specific to ALK-2 in preparing a pharmaceutical composition for inhibiting ALK-2 activity.

Specifically, the pharmaceutical composition contains a pharmaceutically acceptable carrier.

As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and adsorption delaying agents, salts, and the like that are physiologically miscible and compatible. Preferably, the carrier is suitable for use by intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal routes (e.g., by injection or infusion). Depending on the route of administration, the active compound, i.e., antibody, bispecific or multispecific molecule, may be coated with a material in order to protect the compound from acids and other natural conditions that may inactivate the compound. Examples of the salts include acid addition salts and base addition salts. Acid addition salts include salts derived from non-toxic inorganic acids such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous, and salts derived from non-toxic organic acids such as aliphatic mono-and dicarboxylic acids, phenyl-substituted alkanoic, hydroxyalkanoic, aromatic, aliphatic and aromatic sulfonic acids. Base addition salts include salts derived from alkaline earth metals such as sodium, potassium, magnesium, calcium, and from non-toxic organic amines such as N, N' -diphenylethylenediamine, N-methylglutamine, procaine hydrochloride, choline, diethanolamine, ethylenediamine, and procaine.

The pharmaceutical composition of the invention may further comprise pharmaceutically acceptable antioxidants, such as water-soluble antioxidants, e.g. ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, etc.; oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, lecithin, propyl gallate, alpha-tocopherol, and the like; and metal chelators such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like. The pharmaceutical compositions of the invention may also comprise isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, glycerol, or sodium chloride in the composition. The pharmaceutical compositions of the present invention may also contain one or more adjuvants suitable for the chosen route of administration that may improve the shelf life or effectiveness of the pharmaceutical composition, such as preserving, wetting, emulsifying, dispersing, preserving or buffering agents. The compounds of the present invention may be prepared with carriers that prevent rapid release of the compounds, such as controlled release formulations, including implants, transdermal patches, and microencapsulated delivery systems. Such carriers may include gelatin, glyceryl monostearate, glyceryl distearate, biodegradable biocompatible polymers such as ethylene ethyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid alone or with waxes, or other materials well known in the art. Methods for preparing such formulations are generally known to those skilled in the art.

Examples of suitable aqueous and anhydrous carriers that can be used in the pharmaceutical compositions of the present invention include water, ethanol, polyols (such as glycerol, propylene glycol, and polyethylene glycol, and the like) and suitable mixtures thereof, vegetable oils, such as olive oil, injectable organic esters, such as ethyl oleate. For example, by using a coating material such as lecithin, proper fluidity can be maintained for the dispersion agent by the maintenance of the required particle size and by the use of surfactants. These compositions may also contain adjuvants such as preserving, wetting, emulsifying and dispersing agents. By the above-described sterilization method, prevention of occurrence of microorganisms is ensured by adding various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to add isotonic agents, such as sugars, sodium chloride, and the like, to the compositions. In addition, prolonged absorption of injectable pharmaceutical formulations can be brought about by the addition of agents such as aluminum monostearate and gelatin which prolong the absorption time.

Furthermore, the invention also provides application of the ALK-2-79 monoclonal antibody specific to ALK-2 in preparation of a preparation for promoting differentiation of iPSCs into neuronal cells.

Specifically, the iPSC cells can be obtained by making commercial purchase or manually preparing the iPSC cells by genetic engineering means.

Further, the formulations of the present invention may be used in other suitable formulations that promote differentiation of iPSCs cells into neuronal cells.

The formulation may be other formulations common in the art for inducing differentiation, such as the following formulations: neuronal medium, glutaMAX, nonessential amino acids, insulin, holoferrin, putrescine, human serum albumin, superoxide dismutase, glutathione, progesterone, retinol, vitamin A, dl-alpha-tocopheryl acetate, vitamin E, linoleic acid, alpha-linolenic acid, lipoic acid, brain-derived neurotrophic factor, nerve growth factor, Y27632, 5-fluoro-2' -deoxyuridine and the monoclonal antibodies of the invention.

Furthermore, the invention also provides a method for promoting differentiation of iPSCs into neuron cells by using the ALK-2-79 monoclonal antibody specific to ALK-2.

The method further comprises culturing iPSCs cells in DMEM-F12 medium comprising 20% knockout serum replacement, 2mmol glutamate, 1mmolNEAAS and 0.1mmol 2-yl ethanol in incubator for 2d; on day 5 of differentiation, fresh DMEM-F12 medium containing 2% N-2 additive, 1mmol NEAAS and 2mmol glutamate was exchanged, and neuro-inducer 0.5. Mu. Mol BIO, 10. Mu. Mol SB431542 and 10ng/mL rh-FGF2 were added, after 3d incubation of 0.5. Mu. Mol ALK-2-79 monoclonal antibody, the medium was exchanged for neuronal medium containing 1% N-2 additive and 10ng/mLrh-FGF2, after 4d incubation, cells were transferred to a pre-plated Matrigel dish after digestion, and 2% B27, 10ng/mLrh-FGF2 and 10. Mu. Mol Y-27632 were added to the medium. After 5d of culture, differentiated neuronal cells were harvested.

Advantageous effects the present invention provides a highly efficient iPSC induction method and application thereof in differentiating neuronal cells. Specifically, a monoclonal antibody aiming at the key protein ALK-2 of the BMP I signal pathway is used in the induction method, and can specifically inhibit the activity of the ALK-2 protein so as to influence the BMP signal pathway, further promote the differentiation of iPSC cells to neuronal cells, have better promotion effect than small molecular compounds, and the cell mass culture cost is low, so that the method can be applied in large scale.

Drawings

FIG. 1 is a graph showing the results of specific identification of ALK-2-79 monoclonal antibodies

FIG. 2 is a graph showing the effect of each group on gene expression level

FIG. 3 is a graph showing the effect of each group on cell growth

Detailed Description

Those skilled in the art can, with the benefit of this disclosure, suitably modify the process parameters to achieve this. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included in the present invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that variations and modifications can be made in the methods and applications described herein, and in the practice and application of the techniques of this invention, without departing from the spirit or scope of the invention. The methods, apparatus, materials, and so forth in the following examples, unless otherwise indicated, are all conventional in the art and are commercially available.

EXAMPLE 1 ALK-2 preparation of monoclonal antibodies

Recombinant human ALK-2 protein (80. Mu.g/recombinant human ALK-2 protein (RPES 5217, purchased from ASSAY GENIE)) was subcutaneously immunized on 3 SPF-class BALB/c female mice, 1 booster (50. Mu.g/mouse) was performed every 2 weeks, and serum titers were determined by ELISA after 3 boosts. And selecting a No. 1 mouse with the highest titer, and performing intraperitoneal impact by using 50 mug protein. Continuously subculturing mouse myeloma cells (SP 2/0), when the cells are kept in an optimal growth state, selecting 1 mouse, taking mouse spleen in a sterile operation, separating the cell supernatant of the mouse spleen, beating the bottom of a centrifugal tube to fully suspend the cells, putting the centrifugal tube into warm water at 37 ℃, slowly adding 1mL of PEG in the warm water, standing for 1min, slowly adding 2mL of serum-free IMDM medium in 2min, slowly adding 8mL of serum-free IMDM medium in 2min, and centrifugally collecting the cells.

The fused cells were cultured in semi-solid medium (containing 2.3% methylcellulose, IMDM powder medium, naHCO3, penicillin, streptomycin, mycoplasma antibiotics, triple distilled water, and HAT) containing HAT reagent. After 12d, 95 monoclonal cells were picked and cultured in 96-well cell culture plates (previously plated with thymocytes, which were prepared by grinding thymus of mice removed from immunized mice, 100. Mu.L/well) and numbered in sequence 1-94 (1 as blank control and 1 as positive control). Selected clones were screened by ELISA using an immunogen-pack plate and the results are shown in Table 1.

TABLE 1 determination of antibody titers from hybridoma cell supernatants

Numbering device	OD value
		1	0.643
2	0.437
		3	0.563
4	0.482
		5	1.192
6	0.364
		7	0.785
8	0.559
		9	0.487
10	0.196
		11	0.295
12	0.749
		13	0.559
14	1.034
		15	0.963
16	0.556
		17	0.371
18	0.884
		19	0.457
20	0.367
		21	0.554
22	0.123
		23	0.546
24	1.039
		25	0.487
26	0.384
		27	0.541
28	0.566
		29	0.966
30	0.174
		31	0.552
32	0.631
		33	0.453
34	0.271
		35	0.381
36	0.471
		37	0.632
38	0.554
		39	1.112
40	0.946
		41	0.563
42	0.497
		43	1.001
44	0.234
		45	0.546
46	0.348
		47	0.247
48	0.136
		49	0.034
50	0.846
		51	0.214
52	1.046
		53	0.924
54	0.624
		55	0.729
56	0.457
		57	0.844
58	0.196
		59	0.073
60	1.034
		61	0.759
62	0.927
		63	0.549
64	0.046
		65	0.047
66	0.108
		67	0.038
68	0.506
		69	0.847
70	0.953
		71	0.587
72	0.287
		73	0.954
74	0.428
		75	0.295
76	0.346
		77	0.574
78	0.287
		79	1.429
80	0.059
		81	0.756
82	0.069
		83	0.077
84	0.048
		85	0.516
86	0.345
		87	0.078
88	0.056
		89	1.038
90	0.053
		91	0.047
92	0.039
		93	0.056
94	0.045
		Blank control	0.029
Positive control	1.232

As can be seen from Table 1, the hybridoma cell No. 79 has the highest titer and the highest activity, and this hybridoma cell (designated ALK-2-79) was selected for expansion culture and purification, and then the subsequent experiments were conducted.

Diluting the subclass coated antibody with the coating solution to a final concentration of 2. Mu.g/mL, 100. Mu.L/well, at 4℃overnight, and washing with wash solution 3 times; 2% skimmed milk powder (PBS as solvent) was blocked, 200. Mu.L/well, incubated at 37deg.C for 2h, and then washed 3 times with PBST; ALK-2-79 primary antibody (hybridoma cell culture supernatant), negative control (SP 2/0 culture supernatant), 100. Mu.L/well, incubation at 37℃for 1h, washing 3 times with PBST; diluting the secondary antibodies GoatAnti-MouseigM, igG1, igG2a, igG2b, etc. of each subclass with PBS, adding 100 μl/well into appropriate wells, incubating at 37deg.C for 1 hr, taking out, and washing with washing solution for 3 times; the color development liquid (1%A liquid+10% B liquid) (A liquid: 1% TMB in DMSO, B liquid: 0.1% CH4N2 O.H2O 2 citric acid buffer) was added at 100. Mu.L/well, and the color development time was 10min. The color development was stopped by adding 50. Mu.L of 0.5mol/L sulfuric acid to each well. Absorbance was measured at 450nm and 630nm and showed that the subclass of ALK-2-79 monoclonal antibody was IgG2b.

Example 2 ALK-2-79 monoclonal antibody specific identification

Recombinant human ALK-2 protein, human induced pluripotent stem cell (iPS cell) DYP0530 (product number: CSX4461 Ulva test biotechnology Co., ltd.), normal mouse serum, 100ul each, were mixed with SDS-PAGE protein loading buffer, boiled at 100deg.C for 10min to prepare samples, separated by SDS-PAGE gel electrophoresis, and the proteins were transferred to PVDF membrane by semi-dry transfer method. 5% skim milk powder was blocked at 4℃for 1h,1:1500 Diluting antibody, incubating overnight at 4 ℃, and washing the membrane; incubation with IRDye [ 800 ] CWGoat Anti-Mouse IgG Secondary Antibody (1:10000 (volume ratio) dilution) at 4deg.C for 1h; washing the film, developing by using double infrared lasers, and observing and photographing by using a OdessayCLx imaging system. The results are shown in FIG. 1.

As can be seen from FIG. 1, the ALK-2-79 monoclonal antibody provided by the invention has better specificity, can specifically identify ALK-2 protein, is not combined with other proteins, is not combined with mouse serum, and shows better specificity.

Example 3 ALK-2-79 monoclonal antibody affinity identification and variable region identification

Anti-mouse IgG secondary antibodies were immobilized on CM5 chips, ALK-2-79 antibodies (mouse antibodies) were captured using BiacoreT200,200, ALK-2 antigen was used as the analyte, diluted with buffer to 0, 7.5, 15 and 30nM concentration gradients, respectively, and binding of the antibodies to ALK-2 antigen was detected using single-cycle kinetics. The final data were analyzed by kinetics fit using biacoreevaluationsoftware 3.0.0 in a 1:1 model. The ALK-2-79 antibody loci of the invention were compared at the same concentration. The results are shown in Table 2.

Table 2 ALK-2-79 antibody affinity identification

Antibodies to	Affinity KD (mol/L)
		ALK-2-79	5.38E-10
ALK-2-60	3.17E-8

As can be seen from Table 2, the ALK-2-79 monoclonal antibodies of the present invention have a good affinity.

ALK-2-79 hybridoma cells are subjected to variable region determination by using the technology of the Betapick derivative, and the light chain variable region sequence of the monoclonal antibody is identified as shown in SEQ ID NO:1, the heavy chain variable region sequence is shown as SEQ ID NO: 2.

Example 4 influence of ALK-2-79 monoclonal antibodies on the differentiation of iPSC cells into neurons

Culturing hiPSC in a culture dish with Geltrex laid in advance, changing liquid every day, digesting cells with a special digestion liquid for stem cells when the cells are fused to 70% -80%, inoculating the cells in a 35mm culture dish with Geltrex laid, and culturing in a incubator with 5% CO ₂ at 37 ℃. When hiPSC is fused to about 75%, differentiation is started, the hiPSC is divided into 4 groups, namely a blank group, a control group, a DMH1 group and a monoclonal antibody group. Cells were isolated from Geltrex coated dishes after digestion, cultured in uncoated dishes for 2d, without any subsequent treatment of the blank hiPSC, control, DMH1, mab groups were replaced with fresh DMEM-F12 medium (containing 20% knockout serum replacement, 2mM glutamate, 1mM NEAAS and 0.1mM 2-yl ethanol) and cultured in incubator. On day 5 of differentiation, fresh DMEM-F12 medium (containing 2% N-2 additive, 1mM NEAAS and 2mM glutamate) was changed, and the control group was supplemented with 0.5. Mu.M BIO, 10. Mu.M SB431542 and 10ng/mL rh-FGF2, and the DMEM 1 group was supplemented with 0.5. Mu. Mol of DMEM 1 in addition to the above-mentioned reagents and cultured for 3 days, and then the medium was changed to neuronal medium (1% N-2 additive and 10ng/mLrh-FGF2 were added to DMEM-F12 medium). The monoclonal antibody group was incubated with 0.5. Mu.M ALK-2-79 monoclonal antibody for 3d in addition to the control group reagent, and the medium was changed to neuronal medium (DMEM-F12 medium supplemented with 1% N-2 additive and 10ng/mLrh-FGF 2). After 4d incubation of each group, cells were digested and transferred to a pre-Matrigel plated petri dish with 2% B27, 10ng/mLrh-FGF2 and 10. Mu. M Y-27632 added to DMEM-F12 medium. Identification was performed after 5d of culture.

Each group was prepared by extracting total RNA from 50. Mu.l of cells and synthesizing cDNA by reverse transcription. Real-time fluorescent quantitative PCR was performed, wherein the primer set included GAPDH: an upstream primer TTCCAAGCATAAAAGAACGG, a downstream primer TACATCCTCATCACCACCCA; PAX6: an upstream primer ATGTGTGAGTAAAATTCTGGGCA, a downstream primer GCTTACAACTTCTGGAGTCGCTA; nestin: upstream primer CAGCGTTGGAACAGAGGTTGG, downstream primer TGGCACAGGTGTCTCAAGGGTAG. The results are shown in FIG. 2.

As can be seen from the expression conditions of NSC related genes Nestin and PAX6 detected in FIG. 2, compared with the DMH1 group, the monoclonal antibody group of the invention has obviously higher Nestin expression (5.23+/-0.13) than the DMH1 group, the PAX6 expression (4.28+/-0.15) of the monoclonal antibody group is obviously higher than the DMH1 group, and the differences have statistical significance (P < 0.05). These results further demonstrate that the induction efficiency of the mab group is higher than that of the DMH1 group.

After preparing a suspension of differentiated cells with Neural Stem Cell (NSC) characteristics, 100 mu L of the suspension is sucked, the suspension is added into a 96-well plate with a pre-laid Matrigel matrix, the cell density is 1000 cells/well, a blank control group is only added with a culture medium, the blank control group is placed into a culture box with 5% CO ₂ and 37 ℃, 10 mu L of CCK-8 is added into each well on the 2 nd day, the culture box is incubated for 2 hours, and the absorbance at 450nm is measured by an enzyme-labeled instrument. The experiments were divided into a mab group and a control group, 5 parallel wells and 1 blank control well per group, and the experiment was repeated 3 times for 5d total detection. And subtracting the absorbance value of the blank control group from the parallel absorbance value of 5 parallel holes, and drawing a growth curve of the induced differentiated cells.

The results of the detection of OD (450 nm) after CCK-8 addition are shown in FIG. 3, the OD value of the MAb group (2.93.+ -. 0.08) at day 5 after culture was higher than the OD (450 nm) value of the DMHl group (2.48.+ -. 0.07), and the difference was statistically significant (P < 0.05). This result shows that the mab group is significantly more potent than the DMHl group of NSC-like cells.

In addition, the observation result under the microscope by using immunofluorescence shows that more than 15% of monoclonal antibody groups are seen in the day than the nerve-like spindle cells around the cell clusters of DMHl groups, and the result suggests that the monoclonal antibody group induction method has better effect than a small molecular compound in inducing hIPS to differentiate into nerve-like cells.

ALK-2 protein expression level was measured for the 3 d-cultured cells, the 3 d-cultured cells with the DMH1 and the 3 d-cultured cells with the control group, and relative expression levels were calculated using ALK-2 protein in the blank hiPSC cells as a reference, and the results are shown in Table 3.

TABLE 3 ALK-2 results of relative expression levels of proteins

Group of	Relative expression level
		Monoclonal antibody treatment	0.10±0.01#
DMH1 treatment	0.37±0.03#
		Control group	0.83±0.06

In the above table, # represents p <0.05

As can be seen from table 3, the treatment with mab has a better effect of continuously inhibiting ALK-2 protein expression.

In the description of the present specification, a description referring to terms "one embodiment," "some embodiments," "examples," "specific examples," or "some examples," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms do not necessarily refer to the same embodiments or examples. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. While embodiments of the present invention have been shown and described, it will be understood by those of ordinary skill in the art that: many changes, modifications, substitutions and variations may be made to the embodiments without departing from the spirit and principles of the invention, the scope of which is defined by the claims and their equivalents.

Claims (3)

1. A monoclonal antibody specific for ALK-2, wherein the antibody has a light chain variable region sequence set forth in SEQ ID NO:1, the heavy chain variable region sequence is shown as SEQ ID NO: 2.

2. Use of the monoclonal antibody of claim 1 in the preparation of a formulation for promoting differentiation of iPSCs cells into neuronal cells.

3. An efficient iPSC induction method, said method comprising the steps of: step one, culturing iPSC cells in a incubator, wherein the culture medium is DMEM-F12 culture medium, and 20% of Knockout serum replacement, 2mM glutamate, 1mM NEAAS and 0.1mM 2-yl ethanol are added into the culture medium; culturing until day 5, replacing the new DMEM-F12 culture medium, adding 2% of N-2 additive, 1mM NEAAS, 2mM glutamate, 0.5 mu M BIO, 10 mu M SB431542, 10ng/mL rh-FGF2 and 0.5 mu M monoclonal antibody specific to ALK-2, culturing for 3 days, and replacing the culture medium with a neuron culture medium, wherein the neuron culture medium comprises the DMEM-F12 culture medium and 1% of N-2 additive and 10ng/mLrh-FGF2; step three, after culturing for 4d, transferring the digested cells to a culture dish with a pre-spread Matrigel, and adding a new culture medium, wherein the new culture medium comprises 2% of B27, 10ng/mL of rh-FGF2 and 10 mu M Y-27632 in a DMEM-F12 culture medium; after 5d culture, the differentiated neuron cells are obtained, and the variable region sequence of the light chain of the monoclonal antibody is shown as SEQ ID NO:1, the heavy chain variable region sequence is shown as SEQ ID NO: 2.