CN118078752A - Lipid composition for gene editing agent delivery and uses thereof - Google Patents

Lipid composition for gene editing agent delivery and uses thereof Download PDF

Info

Publication number
CN118078752A
CN118078752A CN202211460775.8A CN202211460775A CN118078752A CN 118078752 A CN118078752 A CN 118078752A CN 202211460775 A CN202211460775 A CN 202211460775A CN 118078752 A CN118078752 A CN 118078752A
Authority
CN
China
Prior art keywords
integers
branched
different
same
alkyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211460775.8A
Other languages
Chinese (zh)
Inventor
林耀新
王浩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Tricision Biotherapeutics Inc
Original Assignee
Beijing Tricision Biotherapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Tricision Biotherapeutics Inc filed Critical Beijing Tricision Biotherapeutics Inc
Priority to CN202211460775.8A priority Critical patent/CN118078752A/en
Publication of CN118078752A publication Critical patent/CN118078752A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/16—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
    • A61K47/18—Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/24—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing atoms other than carbon, hydrogen, oxygen, halogen, nitrogen or sulfur, e.g. cyclomethicone or phospholipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/28—Steroids, e.g. cholesterol, bile acids or glycyrrhetinic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5123—Organic compounds, e.g. fats, sugars
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/513—Organic macromolecular compounds; Dendrimers
    • A61K9/5146—Organic macromolecular compounds; Dendrimers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyethylene glycol, polyamines, polyanhydrides

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • General Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Nanotechnology (AREA)
  • Optics & Photonics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Dispersion Chemistry (AREA)
  • Medicinal Preparation (AREA)

Abstract

The invention provides an ionizable lipid compound with an adjacent cis double bond structure, a preparation method thereof, application thereof in a reagent for delivering CRISPR/Cas9 technology, and a delivery system or a composition for delivering the reagent for CRISPR/Cas9 technology, which comprises the ionizable lipid compound. The ionizable lipid compound can provide higher active substance encapsulation efficiency and better cell or in-vivo transfection efficiency, so that the ionizable lipid compound has excellent application effect on reagents for delivering CRISPR/Cas9 technology.

Description

Lipid composition for gene editing agent delivery and uses thereof
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a lipid composition for delivering a gene editing reagent, and application of the lipid composition and an ionizable lipid compound in the lipid composition in preparation of the gene editing reagent.
Background
Genomic targeted modification techniques refer to a means of engineering specific sites of genomic DNA by some means. The establishment of a complete mouse model for gene knockout of ES cells since Thompsson et al in 1987 has been advanced over 20 years to date, and this technology has established a number of theories and methods including, for example, zinc finger nuclease (Zinc-finger nucleases, ZFN) technology, transcription activator-like effector nuclease (Transcription activator like effector nucleases, TALEN) technology ,CRISPR/Cas9(Clustered regulatory interspaced short palindromic repeats/CRISPR-associated protein 9) technology, and the like.
Compared with other current technologies, the CRISPR/Cas9 technology recognizes the target site through a segment of RNA, so that the CRISPR/Cas9 technology is simpler in design and construction. The cell line or animal model for gene knockout can be established by simply synthesizing a custom-made crRNA, inserting it into a suitable plasmid, co-transfecting the cell with a plasmid expressing the tracrRNA and Cas9 protein, respectively, or injecting it into a specific cell after in vitro transcription into RNA. Scientists now find that crRNA: modification of the double-stranded RNA structure of the tracrRNA to Single-stranded guide RNA (sgRNA) can also guide Cas9 protein to specifically cleave double-stranded DNA, which further improves ease of operation.
How to efficiently send DNA or RNA used in CRISPR/Cas9 technology into target cells becomes a key point for further improving the gene targeting modification efficiency of the method. In gene therapy, ionizable lipid compounds have proven to be excellent delivery vehicles for nucleic acids for the treatment of various diseases. Lipid nanoparticles formed from lipids such as ionizable lipid compounds as delivery vehicles for reagents for CRISPR/Cas9 technology are perhaps one technical direction that can be considered.
Disclosure of Invention
The inventors of the present invention have studied to obtain a novel ionizable lipid compound that can be used for delivering biologically active molecules (e.g., mRNA, siRNA, micRNA, proteins, polypeptides, etc.). Given that the amine structure can be protonated to form a positively charged cationic group, the ionizable lipid compounds of the invention are particularly useful for delivering negatively charged active agents, such as DNA, RNA, or other nucleotide molecules, rendering them excellent utility in reagents for delivering CRISPR/Cas9 technology.
On this basis, the invention provides a delivery system or composition of an agent for CRISPR/Cas9 technology, comprising a lipid-containing delivery body, and an agent for CRISPR/Cas9 located in the delivery body. The invention also provides application of the novel ionizable lipid compound in preparing a delivery system or composition of an agent for CRISPR/Cas9 technology. The delivery body in the delivery system may be a microparticle, nanoparticle, liposome, lipid nanoparticle, or microbubble. In one embodiment of the invention, the delivery body is a lipid nanoparticle. The invention also provides a method of gene editing in vitro using the delivery system or composition of the invention.
A delivery system or composition of an agent for CRISPR/Cas9 technology, the delivery system or composition comprising a lipid-containing delivery body, and an agent for CRISPR/Cas9 located in the delivery body.
The delivery body may be a microparticle, nanoparticle, liposome, lipid nanoparticle, or microbubble. In one embodiment of the invention, the delivery body is a lipid nanoparticle.
In one embodiment of the invention, the delivery body consists of a lipid.
According to the present invention, the delivery body comprises an ionizable lipid compound of formula IWherein:
Q is Wherein R 8、R9 is independently selected from substituted or unsubstituted straight chain C1-10 alkylene, 1 or more C atoms of which are optionally replaced by heteroatoms independently selected from O, S and N; r 7 is hydrogen, halogen, -OH, linear or branched C1-20 alkyl, linear or branched C2-20 alkenyl, linear or branched C2-20 alkynyl, or-CH 2CH(OH)R5, orThe substituted substituent groups are halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;
r 1、R2、R3、R4, which may be the same or different, are each independently selected from hydrogen, substituted or unsubstituted straight or branched C1-30 alkyl, substituted or unsubstituted straight or branched C2-30 alkenyl, substituted or unsubstituted straight or branched C2-30 alkynyl, 1 or more C atoms of the alkyl, alkenyl or alkynyl being optionally replaced by heteroatoms independently selected from O, S and N, or-CH 2CH(OH)R5; the substituted substituent group is selected from halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;
Provided that at least one of R 1、R2、R3、R4 is
R 5 is selected from hydrogen, substituted or unsubstituted straight or branched C1-30 alkyl, substituted or unsubstituted straight or branched C2-30 alkenyl, substituted or unsubstituted straight or branched C2-30 alkynyl, 1 or more C atoms of said alkyl, alkenyl or alkynyl being optionally replaced by heteroatoms independently selected from O, S and N; the substituted substituent group is selected from halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;
r 6 is selected from hydrogen, C1-3 alkyl, C1-3 alkoxy, -OH;
n is an integer of 1 to 8, m is an integer of 0 to 8, and n and m are independent of each other and may be the same or different;
When at least two of R 1、R2、R3、R4 are When n and m in each of the groups are independent of each other, they may be the same or different.
Preferably, Q isWherein: x and y may be the same or different and are independently selected from integers of 1 to 8; r 7 is as defined above; preferably, x or y are the same or different and are selected from integers from 1 to 3, for example 1,2 or 3; preferably, R 7 is a straight or branched C1-4 alkyl group, such as methyl, ethyl, n-propyl, n-butyl, and the like.
In a preferred embodiment of the invention, R 6 is-OH.
In a preferred embodiment of the invention, n is selected from integers from 4 to 8 and m is selected from integers from 4 to 8.
In a preferred embodiment of the invention, the compound of formula I is of formula A, B, C or D:
a, wherein each n 1, which may be the same or different, each n 1 is selected from integers from 1 to 8, each m 1, which may be the same or different, each m 1 is selected from integers from 0 to 8; preferably, each n 1 is selected from integers from 4 to 8, and each m 1 is selected from integers from 4 to 8; preferably, each n 1 is identical to each other and each m 1 is identical to each other.
B, wherein each n 2, which may be the same or different, each n 2 is selected from integers from 1 to 8, each m 2, which may be the same or different, each m 2 is selected from integers from 0 to 8; preferably, each n 2 is selected from integers from 4 to 8, and each m 2 is selected from integers from 4 to 8; preferably, each n 2 is identical to each other and each m 2 is identical to each other.
C, wherein each n 3, which may be the same or different, each n 3 is selected from integers from 1 to 8, each m 3, which may be the same or different, each m 3 is selected from integers from 0 to 8; preferably, each n 3 is selected from integers from 4 to 8, and each m 3 is selected from integers from 4 to 8; preferably, each n 3 is identical to each other and each m 3 is identical to each other.
D, wherein each n 4, which may be the same or different, each n 4 is selected from integers from 1 to 8, each m 4, which may be the same or different, each m 4 is selected from integers from 0 to 8; preferably, each n 4 is selected from integers from 4 to 8, and each m 4 is selected from integers from 4 to 8; preferably, each n 4 is identical to each other and each m 4 is identical to each other.
In some embodiments of the invention, the compound of formula I is selected from the following compounds shown in table 1:
TABLE 1
According to the invention, the delivery body further comprises other lipid molecules, which are neutral lipid molecules, cholesterol lipid molecules and pegylated lipid molecules.
According to the invention, the delivery body contains 30-60mol% of the lipid molecules of formula I, preferably 32-55mol%, for example 30mol％,31mol％,32mol％,33mol％,34mol％,35mol％,36mol％,37mol％,38mol％,39mol％,40mol％,41mol％,42mol％,43mol％,44mol％,45mol％,46mol％,47mol％,48mol％,49mol％,50mol％,51mol％,52mol％,53mol％,54mol％,55mol％ etc., more preferably 34-46mol% of the total lipid molecules.
According to the invention, the neutral lipid molecule is an uncharged lipid molecule or a zwitterionic lipid molecule, such as a phosphatidylcholine-like compound, or/and a phosphatidylethanolamine-like compound.
The structure of the phosphatidylcholine compound is shown as a formula E: e, E; the structure of the phosphatidylethanolamine compound is shown as a formula F: /(I) F, wherein Ra, rb, rc, rd is independently selected from the group consisting of linear or branched C1-30 alkyl, linear or branched C2-30 alkenyl, preferably linear or branched C10-30 alkyl, linear or branched C10-30 alkenyl, e.g CH3(CH2)17CH2-、CH3(CH2)15CH2-、CH3(CH2)13CH2-、CH3(CH2)11CH2-、CH3(CH2)9CH2-、CH3(CH2)7CH2-、CH3(CH2)7-CH＝CH-(CH2)7-、CH3(CH2)4CH＝CHCH2CH＝CH(CH2)7-、CH3(CH2)7-CH＝CH-(CH2)9-.
Examples of neutral lipid molecules include, but are not limited to, 5-heptadecylphenyl-1, 3-diol (resorcinol), dipalmitoyl phosphatidylcholine (DPPC), distearoyl phosphatidylcholine (DSPC), phosphorylcholine (DOPC), dimyristoyl phosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1, 2-distearoyl-sn-glycero-3-phosphorylcholine (DAPC), phosphatidylethanolamine (PE), lecithin phosphatidylcholine (EPC), dilauryl phosphatidylcholine (DLPC), dimyristoyl phosphatidylcholine (DMPC), 1-myristoyl-2-palmitoyl phosphatidylcholine (MPPC), 1-palmitoyl-2-myristoyl phosphatidylcholine (PMPC), 1-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), 1, 2-distearoyl-sn-glycero-3-phosphorylcholine (DBPC), 1-stearoyl-2-palmitoyl phosphatidylcholine (SPPC), 1, 2-Eicosyl Phosphatidylcholine (EPC), 1, 2-Eicosoyl Phosphatidylcholine (EPC), stearoyl Phosphatidylcholine (PE), dimyristoyl phosphatidylcholine (DPPC), stearoyl phosphatidylcholine (DPPC), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyl Oleoyl Phosphatidylethanolamine (POPE), lysophosphatidylethanolamine, and combinations thereof.
In one embodiment, the neutral lipid molecule may be selected from the group consisting of: distearoyl phosphatidylcholine (DSPC), dioleoyl phosphatidylethanolamine (DOPE), and distearoyl phosphatidylethanolamine (DSPE). In another embodiment, the neutral lipid molecule may be dimyristoyl phosphatidylethanolamine (DMPE). In another embodiment, the neutral lipid molecule may be dipalmitoyl phosphatidylcholine (DPPC).
According to the invention, the delivery body may contain 5-30mol% neutral lipid molecules, such as 8-20 mol%, such as 8mol%,9mol%,10mol%,11mol%,12mol%,13mol%,14mol%,15mol%,16mol%,17mol%,18mol%,19mol%,20mol%, more preferably 9-16mol%, of its total lipid molecules.
According to the present invention, cholesterol lipid molecules refer to sterols as well as lipids containing sterol moieties, including but not limited to cholesterol, 5-heptadecylresorcinol, stigmasterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, lycosyline, ursolic acid, alpha-tocopherol and mixtures thereof, cholesterol hemisuccinate. In one embodiment, the cholesterol lipid molecule is Cholesterol (CHOL). In one embodiment, the cholesterol lipid molecule is cholesterol hemisuccinate.
According to the invention, the delivery body may contain 30-50mol% cholesterol lipid molecules, such as 30mol％,31mol％,32mol％,33mol％,34mol％,35mol％,36mol％,37mol％,38mol％,39mol％,40mol％,41mol％,42mol％,43mol％,44mol％,45mol％,46mol％,47mol％,48mol％,49mol％,50mol％, etc., preferably 35-50mol%, more preferably 37-49mol% cholesterol lipid molecules based on the total lipid molecules.
According to the invention, the pegylated lipid molecule comprises a lipid moiety and a PEG-based polymer moiety. In some embodiments, the pegylated lipid molecule may be represented as a "lipid moiety-PEG-number average molecular weight" or "PEG-lipid moiety" or "PEG-number average molecular weight-lipid moiety", which is a diacylglycerol or diacylglycerol amide selected from dilauryl glycerol, dimyristoyl glycerol, dipalmitoyl glycerol, distearoyl glycerol, dilauryl glycerol amide, dimyristoyl glycerol amide, dipalmitoyl glycerol amide, distearoyl glycerol amide, 1, 2-distearoyl-sn-glycerol-3-phosphate ethanolamine, 1, 2-dimyristoyl-sn-glycerol-3-phosphate ethanolamine; the PEG has a number average molecular weight of about 130 to about 50,000, such as about 150 to about 30,000, about 150 to about 20,000, about 150 to about 15,000, about 150 to about 10,000, about 150 to about 6,000, about 150 to about 5,000, about 150 to about 4,000, about 150 to about 3,000, about 300 to about 3,000, about 1,000 to about 3,000, about 1,500 to about 2,500, such as about 2000.
In some embodiments, the pegylated lipid molecule may be selected from the group consisting of PEG-dilauroylglycerol, PEG-dimyristoylglycerol (PEG-DMG), PEG-dipalmitoylglycerol, PEG-distearylglycerol (PEG-DSPE), PEG-dilauryl glyceramide, PEG-dimyristoylglycerol amide, PEG-dipalmitoylglycerol amide and PEG-distearylglycerol amide, PEG-cholesterol (1- [8' - (cholest-5-ene-3 [ beta ] -oxy) carboxamido-3 ',6' -dioxaoctyl ] carbamoyl- [ omega ] -methyl-poly (ethylene glycol), PEG-DMB (3, 4-dimyristoxybenzyl- [ omega ] -methyl-poly (ethylene glycol) ether), 1, 2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N- [ methoxy (polyethylene glycol) -2000] (DMG-PEG 2000), 1, 2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [ methoxy (polyethylene glycol) -2000] (DSPE-PEG-2000), 1, 2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [ methoxy (PEG-2000) Poly (ethylene glycol) -2000-dimethacrylate (DMA-PEG 2000) and 1, 2-distearoyloxypropyl-3-amine-N- [ methoxy (polyethylene glycol) -2000] (DSA-PEG 2000). In one embodiment, the pegylated lipid molecule may be DMG-PEG2000. In some embodiments, the pegylated lipid molecule may be DSG-PEG2000. In one embodiment, the pegylated lipid molecule may be DSPE-PEG2000. In one embodiment, the pegylated lipid molecule may be DMA-PEG2000. In one embodiment, the pegylated lipid molecule may be C-DMA-PEG2000. In one embodiment, the pegylated lipid molecule may be DSA-PEG2000. In one embodiment, the pegylated lipid molecule may be PEG2000-C11. In some embodiments, the pegylated lipid molecule may be PEG2000-C14. In some embodiments, the pegylated lipid molecule may be PEG2000-C16. In some embodiments, the pegylated lipid molecule may be PEG2000-C18.
According to the invention, the delivery body may contain 0.4-10mol% of the pegylated lipid molecules, e.g. 0.5-5mol%, e.g. 0.4mol％,0.5mol％,0.6mol％,0.7mol％,0.8mol％,0.9mol％,1.0mol％,1.1mol％,1.2mol％,1.3mol％,1.4mol％,1.5mol％,1.6mol％,1.7mol％,1.8mol％,1.9mol％,2.0mol％,2.1mol％,2.2mol％,2.3mol％,2.4mol％,2.5mol％,2.6mol％,2.7mol％,2.8mol％,2.9mol％,3.0mol％,3.1mol％,3.2mol％,3.3mol％,3.4mol％,3.5mol％,3.6mol％,3.7mol％,3.8mol％,3.9mol％,4.0mol％,4.1mol％,4.2mol％,4.3mol％,4.4mol％,4.5mol％,4.6mol％,4.7mol％,4.8mol％,4.9mol％,5.0mol％ etc., more preferably 1.3-2.7mol% of the total lipid molecules.
In some embodiments of the invention, the lipid of the delivery body consists of a lipid molecule of formula I, a neutral lipid molecule, a cholesterol lipid molecule, and a pegylated lipid molecule.
According to the invention, the ratio of the total mass of lipid molecules in the delivery body to the mass of agent for CRISPR/Cas9 is (5-20): 1 in the delivery system or composition.
According to the invention, the CRISPR/Cas9 agent comprises DNA or mRNA encoding a Cas9 protein, crRNA, tracrRNA, and/or sgRNA that recognizes a target site.
In some embodiments of the invention, the CRISPR/Cas9 agent comprises mRNA encoding a Cas9 protein and sgRNA that recognizes a target site, wherein the molar ratio of mRNA to sgRNA is 1 (1-10).
In one embodiment of the invention, the mRNA encoding the Cas9 protein comprises an ORF encoding the Cas9 protein having a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% homologous to the nucleotide sequence set forth in SEQ ID No. 1. In one embodiment of the invention, the sequence of the ORF is shown in SEQ ID NO. 1.
SEQ ID NO. 1 (ORF sequence of HA-Cas9 mRNA )：AUGGCCCCCAAGAAGAAGCGGAAGGUGGGCAUCCACGGCGUGCCCGCCGCCGACAAGAAGUACAGCAUCGGCCUGGACAUCGGCACCAACAGCGUGGGCUGGGCCGUGAUCACCGACGAGUACAAGGUGCCCAGCAAGAAGUUCAAGGUGCUGGGCAACACCGACCGGCACAGCAUCAAGAAGAACCUGAUCGGCGCCCUGCUGUUCGACAGCGGCGAGACCGCCGAGGCCACCCGGCUGAAGCGGACCGCCCGGCGGCGGUACACCCGGCGGAAGAACCGGAUCUGCUACCUGCAGGAGAUCUUCAGCAACGAGAUGGCCAAGGUGGACGACAGCUUCUUCCACCGGCUGGAGGAGAGCUUCCUGGUGGAGGAGGACAAGAAGCACGAGCGGCACCCCAUCUUCGGCAACAUCGUGGACGAGGUGGCCUACCACGAGAAGUACCCCACCAUCUACCACCUGCGGAAGAAGCUGGUGGACAGCACCGACAAGGCCGACCUGCGGCUGAUCUACCUGGCCCUGGCCCACAUGAUCAAGUUCCGGGGCCACUUCCUGAUCGAGGGCGACCUGAACCCCGACAACAGCGACGUGGACAAGCUGUUCAUCCAGCUGGUGCAGACCUACAACCAGCUGUUCGAGGAGAACCCCAUCAACGCCAGCGGCGUGGACGCCAAGGCCAUCCUGAGCGCCCGGCUGAGCAAGAGCCGGCGGCUGGAGAACCUGAUCGCCCAGCUGCCCGGCGAGAAGAAGAACGGCCUGUUCGGCAACCUGAUCGCCCUGAGCCUGGGCCUGACCCCCAACUUCAAGAGCAACUUCGACCUGGCCGAGGACGCCAAGCUGCAGCUGAGCAAGGACACCUACGACGACGACCUGGACAACCUGCUGGCCCAGAUCGGCGACCAGUACGCCGACCUGUUCCUGGCCGCCAAGAACCUGAGCGACGCCAUCCUGCUGAGCGACAUCCUGCGGGUGAACACCGAGAUCACCAAGGCCCCCCUGAGCGCCAGCAUGAUCAAGCGGUACGACGAGCACCACCAGGACCUGACCCUGCUGAAGGCCCUGGUGCGGCAGCAGCUGCCCGAGAAGUACAAGGAGAUCUUCUUCGACCAGAGCAAGAACGGCUACGCCGGCUACAUCGACGGCGGCGCCAGCCAGGAGGAGUUCUACAAGUUCAUCAAGCCCAUCCUGGAGAAGAUGGACGGCACCGAGGAGCUGCUGGUGAAGCUGAACCGGGAGGACCUGCUGCGGAAGCAGCGGACCUUCGACAACGGCAGCAUCCCCCACCAGAUCCACCUGGGCGAGCUGCACGCCAUCCUGCGGCGGCAGGAGGACUUCUACCCCUUCCUGAAGGACAACCGGGAGAAGAUCGAGAAGAUCCUGACCUUCCGGAUCCCCUACUACGUGGGCCCCCUGGCCCGGGGCAACAGCCGGUUCGCCUGGAUGACCCGGAAGAGCGAGGAGACCAUCACCCCCUGGAACUUCGAGGAGGUGGUGGACAAGGGCGCCAGCGCCCAGAGCUUCAUCGAGCGGAUGACCAACUUCGACAAGAACCUGCCCAACGAGAAGGUGCUGCCCAAGCACAGCCUGCUGUACGAGUACUUCACCGUGUACAACGAGCUGACCAAGGUGAAGUACGUGACCGAGGGCAUGCGGAAGCCCGCCUUCCUGAGCGGCGAGCAGAAGAAGGCCAUCGUGGACCUGCUGUUCAAGACCAACCGGAAGGUGACCGUGAAGCAGCUGAAGGAGGACUACUUCAAGAAGAUCGAGUGCUUCGACAGCGUGGAGAUCAGCGGCGUGGAGGACCGGUUCAACGCCAGCCUGGGCACCUACCACGACCUGCUGAAGAUCAUCAAGGACAAGGACUUCCUGGACAACGAGGAGAACGAGGACAUCCUGGAGGACAUCGUGCUGACCCUGACCCUGUUCGAGGACCGGGAGAUGAUCGAGGAGCGGCUGAAGACCUACGCCCACCUGUUCGACGACAAGGUGAUGAAGCAGCUGAAGCGGCGGCGGUACACCGGCUGGGGCCGGCUGAGCCGGAAGCUGAUCAACGGCAUCCGGGACAAGCAGAGCGGCAAGACCAUCCUGGACUUCCUGAAGAGCGACGGCUUCGCCAACCGGAACUUCAUGCAGCUGAUCCACGACGACAGCCUGACCUUCAAGGAGGACAUCCAGAAGGCCCAGGUGAGCGGCCAGGGCGACAGCCUGCACGAGCACAUCGCCAACCUGGCCGGCAGCCCCGCCAUCAAGAAGGGCAUCCUGCAGACCGUGAAGGUGGUGGACGAGCUGGUGAAGGUGAUGGGCCGGCACAAGCCCGAGAACAUCGUGAUCGAGAUGGCCCGGGAGAACCAGACCACCCAGAAGGGCCAGAAGAACAGCCGGGAGCGGAUGAAGCGGAUCGAGGAGGGCAUCAAGGAGCUGGGCAGCCAGAUCCUGAAGGAGCACCCCGUGGAGAACACCCAGCUGCAGAACGAGAAGCUGUACCUGUACUACCUGCAGAACGGCCGGGACAUGUACGUGGACCAGGAGCUGGACAUCAACCGGCUGAGCGACUACGACGUGGACCACAUCGUGCCCCAGAGCUUCCUGAAGGACGACAGCAUCGACAACAAGGUGCUGACCCGGAGCGACAAGAACCGGGGCAAGAGCGACAACGUGCCCAGCGAGGAGGUGGUGAAGAAGAUGAAGAACUACUGGCGGCAGCUGCUGAACGCCAAGCUGAUCACCCAGCGGAAGUUCGACAACCUGACCAAGGCCGAGCGGGGCGGCCUGAGCGAGCUGGACAAGGCCGGCUUCAUCAAGCGGCAGCUGGUGGAGACCCGGCAGAUCACCAAGCACGUGGCCCAGAUCCUGGACAGCCGGAUGAACACCAAGUACGACGAGAACGACAAGCUGAUCCGGGAGGUGAAGGUGAUCACCCUGAAGAGCAAGCUGGUGAGCGACUUCCGGAAGGACUUCCAGUUCUACAAGGUGCGGGAGAUCAACAACUACCACCACGCCCACGACGCCUACCUGAACGCCGUGGUGGGCACCGCCCUGAUCAAGAAGUACCCCAAGCUGGAGAGCGAGUUCGUGUACGGCGACUACAAGGUGUACGACGUGCGGAAGAUGAUCGCCAAGAGCGAGCAGGAGAUCGGCAAGGCCACCGCCAAGUACUUCUUCUACAGCAACAUCAUGAACUUCUUCAAGACCGAGAUCACCCUGGCCAACGGCGAGAUCCGGAAGCGGCCCCUGAUCGAGACCAACGGCGAGACCGGCGAGAUCGUGUGGGACAAGGGCCGGGACUUCGCCACCGUGCGGAAGGUGCUGAGCAUGCCCCAGGUGAACAUCGUGAAGAAGACCGAGGUGCAGACCGGCGGCUUCAGCAAGGAGAGCAUCCUGCCCAAGCGGAACAGCGACAAGCUGAUCGCCCGGAAGAAGGACUGGGACCCCAAGAAGUACGGCGGCUUCGACAGCCCCACCGUGGCCUACAGCGUGCUGGUGGUGGCCAAGGUGGAGAAGGGCAAGAGCAAGAAGCUGAAGAGCGUGAAGGAGCUGCUGGGCAUCACCAUCAUGGAGCGGAGCAGCUUCGAGAAGAACCCCAUCGACUUCCUGGAGGCCAAGGGCUACAAGGAGGUGAAGAAGGACCUGAUCAUCAAGCUGCCCAAGUACAGCCUGUUCGAGCUGGAGAACGGCCGGAAGCGGAUGCUGGCCAGCGCCGGCGAGCUGCAGAAGGGCAACGAGCUGGCCCUGCCCAGCAAGUACGUGAACUUCCUGUACCUGGCCAGCCACUACGAGAAGCUGAAGGGCAGCCCCGAGGACAACGAGCAGAAGCAGCUGUUCGUGGAGCAGCACAAGCACUACCUGGACGAGAUCAUCGAGCAGAUCAGCGAGUUCAGCAAGCGGGUGAUCCUGGCCGACGCCAACCUGGACAAGGUGCUGAGCGCCUACAACAAGCACCGGGACAAGCCCAUCCGGGAGCAGGCCGAGAACAUCAUCCACCUGUUCACCCUGACCAACCUGGGCGCCCCCGCCGCCUUCAAGUACUUCGACACCACCAUCGACCGGAAGCGGUACACCAGCACCAAGGAGGUGCUGGACGCCACCCUGAUCCACCAGAGCAUCACCGGCCUGUACGAGACCCGGAUCGACCUGAGCCAGCUGGGCGGCGACAGCGGCGGCAAGCGGCCCGCCGCCACCAAGAAGGCCGGCCAGGCCAAGAAGAAGAAGGGCAGCUACCCCUACGACGUGCCCGACUACGCCUGA
In one embodiment of the invention, the sgRNA is an EGFP-recognizing sgRNA, the sequence of which is shown in SEQ ID NO. 2.
SEQ ID NO. 2 (sgEGFP sequence): GTGAACCGCATCGAGCTGAAAGG.
According to the invention, the delivery body may also be modified with targeting molecules to become targeted agents to target specific cells, tissues or organs. The targeting molecule may be located in the delivery body or may be located only on its surface. The targeting molecule may be a protein, peptide, glycoprotein, lipid, small molecule, nucleic acid, etc., examples of which include, but are not limited to, antibodies, antibody fragments, low Density Lipoproteins (LDL), transferrin (transferrin), asialoglycoprotein (asialycoprotein), receptor ligands, sialic acid, aptamers, etc.
According to the present invention, one or more pharmaceutical excipients may be further contained in the delivery system or composition. The term "pharmaceutical excipient" means any type of non-toxic, inert solid, semi-solid, or liquid filler, diluent, etc., including but not limited to sugars such as lactose, trehalose, glucose, and sucrose; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; alcohols such as propylene glycol, ethanol, and the like; buffers such as phosphate buffer, acetate buffer, and citrate buffer; antioxidants, and the like.
In one embodiment of the invention, the delivery body is a lipid nanoparticle. The lipid nanoparticle has a diameter in the range of 1nm to 1000nm, for example, in the range of 20nm to 800nm, or in the range of 50nm to 500nm, or in the range of 80nm to 200nm, or in the range of 1nm to 100nm, or in the range of 1nm to 10 nm. The lipid nanoparticle may be prepared using any method known in the art. These methods include, but are not limited to, spray drying, single and double emulsion solvent evaporation, solvent extraction, phase separation, nano-precipitation, micro-fluidics, simple and complex coacervation, and other methods known to those of ordinary skill in the art.
In some embodiments of the invention, the method of making the delivery system or composition of agents for CRISPR/Cas9 technology comprises: 1) Preparing an organic phase comprising a compound of formula I, a neutral lipid molecule, a cholesterol lipid molecule, and a pegylated lipid molecule; 2) Preparing an aqueous phase containing a reagent for CRISPR/Cas9 technology; 3) The organic phase and the aqueous phase are mixed to prepare a lipid nanoparticle suspension. In the step 1), absolute ethanol or an aqueous solution of ethanol is preferably used as a solvent. In step 2), water is preferably used as solvent. In the step 3), the volume ratio of the organic phase to the aqueous phase is preferably 1:2-4.
A method of gene editing in vitro using a compound described by formula I as a delivery lipid for an agent for CRISPR/Cas9 technology. In some embodiments of the invention, methods of gene editing are performed in vitro using the delivery systems or compositions of the invention described previously.
The ionizable lipid compounds of the invention may be synthesized by methods known in the art, for example, by reacting one or more equivalents of an amine with one or more equivalents of an epoxy-terminated compound under suitable conditions. The synthesis of the ionizable lipid compounds is performed with or without a solvent, and the synthesis may be performed at a higher temperature in the range of 25-100 ℃. The resulting ionizable lipid compound may optionally be purified. For example, a mixture of ionizable lipid compounds may be purified to yield a particular ionizable lipid compound. Or the mixture may be purified to give the particular stereoisomer or regioisomer. The epoxide may be commercially available or synthetically prepared.
In some embodiments of the invention, the ionizable lipid compounds of the invention may be prepared using the following general preparation methods.
A, B, C or D
Step 1: reduction of
The carboxyl group of the compound A1 is reduced to a hydroxyl group in the presence of a reducing agent to obtain a compound A2. Examples of reducing agents include, but are not limited to, lithium aluminum hydride, diisobutylaluminum hydride, and the like. Examples of the solvent used in the reaction include, but are not limited to, ethers (such as diethyl ether, tetrahydrofuran, dioxane, etc.), halogenated hydrocarbons (such as chloroform, methylene chloride, dichloroethane, etc.), hydrocarbons (such as n-pentane, n-hexane, benzene, toluene, etc.), and mixed solvents of two or more of these solvents.
Step 2: oxidation
The hydroxyl group of the compound A2 is oxidized to an aldehyde group in the presence of an oxidizing agent to obtain a compound A3. Examples of oxidizing agents include, but are not limited to, 2-iodoxybenzoic acid (IBX), pyridinium chlorochromate (PCC), pyridinium Dichlorochromate (PDC), dess-martin oxidizing agent, manganese dioxide, and the like. Examples of the solvent used in the reaction include, but are not limited to, halogenated hydrocarbons (such as chloroform, methylene chloride, dichloroethane, etc.), hydrocarbons (such as n-pentane, n-hexane, benzene, toluene, etc.), nitriles (such as acetonitrile, etc.), and mixed solvents of two or more of these solvents.
Step 3: halo-reduction
First, the aldehyde α -hydrogen of the compound A3 is subjected to halogenation with a halogenating agent under acidic conditions to obtain an α -halogenated aldehyde intermediate, and then the aldehyde group of the α -halogenated aldehyde is reduced to a hydroxyl group in the presence of a reducing agent to obtain the compound A4. Examples of conditions that provide acidity include, but are not limited to, DL-proline. Examples of halogenated agents include, but are not limited to, N-chlorosuccinimide (NCS) and N-bromosuccinimide (NBS). Examples of reducing agents include, but are not limited to, sodium borohydride, sodium cyanoborohydride, and sodium triacetoxyborohydride.
Step 4: epoxidation
The compound A4 is subjected to intramolecular nucleophilic substitution reaction in the presence of a base to obtain an epoxy compound A5. Examples of bases include, but are not limited to, hydroxides or hydrides of alkali metals, such as sodium hydroxide, potassium hydroxide, and sodium hydride. Examples of solvents used in the reaction include, but are not limited to, mixtures of dioxane and water.
Step 5: ring opening reaction
Compound A5 is ring-opened with an amine (e.g., N-bis (2-aminoethyl) methylamine) to obtain the final compound. Examples of the solvent for the reaction include, but are not limited to, ethanol, methanol, isopropanol, tetrahydrofuran, chloroform, hexane, toluene, diethyl ether, etc.
The raw material A1 in the preparation method can be obtained commercially or synthesized by a conventional method.
The ionizable lipid has two adjacent cis double bonds in the molecular structure, so that the ionizable lipid has higher encapsulation efficiency and better cell transfection efficiency when being subsequently applied to a delivery system for wrapping active substances; in addition, in preparing lipid nanoparticles, the resulting lipid nanoparticles have a more uniform particle size. The ionizable lipid compounds of the invention are particularly suitable for preparing nanoparticles of solid structure.
As used herein, the term "alkyl" refers to a saturated hydrocarbon group obtained by removing a single hydrogen atom from a hydrocarbon moiety containing 1 to 30 carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, n-heptyl, n-octyl, n-decyl, n-undecyl and n-dodecyl.
The term "alkenyl" refers to a monovalent group derived from a hydrocarbon moiety having at least one carbon-carbon double bond by the removal of a single hydrogen atom. Alkenyl groups include, for example, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl and the like.
The term "alkynyl" refers to a monovalent group derived from a hydrocarbon having at least one carbon-carbon triple bond by removal of a single hydrogen atom. Representative alkynyl groups include ethynyl, 2-propynyl (propargyl), 1-propynyl, and the like.
The term "alkoxy" refers to an alkyl group, as defined above, attached to the parent molecule through an oxygen atom. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, t-butoxy, neopentyloxy, and n-hexyloxy.
The terms "halo" and "halogen" refer to an atom selected from fluorine, chlorine, bromine and iodine.
The terms "substituted" (whether the term "optional" is present or not) and "substituent" refer to the ability to change one functional group to another, provided that the valences of all atoms are maintained. When more than one position in any particular structure may be substituted with more than one substituent selected from a specified group, the substituents may be the same or different at each position.
In the present invention, "Cas9-HA" and "HA-Cas9" have the same meaning.
Drawings
FIG. 1 pKa curves for ionizable lipids II-37
FIG. 2 Transmission Electron microscopy of Cas 9/sgRNA-coated LNP formed by II-37
FIG. 3 Western immunoblot assay following transfection of A549 cells with LNP encapsulating Cas9-HA protein mRNA and sgEGFP formed by II-37
FIG. 4 fluorescence photomicrographs of LNP transfected Vero-EGFP cells expressing green fluorescent protein formed from II-37 encapsulating Cas9-HA protein mRNA and sgEGFP, where A is pre-transfection and B is 48 hours post-transfection
FIG. 5 comparison of cell transfection efficiency of mRNA-coated LNP formed by ionizable lipid II-37 and commercial molecule MC3, respectively
FIG. 6 Cy 5-labeled loaded mRNA, formation of mRNA-encapsulated LNP with ionizable lipid II-37 and commercial molecule MC3, respectively, and observation of the efficiency of delivery of mRNA into cells by LNP by fluorescent staining
FIG. 7 comparison of cell transfection efficiency of mRNA-coated LNP formed by ionizable lipids II-37 and C14-113, respectively
FIG. 8MTT assay for cytotoxicity of II-37-LNP and C14-113-LNP
FIG. 9 cell transfection efficiency of LNP coated with pDNA formed by ionizable lipid II-37
Detailed Description
The technical scheme of the invention will be further described in detail below with reference to specific embodiments. It is to be understood that the following examples are illustrative only and are not to be construed as limiting the scope of the invention. All techniques implemented based on the above description of the invention are intended to be included within the scope of the invention.
Unless otherwise indicated, the starting materials and reagents used in the following examples were either commercially available or may be prepared by known methods. The biological assay methods used are all known in the art or can be performed with reference to the instructions of the kit used.
EXAMPLE 1 Synthesis of ionizable lipid II-37
Synthesis of linolenol (a 2): liAlH 4 (7.20 g), linoleic acid (50 g, a 1) were added to 950mL of tetrahydrofuran at 0deg.C, after which the mixture was stirred at 25deg.C for 2h. After the completion of the reaction, which was shown by Thin Layer Chromatography (TLC), the reaction mixture was quenched by adding water (7.2 mL), naOH aqueous solution (7.2 mL, mass fraction 15%) and water (21.6 mL) in this order, and adding an appropriate amount of Na 2SO4, stirring for 15 minutes, filtering through a buchner funnel and washing the filter cake with ethyl acetate, collecting the filtrate and concentrating by evaporation to obtain 47.4g of the target product linolenol (a 2).
1H NMR(400MHz,CDCl3):δ5.27-5.44(m,4H),3.63(t,J＝6.63Hz,2H),2.77(t,J＝6.44Hz,2H),1.97-2.12(m,4H),1.57-1.63(m,1H),1.20-1.46(m,18H),0.83-0.95(m,3H)
Synthesis of (9Z, 12Z) -octadeca-9, 12-dienal (a 3): linolenol (25.0 g, a 2) and 2-iodoxybenzoic acid (39.4 g) were added to 170mL of acetonitrile at room temperature, and the mixture was stirred at 85 ℃ for 4h. The reaction solution was filtered through a buchner funnel and the filter cake was washed with methylene chloride, and the filtrate was collected and concentrated by evaporation to give 24.0g of the objective (9Z, 12Z) -octadeca-9, 12-dienal (a 3).
1H NMR(400MHz,CDCl3):δ9.76(t,J＝1.76Hz,1H),5.25-5.43(m,4H),2.76(t,J＝6.17Hz,2H),2.41(td,J＝7.33,1.87Hz,2H),2.04(q,J＝6.84Hz,4H),1.56-1.68(m,2H),1.22-1.36(m,14H),0.88(t,J＝6.73Hz,3H)
Synthesis of (9Z, 12Z) -2-chloro-octadeca-9, 12-dien-1-ol (a 4): to 246mL of acetonitrile at 0℃were added (9Z, 12Z) -octadeca-9, 12-dienal (43.0 g, a 3), DL-proline (5.62 g) and N-chlorosuccinimide, followed by stirring at 0℃for 2h. After completion of the reaction, the reaction mixture was diluted with absolute ethanol (246 mL), and sodium borohydride (8.8 g) was added thereto, followed by stirring at 0℃for 4 hours. The reaction mixture was quenched with water (120 mL) and extracted with methyl tert-butyl ether, the combined organic phases were washed with saturated brine, dried over sodium sulfate, filtered and concentrated by evaporation to give the desired product (9 z,12 z) -2-chloro-octadeca-9, 12-dien-1-ol (a 4,46 g) which was used directly in the next step.
1H NMR(400MHz,CDCl3):δ5.25-5.51(m,4H),3.97-4.07(m,1H),3.79(dd,J＝12.01,3.63Hz,1H),3.59-3.70(m,1H),2.67-2.90(m,2H),1.96-2.15(m,5H),1.64-1.82(m,1H),1.20-1.49(m,15H),0.89(br t,J＝6.75Hz,3H)
Synthesis of 2- [ (7 z,10 z) -hexadecane-7, 10-diene ] oxirane (a 5): to 450mL of 1, 4-dioxane were added (9Z, 12Z) -2-chloro-octadeca-9, 12-dien-1-ol (45 g, a 4) and aqueous sodium hydroxide solution (120 g of sodium hydroxide in 585mL of water) at room temperature, and after the addition was completed, the mixture was stirred at 35℃for 2 hours. TLC showed that after the reaction was completed, the reaction solution was separated by a separating funnel and washed with saturated brine, dried over sodium sulfate, filtered and concentrated by evaporation, and then the residue was purified by flash column chromatography eluting with petroleum ether/ethyl acetate to give the target product 2- [ (7 z,10 z) -hexadecane-7, 10-diene ] oxirane (a 5) 29.11g.
1H NMR(400MHz,CDCl3):δ5.27-5.46(m,4H),2.87-2.98(m,1H),2.70-2.85(m,3H),2.46(dd,J＝5.00,2.75Hz,1H),1.94-2.21(m,4H),1.24 -1.58(m,17H),0.78-1.00(m,3H)
Synthesis of II-37: 2- [ (7Z, 10Z) -hexadecane-7, 10-diene ] oxirane (5 g) and N, N-bis (2-aminoethyl) methylamine (739 mg) were added to 10mL of ethanol at room temperature, and the mixture was stirred at 90℃for 36h. The reaction solution was concentrated by evaporation, and the residue was purified by flash column chromatography eluting with methylene chloride/methanol to give crude product II-37 (4 g). The target product was purified again by flash column chromatography with dichloromethane/methanol to give II-37 (2.2 g).
1H NMR(400MHz,CDCl3):δ5.27-5.44(m,12H),3.48-3.79(m,3H),2.63-3.00(m,12H),2.16-2.61(m,12H),2.05(q,J＝6.80Hz,12H),1.18-1.57(m,51H),0.89(t,J＝6.88Hz,9H)
ESI-MS：m/z 910.8[M+H]+,911.8[M+2H]+,912.8[M+3H]+
Ionizable lipids have two main roles: bind nucleic acids and allow release of nucleic acid molecules in cells. The pKa of a lipid is an important factor because lipids need to be positively charged at low pH to bind nucleic acids, but not charged at neutral pH so that LNP formed does not cause toxicity. The pKa of the ionizable lipid II-37 was determined to be 6.81 by the TNS dye binding assay and the results are shown in FIG. 1.
EXAMPLE 2 preparation of Gene editing delivery vehicles from II-37
Accurately weighing the compounds II-37 and DSPC, CHOL, DMG-PEG2000, and fully dissolving each lipid with absolute ethanol or 95% ethanol for standby. According to II-37/DSPC/CHOL/DMG-pe2000=45: 15:38.5:1.5 The lipid solution was mixed uniformly in proportion (molar ratio) as an organic phase. HA-Cas9 mRNA (SEQ ID NO: 1) and sgRNA (SEQ ID NO: 2) were formulated in a molar ratio of 1:2 into an aqueous solution (with pure water as solvent), ph=4.
And mixing the aqueous phase and the organic phase by adopting a microfluidic technology in a volume ratio of 3:1. And centrifugally filtering the obtained nanoparticle suspension by a 100kDa ultrafiltration centrifuge tube, purifying and concentrating, and adding the concentrated liquid into sucrose to prepare a lipid nanoparticle suspension sample.
And detecting a sample by using a laser nano particle size analyzer, wherein the detected particle size (Diameter), PDI and potential (Zeta Pttential). The physical and chemical quality control data of the prepared lipid nanoparticle are shown in table 1:
TABLE 1
Sample information Particle size (nm) PDI Zeta potential ((mV))
II-37-Cas9/sgRNA-LNP 165.7 0.272 29.1
As can be seen from the table, the obtained nano particles have a particle size of less than 200nm, a surface potential of about 30mV, good uniformity of particle size and DPI of less than 0.3.
The morphology analysis of the nano particles is carried out by adopting a transmission electron microscope, and the preparation method of the transmission electron microscope sample comprises the following steps: firstly, diluting nanoparticle suspension with double distilled water for 5 times; secondly, sucking 5 microliters of sample dilution liquid, dripping the sample dilution liquid on a carbon support film copper net, and after the sample is dried, dyeing the copper net by using a uranyl acetate dye, and washing the copper net once by double distilled water; finally, the sample was dried in vacuo. FIG. 2 is a profile of II-37-Cas 9/sgRNA-LNP. From the figure, it can be seen that the nanoparticles exhibit a spherical structure, with a size of about 100-200nm, consistent with the DLS particle size.
EXAMPLE 3 Effect experiment of Gene editing delivery vehicle prepared from II-37
The lipid nanoparticle obtained was prepared by the method of example 2, and delivered against HA-Cas9 protein mRNA (SEQ ID NO: 1) and sgEGFP (SEQ ID NO: 2). The prepared samples were formulated with opti-MEM medium as 15. Mu.g/mL II-37-Cas9/sgRNA-LNP solution.
2ML of A549 cells with the cell number of 1X 10 5 are respectively added into each well of a 6-well cell culture plate, after incubation for 24 hours in a 37 ℃ carbon dioxide incubator, 200 mu L of the sample is respectively added into each well, 3 compound wells are carried out on each gene editing composition, the 6-well plate after sample addition is placed in the 37 ℃ carbon dioxide incubator for incubation for 48 hours, the supernatant is discarded, after the culture solution is absorbed by water absorption paper, the cells are lysed on ice, the protein is extracted, and the protein is subjected to a Western immunoblotting test. As shown in fig. 3, successful expression of the HA-Cas9 protein was detected, demonstrating that the delivery system was effective in delivering HA-Cas9 mRNA and sgEGFP into cells.
EXAMPLE 4 knockout Effect experiment of Gene editing delivery vector prepared from II-37
The lipid nanoparticle prepared by the method of example 2 was subjected to knockout experiments with respect to green fluorescent protein genes. The prepared samples were formulated with Opti-MEM medium as 5. Mu.g/mL II-37-Cas9/sgRNA-LNP solution.
2ML of Vero-EGFP cells expressing green fluorescent protein with the cell number of 1X 10 5 are added to each well of a 6-well cell culture plate, after incubation for 24 hours in a 37 ℃ carbon dioxide incubator, 200 mu L of the sample is added to each well, 3 multiplex wells are carried out for each gene editing composition, and after incubation for 48 hours in a 37 ℃ carbon dioxide incubator, the green fluorescent protein expression of the cells is observed under a fluorescent microscope. As shown in FIG. 4, 48 hours after loading, the visual field had no apparent green fluorescence, indicating that EGFP gene was successfully knocked out.
EXAMPLE 5 II-37 preparation of lipid nanoparticles by coating DNA
The ionizable lipids II-37, DSPC, CHOL and DMG-PEG2000 were prepared by preparing an ethanol solution as an organic phase at a molar ratio of 45% to 10% to 43.5% to 1.5%, and dissolving Lucferase DNA (pDNA) in an aqueous solution at pH=4 as an aqueous phase. The nanoparticle suspension was prepared by microfluidic techniques on a nanopharmaceutical manufacturing apparatus (PNI company, canada, model Ignite) with a volume ratio of aqueous phase to organic phase of 3:1. And after the preparation, performing ultrafiltration concentration to obtain the final pDNA-LNP lipid nanoparticle, and storing at 2-8 ℃ for later use.
Characterization of pDNA-LNP particle size and Zeta potential was performed using a Zetasizer Pro nanoparticle potentiometer (malverpa family), and the results are shown in table 2, in which the lipid nanoparticle pDNA-LNP particle size was around 173nm, and the pDNA-LNP particle size distribution was narrower (PDI was smaller).
TABLE 2
Particle size (nm) PDI Zeta potential (mV)
pDNA-LNP 173.2 0.213 24.1
The transfection efficiency of the prepared pDNA-LNP293T cells was examined by a multifunctional enzyme-labeled instrument (BioTek, model SLXFATS) fluorescein reporter method, and the amounts of transfected pDNA were 0.5. Mu.g, 1.0. Mu.g, and 2.0. Mu.g, respectively. The method of in vitro transcription is as follows: 293T cells were plated at a cell density of 2.0X10 5 cells/mL and transfected at a cell fusion of 30% -50%. Positive control 2. Mu.g of pDNA was transfected with the transfection reagent Lipofectamine 2000 (ThermoFisher Scientific) and the transfection procedure was performed according to the transfection reagent product instructions. And (5) detecting the protein expression quantity by using a multifunctional enzyme-labeled instrument after 48 hours of transfection. The negative control was cell culture medium without pDNA-LNP added. In vitro cell transfection efficiency as shown in FIG. 9, LNP coated DNA prepared from ionizable lipid II-37 was shown to have extremely high cell transfection efficiency: 1.0 μg of pDNA was transfected with LNP prepared in II-37 with higher protein expression than 2 μg of pDNA transfected with Lipofectamine 2000; II-37 in vitro cell transfection efficiency was about 3-fold higher than commercial Lipofectamine 2000 with the same 2. Mu.g pDNA transfection.
Examples 6II-37 and comparison of the Effect of commercial ionizable cationic lipid molecules MC3
The molecular formula of MC3 is: 4- (N, N-dimethylamino) butanoic acid (6 z,9z,28z,31 z) -heptanthirty-carbon-6,9,28,31-tetralin-19-yl ester.
Lipid nanoparticles were prepared in a similar manner to that described in example 2, using II37 and MC3, respectively, in the following molar ratios: II-37:DSPC:CHOL:DMG-PEG 2000=45:15:38.5:1.5; MC3 DSPC CHOL DMG-PEG2000=45:15:38.5:1.5; the N/P ratio was 5:1.
The physical and chemical quality control data of the prepared lipid nanoparticle are shown in the following table:
Sample information Particle size (nm) PDI Zeta potential Encapsulation efficiency
mRNA-LNP(II-37) 154.58 0.1068 22.07 90.5
mRNA-LNP(MC3) 234.08 0.1259 2.44 40.7
As can be seen from the above table, the encapsulation rate of the lipid nanoparticle prepared by II-37 is as high as 90.5%, which is far higher than that of the lipid nanoparticle of MC3, and the lipid nanoparticle has smaller and more uniform particle size and higher potential.
The prepared lipid nanoparticle is transfected into a cell CHO-K1, the protein expression condition is known, the result is shown in figure 5, and under the condition that the transfected mRNA amount is the same, the lipid nanoparticle prepared by II-37 (shown as C2 in the figure) carries mRNA to transfect the cell, the protein expression amount in the cell is far higher than that of MC3, and the cell transfection efficiency of the lipid nanoparticle prepared by II-37 is high.
In addition, cy5-mRNA-LNP (II-37) and Cy5-mRNA-LNP (MC 3) were obtained by labeling the supported mRNA with Cy 5. After 2h and 6h incubation with 293T cells, the cell lysosomes were stained with LysoSensorTM Green to observe the Cy5-mRNA entry effect. As can be seen from FIG. 6, after incubation of Cy5-mRNA-LNP (II-37) with cells for 6h, the Cy5-mRNA reached mostly lysosomes with co-localization coefficient of 0.626; after 6h incubation of Cy5-mRNA-LNP (MC 3) with the cells, cy5-mRNA was less incorporated into the cells, thus comparing the nucleic acid delivery efficiency of the II-37 molecule to that of the MC3 molecule.
From the results of example 6, it can be seen that lipid nanoparticles prepared from the novel lipid compound formulations are superior to MC3 molecules in both nucleic acid delivery efficiency and in vitro cell transfection efficiency.
Example 7 comparison of II-37 with structural analog molecule C14-113
The structural formula of C14-113 is as follows:
Lipid nanoparticles were prepared in a similar manner to example 2 using II37 and C14-113, respectively, in the following molar ratios: II-37:DSPC:CHOL:DMG-PEG 2000=45:15:38.5:1.5; c14-113:dspc:chol:dmg-PEG2000 = 45:15:38.5:1.5; the N/P ratio was 10:1.
The physical and chemical quality control data of the prepared lipid nanoparticle are shown in the following table:
Sample information Particle size (nm) PDI Zeta potential
mRNA-LNP(II-37-LNP) 136.68 0.14 20.07
mRNA-LNP(C14-113-LNP) 152.65 0.12 24.1
The prepared lipid nanoparticle is transfected into a cell 293T, the expression condition of the protein is known, and the result is shown in figure 7, and under the condition that the transfected mRNA amount is the same, the protein expression amount in the cell is far higher than that of C14-113 after the lipid nanoparticle prepared by II-37 (shown as II-37-LNP in the figure) carries the mRNA to transfect the cell, so that the cell transfection efficiency of the lipid nanoparticle prepared by II-37 is high.
In addition, the cytotoxicity of II-37-LNP and C14-113-LNP was measured by MTT method, and the effect of the vector dose and time of action on the proliferation of normal cells (293T) was examined. As a result, as shown in FIG. 8, the lipid nanoparticle prepared by II-37 (shown as II-37-LNP in the figure) remained relatively active at a relatively high dose (2. Mu.g/mL) after 48 hours of transfection of cells with mRNA, indicating that the cytotoxicity of the lipid nanoparticle prepared by II-37 was very low.
From the results of example 7, it can be seen that lipid nanoparticles prepared from the novel lipid compound formulations are low in cytotoxicity and superior to the structural analog molecule C14-113 in mRNA transfection efficiency.
The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (11)

1. A delivery system or composition of reagents for CRISPR/Cas9 technology comprising a lipid-containing delivery body and a reagent for CRISPR/Cas9 located in the delivery body, characterized in that the delivery body comprises an ionizable lipid compound of formula IWherein:
Q is Wherein R 8、R9 is independently selected from substituted or unsubstituted straight chain C1-10 alkylene, 1 or more C atoms of which are optionally replaced by heteroatoms independently selected from O, S and N; r 7 is hydrogen, halogen, -OH, linear or branched C1-20 alkyl, linear or branched C2-20 alkenyl, linear or branched C2-20 alkynyl, or-CH 2CH(OH)R5, orThe substituted substituent groups are halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;
r 1、R2、R3、R4, which may be the same or different, are each independently selected from hydrogen, substituted or unsubstituted straight or branched C1-30 alkyl, substituted or unsubstituted straight or branched C2-30 alkenyl, substituted or unsubstituted straight or branched C2-30 alkynyl, 1 or more C atoms of the alkyl, alkenyl or alkynyl being optionally replaced by heteroatoms independently selected from O, S and N, or-CH 2CH(OH)R5; the substituted substituent group is selected from halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;
Provided that at least one of R 1、R2、R3、R4 is
R 5 is selected from hydrogen, substituted or unsubstituted straight or branched C1-30 alkyl, substituted or unsubstituted straight or branched C2-30 alkenyl, substituted or unsubstituted straight or branched C2-30 alkynyl, 1 or more C atoms of said alkyl, alkenyl or alkynyl being optionally replaced by heteroatoms independently selected from O, S and N; the substituted substituent group is selected from halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;
r 6 is selected from hydrogen, C1-3 alkyl, C1-3 alkoxy, -OH;
n is an integer of 1 to 8, m is an integer of 0 to 8, and n and m are independent of each other and may be the same or different;
When at least two of R 1、R2、R3、R4 are When n and m in each of the groups are independent of each other, they may be the same or different;
Preferably, Q is Wherein: x and y may be the same or different and are independently selected from integers of 1 to 8; preferably, x or y are the same or different and are selected from integers from 1 to 3; preferably, R 7 is a straight or branched C1-4 alkyl group;
Preferably, R 6 is-OH;
Preferably, n is an integer from 4 to 8, and m is an integer from 4 to 8;
Preferably, the delivery body is a microparticle, nanoparticle, liposome, lipid nanoparticle or microbubble.
2. The delivery system or composition of claim 1, wherein the compound of formula I is of formula A, B, C or D:
Wherein each n 1, which may be the same or different, each n 1 is selected from integers from 1 to 8, each m 1, which may be the same or different, each m 1 is selected from integers from 0 to 8; preferably, each n 1 is selected from integers from 4 to 8, and each m 1 is selected from integers from 4 to 8; preferably, each n 1 is identical to each other and each m 1 is identical to each other;
Wherein each n 2, which may be the same or different, each n 2 is selected from integers from 1 to 8, each m 2, which may be the same or different, each m 2 is selected from integers from 0 to 8; preferably, each n 2 is selected from integers from 4 to 8, and each m 2 is selected from integers from 4 to 8; preferably, each n 2 is identical to each other and each m 2 is identical to each other;
Wherein each n 3, which may be the same or different, each n 3 is selected from integers from 1 to 8, each m 3, which may be the same or different, each m 3 is selected from integers from 0 to 8; preferably, each n 3 is selected from integers from 4 to 8, and each m 3 is selected from integers from 4 to 8; preferably, each n 3 is identical to each other and each m 3 is identical to each other;
Wherein each n 4, which may be the same or different, each n 4 is selected from integers from 1 to 8, each m 4, which may be the same or different, each m 4 is selected from integers from 0 to 8; preferably, each n 4 is selected from integers from 4 to 8, and each m 4 is selected from integers from 4 to 8; preferably, each n 4 is identical to each other and each m 4 is identical to each other.
3. The delivery system or composition of claim 2, wherein the compound of formula I is
4. A delivery system or composition according to any one of claims 1 to 3, wherein the delivery body further comprises neutral lipid molecules, cholesterol lipid molecules and pegylated lipid molecules;
Preferably, the delivery body contains 30-60mol%, preferably 32-55mol%, of the lipid molecules of formula I based on the total lipid molecules;
Preferably, the delivery body contains 5-30mol% neutral lipid molecules, preferably 8-20 mol%, based on the total lipid molecules;
preferably, the delivery body contains 30-50mol% cholesterol lipid molecules, preferably 35-50mol% cholesterol lipid molecules, based on the total lipid molecules;
preferably, the delivery body contains 0.4 to 10mol%, preferably 0.5 to 5mol%, of the PEGylated lipid molecules based on the total lipid molecules.
5. The delivery system or composition of claim 4, wherein the neutral lipid molecule is selected from the group consisting of phosphatidylcholine compounds, or/and phosphatidylethanolamine compounds, wherein the phosphatidylcholine compounds have the structure of formula E: the structure of the phosphatidylethanolamine compound is shown as a formula F: Wherein Ra, rb, rc, rd is independently selected from the group consisting of linear or branched C1-30 alkyl, linear or branched C2-30 alkenyl, preferably linear or branched C10-30 alkyl, linear or branched C10-30 alkenyl, preferably CH3(CH2)17CH2-、CH3(CH2)15CH2-、CH3(CH2)13CH2-、CH3(CH2)11CH2-、CH3(CH2)9CH2-、CH3(CH2)7CH2-、CH3(CH2)7-CH＝CH-(CH2)7-、CH3(CH2)4CH＝CHCH2CH＝CH(CH2)7-、CH3(CH2)7-CH＝CH-(CH2)9-; and preferably said neutral lipid molecule is selected from the group consisting of: distearoyl phosphatidylcholine (DSPC), dioleoyl phosphatidylethanolamine (DOPE), and distearoyl phosphatidylethanolamine (DSPE);
the cholesterol lipid molecule is selected from cholesterol, 5-heptadecyl resorcinol, fecal sterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomato hypoalkali, tomato alkali, ursolic acid, alpha-tocopherol, mixtures thereof, and cholesterol hemisuccinate;
The pegylated lipid molecule comprises a lipid moiety and a PEG-based polymer moiety, denoted as "lipid moiety-PEG-number average molecular weight", the lipid moiety being a diacylglycerol or diacylglycerol amide selected from dilauroylglycerol, dimyristoylglycerol, dipalmitoylglycerol, distearoyl glycerol, dilauryl glyceramide, dimyristoylglycerol amide, dipalmitoylglycerol amide, distearoyl glyceramide, 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine, 1, 2-dimyristoyl-sn-glycerol-3-phosphoethanolamine; the number average molecular weight of PEG is 130-50,000.
6. The delivery system or composition of any one of claims 1-5, wherein the CRISPR/Cas9 agent comprises DNA or mRNA encoding a Cas9 protein, crRNA, tracrRNA, and/or sgRNA that recognizes a target site;
Preferably, the CRISPR/Cas9 agent comprises mRNA encoding Cas9 protein and sgRNA that recognizes the target site, wherein the molar ratio of mRNA to sgRNA is 1 (1-10).
7. The delivery system or composition of claim 6, wherein the mRNA encoding the Cas9 protein comprises an ORF encoding the Cas9 protein having a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% homologous to the nucleotide sequence set forth in SEQ ID No. 1;
Preferably, the sequence of the ORF is shown as SEQ ID NO. 1.
8. The delivery system or composition of any one of claims 1-7, wherein the ratio of the total mass of lipid molecules to the mass of CRISPR/Cas9 agent in the delivery body is (5-20): 1.
9. The use of an ionizable lipid compound of formula I in the preparation of a delivery system or composition for delivering an agent for CRISPR/Cas9 technology,
Wherein:
Q is Wherein R 8、R9 is independently selected from substituted or unsubstituted straight chain C1-10 alkylene, 1 or more C atoms of which are optionally replaced by heteroatoms independently selected from O, S and N; r 7 is hydrogen, halogen, -OH, linear or branched C1-20 alkyl, linear or branched C2-20 alkenyl, linear or branched C2-20 alkynyl, or-CH 2CH(OH)R5, orThe substituted substituent groups are halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;
r 1、R2、R3、R4, which may be the same or different, are each independently selected from hydrogen, substituted or unsubstituted straight or branched C1-30 alkyl, substituted or unsubstituted straight or branched C2-30 alkenyl, substituted or unsubstituted straight or branched C2-30 alkynyl, 1 or more C atoms of the alkyl, alkenyl or alkynyl being optionally replaced by heteroatoms independently selected from O, S and N, or-CH 2CH(OH)R5; the substituted substituent group is selected from halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;
Provided that at least one of R 1、R2、R3、R4 is
R 5 is selected from hydrogen, substituted or unsubstituted straight or branched C1-30 alkyl, substituted or unsubstituted straight or branched C2-30 alkenyl, substituted or unsubstituted straight or branched C2-30 alkynyl, 1 or more C atoms of said alkyl, alkenyl or alkynyl being optionally replaced by heteroatoms independently selected from O, S and N; the substituted substituent group is selected from halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;
r 6 is selected from hydrogen, C1-3 alkyl, C1-3 alkoxy, -OH;
n is an integer of 1 to 8, m is an integer of 0 to 8, and n and m are independent of each other and may be the same or different;
When at least two of R 1、R2、R3、R4 are When n and m in each of the groups are independent of each other, they may be the same or different;
Preferably, Q is Wherein: x and y may be the same or different and are independently selected from integers of 1 to 8; preferably, x or y are the same or different and are selected from integers from 1 to 3; preferably, R 7 is a straight or branched C1-4 alkyl group;
Preferably, R 6 is-OH;
preferably, n is an integer from 4 to 8 and m is an integer from 4 to 8.
10. The use according to claim 9, wherein the compound of formula I is of formula A, B, C or D:
Wherein each n 1, which may be the same or different, each n 1 is selected from integers from 1 to 8, each m 1, which may be the same or different, each m 1 is selected from integers from 0 to 8; preferably, each n 1 is selected from integers from 4 to 8, and each m 1 is selected from integers from 4 to 8; preferably, each n 1 is identical to each other and each m 1 is identical to each other;
Wherein each n 2, which may be the same or different, each n 2 is selected from integers from 1 to 8, each m 2, which may be the same or different, each m 2 is selected from integers from 0 to 8; preferably, each n 2 is selected from integers from 4 to 8, and each m 2 is selected from integers from 4 to 8; preferably, each n 2 is identical to each other and each m 2 is identical to each other;
Wherein each n 3, which may be the same or different, each n 3 is selected from integers from 1 to 8, each m 3, which may be the same or different, each m 3 is selected from integers from 0 to 8; preferably, each n 3 is selected from integers from 4 to 8, and each m 3 is selected from integers from 4 to 8; preferably, each n 3 is identical to each other and each m 3 is identical to each other;
Wherein each n 4, which may be the same or different, each n 4 is selected from integers from 1 to 8, each m 4, which may be the same or different, each m 4 is selected from integers from 0 to 8; preferably, each n 4 is selected from integers from 4 to 8, and each m 4 is selected from integers from 4 to 8; preferably, each n 4 is identical to each other and each m 4 is identical to each other;
preferably, the compound of formula I is
11. A method of gene editing in vitro, characterized in that the delivery system or composition according to any one of claims 1-8 is used.
CN202211460775.8A 2022-11-17 2022-11-17 Lipid composition for gene editing agent delivery and uses thereof Pending CN118078752A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211460775.8A CN118078752A (en) 2022-11-17 2022-11-17 Lipid composition for gene editing agent delivery and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211460775.8A CN118078752A (en) 2022-11-17 2022-11-17 Lipid composition for gene editing agent delivery and uses thereof

Publications (1)

Publication Number Publication Date
CN118078752A true CN118078752A (en) 2024-05-28

Family

ID=91150587

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211460775.8A Pending CN118078752A (en) 2022-11-17 2022-11-17 Lipid composition for gene editing agent delivery and uses thereof

Country Status (1)

Country Link
CN (1) CN118078752A (en)

Similar Documents

Publication Publication Date Title
JP6948313B2 (en) Compounds and compositions for intracellular delivery of therapeutic agents
DE69800178T2 (en) GLYCEROLIPID COMPOUNDS AND THEIR APPLICATION FOR TRANSPORTING AN ACTIVE SUBSTANCE TO A TARGET CELL
CN113993839B (en) Ionizable lipid molecule, preparation method thereof and application thereof in preparation of lipid nanoparticles
WO2018170336A1 (en) Lipid nanoparticle formulation
CN115403474B (en) Lipid compounds and their use in nucleic acid delivery
WO2010057150A1 (en) Releasable polymeric lipids for nucleic acids delivery systems
EP2364085A1 (en) Releasable cationic lipids for nucleic acids delivery systems
EP2355799A1 (en) Releasable fusogenic lipids for nucleic acids delivery systems
WO2010014895A2 (en) Nanoparticle compositions for nucleic acids delivery system
CN117098541A (en) Lipid nanoparticles for delivery of nucleic acids and related methods of use
CA2665403C (en) Compositions comprising a sirna and lipidic 4,5-disubstituted 2-deoxystreptamine ring aminoglycoside derivatives and uses thereof
CN114716355A (en) Lipid compound, composition containing same and application
CN116199646B (en) Tris-based ionizable lipid, and preparation method and application thereof
CN118369308A (en) Compounds and compositions for delivery of therapeutic agents
WO2016027699A1 (en) Cationic lipid for nucleic acid delivery
DE69804302T2 (en) CATIONIC AGENTS FOR TRANSFECTING NUCLEIC ACIDS
CN117658848A (en) Lipid compounds for delivery of therapeutic agents and uses thereof
CN118078752A (en) Lipid composition for gene editing agent delivery and uses thereof
JP2004508364A (en) Acid-sensitive compounds, production and use of said compounds
US20030065033A1 (en) Lipid derivatives of polythiourea
JP2003516970A (en) Amphiphilic polyamines, their use and their synthesis
CN115745788A (en) Ionizable lipid compound and preparation method and application thereof
CN117534585A (en) Novel ionizable cationic lipid compound, and preparation method and application thereof
CN118059059A (en) Freeze-dried preparation of lipid nano particles
CN118666931A (en) Ionizable lipid based on cholic acid compound, preparation method, composition and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination