CN118028364A

CN118028364A - Method for creating diploid seedless watermelons through gene editing ClCKI a1

Info

Publication number: CN118028364A
Application number: CN202410266951.7A
Authority: CN
Inventors: 袁黎; 陈鑫儿; 朱学杰; 田树娟; 刘曼; 王家发; 张显
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2024-03-08
Filing date: 2024-03-08
Publication date: 2024-05-14

Abstract

The invention discloses a method for creating diploid seedless watermelons through gene editing ClCKI <1 >, belonging to the technical field of plant genetic engineering breeding. The method for creating diploid seedless watermelons through gene editing ClCKI1 disclosed by the invention utilizes a CRISPR/Cas9 technology for the first time to carry out targeted editing on the watermelon ClCKI1 gene, so that the gene function is deleted, female gametes are sterile, self-pollinated fruits are normally expanded, double fertilization cannot form a zygote, seeds are aborted, and only a small amount of white shell seeds are produced, thereby creating the diploid seedless watermelons. Compared with wild type material, the diploid seedless watermelon edited plant created by the method of the invention has no obvious phenotype change except female gamete sterility, vegetative growth stage and male gamete. The method has the advantages of simplicity, easiness, high efficiency, low cost, short period and the like.

Description

Method for creating diploid seedless watermelons through gene editing ClCKI a1

Technical Field

The invention relates to the technical field of plant genetic engineering breeding, in particular to a method for creating diploid seedless watermelons through gene editing ClCKI.

Background

Watermelon (Citrullus lanatus) contains abundant sugar, organic acid, vitamins and minerals in mature fruits, has important nutritive and edible values, and is an important horticultural crop which is cultivated generally worldwide and has high economic value. Seedless watermelons are favored by consumers and producers because of their convenience in eating without seeds, high sweetness, rich nutritional quality, strong disease resistance and long shelf life. In recent years, the research of seedless watermelons is mainly focused on the hybridization of diploid watermelons and tetraploid watermelons to obtain triploid seedless watermelons, hormone seedless watermelons and few chromosomal translocation seeds. The traditional triploid seedless watermelons are obtained by hybridization of tetraploids and diploids, the female parent of the tetraploids is difficult to obtain in the breeding process, the triploid seeds are difficult to form, the seed quantity is less, the seed coats are thick, the germination rate of the seeds is low, and the seedling rate is low, so that the production cost of the seeds is high. The procedures of hormone seedless and chromosome translocation few-seed breeding are complicated, time-consuming and labor-consuming, low in fruit setting rate, and poor in fruit seedless and commercial properties (Zheng Xiaoying, etc., 2005). The breeding cycle is long and the breeding cost is high, so that the popularization and development of seedless watermelons are greatly limited. In recent years, the technical research of seedless watermelons on the molecular biology level is in an initial stage, and along with the application of genetic engineering in the breeding field, the reproductive development genes of watermelons can be modified, so that seeds cannot be normally formed due to double fertilization failure, and the creation of seedless watermelons on the diploid level is possible.

The life cycle of angiosperms is subjected to an alternating process from diploid sporophyte generation to haploid gametophyte generation, which is realized through gametophyte development, double fertilization to form a zygote and embryo development, and female gametophyte development has significance for plant sexual reproduction and crop yield. Cytokinin histidine protein kinase (CKI 1) is a constitutive activator of cytokinin signals, a key determinant of angiosperm central cells, a precursor of endosperm, and plays an important role in the development of female gametes. CKI1 is stably expressed from the FG1 (female gametophyte 1) stage of embryo sac development to the FG7 stage of mature embryo sac stage, and high expression is concentrated in the central cells of mature embryo sac stage, and low expression in egg cells and helper cells. Functional trait studies of CKI1 have not been reported in watermelons.

The CRISPR/Cas9 mediated plant genome editing technology can carry out fixed-point modification on excellent properties of crops, thereby realizing accurate breeding of the crops and improving breeding efficiency. Therefore, it is an urgent need for those skilled in the art to provide a method for creating diploid seedless watermelons by gene editing ClCKI.

Disclosure of Invention

In view of the above, the invention provides a method for creating diploid seedless watermelons by gene editing ClCKI a, which utilizes CRISPR/Cas9 to edit and create diploid horizontal seedless watermelons on watermelon histidine kinase protein ClCKI1 (Cla 97C02G 040700), shortens the breeding period of the seedless watermelons, reduces the breeding cost and accelerates the breeding process.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

A double-target knockout vector comprising a double target of gRNA1 and gRNA2, or gRNA3 and gRNA 4;

The sequences of the gRNA1, the gRNA2, the gRNA3 and the gRNA4 are as follows:

gRNA1：5’-AATTTTGCTAAACTTCTCA-3’；SEQ ID NO.3；

gRNA2：5’-CATTGGTCAGTAGCAACAC-3’；SEQ ID NO.4；

gRNA3：5’-TTCTTCGAACTCAAATCTA-3’；SEQ ID NO.5；

gRNA4：5’-TCCACCACGGGAATATAGT-3’；SEQ ID NO.6。

Further, the method for creating the diploid seedless watermelons through gene editing ClCKI1 comprises the following specific steps:

1) Designing target points gRNA1, gRNA2, gRNA3 and gRNA4 according to ClCKI CDS sequences;

2) Constructing ClCKI1 CRISPR/Cas9 double-target knockout vector; gRNA1 and gRNA2, gRNA3 and gRNA4 are combined with double targets respectively;

(1) Performing enzyme digestion on the CRISPR/Cas9 vector pBSE402,402 by using restriction enzyme BsaI-HF, and recovering the digested vector pBSE402,402;

(2) Performing PCR amplification by using intermediate vector pCBC-DT1T2 as a template and using primers Target1-1F/Target1-2R and Target1-3F/Target1-4R, and recovering Target fragment 1 and Target fragment 2 respectively;

(3) Carrying out homologous recombination on the vector pBSE402 subjected to enzyme digestion in the step (1) and the target fragment recovered in the step (2) respectively, and converting DH5 alpha competence;

(4) Shaking bacteria of the colonies obtained in the step (3) respectively, extracting recombinant plasmids, sequencing and comparing, and respectively converting the recombinant plasmids with correct sequencing into the competence of the agrobacterium EHA 105;

(5) Performing PCR detection on the colony obtained in the step (4), and performing watermelon genetic transformation after verifying correctness;

3) The genetic transformation of the watermelon is subjected to infection, co-culture, recovery culture, selective culture, bud elongation culture and rooting culture to obtain a transgenic plant;

4) And 3) carrying out gene editing detection on the transgenic plant obtained in the step 3), and transplanting the gene editing plant to a test field for seedless phenotype observation.

Further, the ClCKI CDS sequence is shown as SEQ ID NO. 2.

Further, the sequences of the primers Target1-1F/Target1-2R and Target1-3F/Target1-4R are as follows:

Target1-1F：

5’-TCGAAGTAGTGATTGTGAGAAGTTTAGCAAAATTGTTTTAGAGCTAGAAATAGC-3’；SEQ ID NO.7；

Target1-2R：

5’-TTCTAGCTCTAAAACGTGTTGCTACTGACCAATGCAATCTCTTAGTCGACTCTAC-3’；SEQ ID NO.8；

Target1-3F：

5’-TCGAAGTAGTGATTGTTCTTCGAACTCAAATCTAGTTTTAGAGCTAGAAATAGC-3’；SEQ ID NO.9；

Target1-4R：

5’-TTCTAGCTCTAAAACACTATATTCCCGTGGTGGACAATCTCTTAGTCGACTCTAC-3’；SEQ ID NO.10。

Further, the double-target knockout vector or the method is applied to seed-free watermelon breeding.

The genetic transformation of the watermelon is carried out by selecting wild variety YL.

The gene editing is achieved by a CRISPR/Cas9 system. Clcki1 mutant nutrient growth and male gamete are not affected, and female gamete is sterile. The gene editing method can shorten the breeding period of the seedless watermelons, save the breeding cost, accelerate the fine variety breeding process of the seedless watermelons and enrich the germplasm resources of the seedless watermelons.

The invention adopts CRISPR/Cas9 technology to tart out the watermelon ClCKI1 gene, thereby deleting the gene function, the mutant is represented by female gamete sterility, fertilization failure, seed abortion, only a small amount of white shell seeds are produced, and the seedless watermelon is realized at the diploid level. The diploid seedless watermelons created by CRISPR/Cas9 effectively shorten the breeding period of the seedless watermelons, and provide theoretical basis for researching the seedless watermelons on the molecular biology level.

Compared with the prior art, the invention discloses a method for creating diploid seedless watermelons by gene editing ClCKI, which uses CRISPR/Cas9 technology for the first time to carry out targeted editing on the watermelon ClCKI1 genes, so that the genes are in a missing function, female gametophytes are sterile, fertilization is failed, only a small amount of white shell seeds can be formed, and therefore, the diploid seedless watermelons are created. Compared with wild type material, the diploid seedless watermelon editing plant created by the method of the invention has no obvious phenotype change except female gamete sterility, male gamete and vegetative growth stage. The method has the advantages of simple operation, high efficiency, low cost, short period and the like. The diploid seedless watermelons are created through gene editing ClCKI < 1 >, the breeding period is shortened, the breeding cost is saved, the seedless watermelons breeding resources are enriched, and the method has important significance for accelerating fine seed breeding of the seedless watermelons.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments or the description of the prior art will be briefly described below, and it is obvious that the drawings in the following description are only embodiments of the present invention, and that other drawings can be obtained according to the provided drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram showing the structure of ClCKI gene of the present invention; the black boxes represent exons, the black straight lines represent introns, and the ClCKI gene target positions are marked by arrows;

FIG. 2 is a schematic diagram of the pBSE402 CRISPR/Cas9 vector recombination construction of the present invention;

wherein A: a dual target for gRNA1 and gRNA 2; b: a dual target for gRNA3 and gRNA 4; expression cassette pro35S: zCAS9, pro35S: GFP, pro35S: basta belongs to the original vector pBSE part 402;

FIG. 3 is a schematic representation of the Clcki1 CRISPR/Cas9 mutation types of the invention;

Wherein, WT is a wild-type 'YL' sequence, clcki is a 'YL' mutant sequence; the gRNA target sequence and the PAM sequence are respectively marked by underline and letter thickening; the mutant deleted bases are indicated by black dashed lines;

FIG. 4 is a drawing showing the phenotype observation of Clcki a seedless fruit in accordance with the present invention;

Wherein a: wild WT selfing mature fruit; b: clcki1-1 mutant mature fruit; c: cross-sectional view of wild WT selfed mature fruit; d: clcki 1A cross section of mature fruit of 1-1 mutant; e: the number of mature fruit seeds of wild WT selfing; f: clcki1 number of mature fruit seeds of 1-1 mutant.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1 ClCKI1 (Cla 97C02G 040700) Gene structural analysis and design of editing sites

Blast ClCKI1 genes in the cucurbitaceae website (http:// cucurbstgenomics. Org /) watermelon genome database, genes ID ClCKI: cla97C02G040700; and the gene sequence thereof is analyzed.

The sequence of the watermelon ClCKI gene is shown as SEQ ID NO.1, the sequence analysis is shown as figure 1, and the ClCKI gene has five exons. Designing targets on a CRISPR DIRECT website (http:// crispr. Dbcls. Jp /) according to ClCKI (Cla 97C02G 040700) CDS sequence SEQ ID NO.2 (YL), comprising 4 targets, clCKI1 targets, gRNA1, gRNA2, gRNA3, gRNA4; gRNA1 and gRNA3 target first exon, gRNA2 and gRNA4 target second exon.

Watermelon ClCKI gene sequence:

ATGTATGCGTCCACACCAAATTTCGCTAAACTTCTCACCCCATCTTTCAATGGAACTCAAATTTCATTCTTCGAACTCAAATCTAAGGTTAGCTACTATCTCGTCTATCTAAATCTAACTATGATACTAAAAGAGTATATAAAGTTAACATGTGATCATAGAGATTCAAACATTTCACCTTTTAGTTGATGTCTTAACTATTTAAGTCAGTTTAGGGTTTAGGGATTGAATTATGATTCCATGTGGTCTCCATTGTTAACTTTTATGATGAAGTGGCATGCTATTACGATGATGTGGCATGTTATTACGACAACATTATTTCATTTGTTATAACACAATATGAATAGATGACGAAAACAAATAAATAACTAGACAAAGTGAAGTGACACATAACATATCCTCTTTTGGAACCGTTACCTCAAATCTCTTTTATAAATTGTATCACTATATCCTATCGAACTATTTACTTATTTATGCCATTTGTCAACACATACCAAATTAACCAAAGTTTATAATTCACAACTTCGCTACCTACAACTATTAATGTTTCTAATGCATTTTTTTTTTTTTTTTTGATCTTTCAGATTGCTCCTATGTTATTTCAAGGATTTTCAATTATTCCATACCTGACTCAAATATCCTATATTGGGATGGATGGTCTCTTCTTCTCATACTACACTGACAAAAACCAAACTTTTGCAGTCTATGCTAACTCTACCTTCACTGCCAAATTGTATCCTCATCCACCACGGGAATATAGTTGGCTGACTCAATTGGTAAACTCTAACACAGGAGAATTATATGGGAATATGACTGAGACCCTCCCATTGGTCAGTAGCAACACGGGTTGGTTTCGAGAAGCCTTGAATAGTAACCAGGGATGTGCATCTATAGGCACAAAATGGAGCTCAGATCATGAATGTTTGTTCCTCAACACAGTTAGAGTTAATGGAAGTAACGGAGTTGTTTCCTTCGGATTTTCGATCAAAACATTTATCGATCTCGTCTTCACGAACATCGAACATCAAGGAGGGAGATTTTACATTACAACCACTGAAGGAGAAATTCTTGTCCCAGGGTTTCAGAACATTAAGATGGTCCTTGCCAATGGTTCAGCTTCATTTCAGTTTTTGAATCCAAATGGCAGTGAAATTGCTCGAATTGGGAACGTCTCGTGCCTGCCTAGGATAGAAGATTTTAATCCAAAGGATTCTTTCTTTAATCTTCTTGGTACAAACTATATGATATATTGCTCTCCACTTGAGATATTGGGTGTGCAGCTGGTAATTCATCATGCTCTAACAAGAACATATATCCTGAAACGTTGAGATCATATGAATCAGTTCATAGATAAGCAATGATTTTATATTTTTCTTGACTATGTTAGGTGCAAATGCATACAAACATTATTTTTAATGTCTCTTACCCCTGTTCTTATTTCAGGTGTATTCATTAGTATTGCCACAAAAAGAGTTAGCTAGCCATCTCTACAAGAGTAGCAGAGTGGGTCTAATTCTTCTTATACTAATAATGGCTACCACAGTTATCTCCATTTTTGGTTTTGTGTTCATAGTCATTAGAGCAACAAAAAGAGAAATACATTTATGTTCCAAACTCATTCAACAAATGGAAGCAACTCAACAGGCAGAGAGGAAGAGTATGAACAAGAGCGTTGCTTTCACTAGAGCAAGCCATGACATTCGTGCTTCTTTGGCAGGCATTATTGGTTTGATTGAGATATGCCACAATGAAGCTGCCCCAGGTTCAGAGTTAGACATAAGCCTAAAACAGATGGATGGTTGTACAAAGGATCTTGTAGGTAATTCACATTCAAAACTTGAATGCTCTCATCTCTCTCATTAATTGTCAAACATATAAAATTTTGGTTATAATCCATTTCAGGCATATTAAACTCTATTCTGGATACAAGCAAGATTGAGGCAGGGAAAATACAGCTCGAGGAAGAAGAGTTTCATTTGGGTCAACTTCTTGAGGATGTGGTAGATTTGTATCATCCAGTAGGTGTGAAGAAAGGAATTGACATAGTGTTAGATCCCTATGATGGCTCAATTATCAAGTTTTCACAAGTAAAGGGTGATAGGGGAAAGCTTAAACAAGTTTTGTGCAATTTACTGAGCAATGCTGTTAAATTCACTTCTGAAGGGCAAGTAACTGTTCGAGCGTGGGTCAAGGATTTACCTGCTATGCAGAACAATATGATTTCTTCGAATCACAATGGTGAAATATTGAAGCATTTATCATTCTTAATATGCAACACACACACGTACCAAGAACAACAAGCCATGGATAATGGAGTTAATTTGAATCCTGACTGTATGGAATTTACATTTGAGATAGATGACACAGGGAAGGGCATTCCTAAAGAGAAGCGTAAATTGGTTTTTGAGAACTATGTCCAAGTCAAAGAAACAGCTTTGGGACAAGGAGGAACTGGCTTGGGACTTGGCATTGTTCAATCTCTGGTATGTAACTTTACTTTTAAAGACAAACTGGTCCACTGTCTTTTATTTTATTTTTTTATTTTTTTTCCTTCTTCTTCTGACATATCTTGCTAAATTTGCAACCAAAAGTTCATGTTGAAGGTTATCTCATTTTTAGATAAAATAAATTTCAAGTGCATTTGTTTGTATTATTGAAGGTACGCTTGATGGGAGGAGATATAGCGATTTTAGACAAAGAGATTGGAGAAAAGGGAACATGTTTTAGGTTCACTGTTCTTCTTACTGTCTTAGAGGGCAACGTCAACTCCAGTGATGACACACGTCAATCATCGCCTACTTCAAGACTGACTTTTCGGGCCCCTAGTACAAGTCTCCATTCCCCTAGAGCAATCCGAACTACCAGTTCAAAAACTGAAACATCTCGTGTCATTCTCTTAATTCAAAATGATCAACGAAGAATTATATGCAAGAAATTCATGGAGAGTCTTGGTGTAAAAGTATTGGCAATGAAAGAATGGGAGCAACTGCTTGTCACTCTACGGAAAATATTGGAGAAACAGAGTCATTCTATGCACAACTCAAGAGGAAGGTCAGGTAATAGTTCACCAAGTGACCGCCTAAGCAAATCAACATCCGGTGACTCTGGCAATGGGCTGAACATGCATGTTTCTTTGGGTGCAATGAAAGACGAGACAAATTACTTTCTTTCTGTATTCAAAAAGAATAATCTCAGAGGTGGAAATAGCTTCACCTTGATCGTAATTGATGCTAGTGCGGGACCATTCAAGGAAATATGTAATATGGTAGCTAATTTTCGAAGGGGACTTCAAGGTGCCTATTGTAAGGTCGTTTGGCTACTGGAGAATCAAATGACACGCATTATCAACAACAAGGGGCTAGACTCGAACATTTTCAAGTCGAATGATGTTTTTATATCTAGACCTTTTCATGGTTCTCGTTTGTATGAAGTGATAAGACTGCTTCCAGAGTTTGGAGGCACATTAGAAACCGAAGAAAGTAGTAGATTATTTTGGAGTGGGAGGGTTTCTAAAGATCTAAGTTCATCACCGTACCAATACCATAGTAAGGCCAAGGAGGAGAATTCACCAATTCTTAGAGGCCAAATCAGAACGAGAATGCAAAAAGAAACAACATCAAGTAGTGGGCCCTCCCCAAGGAATTCGTCCATGAATCAAATTCATTCTTCTTCAGGATCAAAGTCTAGAAATTCACCCATTGTTGGGCAAAAAAGTCTACACCAAGAAATTAGAGAAGAGAAATCTAAAAACTTGAGTGGCGAAAAACCTCTAAGTGGCAAAAATGTCTTGGTTGCTGAGGACAATATAGTGTTGCAAAAACTAGCTAGATTGAACCTTGAAAGACTTGGTGCAACCATTGAGATATGTGAAAATGGAAAGGAAGCATTAGAGCTTGTTTGCAATGGCTTAGGCAATCAGTGGAAACATGGTGCTTCAAATGCTCTCCCTTACGATTACATTCTAATGGACTGTGAGGTAAGAAATTAATTACCTACTATCTTCTTTTTTTCCCAATAAGAATTACTATACCGAACATACATGTCTGCAATTGTTGCACCAAAACAAAAGAAAAAAAAAAACATTAAACCTGTTAAAACAATAATGTTAATGCAACTAATATCATTTTTGTTTCCTACTTTCACTTCAACATATATTCAATTGATTAAGTTTTTACCCTCCTGCAATAATTTATGTTAATAAGAATTTGGATGTGGTAGATGCCAATAATGGATGGATATGAAGCAACAAGACAGATAAGGAAGGTAGAAAGATATTACAACACCCACATTCCAATCATTGCACTAACAGCCCATACAACAGGAGAAGAAGCAGCAAAGACAATTGAAGCTGGAATGGATGTGCATTTAGGCAAGCCACTCAGAAAAGAGAAACTACTCGAAGTCATTACTTGTATCCATAGCAAATAA;SEQ ID NO.1.

ClCKI1 CDS sequence:

ATGTATGTGTCCACACCAAATTTTGCTAAACTTCTCACTCCATCTTTCAATGGAACTCAAATTTCATTCTTCGAACTCAAATCTAAGATTGCTCCTATGTTATTTCAAGGATTTTCAATTATTCCATACCTGACTCAAATATCCTATATTGGGATGGATGGTCTCTTCTTCTCATACTACACTGACAAAAACCAAACTTTTGCAGTCTATGCTAACTCTACCTTCACTGCCAAATTGTATCCTCATCCACCACGGGAATATAGTTGGCTGACTCAATTGGTAAACTCTAACACAGGAGAATTATATGGGAATATGACTGAGACCCTCCCATTGGTCAGTAGCAACACGGGTTGGTTTCGAGAAGCCTTGAATAGTAACCAGGGATGTGCATCTATAGGCACAAAATGGAGCTCAGATCATGAATGTTTGTTCCTCAACACAGTTAGAGTTAATGGAAGTAACGGAGTTGTTTCCTTCGGATTTTCGATCAAAACATTTATCGATCTCGTCTTCACGAACATTGAACATCAAGGAGGGAGATTTTACATTACAACCACTGAAGGAGAAATTCTTGTCCCAGGGTTTCAGAACATTAAGATGGTCCTTGCCAATGGTTCAGCTTCATTTCAGTTTTTGAATCCAAATGGCAGTGAAATTGCTCGAATTGGGAACGTCTCGTGCCTGCCTAGGATAGAAGATTTTAATCCAAAGGATTCTTTCTTTAATCTTCTTGGTACAAACTATATGATATATTGCTCTCCACTTGAGATATTGGGTGTGCAGCTGGTGTATTCATTAGTATTGCCACAAAAAGAGTTAGCTAGCCATCTCTACAAGAGTAGCAGAGTGGGTCTAATTCTTCTTATACTAATAATGGCTACCACAGTTATCTCCATTTTTGGTTTTGTGTTCATAGTCATTAGAGCAACAAAAAGAGAAATACATTTATGTTCCAAACTCATTCAACAAATGGAAGCAACTCAACAGGCAGAGAGGAAGAGTATGAACAAGAGCGTTGCTTTCACTAGAGCAAGCCATGACATTCGTGCTTCTTTGGCAGGCATTATTGGTTTGATTGAGATATGCCACAATGAAGCTGCCCCAGGTTCAGAGTTAGACATAAGCCTAAAACAGATGGATGGTTGTACAAAGGATCTTGTAGGCATATTAAACTCTATTCTGGATACAAGCAAGATTGAGGCAGGGAAAATACAGCTCGAGGAAGAAGAGTTTCATTTGGGTCAACTTCTTGAGGATGTGGTAGATTTGTATCATCCAGTAGGTGTGAAGAAAGGAATTGACATAGTGTTAGATCCCTATGATGGCTCAATTATCAAGTTTTCACAAGTAAAGGGTGATAGGGGAAAGCTTAAACAAGTTTTGTGCAATTTACTGAGCAATGCTGTTAAATTCACTTCTGAAGGGCAAGTAACTGTTCGAGCGTGGGTCAAGGATTTACCTGCTATGCAGAACAATATGATTTCTTCGAATCACAATGGTGAAATATTGAAGCATTTATCATTCTTAATATGCAACACACACACGTACCAAGAACAACAAGCCATGGATAATGGAGTTAATTTGAATCCTGACTGTATGGAATTTACATTTGAGATAGATGACACAGGGAAGGGCATTCCTAAAGAGAAGCGTAAATTGGTTTTTGAGAACTATGTTCAAGTCAAAGAAACAGCTTTGGGACAAGGAGGAACTGGCTTGGGACTTGGCATTGTTCAATCTCTGGTACGCTTGATGGGAGGAGATATAGCGATTTTAGACAAAGAGATTGGAGAAAAGGGAACATGTTTTAGGTTCACTGTTCTTCTTACTGTCTTAGAGGGCAACGTCAACTCCAGTGATGACACACGTCAATCATCGCCTACTTCAAGACTGACTTTTCGGGCCCCTAGTACAAGTCTCCATTCCCCTAGAGCAATCCGAACTACCAGCTCAAAAACTGAAACATCTCGTGTCATTCTCTTAATTCAAAATGATCAACGAAGAATTATATGCAAGAAATTCATGGAGAGTCTTGGTGTAAAAGTATTGGCAATGAAAGAATGGGAGCAACTCCTTGTCACTCTACGGAAAATATTGGAGAAACAGAGTCATTCTATGCACAACTCAAGAGGAAGGTCAGGTAATAGTTCACCAAGTGACTGCCTAAGCAAATCAACATCCGGTGACTCTGGCAATGGGCTGAACATGCATGTTTCTTTGGGTGCAATGAAAGACGAGACAAATTACTTTCTTTCTGTATTCAAAAAGAATAATCTCAGAGGTGGAAATAGCTTCACCTTGATCGTAATTGATGCTAGTGCGGGACCATTCAAGGAAATATGTAATATGGTAGCTAATTTTCGAAGGGGACTTCAAGGTGCCTATTGTAAGGTCGTTTGGCTACTGGAGAATCAAATGACACGCATTATCAACAACAAGGGGCTAGACTCGAACATTTTCAAGTCGAATGATGTTTTTATATCTAGACCTTTTCATGGTTCTCGTTTGTATGAAGTGATAAGACTGCTTCCAGAGTTTGGAGGCACATTAGAAACCGAAGAAAGTAGTAGATTATTTTGGAGTGGGAGGGTTTCTAAAGATCTAAGTTCATCACCGTACCAATACCATAGTAAGGCCAAGGAGGAGAATTCACCAATTCTTAGAGGCCAAATCAGAACGAGAATGCAAAAAGAAACAACATCAAGTAGTGGGCCCTCCCCAAGGAATTCGTCCATGAATCAAATTCATTCTTCTTCAGGATCAAAGTCTAGAAATTCACCCATTGTTGGGCAAAAAAGTCTACACCAAGAAATTAGAGAAGAGAAATCTAAAAACTTGAGTGGCGAAAAACCTCTAAGTGGCAAAAATGTCTTGGTTGCTGAGGACAATATAGTGTTGCAAAAACTAGCTAGATTGAACCTTGAAAGACTTGGTGCAACCATTGAGATATGTGAAAATGGAAAGGAAGCATTAGAGCTTGTTTGCAATGGCTTAGGCAATCAGTGGAAACATGGTGCTTCAAATGCTCTCCCTTACGATTACATTCTAATGGACTGTGAGATGCCAGTAATGGATGGATATGAAGCAACAAGACAGATAAGGAAGGTAGAAAGATATTACAACACCCACATTCCAATCATTGCACTAACAGCCCATACAACAGGAGAAGAAGCAGCAAAGACAATTGAAGCTGGAATGGATGTGCATTTAGGCAAGCCACTCAGAAAAGAGAAACTACTCGAAGTCATTACTTGTATCCATAGCAAATAA;SEQ ID NO.2.

ClCKI1 the target sequence is as follows:

gRNA1：5’-AATTTTGCTAAACTTCTCA-3’；SEQ ID NO.3；

gRNA2：5’-CATTGGTCAGTAGCAACAC-3’；SEQ ID NO.4；

gRNA3：5’-TTCTTCGAACTCAAATCTA-3’；SEQ ID NO.5；

gRNA4：5’-TCCACCACGGGAATATAGT-3’；SEQ ID NO.6。

Example 2 construction ClCKI1 CRISPR/Cas9 double-targeting knockout vector

Wherein ClCKI g of RNA1 and g of RNA2, g of RNA3 and g of RNA4 are combined with double targets respectively. The main expression elements of the recombinant plasmid are shown in figure 2.

The CRISPR/Cas9 vector pBSE402 was digested with restriction enzyme BsaI-HF (NEW ENGLAND biolab) and the digested vector pBSE was recovered. Enzyme cleavage System (30. Mu.L): 10x CutSmartbuffer 3 μL, pBSE402 (1-2 μg) 2 μL, bsaI-HF 1 μL, ddH ₂ O24 μL.

PCR amplification was performed using intermediate vector pCBC-DT1T2 as a template, target1-1F/Target1-2R (containing gRNA1 and gRNA2, respectively), and Target1-3F/Target1-4R (containing gRNA3 and gRNA4, respectively) as primers, using Vazyme P505 high-fidelity enzyme (PhantaMax Super-FIDELITY DNA Polymerase).

The Target1-1F/Target1-2R, target1-3F/Target1-4R primer sequences were as follows:

Target1-1F：

Target1-2R：

Target1-3F：

Target1-4R：

Amplification system (50 μl): 2x Phanta Max Buffer 25. Mu.L, dNTP Mix (10 mM) 1. Mu.L, 2. Mu.L each of the upstream and downstream primers (10. Mu.M), phanta Max Super-FIDELITY DNA Polymerase 1. Mu.L, 2. Mu.L of template DNA, and ddH ₂ O17. Mu.L. PCR reaction procedure: pre-denaturation at 95℃for 3min; denaturation at 95℃for 15s, annealing at 58℃for 15s, extension at 72℃for 30s,35 cycles; the extension was complete at 72℃for 5min. Agarose gel electrophoresis detection was performed to recover Target fragment 1 (using Target1-1F/Target1-2R as primers) and Target fragment 2 (using Target1-3F/Target1-4R as primers), respectively.

The vector after enzyme digestion is connected with the recovered target fragment 1 and target fragment 2 by utilizing Vazyme C and 112 ClonExpress II One Step Cloning Kit homologous recombination respectively. Ligation reaction system (10 μl): 1. Mu.L of linearization vector, 2. Mu.L of target fragment, 5x CE II Buffer 2. Mu.L, exnase II. Mu.L, ddH ₂ O4. Mu.L, and reaction at 37℃for 30min were performed to transform DH 5. Alpha. Competence, respectively, according to the Shanghai Weidi Biotechnology Co., ltd.

Colony PCR detection was performed using primers U626-IDF and U629-IDR, respectively, with the following sequences:

U626-IDF：5’-TGTCCCAGGATTAGAATGATTAGGC-3’；SEQ ID NO.11；

U629-IDR：5’-AGCCCTCTTCTTTCGATCCATCAAC-3’；SEQ ID NO.12。

Recombinant plasmids are extracted by shaking bacteria respectively, sequencing and comparison are carried out, and the recombinant plasmids with correct sequencing are respectively transformed into the competence of the agrobacterium EHA105, and the transformation method is carried out by referring to the description of the competence of the agrobacterium EHA105 of Shanghai Weidi biotechnology limited company.

PCR detection was performed on Agrobacterium with primers U626-IDF and U629-IDR, respectively, to verify correct colonies.

EXAMPLE 3 genetic transformation of watermelon

Sowing: soaking full seeds of watermelon material 'YL' in a water bath at 55deg.C for 30min, and removing seed coat. Placing into an ultra clean bench, sterilizing peeled kernel with 75% alcohol for 30s, soaking with 3% sodium hypochlorite for 15min, cleaning with sterile water for 5 times, air drying on sterile filter paper, spreading in seeding culture medium (BM, breeding medium; H ₂ O, agar 6.64 g/L), and culturing in dark at 28deg.C for 2d.

Dip dyeing: when the seeds germinate, cutting off the two ends of cotyledons, dividing the cross shape of the rest explants into 8 pieces and cutting for dip dyeing. Meanwhile, single colonies of EHA105 with correct PCR verification were picked into LB liquid medium containing 50mg/L kanamycin and 25mg/L rifampicin, and when the bacterial liquid concentration was shaken to OD ₆₀₀ =0.8, the bacterial liquid was resuspended in MS culture liquid (M519.43 g/L, sucrose 30g/L, 6-BA 1.5 mg/L) to a final concentration OD ₆₀₀ =0.2. Vacuum-infecting the cut cotyledon in a 20mL syringe containing a resuspension bacterial solution for 15min, taking out the explant, airing on sterile filter paper, spreading the explant on a co-culture medium (CM, co-culture medium; M519 4.43g/L, sucrose 30g/L, G3251 g/L and 6-BA 1.5 mg/L) filled with the filter paper, and performing co-culture in the dark at 28 ℃ for 3d; wherein M519 and G3251 are purchased from Phytotech, and 6-BA is purchased from Source leaf.

Recovery culture: after co-cultivation for 3d, cotyledon pieces were transferred to recovery medium (RM; M519.43 g/L, sucrose 30g/L, G3251, g/L, 6-BA 1.5mg/L, 200 mg/LTIMENTIN) and cultured at 28℃under an illumination intensity of 20000lux for a period of 16h/d for 7d.

Selection and culture: after completion of recovery culture, the explants were transferred to selection medium (SM, SELECTIVE MEDIUM; M519.43 g/L, sucrose 30g/L, agar 6.4.4 g/L, 6-BA 1.5mg/L, 1.4mg/L Basta and 200mg/L TIMENTIN) for selection culture, subcultured at 28℃for 3-4 weeks, and subcultured every 12 d.

Bud elongation culture: explants with distinct shoot spots carrying GFP tags were transferred to shoot elongation medium (SE, seedling elongation; M519.43 g/L, sucrose 30g/L, agar 6.4.4 g/L, 6-BA 0.5mg/L and 200mg/L TIMENTIN) for cultivation.

Rooting culture: the selected buds are transferred to MS culture medium containing 0.5mg/L IAA and 200mg/L TIMENTIN for rooting culture, and the culture is carried out at 28 ℃ until rooting.

Transplanting: taking out from the culture flask when the regenerated seedlings root and grow to 4-5 true leaves, flushing the culture medium with clear water to remove the roots, and transplanting to a substrate: vermiculite is 2:1, covering a preservative film, preserving heat and moisture, culturing for 3-4d, gradually uncovering the film, hardening off seedlings, and moving into the field for normal management.

Example 4 watermelon Clcki transgenic plant edit detection

The CTAB method extracts Clcki watermelon regenerated seedling (containing different target sites) DNA carrying GFP tag. Cutting tender leaves, placing the tender leaves in a 2ml centrifuge tube containing steel balls, precooling in liquid nitrogen, and rapidly vibrating and grinding into powder; adding 800 mu L of CTAB extraction buffer preheated at 65 ℃ and carrying out water bath at 65 ℃ for 30min, and turning over once every 10min; equal volume of 24:1 (chloroform: isoamyl alcohol) solution, mixing the solution upside down, and centrifuging the mixture at 8000r/min for 10min; transferring the supernatant into a 1.5ml centrifuge tube, adding isopropyl alcohol with equal volume, and slightly mixing upside down; centrifuging at 10000r/min for 10min, discarding supernatant, washing precipitate with 75% ethanol twice, removing residual liquid, drying, dissolving with 100 μl ddH2O (containing 0.1% RNase), and preserving at 4deg.C.

The DNA of the watermelon regeneration seedling with the GFP tag extracted Clcki is taken as a template, the primer CRISPR CLCKI1 detection primer F and the primer CRISPR CLCKI detection primer R are used for respectively carrying out PCR amplification on the sequences containing two target sites of ClCKI, and the negative control is non-transgenic plant DNA. Detection primer CRISPR CLCKI detection primer F was sent to the assay.

CRISPR CLCKI1 detection primer F and CRISPR CLCKI1 detection primer R sequences are as follows:

CRISPR CLCKI1 detection primer F:5'-TTCCCATGATCTCCTTATGAACAA-3'; SEQ ID NO.13;

CRISPR CLCKI1 detection primer R:5'-CAATGGAGACCACATGGAATCAT-3'; SEQ ID NO.14.

Amplification system (25 μl) and reaction procedure: 2x T5 SuperMIX 12.5. Mu.L of each of the upstream and downstream primers (10. Mu.M), 1. Mu.L of the template DNA, and 9.5. Mu.L of ddH ₂ O. PCR reaction procedure: pre-denaturation at 98℃for 3min; denaturation at 98℃for 10s, annealing at 58℃for 10s, extension at 72℃for 15s,35 cycles; the extension was complete at 72℃for 5min. Agarose gel electrophoresis detection.

The result of Clcki mutant target editing and comparison is shown in figure 3, wherein Clcki-1 lacks 2bp at the gRNA1 target, clcki1-2 lacks 2bp at the gRNA3 target, and Clcki1-3 lacks 22bp at the gRNA3 target.

Example 5Clcki phenotypic observation of transgenic plants. Wherein phenotypic observations are illustrated with Clcki1-1 as an example.

Edit plants Clcki-1, clClcki1-2 and Clcki-3 were planted in Cao Xinzhuang test fields from North-west agricultural and forestry university, and were normally managed to observe phenotypes.

Edit plants Clcki-1, clcki1-2 and Clcki-3 were grown nutritionally and male gametes developed normally, female gametes were sterile at reproductive stage.

As Clcki-1 female gametes are aborted, male gametes are normal, clcki-1 female flowers are selfed on the same day when being opened, fertilization is abnormal during self-pollination, fruits are normally enlarged, and a small amount of white shell seeds exist in the Clcki1-1 mature watermelon fruits as shown in figure 4.

In summary, the invention provides a method for creating diploid seedless watermelons by gene editing ClCKI1, which is characterized in that the watermelon ClCKI1 is targeted and knocked out, so that the gene function of the watermelon ClCKI is deleted, female gametes are sterile, self-pollinated fruits are normally expanded but cannot be fertilized normally to form synthons, and mature fruits show a seedless phenotype, so that the seedless watermelons are created at the diploid level, and the creation process of the diploid seedless watermelons is accelerated. The diploid seedless watermelons created by CRISPR/Cas9 effectively shorten the breeding period of the seedless watermelons, save the breeding cost, promote the fine seed breeding of the seedless watermelons and provide a theoretical basis for researching the seedless watermelons on the molecular biology level.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A double-target knockout vector, comprising a double target of gRNA1 and gRNA2, or gRNA3 and gRNA 4;

The sequences of the gRNA1, the gRNA2, the gRNA3 and the gRNA4 are as follows:

gRNA1：5’-AATTTTGCTAAACTTCTCA-3’；SEQ ID NO.3；

gRNA2：5’-CATTGGTCAGTAGCAACAC-3’；SEQ ID NO.4；

gRNA3：5’-TTCTTCGAACTCAAATCTA-3’；SEQ ID NO.5；

gRNA4：5’-TCCACCACGGGAATATAGT-3’；SEQ ID NO.6。

2. a method for creating diploid seedless watermelons by gene editing ClCKI1 is characterized by comprising the following specific steps:

1) Designing target gRNA1, gRNA2, gRNA3, gRNA4 in claim 1 according to ClCKI a CDS sequence;

3. The method for creating diploid seedless watermelons by gene editing ClCKI a according to claim 2, wherein the ClCKI a CDS sequence is shown in SEQ ID No. 2.

4. The method for creating diploid seedless watermelons by gene editing ClCKI1 according to claim 2, wherein the sequences of the primers Target1-1F/Target1-2R and Target1-3F/Target1-4R are as follows:

Target1-1F：

5’-TCGAAGTAGTGATTGTGAGAAGTTTAGCAAAATTGTTTTAGAGC TAGAAATAGC-3’；SEQ ID NO.7；

Target1-2R：

5’-TTCTAGCTCTAAAACGTGTTGCTACTGACCAATGCAATCTCTTAG TCGACTCTAC-3’；SEQ ID NO.8；

Target1-3F：

5’-TCGAAGTAGTGATTGTTCTTCGAACTCAAATCTAGTTTTAGAGCT AGAAATAGC-3’；SEQ ID NO.9；

Target1-4R：

5’-TTCTAGCTCTAAAACACTATATTCCCGTGGTGGACAATCTCTTAG TCGACTCTAC-3’；SEQ ID NO.10。

5. Use of the double-targeted knockout vector of claim 1 or the method of any one of claims 2-4 in seed-free watermelon breeding.