CN118028487A - SNP locus combination for Wu Mengfeng chicken identification, primer combination and identification method - Google Patents
SNP locus combination for Wu Mengfeng chicken identification, primer combination and identification method Download PDFInfo
- Publication number
- CN118028487A CN118028487A CN202410287011.6A CN202410287011A CN118028487A CN 118028487 A CN118028487 A CN 118028487A CN 202410287011 A CN202410287011 A CN 202410287011A CN 118028487 A CN118028487 A CN 118028487A
- Authority
- CN
- China
- Prior art keywords
- chicken
- mengfeng
- snp
- locus
- combination
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000287828 Gallus gallus Species 0.000 title claims abstract description 147
- 238000000034 method Methods 0.000 title claims abstract description 23
- 235000013330 chicken meat Nutrition 0.000 claims description 130
- 108700028369 Alleles Proteins 0.000 claims description 21
- 210000000349 chromosome Anatomy 0.000 claims description 10
- 238000012408 PCR amplification Methods 0.000 claims description 9
- 238000012216 screening Methods 0.000 claims description 7
- 238000012163 sequencing technique Methods 0.000 claims description 5
- 210000003746 feather Anatomy 0.000 claims description 4
- 230000002068 genetic effect Effects 0.000 claims description 4
- 210000003462 vein Anatomy 0.000 claims description 4
- 238000012217 deletion Methods 0.000 claims description 2
- 230000037430 deletion Effects 0.000 claims description 2
- 230000004069 differentiation Effects 0.000 claims description 2
- 239000002773 nucleotide Substances 0.000 claims description 2
- 125000003729 nucleotide group Chemical group 0.000 claims description 2
- 244000178870 Lavandula angustifolia Species 0.000 claims 1
- 235000010663 Lavandula angustifolia Nutrition 0.000 claims 1
- 239000008280 blood Substances 0.000 claims 1
- 210000004369 blood Anatomy 0.000 claims 1
- 239000001102 lavandula vera Substances 0.000 claims 1
- 235000018219 lavender Nutrition 0.000 claims 1
- 108020004414 DNA Proteins 0.000 description 7
- 244000144977 poultry Species 0.000 description 4
- 235000013594 poultry meat Nutrition 0.000 description 4
- 238000009396 hybridization Methods 0.000 description 3
- 238000000137 annealing Methods 0.000 description 2
- 238000010241 blood sampling Methods 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 238000011835 investigation Methods 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 230000035772 mutation Effects 0.000 description 2
- 238000011144 upstream manufacturing Methods 0.000 description 2
- 241000271566 Aves Species 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 108010006785 Taq Polymerase Proteins 0.000 description 1
- 210000001015 abdomen Anatomy 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 238000012214 genetic breeding Methods 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 238000002955 isolation Methods 0.000 description 1
- 244000144972 livestock Species 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 239000011535 reaction buffer Substances 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a SNP locus combination, a primer combination and an identification method for Wu Mengfeng chicken identification, wherein the locus combination comprises WMF1 locus to WMF6 locus. When the locus combination is utilized to carry out the resource identification of the black-bone Meng Feng chicken, the individual can be completely excluded from belonging to the Wu Mengfeng chicken as long as one SNP locus genotype does not accord with the corresponding genotype of the Wu Mengfeng chicken; and if all the 6 SNP locus combinations accord with Wu Mengfeng chicken genotypes, judging that the individual belongs to Wu Mengfeng chicken. The identification method is simple and convenient to operate, high in accuracy and capable of rapidly identifying Wu Mengfeng chicken resources.
Description
Technical Field
The invention relates to identification of poultry varieties, in particular to SNP locus combination, primer combination and identification method for Wu Mengfeng chicken identification.
Background
Wu Mengfeng chicken, also known as chicken with chicken head and chicken pecking (zhu ā i) have 200 years of history, and are genetic resources newly developed by the third resource census Guizhou province. The origin is six-disc water city of Guizhou province, and the villages and towns are distributed in 12 villages in the whole city, wherein the villages and towns of the guarantor and Zang Ke are central production areas, and are distributed sporadically nearby other villages. In the past, wu Mengfeng chickens are located in the abdomen of the Wumongshan in the main producing area, so that the local mountain situation is dangerous, the natural geographic isolation conditions are realized, and the influence of external poultry seeds is less. However, in recent years, due to the large amount of exotic chicken species rushing in, wu Mengfeng chickens are abandoned or mixed by most farmers due to relatively low production performance, and the pure-bred Wu Mengfeng chickens are only bred in extremely-locked minority villages, so that the pure-bred Wu Mengfeng chickens are endangered. With the development of general investigation of livestock and poultry genetic resources in China, the investigation and protection of local chicken resources are more emphasized and strengthened, more and more local chicken new resources are more socially focused, wu Mengfeng chickens are also socially focused gradually, the protection of Wu Mengfeng chickens resources is also strengthened in Guizhou province, and a Wu Mengfeng chicken core seed-preserving field is established, so that Wu Mengfeng chicken resource groups are gradually expanded. The agricultural product geographical sign registration protection is formally approved by the agricultural rural department of the people's republic of China for ' Liujingshui Wu Mengfeng ' on the 3 th 7 th 2018. For better breeding and protection of Wu Mengfeng chicken breeder seeds, collection and protection of pure Wu Mengfeng chicken are required, so that identification of Wu Mengfeng chicken is indispensable.
At present, wu Mengfeng chickens are identified mainly by means of appearance observation, the subjectivity of the observation is strong, the appearance is similar when the offspring of Wu Mengfeng chickens and other breeds of chickens are identified, and the identification error rate is high. In addition, when new resources of black-bone Meng Feng chickens are identified, the new resources are required to be distinguished from the existing local chickens in Guizhou province and the varieties similar to the external province in appearance, such as the Jinhu black-bone chicken and the like, the phenomenon of 'homologous and different names' is avoided, and the effective identification of the new resources and the faster promotion of protection work are realized. Therefore, the development of the method capable of effectively and accurately identifying Wu Mengfeng chicken resources has very important significance when applied to Wu Mengfeng chicken identification work.
Disclosure of Invention
Aiming at the problem of difficult identification of Wu Mengfeng chicken resources, the invention provides a set of SNP locus combination, primer combination and identification method for Wu Mengfeng chicken identification, wherein the locus combination comprises the following WMF1 locus to WMF6 locus:
| Sequence number | Chromosome of the human body | SNP site ID | Location on chromosome | Reference genome | Mutation site |
| WMF1 | NC_006113.5 | rs317429549 | chr26:3883154 | G | A |
| WMF2 | NC_006092.5 | rs14511492 | chr5:8348023 | A | G |
| WMF3 | NC_006097.5 | rs315992594 | chr10:19871640 | C | A |
| WMF4 | NC_006099.5 | rs316929397 | chr12:16243309 | G | A |
| WMF5 | NC_006093.5 | rs312886198 | chr6:30651981 | G | A |
| WMF6 | NC_006088.5 | rs315226425 | chr15:10088459 | T | C |
The nucleotide sequence of the primer of each SNP locus is as follows:
The screening method of the SNP locus comprises the following steps: the method comprises the steps of utilizing a chip to screen and determine 55000 SNP loci of 12 chicken species (Wu Mengfeng chickens; 7 local chickens in Guizhou province: black-bone chickens, xingwu black-bone chickens, zhuxiang chickens, weining chickens, southeast chicken, short-leg chickens and tall-leg chickens in Guizhou regions, which are similar to Wu Mengfeng chickens, possibly have hybridization conditions, selecting different allele frequencies of each locus of other regions, namely golden lake black-bone chickens and silky black-bone chickens, and the like, introducing varieties used for hybridization matching (Habert chickens and Lavandular chickens) in foreign representatively, selecting a set of loci with the largest difference according to comparison of each variety with other varieties, selecting a genetic differentiation finger Top5%, the minimum allele frequency being more than 0.2, the deletion rate being less than 0.1, determining 220 SNP loci, preferentially selecting Wu Mengfeng chickens with reference genome locus allele frequencies of 0 or 1, then determining different allele frequencies of each locus of other 11 varieties, and identifying the different allele frequencies of each locus by comparing the average value with the different allele frequencies of Wu Mengfeng chickens to be 34, and determining that the allele frequencies of each locus are close to the final allele frequency is close to 0 or is close to the allele frequency of the 6.
The technical problem to be solved by the invention is to provide an identification method of black-bone Meng Feng chicken, which comprises the following steps:
(1) Extracting total DNA of a chicken genome to be detected;
(2) Respectively carrying out PCR amplification by utilizing corresponding primer combinations according to the SNP locus combinations;
(3) Sequencing the PCR amplification product and judging the genotype;
(4) If the genotype corresponding to the SNP locus combination does not accord with the genotype corresponding to the Wu Mengfeng chicken, judging that the individual does not belong to the Wu Mengfeng chicken; if the genotypes corresponding to the 6 SNP locus combinations all accord with the genotypes of Wu Mengfeng chickens, the individual is judged to belong to Wu Mengfeng chickens, and the genotypes of the 6 SNP loci WMF 1-WMF 6 are AA, GG, CC, GG, GG, TT in sequence.
Preferably, the genomic DNA of the chicken to be tested in the step (1) is obtained by blood sampling from the individual ptera veins of the chicken species.
In the step (2), the PCR product lengths of WMF 1-WMF 6 are 221bp, 227bp, 215bp, 240bp, 232bp and 202bp respectively. The information of each corresponding product is as follows:
WMF1- -221bp (SNP site: 192bp G/A)
AATACCAGTATCTAGAAAGTTTCCAAGCATGTCGAACGAGAATCAGAATGAATCCTCTAGTGCAAAAATGAATTACAGGCCTCTCTCACTACTCAGAAGCATATCAGTATTTTGCACGCAGGCAGAAAGGAACAACCAGAAGCAGCAGAGGGGAGAACTGTAGGAAGGCTTTGTGAAATGACCTTATCCCAK(G/A)TGAGGTGCTGTTCACCTTTAGAATATGGA
WMF2- -227bp (SNP site: 51bp A/G)
AGGCAGGTTGAAAGGGTTTTCAGACCTGACGTTTCTATCAAAGCTAGACCK(A/G)AGCCCAACTTCTTCATTGATGCTATCAACTTCAGGGAGTTCCTTTCAAACAAGATCCATCAGACATACTGCTGTCTGCATCAAGGGAAAAAAACAAACAGGCTCCTTTCTAGCCAGATTAACCTGCTACCTTAAACTGCCACGTTTAAAACTACATGCACACACACCCAGGGATAT
WMF3- -215bp (SNP site: 32bp C/A)
TGCTTCAAGGATCCCAAAAAGCCCATCTCAGK(C/A)TAATGCACGTTGTTTATTCTCACTGCTGAAAGAAAATTAGAGAAAAAATCAAATCAAATCACAGTTCTGGAATGCATTGCAGAGTTTATGATCCCCCCTTGTATTATCTCTAGCTCTAACCCAGATTTGCAGCCACGCAGTGCTCTTGTTCGGTGCTCTGCCAATGCACTTTGCTGTGACCTG
WMF4- -240bp (SNP site: 132bp G/A)
TGAAAGTGCAACCAGTCCACTGCTCCTGGCAGCAACCTGCCTGGGTCCTTCTGCTCAGATGTGGGTTCTCCTCCCAACTGCTGCATCCCAGGTGATGCTCAGAGCACCTTGTGCCCATCACATGTTCATAGK(G/A)GAGATGGATAATGTATTTTAGAAAACCACACTTCTCTGCTCTTCCCTAAAAGTAGGGAGGTAGGAGCGGAGATATCTGGGAGTTGTGGTGGTGACATAAAGCAGCTGC
WMF5- -232bp (SNP site: 186bp G/A)
ATACGTGGTGCCAGAAGAGGTTTTATCTTCTGTATATATATTTTTAAAAATTTAATAAATACAAAGCAAATAGCATTGGTTTATCCAGGGGAATATTGAAATCCATTAGGAATCCACTTGGAGTAATCTGATTCAACAAGTCAGTATATTTCTCTCAAAAACATAATATCTGTACTACATTGTGCK(G/A)AGATGAAGGTTAGATTACATTTCTTGCCAGTGCAGTAATTCCCACA
WMF6- -202bp (SNP site: 161bp T/C)
CAACCAATGGTGGCTCTCTTACATGAGATTAGATTTGACAAAACTATTTCCCAAAGTGTCACAGTGCACCATTTCTTTTTTCTATGGAGTCATTTTGAAGTCTCCAAACTAGTGGTTACCCCAGAAAGTCTAAGAGGTCTGAACGCTCCATTATCACTTAK(T/C)TTATGAAAGTCATAATGATTAATTCTTGGACGACGGAGCTA
Through the technical scheme, the invention has the following beneficial effects:
the SNP locus combination is adopted to carry out resource identification of black-bone Meng Feng chickens, and the probability of judging the combined genotype of 6 SNP loci as Wu Mengfeng chickens reaches more than 99.99 percent. The probability of eliminating Wu Mengfeng chickens from any SNP locus genotype reaches 100 percent. Therefore, if only one SNP locus genotype does not accord with the corresponding genotype of Wu Mengfeng chickens, the individual can be completely excluded from belonging to Wu Mengfeng chickens.
Detailed Description
Aiming at the problem of difficult Wu Mengfeng chicken resource identification, the invention provides a set of SNP locus combination, primer combination and application thereof for Wu Mengfeng chicken resource identification, wherein the locus combination comprises WMF1 locus to WMF6 locus.
The screening method of the 6 SNP loci comprises the following steps: using a 55K jingxin chip number one (reference Gallus _ gallus genome redesign, beijing Kang Pusen biotechnology limited) optimized in 2023, 12 breeder chickens (Wu Mengfeng chickens; the method comprises the steps of selecting 7 local chicken species in Guizhou, namely black-bone chicken, xingwu black-bone chicken, zhuxiang chicken, weining chicken, southeast chicken, low-foot chicken and high-foot chicken, selecting similar representative black-bone chicken species in other areas, namely golden lake black-bone chicken and silk feather black-bone chicken, introducing varieties used for hybridization matching, namely hubert chickens and lead-in avians, randomly selecting 200 individuals for each variety), screening and determining 55000 SNP loci, comparing each variety with other varieties, taking a set of loci with the largest difference, selecting a Minimum Allele Frequency (MAF) of 0.2, selecting a loss rate (mass rate) of <0.1, selecting core locus information of the Wu Mengfeng chickens, preferentially selecting a reference genome locus allele frequency of 0 or 1 for the other 11 varieties, selecting a different allele frequency average value of each locus of the other 11 varieties, and selecting the different allele frequency of each locus of the other than Wu Mengfeng chickens to be close to 0 or 1 by comparing the average value with the different allele frequencies of each locus of the Wu Mengfeng chickens, and selecting the different alleles of the loci to be close to 0.
The genotype frequency of other varieties refers to the genotype frequency average value of each locus obtained by combining and calculating 11 varieties of golden lake black-bone chicken, silk feather black-bone chicken, xingwu black-bone chicken, zhuxiang chicken, qian southeast chicken, weining chicken, low-foot chicken, high-foot chicken, hubert chicken, largehead chicken and the like.
Finally, 6 SNP loci for Wu Mengfeng chicken resource identification are determined. Genotype frequencies of 6 SNP loci in Wu Mengfeng chickens and other varieties are as follows:
the 6 SNP loci information is shown in the following table.
| Sequence number | Chromosome of the human body | SNP site ID | Location on chromosome | Reference genome | Mutation site |
| WMF1 | NC_006113.5 | rs317429549 | chr26:3883154 | G | A |
| WMF2 | NC_006092.5 | rs14511492 | chr5:8348023 | A | G |
| WMF3 | NC_006097.5 | rs315992594 | chr10:19871640 | C | A |
| WMF4 | NC_006099.5 | rs316929397 | chr12:16243309 | G | A |
| WMF5 | NC_006093.5 | rs312886198 | chr6:30651981 | G | A |
| WMF6 | NC_006088.5 | rs315226425 | chr15:10088459 | T | C |
Based on the red chicken reference genome sequence (Gallus _ gallus 6) according to the physical positions of the 6 SNP loci, 6 SNP locus DNA sequences were obtained using UCSC website https:// genome-asia. UCSC. Edu/cgi-bin/HGGATEWAYHGSID =791993043_MvNmFj6QPMRQsauOxQiaxq3 gPtEUU, and primers were designed using Primer5.0. The sequence of each SNP primer, the length of PCR product and annealing temperature are shown in the following table:
the specific method for identifying the black-bone Meng Feng chicken resources by using the SNP primer combination comprises the following steps:
(1) Extracting total DNA of a chicken genome to be detected;
(2) Respectively carrying out PCR amplification by using the corresponding primer according to the selected SNP primer combination;
(3) Sequencing the PCR amplification product and judging the genotype;
(4) Judging whether the individual belongs to Wu Mengfeng chicken resources according to genotype results, and judging that the individual does not belong to Wu Mengfeng chicken if the genotype corresponding to the selected SNP combination does not accord with the genotype corresponding to Wu Mengfeng chicken; if all genotypes corresponding to the SNP combination accord with genotypes corresponding to Wu Mengfeng chickens, the individual is judged to belong to Wu Mengfeng chickens.
In the identification method of the present invention, it is preferable to collect the genomic DNA from the fin vein of the chicken to be tested by a conventional extraction method in the art, and in the embodiment of the present invention, it is preferable thatGenomic DNA was extracted by the imitation method.
When the method is applied, WMF 1-WMF 6 locus combination is adopted to identify the black-bone Meng Feng chicken resource, and corresponding upstream and downstream primers are adopted to carry out PCR amplification. PCR amplification is carried out by methods conventional in the art.
In the invention, genotypes of 6 SNP loci WMF1 to WMF6 in Wu Mengfeng chickens are AA, GG, CC, GG, GG, TT in sequence.
The following describes specific embodiments of the present invention in detail with reference to examples. It should be understood that the detailed description and specific examples, while indicating and illustrating the invention, are not intended to limit the invention.
Example 1
Randomly selecting and marking Wu Mengfeng chickens, 20 golden lake black-bone chickens, 20 silk feather black-bone chickens, 20 Xingwu black-bone chickens, 20 Qian southeast chicken, 20 Zhu Xiang chickens and 20 Weining chickens which are preserved in a poultry genetic breeding key laboratory germplasm resource genetic material library of Jiangsu province. The wing vein is used for blood sampling,Extracting genome DNA by an imitation method, and carrying out PCR amplification according to primers of 6 SNP loci corresponding to WMF 1-WMF 6.
50. Mu.L of the total PCR reaction system: DNA template 2. Mu.L, dNTP (2 mmol/L) 4. Mu.L, mg 2+(3mmol·L-1) 0.6. Mu.L, 1 XPCR reaction buffer 5. Mu.L, 1. Mu.L each of the upstream and downstream primers (10. Mu. Mol. L -1), 2.5. Mu.L of Taq polymerase (1U. Mu.L -1), and ultra-pure water to 50. Mu.L.
PCR reaction procedure: pre-denaturation at 95 ℃ for 5min; denaturation at 94℃for 30s, annealing at 60℃for 30s, extension at 72℃for 30s, for a total of 35 cycles; extending at 72℃for 5min. The target fragment amplified by PCR was detected by 1.5% agarose gel electrophoresis.
The PCR products were sent to Bio Inc. for sequencing, and the sequences were subjected to polymorphism detection and genotyping.
According to the sequencing result, the combined genotype of 6 sites of 20 individuals is AAGGCCGGGGTT, and the result is consistent with the mark, wherein the chicken is judged to be Wu Mengfeng. None of the remaining individuals fully met the AAGGCCGGGGTT genotype and were therefore judged to be non-Wu Mengfeng chickens.
The preferred embodiments of the present invention have been described in detail above with reference to the examples, but the present invention is not limited to the specific details of the above embodiments, and various simple modifications can be made to the technical solutions of the present invention within the scope of the technical concept of the present invention, and all the simple modifications belong to the protection scope of the present invention.
In addition, the specific features described in the above embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, various possible combinations are not described further.
Moreover, any combination of the various embodiments of the invention can be made without departing from the spirit of the invention, which should also be considered as disclosed herein.
Claims (6)
1. SNP locus combination for Wu Mengfeng chicken resource identification, characterized by comprising the following WMF1 locus to WMF6 locus:
WMF1 is located at position 3883154 on nc_006113.5 chromosome 26, which is a G or a polymorphism;
WMF2 is located at position 8348023 on nc_006092.5 chromosome 5, which is an a or G polymorphism;
WMF3 is located at position 19871640 on nc_006097.5 chromosome 10, which is a C or a polymorphism;
WMF4 is located at position 16243309 on nc_006099.5 chromosome 12, which is a G or a polymorphism;
WMF5 is located at position 30651981 on nc_006093.5 chromosome 6, which is a G or a polymorphism;
WMF6 is located at position 10088459 on nc_006088.5 chromosome 15, which is a T or C polymorphism.
2. The SNP locus combination according to claim 1, wherein the SNP locus screening method is as follows:
Screening and determining 55000 SNP loci of 12 chicken breeds by utilizing a chip, comparing each breed with other breeds, taking a set of loci with the largest difference, screening the genetic differentiation index Top5% among groups, the minimum allele frequency of >0.2 and the deletion rate of <0.1, determining 220 SNP loci, preferentially selecting Wu Mengfeng chicken reference genome loci, wherein the allele frequency is 0 or 1, determining the average value of different allele frequencies of each locus of other 11 breeds, comparing the average value with the different allele frequencies of each locus of Wu Mengfeng chicken, screening SNP loci with larger allele frequency difference, selecting loci with the allele frequency of close to 1 or close to 0 in other groups, finally determining 6 SNP loci for Wu Mengfeng chicken resource identification,
Wherein the 12 chicken species comprise black Meng Feng chicken, black Mongolian black-bone chicken, xingwu black-bone chicken, zhuxiang chicken, weining chicken, qian southeast chicken, low-foot chicken, high-foot chicken, jinhu black-bone chicken, silk feather black-bone chicken, hubert chicken and Lavender chicken.
3. The primer combination corresponding to the SNP site combination according to claim 1 or 2, wherein the nucleotide sequence of the primer of each SNP site is:
WMF1-F：5’GGCAGAAAGGAACAACCAGA3’
WMF1-R：5’GCAGGGACTGAGCTGTTAGG3’
WMF2-F：5’AGGCAGGTTGAAAGGGTTTT3’
WMF2-R：5’ATATCCCTGGGTGTGTGTGC 3’
WMF3-F：5’TGCTTCAAGGATCCCAAAAA 3’
WMF3-R：5’CAGGTCACAGCAAAGTGCAT 3’
WMF4-F：5’TGAAAGTGCAACCAGTCCAC 3’
WMF4-R：5’GCAGCTGCTTTATGTCACCA 3’
WMF5-F：5’ATACGTGGTGCCAGAAGAGG 3’
WMF5-R：5’TGTGGGAATTACTGCACTGG 3’
WMF6-F：5’CAACCAATGGTGGCTCTCTT3’
WMF6-R：5’TAGCTCCGTCGTCCAAGAAT3’。
4. The Wu Mengfeng chicken identification method is characterized by comprising the following steps:
(1) Extracting total DNA of a chicken genome to be detected;
(2) The SNP site combination according to claim 1 or 2, PCR amplification is performed respectively using the primer combination corresponding to claim 3;
(3) Sequencing the PCR amplification product and judging the genotype;
(4) If the genotype corresponding to the SNP locus combination does not accord with the genotype corresponding to the Wu Mengfeng chicken, judging that the individual does not belong to the Wu Mengfeng chicken; if the genotypes corresponding to the 6 SNP locus combinations all accord with the genotypes of Wu Mengfeng chickens, the individual is judged to belong to Wu Mengfeng chickens, and the genotypes of the 6 SNP loci WMF 1-WMF 6 are AA, GG, CC, GG, GG, TT in sequence.
5. The method according to claim 4, wherein the genomic DNA of the chicken to be tested in the step (1) is obtained by taking blood from the individual fin veins of the chicken species.
6. The method according to claim 4, wherein in the step (2), the PCR products of WMF1 to WMF6 have lengths of 221bp, 227bp, 215bp, 240bp, 232bp, and 202bp, respectively.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410287011.6A CN118028487A (en) | 2024-03-13 | 2024-03-13 | SNP locus combination for Wu Mengfeng chicken identification, primer combination and identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410287011.6A CN118028487A (en) | 2024-03-13 | 2024-03-13 | SNP locus combination for Wu Mengfeng chicken identification, primer combination and identification method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN118028487A true CN118028487A (en) | 2024-05-14 |
Family
ID=90991176
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410287011.6A Pending CN118028487A (en) | 2024-03-13 | 2024-03-13 | SNP locus combination for Wu Mengfeng chicken identification, primer combination and identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN118028487A (en) |
-
2024
- 2024-03-13 CN CN202410287011.6A patent/CN118028487A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111705140B (en) | SNPs molecular marker related to weight traits and application thereof in Hu sheep assisted breeding | |
| CN109988851B (en) | Specific primer and detection method for Tibetan mastiff molecular marker | |
| CN113322335B (en) | Application of a group of SNP sites in Beijing duck variety identification | |
| CN107557439B (en) | Method for detecting CNV (human embryonic kidney) marker of IGF1R gene of cattle in Jinnan and application of CNV marker | |
| CN101818195A (en) | Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application | |
| CN112210612A (en) | SSR molecular marker for distinguishing specific geographical population of procambarus clarkii and application of SSR molecular marker | |
| CN114317780B (en) | SNP molecular marker related to chicken prematurity and application | |
| CN115948387A (en) | SNP primer combination, method and application for identifying Wuhua Sanhuang chicken variety | |
| CN113322334B (en) | SNP primer combination for identifying variety of golden duck and identification method | |
| CN106755422B (en) | Detection method of MEG3 gene SNP related to cattle growth traits and application thereof | |
| CN118028487A (en) | SNP locus combination for Wu Mengfeng chicken identification, primer combination and identification method | |
| CN114350818A (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| CN109207611B (en) | SNP molecular marker related to sheep oestrus character and detection kit and application thereof | |
| CN116411091A (en) | SNP locus primer combination for Wu Mengfeng chicken resource identification and application thereof | |
| CN116287320B (en) | SNP locus primer combination for identifying silky fowl variety and application thereof | |
| CN113308558B (en) | Application of SNP locus combination in identifying Liancheng white duck variety | |
| CN113373246B (en) | SNP locus combination for identifying Shaoxing duck varieties and application thereof | |
| CN118207342A (en) | SNP locus combination, primer combination and method for identifying low-foot chicken variety | |
| CN116411090A (en) | SNP locus primer combination for identifying pettitoes and application thereof | |
| CN116987795B (en) | Molecular marker combination for identifying recessive white feather chicken and application thereof | |
| CN118166124A (en) | SNP locus combination, primer combination and method for identifying high-foot chicken variety | |
| CN113308559B (en) | SNP locus combination for identifying royal duck variety and identification method thereof | |
| CN113337622B (en) | Method for identifying Jianchang duck variety | |
| CN110144405B (en) | Chicken weight character gene diagnosis kit and application thereof | |
| CN116334251A (en) | SNP locus primer combination for identifying variety of Jinhu black-bone chicken and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |