CN118064439A - Oligonucleotide aptamer bracket for graphene surface and application of oligonucleotide aptamer bracket in enrichment of biological samples - Google Patents
Oligonucleotide aptamer bracket for graphene surface and application of oligonucleotide aptamer bracket in enrichment of biological samples Download PDFInfo
- Publication number
- CN118064439A CN118064439A CN202410088624.7A CN202410088624A CN118064439A CN 118064439 A CN118064439 A CN 118064439A CN 202410088624 A CN202410088624 A CN 202410088624A CN 118064439 A CN118064439 A CN 118064439A
- Authority
- CN
- China
- Prior art keywords
- graphene
- aptamer
- bracket
- nucleic acid
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108091023037 Aptamer Proteins 0.000 title claims abstract description 124
- 229910021389 graphene Inorganic materials 0.000 title claims abstract description 116
- OKTJSMMVPCPJKN-UHFFFAOYSA-N Carbon Chemical compound [C] OKTJSMMVPCPJKN-UHFFFAOYSA-N 0.000 title claims abstract description 115
- 108091034117 Oligonucleotide Proteins 0.000 title claims abstract description 64
- 239000012472 biological sample Substances 0.000 title abstract description 17
- 150000007523 nucleic acids Chemical class 0.000 claims abstract description 54
- 102000039446 nucleic acids Human genes 0.000 claims abstract description 50
- 108020004707 nucleic acids Proteins 0.000 claims abstract description 50
- 238000000034 method Methods 0.000 claims abstract description 29
- 102100025222 CD63 antigen Human genes 0.000 claims description 67
- 101000934368 Homo sapiens CD63 antigen Proteins 0.000 claims description 67
- 239000000243 solution Substances 0.000 claims description 51
- 239000003480 eluent Substances 0.000 claims description 19
- 108020004414 DNA Proteins 0.000 claims description 18
- 238000001179 sorption measurement Methods 0.000 claims description 18
- 239000011324 bead Substances 0.000 claims description 16
- 102000053602 DNA Human genes 0.000 claims description 13
- 108020004682 Single-Stranded DNA Proteins 0.000 claims description 11
- 230000000295 complement effect Effects 0.000 claims description 9
- 102000004169 proteins and genes Human genes 0.000 claims description 9
- 108090000623 proteins and genes Proteins 0.000 claims description 9
- 239000007788 liquid Substances 0.000 claims description 7
- 238000002156 mixing Methods 0.000 claims description 7
- 238000007789 sealing Methods 0.000 claims description 6
- 238000004458 analytical method Methods 0.000 claims description 5
- 239000004005 microsphere Substances 0.000 claims description 5
- 241000972773 Aulopiformes Species 0.000 claims description 4
- 239000003153 chemical reaction reagent Substances 0.000 claims description 4
- 239000000203 mixture Substances 0.000 claims description 4
- 235000019515 salmon Nutrition 0.000 claims description 4
- 238000001514 detection method Methods 0.000 claims description 3
- 210000001808 exosome Anatomy 0.000 claims description 3
- 239000002504 physiological saline solution Substances 0.000 claims description 3
- 108091008102 DNA aptamers Proteins 0.000 claims description 2
- 238000000137 annealing Methods 0.000 claims description 2
- 239000000969 carrier Substances 0.000 claims description 2
- 238000011010 flushing procedure Methods 0.000 claims description 2
- 230000015572 biosynthetic process Effects 0.000 abstract description 5
- 238000003786 synthesis reaction Methods 0.000 abstract description 4
- 238000007306 functionalization reaction Methods 0.000 abstract description 2
- 239000000178 monomer Substances 0.000 description 16
- 239000000523 sample Substances 0.000 description 10
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 8
- 238000002360 preparation method Methods 0.000 description 7
- 230000000694 effects Effects 0.000 description 6
- 230000000903 blocking effect Effects 0.000 description 5
- 238000009396 hybridization Methods 0.000 description 5
- 238000002791 soaking Methods 0.000 description 5
- 239000006228 supernatant Substances 0.000 description 5
- 239000000463 material Substances 0.000 description 4
- 238000000926 separation method Methods 0.000 description 4
- 238000010186 staining Methods 0.000 description 4
- 238000007885 magnetic separation Methods 0.000 description 3
- 239000000047 product Substances 0.000 description 3
- 238000000746 purification Methods 0.000 description 3
- 238000012772 sequence design Methods 0.000 description 3
- 239000000126 substance Substances 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 238000005576 amination reaction Methods 0.000 description 2
- -1 and the like Substances 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 239000007853 buffer solution Substances 0.000 description 2
- 239000013592 cell lysate Substances 0.000 description 2
- 238000007385 chemical modification Methods 0.000 description 2
- 230000001419 dependent effect Effects 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 239000011325 microbead Substances 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000003647 oxidation Effects 0.000 description 2
- 238000007254 oxidation reaction Methods 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 125000006850 spacer group Chemical group 0.000 description 2
- 238000005406 washing Methods 0.000 description 2
- 239000002202 Polyethylene glycol Substances 0.000 description 1
- 241000700605 Viruses Species 0.000 description 1
- 230000009471 action Effects 0.000 description 1
- 125000004432 carbon atom Chemical group C* 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 238000005345 coagulation Methods 0.000 description 1
- 230000015271 coagulation Effects 0.000 description 1
- 238000010226 confocal imaging Methods 0.000 description 1
- 238000004624 confocal microscopy Methods 0.000 description 1
- 230000008878 coupling Effects 0.000 description 1
- 238000010168 coupling process Methods 0.000 description 1
- 238000005859 coupling reaction Methods 0.000 description 1
- 230000006378 damage Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000000432 density-gradient centrifugation Methods 0.000 description 1
- 238000004043 dyeing Methods 0.000 description 1
- 238000010828 elution Methods 0.000 description 1
- 230000002349 favourable effect Effects 0.000 description 1
- 239000007850 fluorescent dye Substances 0.000 description 1
- 239000011521 glass Substances 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 239000003446 ligand Substances 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 239000002245 particle Substances 0.000 description 1
- 230000000704 physical effect Effects 0.000 description 1
- 229920001223 polyethylene glycol Polymers 0.000 description 1
- 239000002861 polymer material Substances 0.000 description 1
- 230000002035 prolonged effect Effects 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 229920002477 rna polymer Polymers 0.000 description 1
- 239000012488 sample solution Substances 0.000 description 1
- 238000004062 sedimentation Methods 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 238000001542 size-exclusion chromatography Methods 0.000 description 1
- 239000012134 supernatant fraction Substances 0.000 description 1
- 239000013076 target substance Substances 0.000 description 1
- 238000005199 ultracentrifugation Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
- C07K1/16—Extraction; Separation; Purification by chromatography
- C07K1/22—Affinity chromatography or related techniques based upon selective absorption processes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70596—Molecules with a "CD"-designation not provided for elsewhere in G01N2333/705
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Urology & Nephrology (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an oligonucleotide aptamer bracket for a graphene surface and application of the oligonucleotide aptamer bracket in enrichment of biological samples. The invention provides an aptamer oligonucleotide scaffold structure nucleic acid, which can be displayed on a graphene interface, has the capability of capturing and releasing a specific target in a biological sample, has low synthesis cost and simple and convenient use method compared with a traditional antibody functionalization mode, and is particularly suitable for mass use.
Description
Technical Field
The invention belongs to the field of biological sample separation and purification, and particularly relates to an oligonucleotide aptamer bracket for a graphene surface and application of the oligonucleotide aptamer bracket in enrichment of biological samples.
Background
The separation and purification of biological samples are important pre-steps for the subsequent analysis of the biological samples, and the analysis of structures and functions of the biological samples such as proteins, viruses, exosomes and the like is dependent on different separation and purification methods to obtain samples with higher purity concentration.
The current biological sample enrichment methods can be generally divided into three main categories according to principles: the first type is to enrich the target substance based on physical properties such as sedimentation coefficient, density and particle size, such as ultracentrifugation, density gradient centrifugation, size exclusion chromatography, etc., which are widely applicable, but such methods are generally time-consuming and laborious and require expensive instruments, and extreme separation conditions can also lead to the destruction of the sample structure and thus affect the subsequent use; the second type is to enrich the target object through non-specific adsorption or coagulation of high polymer materials such as polyethylene glycol, and the method has simple and convenient general steps, relatively mild conditions and suitability for mass use, but has low enrichment purity and is difficult to be applied to samples with complex components such as serum; the third class is a method for enriching the target object by specifically capturing the surface marker of the target object, and the enrichment purity of the method is higher, but most of the methods depend on antibodies, so that the method is high in cost and difficult to use in a large amount. Therefore, the field of the biological sample enrichment method lacks an enrichment method which can simultaneously achieve high specificity, high enrichment amount, mild conditions and simple operation.
The aptamer is a short single-stranded ribonucleic acid or deoxyribonucleic acid with the binding capacity to a specific target object, which is obtained through screening. Compared with the antibody, the aptamer has the advantages of low synthesis cost, stable chemical property, small molecular weight and the like, and the binding capacity to the target is equivalent to that of the antibody, so that the aptamer is more suitable for mass use. Some studies have been made to use the aptamer for biological enrichment, and covalent coupling is mostly adopted to fix the aptamer to the carrier in these studies, and although the fixing manner is relatively firm, complex chemical reagents and complicated preparation procedures are often required in the fixing process, and the subsequent release of the target from the carrier is difficult due to the too firm fixing manner, which is unfavorable for the subsequent use of the target.
Graphene is a two-dimensional material with carbon atoms arranged in a sp2 mode, and besides various well-known advantages, the graphene material has unique properties when being matched with nucleic acid as an essential substance: graphene can adsorb single-stranded nucleic acid in a pi-pi stacking manner, while double-stranded or other nucleic acid with a higher structure is hardly adsorbed by graphene because the conjugated structure in the base thereof is not easily leaked out. The selective adsorption property is matched with the specific capturing capability of the proper ligand, so that the biological sample enrichment platform for target specific capturing and releasing is very suitable to be constructed.
Disclosure of Invention
The invention aims to provide an oligonucleotide aptamer bracket for a graphene surface and application of the oligonucleotide aptamer bracket in enrichment of biological samples.
To achieve the object of the present invention, in a first aspect, the present invention provides an oligonucleotide aptamer scaffold for graphene surfaces, the aptamer scaffold being formed by annealing single-stranded nucleic acids Ss-1 and Ss-2;
Wherein, the single-stranded nucleic acid Ss-1 is from the 5 'end to the 3' end in sequence: DNA aptamer sequence-spacer sequence 1-graphene adsorption polyA sequence designed according to target molecules;
the single-stranded nucleic acid Ss-2 comprises, in order from the 5 'end to the 3' end: graphene adsorbing polyA sequence-spacer sequence 2;
wherein, the interval sequence 1 and the interval sequence 2 are complementary sequences, and the length is 10-30 bp;
The length of the polyA sequence is 15-100 bp.
In the present invention, the target molecules include, but are not limited to, CD63 protein, and the reference sequences of the CD63 protein on NCBI are numbered AAH02349.1 and AAH13017.1.
When the target molecule is CD63 protein, the sequences of the single-stranded nucleic acids Ss-1 and Ss-2 are as follows: ss-1:5'-CACCCCACCTCGCTCCCGTGACACTAATGCTATGACAGTCTCAGATCA AAAAAAAAA-3' (SEQ ID NO: 1);
Ss-2：5′-AAAAAAAAAAGATCTGAGACTGTCA-3′(SEQ ID NO:2)。
In a second aspect, the invention provides any one of the following applications of the aptamer scaffold:
1) For enrichment of target molecules in a sample;
2) Enrichment of exosomes for surface-carrying target molecules
2) For separating and purifying target molecules in a sample;
3) A reagent or a kit for preparing the detection target molecule.
In a third aspect, the invention provides a method of enriching a sample for CD63 protein comprising the steps of:
1) Mixing and incubating two single-stranded nucleic acid solutions forming the aptamer bracket to prepare an aptamer bracket nucleic acid solution; wherein the two single-stranded nucleic acids are single-stranded nucleic acids Ss-1 and Ss-2;
2) Mixing the carrier containing the graphene interface with an aptamer bracket nucleic acid solution to enable the aptamer bracket to be adsorbed on the surface of the graphene carrier;
graphene surfaces on carriers such as graphene plates or graphene microspheres;
3) Closing the surface of the graphene carrier adsorbed with the aptamer bracket in the step 2) by using a short single-stranded DNA solution;
the treated graphene surface to reduce non-specific adsorption;
4) Mixing and incubating the surface of the graphene carrier after the sealing in the step 3) with a sample liquid containing target protein CD63, so that the target protein is fully captured by the aptamer;
5) Removing the sample liquid, and flushing the surface of the graphene carrier, in which the target protein is captured in the step 4), by using a PBS solution or physiological saline;
6) Adding an eluent to the surface of the graphene carrier in the step 5) to release the target protein into a system of the eluent so as to carry out subsequent analysis on the target protein;
Wherein the eluate contains single-stranded nucleic acid 10T+SC:5'-TTTTTTTTTTGATCTGAGACTGTCA-3' (SEQ ID NO: 3).
Further, step 1) includes: two single-stranded nucleic acid solutions were prepared with PBS solution at pH7.2 at a concentration of 10. Mu.M, and the prepared solutions were incubated at 37℃for 12 hours to hybridize the two single-stranded nucleic acids.
Further, in the step 3), the short single-stranded DNA solution is a salmon sperm DNA solution of 1 mg/mL.
Further, the composition of the eluent in step 6) is 100mM 10T+SC nucleic acid solution.
Further, the support containing the graphene interface in the step 2) includes, but is not limited to, graphene paper, graphene plates, graphene microspheres (microbeads), graphene magnetic beads, and the like, and products of their oxidation, amination, and the like after chemical modification.
By means of the technical scheme, the invention has at least the following advantages and beneficial effects:
the invention provides an aptamer oligonucleotide scaffold structure nucleic acid, which can be displayed on a graphene interface, has the capability of capturing and releasing a specific target in a biological sample, has low synthesis cost and simple and convenient use method compared with a traditional antibody functionalization mode, and is particularly suitable for mass use.
Drawings
FIG. 1 is a schematic representation of the sequence and structure of a CD 63-aptamer oligonucleotide scaffold of the invention.
FIG. 2 shows the intramolecular secondary structure of mFold software predicted scaffold monomer Ss-1 according to a preferred embodiment of the present invention.
FIG. 3 is a graph showing the predicted concentration of each component of two stent monomers Ss-1 and Ss-2 according to the temperature by mFold software in the system according to the preferred embodiment of the present invention.
FIG. 4 shows the case of non-denaturing PAGE electrophoresis performed after preparation of CD 63-aptamer oligonucleotide scaffolds under different conditions, according to a preferred embodiment of the present invention, wherein the target product bands are brightest at 37℃overnight.
Fig. 5 shows the fluorescence of the fluorescent labeled aptamer oligonucleotide scaffold at the aptamer end and the fluorescent label Ss-1 adsorbed on the surface of graphene oxide paper photographed by a laser confocal microscope in the preferred embodiment of the invention, and the fluorescence of the CD63 aptamer oligonucleotide scaffold group is obviously stronger than that of the Ss-1 group. * P <0.001.
FIG. 6 shows the fluorescence of the supernatant of the fluorescent-labeled CD63 aptamer oligonucleotide scaffold adsorbed on the surface of graphene oxide paper after the elution solutions with different components are released by the enzyme-labeled instrument in the preferred embodiment of the invention, and the best release effect of 10T+SC on the scaffold can be seen. * P <0.001.
Fig. 7 shows the fluorescence of the laser confocal microscope after capturing the CD63 protein by capturing the aptamer graphene paper, and after staining the aptamer using the ROX-labeled CD63 according to the preferred embodiment of the invention, the fluorescence intensity of the experimental group is significantly higher than that of the two control groups. * P <0.01 and P <0.001.ns denotes P > 0.05 (p= 0.0993).
Fig. 8 shows fluorescence after the release of CD63 protein captured by graphene paper and staining with a ROX-labeled CD63 aptamer by using a laser confocal microscope in the preferred embodiment of the invention, and it is seen that both release groups have weaker fluorescence than the control group, and that the release effect of the 10T eluent is stronger than the CD63 aptamer complementary sequence.
FIG. 9 is a schematic representation of laser confocal microscopy of staining of a graphene magnetic bead carrying CD63 aptamer oligonucleotide scaffold with ROX-labeled aptamer after capture of CD63 protein in accordance with a preferred embodiment of the present invention.
Detailed Description
The invention aims to provide a design and preparation method of a graphene surface aptamer oligonucleotide bracket for biological sample enrichment and application of the graphene surface aptamer oligonucleotide bracket in biological sample enrichment; the aptamer bracket can fix the aptamer on the surface of graphene to capture a target object, and can release the bracket structure after introducing single-stranded nucleic acid complementary to the bracket part sequence. The aptamer bracket is displayed on a graphene interface such as a graphene plate or a graphene microsphere, is easy to prepare, low in synthesis cost and simple in use method, and can be used for separating and purifying a target object corresponding to a selected aptamer.
The invention adopts the following technical scheme:
The invention provides a design scheme of an aptamer oligonucleotide bracket, which comprises a nucleic acid structure of three functional areas, namely a CD63 aptamer area, a double-stranded nucleic acid spacing area and a single-stranded adsorption area.
Specifically, the invention provides a deoxyribonucleic acid sequence of a CD63 aptamer oligonucleotide bracket, which comprises the following two monomers (5 '-3'):
Ss-1:CACCCCACCTCGCTCCCGTGACACTAATGCTATGACAGTCTCAGATCAA AAAAAAAA；
Ss-2:AAAAAAAAAAGATCTGAGACTGTCA。
The invention also provides a sequence design method of the CD63 aptamer oligonucleotide bracket, which comprises the following steps: 1) Integrating a 32-base CD63 full-length aptamer sequence, a 15-base interval protection sequence and a 10-base graphene adsorption polyA sequence into a total 57-base nucleic acid single strand according to the sequence from the 5' end to the 3' end in the monomers Ss-1, and integrating a polyA sequence which is10 bases in total with the complementary sequence 15 bases and the 5' end of the interval sequence of the Ss-1 into a total 25-base nucleic acid single strand by the other monomers Ss-2; 2) And predicting the secondary structure of each monomer and the hybridization condition of the two monomers under the use environment by means of mFold software, and adjusting the sequence according to the prediction result until the sequence can meet the preparation and use requirements.
In the invention, the polyA length for graphene adsorption on the bracket can be properly prolonged according to the size of the target object so as to ensure that the polyA length can be firmly combined with the graphene in the capturing process of the target object. In the invention, DNAFolding Form function is used when mFold software predicts a single-chain secondary structure, the predicted temperature is 37 ℃, the intramolecular secondary structure under the condition of 0.3M Na +,0M Mg2+ (PBS buffer solution and no additional Mg 2+) is needed, and if a double-chain spacer or a polyA region can conflict with the aptamer functional region secondary structure (intramolecular pairing occurs), the sequence needs to be regulated. In the invention, mFold software predicts the hybridization condition of two monomers in a system by using the function of 'hybridization of two DNA strands/RNA strands' in DINAMelt, predicts the hybridization condition under the conditions of 0-100 ℃ and 0.3M Na +,0M Mg2+, and if the prediction result shows that the two monomers cannot be hybridized stably at the working temperature (below 40 ℃), the sequence design needs to be optimized again.
The invention also provides a preparation method of the CD63 aptamer oligonucleotide bracket, which comprises the following steps: 1) Preparing 10 mu M pH 7.2PBS solution of the two monomers; 2) And (3) placing the solution prepared in the step (1) in a 37 ℃ environment for 12 hours to allow the two monomers to fully hybridize, thus preparing the CD63 aptamer oligonucleotide bracket.
The invention also provides a method for capturing CD63 protein on the surface of graphene by using the CD63 aptamer oligonucleotide bracket, which comprises the following steps: 1) Determining the nucleic acid adsorption capacity of the graphene interface by using a short single-stranded DNA solution, and determining the dosage proportion of the aptamer oligonucleotide bracket and the graphene interface according to the determined nucleic acid adsorption amount; 2) Soaking the graphene interface in an aptamer oligonucleotide bracket solution, and uniformly shaking and adsorbing for 30min; 3) Blocking the graphene interface with an excess of short single-stranded DNA solution; 4) Soaking the graphene interface prepared in the step 3) in a sample liquid containing CD63 protein, and uniformly shaking and capturing for 1h; 5) The graphene interface in step 4) is washed with buffer solution or physiological saline, and the CD63 protein is captured at the graphene interface.
According to the method for measuring the graphene interface nucleic acid adsorption capacity, the graphene interface nucleic acid adsorption capacity of unit mass or area is measured by measuring the concentration change of a short single-stranded nucleic acid solution with known concentration before and after the graphene interface adsorption of a determined amount; in the invention, the short single-stranded nucleic acid solution is a commercial denatured salmon sperm DNA solution, and the concentration is diluted to 1mg/mL when the solution is used in a sealing way; in the invention, the graphene interface can be graphene paper, graphene plates, graphene microbeads, graphene magnetic beads and the like, and products of oxidation, amination and other chemical modifications.
The invention also provides a release method of the graphene interface CD63 aptamer oligonucleotide bracket after capturing CD63 protein, which comprises the following steps: 1) Soaking the graphene interface after capturing the CD63 protein in a certain volume of eluent, and uniformly shaking and incubating for 1h at room temperature; 2) Separating the eluent from graphene, and allowing the CD63 protein and the scaffold to enter the eluent for subsequent analysis.
In the invention, the adding volume of the eluent is dependent on the final concentration of the target object, and at least the surface of the graphene should be completely soaked; in the invention, the eluent comprises 100mM 10T+SC nucleic acid solution, and the amount of added substances is 2 to 5 times of the adsorption amount of the theoretical graphene surface aptamer oligonucleotide scaffold; in the present invention, the 10T+SC nucleic acid sequence is (5 '-3'): TTTTTTTTTTGATCTGAGACTGTCA.
The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Unless otherwise indicated, the technical means used in the examples are conventional means well known to those skilled in the art, and all raw materials used are commercially available.
Example 1CD63 aptamer scaffold sequence design, preparation and use on graphene oxide paper
1. Software assisted sequence optimization of CD 63-aptamer oligonucleotide scaffolds
The CD63 aptamer, the double-chain complementary region and the single-chain adsorption region are integrated in sequence, and the CD63 aptamer bracket structure shown in figure 1 is designed. The designed nucleic acid structure is respectively predicted by mFold software to optimize the nucleic acid sequence until the nucleic acid has no complex secondary structure which is unfavorable for the function of the bracket, and the predicted result is shown in figure 2. Next, mFold software hybridization prediction was used to predict hybridization of two monomers of an aptamer scaffold under possible use conditions (10. Mu.M each for nucleic acid two monomers, 0.3M Na+,0M Mg 2+, 0-100 ℃), as shown in FIG. 3, the aptamer scaffold was stably bound (AB: more than 95%) below 40 ℃, initially indicating that the structure was able to work in the environment required for enrichment of a general biological sample (37 ℃,4 ℃), and the sequence was readjusted if the results showed that the designed sequence could not meet the requirements.
2. Preparation of CD 63-aptamer oligonucleotide scaffold
The aptamer oligonucleotide scaffold yields were judged by non-denaturing PAGE electrophoresis (20% PAGE,110V,3 h) using PBS at pH 7.2 after mixing equimolar ratios of 100. Mu.M of the respective nucleic acid monomers Ss-1, ss-2, and incubation for 12h at 37℃was found to be a condition favorable for aptamer oligonucleotide scaffold formation after screening, and either denaturation or too rapid a temperature decrease resulted in a decrease in aptamer oligonucleotide scaffold yields (FIG. 4). Thus, the CD 63-aptamer oligonucleotide scaffolds were prepared by incubating two monomers at a concentration of 10. Mu.M each at 37℃for 12h and stored at 4 ℃.
3. Detection of fixation and release conditions of CD63 aptamer oligonucleotide bracket on graphene oxide paper surface
In order to judge whether the support structure can play a role in protecting the CD63 aptamer, a FAM fluorescent group is connected to the aptamer end of the aptamer oligonucleotide support structure, the fluorescent group is quenched by graphene to lose fluorescence, fluorescence can be emitted when the aptamer is far away from the surface of the graphene, and whether the oligonucleotide support structure plays a role in protecting the aptamer end at intervals can be indirectly proved by observing the fluorescence level of the surface of the graphene by virtue of the property, so that the aptamer end is far away from the surface of the graphene. Thus, a 10. Mu.M fluorescence-labeled aptamer oligonucleotide scaffold was prepared by the same method as described above, 5. Mu.L was added to 195. Mu.L of PBS containing about 0.2cm 2 graphene oxide paper, and after shaking at room temperature and light-shielding for 30min, the graphene paper was placed on a glass slide and subjected to surface fluorescence observation by using a laser confocal microscope, and the aptamer oligonucleotide scaffold was replaced with fluorescence-labeled Ss-1 single-stranded nucleic acid in the control group. The experimental results are shown in fig. 5, and the average fluorescence intensity of the aptamer oligonucleotide scaffold group is obviously stronger than that of the aptamer oligonucleotide scaffold group directly using single chains, so that the aptamer oligonucleotide scaffold has an interval protection function on the aptamer end.
The release experiments were also referenced to the fluorescence intensity of the FAM fluorophore at the aptamer end. As alternative materials for the eluent, 300. Mu.M 3T solution (oligonucleotide of sequence TTT), 150. Mu.M 6T solution (oligonucleotide of sequence TTTTTTT), 90. Mu.M 10T solution (oligonucleotide of sequence TTTTTTTTTT), 90. Mu.M 10T+SC solution (25 mer oligonucleotide of sequence 10T bases plus 15 bases of spacer complementary sequence from 5' end, SEQ ID NO: 3) were prepared in advance, wherein 3T, 6T, 10T are of equal mass concentration, 10T and 10T+SC are of equal mass concentration. Washing 0.5cm 2 graphene oxide paper stored in ethanol in advance by using PBS for 1 time to remove ethanol, re-supplementing 490 mu L of PBS, adding 10 mu L of 10 mu M fluorescent-labeled CD63 aptamer oligonucleotide bracket, shaking uniformly at room temperature for 30min at room temperature, and fixing on the surface of the graphene oxide paper to prepare the aptamer graphene. After the fixation is completed, the surface of the aptamer graphene is washed for 1 time by using 500 mu L of PBS, 290 mu L of PBS is added again, then 10 mu L of the alternative materials of the eluent are respectively added into each aptamer graphene sample, 10 mu L of PBS is added into a control group, the mixture is uniformly shaken at room temperature and away from light for 1 hour to fully release the fluorescent marked aptamer oligonucleotide bracket on the surface of the graphene oxide, after the release is completed, the supernatant is collected, the fluorescent intensity of the supernatant is measured by an enzyme-labeled instrument to determine the release effect of different eluents, and the stronger the fluorescent intensity of the supernatant is, the stronger the release capacity of the eluent to the bracket is represented. The experimental results are shown in fig. 6, wherein the release capacity of 3T, 6T, 10T and 10t+sc on the fluorescent-labeled aptamer oligonucleotide scaffold on the surface of graphene oxide is sequentially enhanced, and it is seen that 10t+sc solution is the optimal choice as eluent for the CD63 aptamer oligonucleotide scaffold.
Example 2CD63 aptamer oligonucleotide scaffold captures CD63 protein in cell lysate on graphene magnetic beads and graphene oxide paper surface
1. CD63 aptamer oligonucleotide bracket captures and releases CD63 protein on graphene oxide paper surface
And (3) soaking a 0.1cm 2 graphene oxide paper sample in 200 mu L of 2.5 mu M CD63 aptamer oligonucleotide bracket solution, and soaking a control group without CD63 capturing capacity in 200 mu L of 5 mu M aptamer bracket monomer Ss-2 nucleic acid solution, and adsorbing for 30min to prepare the aptamer graphene paper. The supernatant fraction was removed, and 200. Mu.L of a 10mg/mL BSA solution was added to block the graphene oxide paper for 1h. Removing the blocking solution, adding 150 mu L of 2-fold diluted CD63 sample solution (THP-1 cell lysate) into the aptamer graphene paper, and adding 150 mu L of 1mg/mL BSA solution into the CD63 protein-free control group, and shaking at room temperature to capture for 1h. After the completion of the capturing, the graphene paper was washed 3 times with 150. Mu.L of 1mg/mL BSA solution each time, and was closed by re-feeding 150. Mu.L of 3.3mg/mL short single-stranded DNA solution (denatured salmon sperm DNA solution) for 30min. Subsequently, the nucleic acid blocking solution was removed, 150. Mu.L of 1mg/mL short single-stranded DNA solution was added, 0.5. Mu.L of 100. Mu.M ROX red fluorescent-labeled CD63 aptamer was added, and the mixture was shaken overnight in the absence of light to develop the CD63 protein on the graphene surface. Finally, shooting the graphene surface by using a laser confocal microscope, and displaying the capture condition of the CD63 on the graphene paper surface by red fluorescence intensity. The experimental results are shown in fig. 7, and the surface fluorescence intensity of the graphene oxide paper of the experimental group is stronger than that of a control group without the CD63 capturing capability and a control group without the CD63 protein, which indicates that the CD63 aptamer oligonucleotide bracket can specifically capture the CD63 protein on the surface of the graphene oxide paper.
Subsequently, the CD63 aptamer graphene paper capturing the CD63 protein was prepared again by the same method as described above, 5. Mu.L of 90. Mu.M 10T eluent, 5. Mu.L of 100. Mu.M CD63 aptamer complementary sequence nucleic acid solution as a release group, 5. Mu.L of 1mg/mL short single-stranded DNA solution as a control group were added to different samples after PBS was made up to 300. Mu.L, and shaking was performed at room temperature for 1h. Subsequently, the CD63 protein on the surface of graphene is stained by the same procedure as before using the ROX-labeled CD63 aptamer, and the amount of the reagent may be appropriately adjusted according to the surface area of the graphene sheet. And after the dyeing is finished, observing the surface fluorescence condition of the graphene paper by using a laser confocal microscope. The experimental results (figure 8) show that the fluorescence intensity of the 10T eluent release group and the fluorescence intensity of the CD63 aptamer complementary sequence nucleic acid release group are obviously reduced compared with the comparison group, which shows that the two modes can release the CD63 protein captured by the aptamer graphene paper, and the 10T eluent release effect is better.
2. CD63 aptamer oligonucleotide bracket captures CD63 protein on graphene magnetic bead surface
Taking 0.15mg of amino modified Graphene Magnetic Beads (GMB) dispersed in ethanol, washing with 150 mu L of PBS for 2 times to remove residual ethanol, re-suspending the GMB in 140 mu L of PBS, adding 10 mu L of 10 mu M CD63 aptamer oligonucleotide bracket, adding 10 mu L of PBS in the no aptamer control group, and shaking at room temperature for adsorption for 30min; after the aptamer is adsorbed and fixed, removing supernatant by magnetic separation, and respectively blocking different groups by using 150 mu L of 0.5mg/mL short single-stranded DNA or 150 mu L of 2.5mg/mL BSA, shaking at room temperature and blocking for 30min; removing the sealing liquid by magnetic separation, adding 150 mu L of sample liquid containing CD63, and shaking uniformly to capture the aptamer magnetic beads for 1h; the aptamer magnetic beads were collected by magnetic separation, washed 1 time with 100. Mu.L of PBS, 100. Mu.L of ROX fluorescent-labeled CD63 aptamer stain (1 mg/mL short single-stranded DNA solution containing 0.1. Mu.M ROX-labeled CD63 aptamer) was added, and after shaking-up staining for 1 hour, the surface fluorescence of the magnetic beads was photographed using laser confocal imaging. The experimental results are shown in fig. 9, wherein the red average fluorescence intensity of the aptamer magnetic beads with the first group and the second group in different sealing modes is stronger than that of the aptamer magnetic beads which are not carried with the magnetic beads and are only subjected to sealing treatment, and the experiment results show that the CD63 aptamer oligonucleotide bracket can play a role on the surface of the amino-modified graphene magnetic beads; as can be seen from comparison of the first group and the second group, the capture effect of the short single-stranded DNA-blocked aptamer magnetic beads on the CD63 protein is stronger than that of the BSA-blocked aptamer magnetic beads, which indicates that the short single-stranded DNA-blocked aptamer oligonucleotide scaffold is more beneficial to the action of the CD 63-aptamer oligonucleotide scaffold while the nonspecific adsorption of the graphene surface is reduced, and the possible reason is that the size of the aptamer oligonucleotide scaffold is smaller, and the BSA-blocked aptamer end is possibly embedded so as to be unfavorable for the capture effect.
While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Claims (10)
1. An oligonucleotide aptamer scaffold for a graphene surface, wherein the aptamer scaffold is formed by annealing single-stranded nucleic acids Ss-1 and Ss-2;
Wherein, the single-stranded nucleic acid Ss-1 is from the 5 'end to the 3' end in sequence: DNA aptamer sequence-spacer sequence 1-graphene adsorption polyA sequence designed according to target molecules;
the single-stranded nucleic acid Ss-2 comprises, in order from the 5 'end to the 3' end: graphene adsorbing polyA sequence-spacer sequence 2;
wherein, the interval sequence 1 and the interval sequence 2 are complementary sequences, and the length is 10-30 bp;
The length of the polyA sequence is 15-100 bp.
2. The aptamer scaffold of claim 1, wherein the target molecule is CD63 protein.
3. The aptamer scaffold of claim 2, wherein the single stranded nucleic acids Ss-1 and Ss-2 have the following sequences:
Ss-1：5′-CACCCCACCTCGCTCCCGTGACACTAATGCTATGACAGTCTCAGATCA AAAAAAAAA-3′；
Ss-2：5′-AAAAAAAAAAGATCTGAGACTGTCA-3′。
4. any one of the following uses of the aptamer scaffold of claim 1:
1) For enrichment of target molecules in a sample;
2) Enrichment of exosomes for surface-carrying target molecules
3) For separating and purifying target molecules in a sample;
4) A reagent or a kit for preparing the detection target molecule.
5. The use according to claim 4, wherein the target molecule is CD63 protein.
6. A method for enriching a sample for CD63 protein, comprising the steps of:
1) Mixing and incubating two single-stranded nucleic acid solutions forming the aptamer bracket to prepare an aptamer bracket nucleic acid solution; wherein the two single-stranded nucleic acids are the single-stranded nucleic acids Ss-1 and Ss-2 described in claim 3;
2) Mixing a carrier containing a graphene interface with an aptamer bracket nucleic acid solution to enable the aptamer bracket to be adsorbed on the surface of the graphene carrier;
graphene surfaces on carriers such as graphene plates or graphene microspheres;
3) Closing the surface of the graphene carrier adsorbed with the aptamer bracket in the step 2) by using a short single-stranded DNA solution;
the treated graphene surface to reduce non-specific adsorption;
4) Mixing and incubating the surface of the graphene carrier after the sealing in the step 3) with a sample liquid containing target protein CD63, so that the target protein is fully captured by the aptamer;
5) Removing the sample liquid, and flushing the surface of the graphene carrier, in which the target protein is captured in the step 4), by using a PBS solution or physiological saline;
6) Adding an eluent to the surface of the graphene carrier in the step 5) to release the target protein into a system of the eluent so as to carry out subsequent analysis on the target protein;
wherein the eluate contains single-stranded nucleic acid 10T+SC:5'-TTTTTTTTTTGATCTGAGACTGTCA-3'.
7. The method of claim 6, wherein step 1) comprises: two single-stranded nucleic acid solutions were prepared with PBS solution at pH7.2 at a concentration of 10. Mu.M, and the prepared solutions were incubated at 37℃for 12 hours to hybridize the two single-stranded nucleic acids.
8. The method of claim 6, wherein the short single-stranded DNA solution of step 3) is a 1mg/mL denatured salmon sperm DNA solution.
9. The method of claim 6, wherein the composition of the eluate of step 6) is 100mm10t+sc nucleic acid solution.
10. The method according to any one of claims 6-9, wherein the support comprising a graphene-like interface of step 2) is graphene paper, graphene plates, graphene microspheres, graphene magnetic beads, and oxidized, aminated products thereof.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410088624.7A CN118064439A (en) | 2024-01-22 | 2024-01-22 | Oligonucleotide aptamer bracket for graphene surface and application of oligonucleotide aptamer bracket in enrichment of biological samples |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410088624.7A CN118064439A (en) | 2024-01-22 | 2024-01-22 | Oligonucleotide aptamer bracket for graphene surface and application of oligonucleotide aptamer bracket in enrichment of biological samples |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN118064439A true CN118064439A (en) | 2024-05-24 |
Family
ID=91094666
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410088624.7A Pending CN118064439A (en) | 2024-01-22 | 2024-01-22 | Oligonucleotide aptamer bracket for graphene surface and application of oligonucleotide aptamer bracket in enrichment of biological samples |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN118064439A (en) |
-
2024
- 2024-01-22 CN CN202410088624.7A patent/CN118064439A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230081326A1 (en) | Increasing dynamic range for identifying multiple epitopes in cells | |
| US20210239692A1 (en) | Aptamer-Based Multiplexed Assays | |
| JP6491610B2 (en) | Multiplexed analysis of test samples | |
| US9404919B2 (en) | Multiplexed analyses of test samples | |
| US7855054B2 (en) | Multiplexed analyses of test samples | |
| CN111118120B (en) | Liquid chromatography for simultaneously detecting multiple microRNAs based on DSN cyclic amplification technology | |
| WO2017126646A1 (en) | Method for screening nucleic acid aptamer | |
| CN101148667B (en) | Preparation and use for affinity human albumin nucleic acid aptamer | |
| US20160320377A1 (en) | Method for protein analysis | |
| CN118064439A (en) | Oligonucleotide aptamer bracket for graphene surface and application of oligonucleotide aptamer bracket in enrichment of biological samples | |
| KR102559020B1 (en) | Method for detecting target utilizing Graphene oxide and aptamer/G-quadruplex-based hybridization chain reaction (GQ-HCR) | |
| US20240018512A1 (en) | Method for multi-dimensional analysis of cell epigenomics | |
| AU2015261546B2 (en) | Multiplexed analyses of test samples | |
| CN117431300A (en) | Detection method and kit | |
| AU2013203360B2 (en) | Multiplexed analyses of test samples | |
| KR20220163640A (en) | Preparation of Proteome Binding Aptamer Pool using Magnetic Collection for Quantitatively Analyzing Proteome and Automated Equipment thereof | |
| KR20220164163A (en) | Preparation of aptamer pool using magnetic collection for proteomic profile or protein quantification and automated equipment thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |