CN118019456A

CN118019456A - Feed additive composition and method of use thereof

Info

Publication number: CN118019456A
Application number: CN202280065027.1A
Authority: CN
Inventors: C·H·波尔森; J·彼得森; T·M·格鲁伯尔
Original assignee: International N&h Denmark Ltd
Current assignee: International N&h Denmark Ltd
Priority date: 2021-08-23
Filing date: 2022-08-22
Publication date: 2024-05-10

Abstract

Provided herein, inter alia, are methods of improving animal health (such as intestinal health) and performance and reducing methane emissions via administration of an effective amount of a glycoside hydrolase capable of removing at least one alpha-1, 2-L-fucose moiety from an intestinal mucin layer. Such methods improve animal health and performance without the need to administer potentially harmful antibiotics to livestock.

Description

Feed additive composition and method of use thereof

Cross Reference to Related Applications

The present application claims priority from U.S. provisional patent application Ser. No. 63/236,079, filed 8/23 of 2021, and U.S. provisional patent application Ser. No. 63/308,732, filed 2/2022, the disclosures of each of which are incorporated herein by reference in their entireties.

Technical Field

Provided herein, inter alia, are methods and compositions for promoting beneficial intestinal microbiota in livestock animals via glycan engineering.

Background

The diverse and dynamic microflora in the gastrointestinal tract of animals plays a key role in maintaining intestinal health and animal performance. Microbiota regulate nutrient utilization, development and maintenance of the immune system, and provide colonization resistance against pathogens.

Antibiotic resistance was listed by WHO as one of the ten major threats to global human health in 2019, especially in the context of mass farming and meat production. According to the united states food and drug administration, 80% of the antibiotics sold are used in livestock. In many countries, bans have been implemented on the use of antibiotics in livestock production, while in other countries consumer pressure is forcing the industry to stop using antibiotic growth promoters. Abrupt cessation of antibiotic growth-promoting agent use places tremendous stress on the animal industry. For example, a 2-fold increase in mortality was observed by pig breeders in latin america when switching to antibiotic-free production. It is estimated that global diarrhea in piglets caused by E.coli alone would cause 25 billion dollars/year loss to the industry.

Current feed additives such as acidulants, minerals, prebiotics, direct fed microorganisms (DFM, also known as probiotics), nucleotides and plant extracts (Liu et al, 2018,Animal Nutrition [ animal nutrition ], 4:113-125) that replace antibiotic growth promoters in livestock production all show much lower efficacy (less than 50%) than antibiotics (about 95%). Thus, there is a great unmet need for the search for antibiotic alternatives that can maintain livestock health and performance without the attendant negative effects associated with increased antibiotic resistance.

The subject matter disclosed herein addresses this need and provides additional benefits as well.

Disclosure of Invention

Accordingly, provided herein are methods of improving intestinal health in an animal comprising administering to the animal an effective amount of a glycoside hydrolase enzyme capable of removing at least one α -1, 2-L-fucose moiety from an intestinal mucin layer. In some embodiments, improving intestinal health comprises one or more of: a) Promoting the growth of one or more commensal enterobacteria; b) Reducing the growth of one or more methanogenic archaea; c) Increasing the amount of intestinal IgA, including but not limited to the amount of intestinal IgA bound to fecal microorganisms; d) An amount that reduces intestinal neutrophil levels; e) Increasing Average Daily Food Intake (ADFI) of the animal; f) Reducing the death number; and/or g) improving Feed Conversion Ratio (FCR). In some of any of the embodiments disclosed herein, the symbiotic bacteria include a Prevotella spp, a megasphaerella spp, a Clostridium spp, a Blautia spp, a ruminococcus spp, a vibrio spp, a Desulfovibrio spp, and/or a Barnesiella spp. In some of any of the embodiments disclosed herein, the methanogenic archaea comprises a methanoculleus species (Methanobrevibacter spp.) and/or methanogenic mosaic species (Methanomassiliicoccus spp.). In some embodiments, the methanogenic archaea comprises Brevibacterium smith (M.smithii). In some of any of the embodiments disclosed herein, the glycoside hydrolase is an alpha-L-fucosidase. In some embodiments, the α -L-1,2 fucosidase is selected from the group consisting of glycoside hydrolase family 95 (GH 95) and glycoside hydrolase family 29 (GH 29). In some of any of the embodiments disclosed herein, the method further comprises administering to the animal an effective amount of at least one direct fed microorganism. In some of any of the embodiments disclosed herein, the method further comprises administering to the animal an effective amount of one or more additional enzymes selected from the group consisting of: proteases, xylanases, beta-glucanases, phytases and amylases. In some of any of the embodiments disclosed herein, the α -L-1,2 fucosidase and/or additional enzyme is encapsulated. In some of any of the embodiments disclosed herein, the α -L-1,2 fucosidase and/or the direct fed microorganism and/or the additional enzyme are administered in an animal feed or premix. In some of any of the embodiments disclosed herein, the α -L-1,2 fucosidase and/or additional enzyme is in the form of particles. In some of any of the embodiments disclosed herein, the animal is a pig. In some of any of the embodiments disclosed herein, the pig is a piglet, a growing pig, or a sow. In some embodiments, the piglet is a weanling piglet. In some of any of the embodiments disclosed herein, the glycoside hydrolase capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer is not administered to treat or prevent an enteropathogenic infection and/or diarrhea. In some of any of the embodiments disclosed herein, the glycoside hydrolase capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer is administered for at least 3 weeks. In some of any of the embodiments disclosed herein, the intestinal IgA is conjugated to fecal microorganisms. In some of any of the embodiments disclosed herein, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

In another aspect, provided herein are methods of reducing methane emissions in an animal comprising administering to the animal an effective amount of a glycoside hydrolase enzyme capable of removing at least one α -1, 2-L-fucose moiety from an intestinal mucin layer. In some embodiments, the reduced methane emissions are due to a reduction in the growth of one or more methanogenic archaea in the intestinal tract of the animal. In some of any of the embodiments disclosed herein, the methanogenic archaea comprises a methanobrevibacterium species and/or a methanogenic mosaic species. In some of any of the embodiments disclosed herein, the methanogenic archaea comprises Brevibacterium smith. In some of any of the embodiments disclosed herein, the glycoside hydrolase is an alpha-L-fucosidase. In some embodiments, the α -L-1,2 fucosidase is selected from the group consisting of glycoside hydrolase family 95 (GH 95) and glycoside hydrolase family 29 (GH 29). In some of any of the embodiments disclosed herein, the α -L-1,2 fucosidase is encapsulated. In some of any of the embodiments disclosed herein, the α -L-1,2 fucosidase is in an animal feed or premix. In some of any of the embodiments disclosed herein, the α -L-1,2 fucosidase is in the form of particles. In some of any of the embodiments disclosed herein, the animal is a pig. In some of any of the embodiments disclosed herein, the pig is a piglet, a growing pig, or a sow. In some embodiments, the piglet is a weanling piglet. In some of any of the embodiments disclosed herein, the glycoside hydrolase capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer is administered for at least 3 weeks. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

Each of the aspects and embodiments described herein can be used together unless expressly or clearly excluded from the context of the embodiments or aspects.

Throughout this specification, various patents, patent applications, and other types of publications (e.g., journal articles, electronic database entries, etc.) are referenced. The disclosures of all patents, patent applications, and other publications cited herein are hereby incorporated by reference in their entirety for all purposes.

Drawings

FIG. 1 depicts a graph showing mean absolute neutrophil counts expressed in K/. Mu.L per treatment group and plotted in time on the x-axis: (day (-7), day 0, day 2, day 5, and day 14). Treatment group a (afucosidase) =circle, treatment group B (50 mg/kg fucosidase) =cross, treatment group C (100 mg/kg fucosidase) =diamond, treatment group D (200 mg/kg fucosidase) =x.

Fig. 2 depicts a series of graphs showing the average fluorescence intensity of IgA bound to fecal microorganisms measured by flow cytometry on day 0, day 5 and day 14, respectively, and grouped by treatment over each day. Fucosidase Concentration (FC) =0, 50, 100 or 200 mg enzyme/kg feed. Statistical analysis was determined using Welch's ANOVA followed by Dunnett (Dunnett) T3 post hoc test to determine pairwise significance between groups indicated by asterisks (< 0.05-0.01, <0.01-0.001, < 0.001).

FIG. 3 depicts a series of graphs showing the relative abundance of Vibrio inert desulfur (Desulfovibrio piger) (FIG. 3A) and Brevibacterium smith (Methanobrevibacter smithii) (FIG. 3B) measured by 16s Illumina sequencing in a stool sample at day 0. The data are grouped as treatment components, wherein treatment values are measured in milligrams of enzyme per kilogram of feed. In the case of P <0.0001, the group comparison was performed using Kruskal-walis (Kruskal-walis) with Dunn correction (Dunn's corrections). Fig. 3C depicts an xy scatter plot showing relative abundance values in D0 values between vibrio inert desulphurisation (D. Pipe) and brevibacillus smithii.

FIG. 4 depicts microbial abundance measured from amplicon sequencing of 16S rRNA from D0 fecal metagenomic extract. Prevotella species abundance data grouped by fucosidase treatment (mg/kg feed). The krusercal-vorax test of the treatment group effect was significant for fecal prasugrel bacteria (p.copri) (ρ=0.008), fecal prasugrel bacteria 96% (ρ=0.002), and scott prasugrel bacteria (p.stercorea) (ρ=0.008). In the case of P <0.001, an inter-group comparison was performed using dunne correction.

Figure 5 depicts a series of graphs showing whole blood count measurements obtained from individual animals on day 0, using one-way anova to analyze treatment group differences. The neutrophil percentage and lymphocyte percentage counts were plotted against the group and pair comparison, with significant differences p < (0.05-0.02) =, p < 0.01. Neutrophil/lymphocyte ratios (NLR) were calculated from absolute cell count values and plotted and analyzed as described in percent values.

FIG. 6 is a graph depicting total sIgA levels (ng/mL) in feces of fucosidase-treated piglets. From day 0 to day 21, fucosidase was added to the feed at 100 ppm. Fresh faeces were collected from piglets on day 42 and frozen until use. PBS was added and the supernatant was used for total sIgA measurement. Each group represents 24 individual samples. Tr1: blank control; tr2: fucosidase (WGW coated); tr3: fucosidase (Eudragit) coated; p <0.01.

Detailed Description

Prevotella is one of the most prominent microbial genera in the large intestine of pigs. A meta-analysis (Holman et al, 2017, host-Microbe Biology [ host microbiological Biology ] mSystems [ microbiological systems ] 2:e00004-17) comprising 20 studies showed that in fecal samples, prevotella, clostridium, prevotella (AlloPrevotella), ruminococcus and RC9 intestinal (RC 9 gun group) were found in 99% of all fecal samples. Furthermore, clostridium, b.brute, lactobacillus (LactoBacillus), prasuvorexa, ruminococcus, rochanteria (Roseburia), RC9 gut and rare micrococcus (Subdoligranulum) are common in 90% of all GI samples, indicating the presence of a so-called "core" microbiota in all commercial pigs. Furthermore, prevotella is also the most abundant genus of microorganisms among all the identified genera (Holman et al, 2017, host-Microbe Biology [ host microbiological Biology ] mSystems [ microbial systems ] 2:e00004-17).

In commercial pig production, pigs are typically fed a cereal-based diet with a relatively high carbohydrate content. Prevotella produces carbohydrases, such as glucanase, mannanase and xylanase (Holman et al, 2017, host-Microbe Biology [ host microbiology ] mSystems [ microbial systems ] 2:e00004-17). Clostridium, blautia and ruminococcus are members of the order clostridium (Clostridiales order) and, like prasuvorexa, are widely present in the mammalian intestine (Biddle et al, 2013, diversity [ diversity ] 5:627-640). These genera produce butyrate, a Short Chain Fatty Acid (SCFA), most commonly via the butyryl-CoA (CoA) acetate CoA transferase pathway from acetate, also an SCFA (Vital et al, 2014, mBio [ microorganism ] 5:e00889-14). Prevotella species produce acetic acid in the intestine, thereby providing an energy source for butyric acid producing bacteria (Looft et al, 2014,Front Microbiol [ microbiology preamble ]. 5:276). Importantly, butyric acid reduces inflammation in the host intestine, and cells in the intestinal epithelium can use it as an energy source (Hamer et al 2008,Aliment Pharmacol Ther [ nutraceutical pharmacology and therapeutics ]. 27:104-119).

The feed intake of pigs is related to certain taxa in microbiome. In one study on commercial duroque pigs (Duroc pig), animals carrying a prasugrel-dominant intestinal form (enterotype) have been shown to have significantly higher Average Daily Feed Intake (ADFI). Furthermore, prevotella has been shown to be the central bacterium in a co-abundance network, exhibiting a strong positive correlation with ADFI (Yang et al 2018,BMC Microbiol[BMC microbiology ].2018,18,215).

From this, it is speculated that Prevotella may promote the feed intake of pigs, and it has proved necessary to further investigate how to manipulate the Prevotella species to increase the feed intake and thereby promote the growth performance (Amat et al 2020, microorganisms, 8,1584). Fut-/-pigs (i.e., with inactive transglycosylation (transfucosylation) enzymes) have been shown to exhibit altered intestinal mucin glycosylation whereby mucin lacks α1,2 fucosylation (HESSELAGER, 2015, "THE IMPACT of alpha 1,2fucosyltransferase 1 (FUT 1) on pig gut health) [ effect of α1,2fucosyltransferase 1 (FUT 1) on pig intestinal health ]" PHD THESIS [ doctor paper ], aarhus University [ university of Ocimus ], aahlus, denmark [ Denmark OHus City ]). These Fut-/-pigs have significantly lower levels of enteroprasugrel spp and exhibit reduced growth compared to wild-type animals. This observation may lead to the genotype not being generally selected as a porcine reproductive program, although the Fut-/-genotype confers resistance to infection with enterotoxigenic escherichia coli (ESCHERICHIA COLI) (ETEC) F18.

The study discussed above supports a positive correlation between Prevotella and pig growth and also suggests that Prevotella relies on fucose derived from intestinal mucin as an energy source for growth in the intestine. As the piglets transition to solid feed, the abundance of microbial species changes from microbial species that adapt to milk oligosaccharides and host-derived glycans to microorganisms that are able to adapt to nutrients released from complex cereal-based diets. Maturation of adaptive immunity in piglets depends on signals received from the weaning process by microorganisms colonizing the intestines. Disruption of immune development due to inflammation or establishment of microbial communities that do not support normal immune development can lead to loss of acute mortality, permanent immune dysfunction, and loss of performance.

The succession of microbial compositions from the immature pre-weaning state to the mature state can take a wide variety of trajectories. Rapid achievement of mature microbial composition dominated by certain core microbial species and development of a robust adaptive immune system are interdependent processes, both occurring in windows of dysplasia.

Based on the criteria discussed above, prevotella is a more potent candidate for a next generation probiotic for promoting the development of mature gut microbiota in post-weaning livestock. Unfortunately, prevotella species are gram-negative strictly anaerobic bacteria that are very difficult to grow, especially when produced in commercial quantities. In fact, it is currently difficult to simply isolate Prevotella (Amat et al 2020, microorganisms, 8,1584), let alone deliver it as a feed ingredient to livestock in an aerobic environment.

Fortunately, the inventors of the present application surprisingly found that by constructing a succession of microorganisms in the challenging transition from pre-weaning to post-weaning, the enzymatic in situ modification of enteroglycans in livestock (e.g. pigs) can be an effective method to support adaptive immune system development and long-term performance. In particular, it was found that the amount of Prevotella species in the intestinal microbiota increases when feeding post-weaning piglets with fucosidase. The inventors have also observed that there is a positive correlation between fucosidase treatment, intestinal IgA levels, average daily growth, number of deaths, and other populations of potentially beneficial intestinal probiotics (e.g., megasphaerella species). Accordingly, the application disclosed herein provides a novel method of promoting the growth of desired beneficial enterobacteria (e.g., prevotella) in situ by selectively providing the bacteria with a food source (e.g., fucose) derived from animal self-intestinal mucins via the addition of a glycan hydrolase (e.g., fucosidase) to the feed. Furthermore, the inventors have observed a decrease in the abundance of methanogenic archaea in the intestine following administration of fucosidase. Thus, in addition to promoting benefits associated with immune development and performance of animals, the methods described herein may also result in reduced methane production by livestock, thereby reducing the overall environmental impact associated with large-scale animal production.

I. Definition of the definition

The term "glycoside hydrolase" is used interchangeably with "glycosidase" and "glycosyl hydrolase". Glycoside hydrolase contributes to hydrolysis of glycosidic bonds in complex sugars (polysaccharides). Together with glycosyltransferases, glycosidases form the primary catalytic mechanism for glycosidic bond synthesis and destruction. Glycoside hydrolases are classified as EC 3.2.1 as enzymes catalyzing the hydrolysis of glycosides. Glycoside hydrolases can also be classified according to the stereochemistry of the hydrolysis reaction: they can be classified as either a configuration maintenance enzyme (RETAINING ENZYME) or a configuration inversion enzyme (INVERTING ENZYME). Glycoside hydrolases can also be classified as exo-or endo-acting, depending on whether they act on the ends or the middle of the (usually non-reducing) oligo/polysaccharide chain, respectively. Glycoside hydrolases can also be classified by sequence or structure based methods. They are typically named after the substrate they act on.

The term "glycosyltransferase" refers to an enzyme that catalyzes the formation of glycosidic linkages between saccharides.

The terms "alpha-L-fucosidase", "alpha-L-fucosidase" and "alpha-fucosidase" are used interchangeably herein and refer to enzymes in EC category number 3.2.1.51 that remove L-fucose from alpha-L-fucoside. alpha-L-fucosidase is an exoglycosidase found in various organisms and mammals. alpha-L-fucosidases have been divided into two distinct glycoside hydrolase families: alpha-L-fucosidases that catalyze hydrolysis using retention mechanisms belong to the well known glycoside hydrolase family 29 (GH 29). alpha-L-fucosidases that catalyze hydrolysis using a turnover mechanism belong to glycoside hydrolase family 95 (GH 95).

The terms "α -1, 2-L-fucosidase", "amygdalin tyrosol-glucosidase II", "α -2-L-fucopyranosyl- β -D-galactoside fucosidase" and "α - (1- > 2) -L-fucosidase" are used interchangeably herein and refer to enzymes in EC category number 3.2.1.63 that catalyze the hydrolysis of a non-reducing terminal L-fucose residue that is linked to a D-galactose residue by a1, 2- α bond. The terms "alpha-1, 3-L-fucosidase", "almond tyrosol-glucosidase I" and "alpha-3-L-fucose-N-acetylglucosamine-glycoprotein fucose hydrolase" are used interchangeably herein and refer to enzymes in EC category number 3.2.1.111 that hydrolyze the (1- > 3) -bond between alpha-L-fucose and N-acetylglucosamine residues.

The terms "α -1, 6-L-fucosidase", "α -L-fucosidase" and "1, 6-L-fucose-N-acetyl-D-glucosaminyl peptide fucose hydrolase" are used interchangeably herein to refer to enzymes in EC class number 3.2.1.127 that hydrolyze the (1- > 6) -bond between α -L-fucose and N-acetyl-D-glucosamine residues.

The terms "defucosylation (defucosylate)" and "defucosylation (defucosylating)" are used interchangeably and refer to enzymes capable of removing fucosyl groups from glycan-containing structures.

The terms "glycan" and "polysaccharide" are used interchangeably herein.

By glycan is meant a polysaccharide or oligosaccharide, or the carbohydrate portion of a glycoconjugate, such as a glycoprotein, glycolipid or proteoglycan, even though the carbohydrate is only an oligosaccharide. The glycans can be homopolymers or heteropolymers of monosaccharide residues. They may be linear or branched molecules. It can be found that glycans attach to proteins as in glycoproteins and proteoglycans. Typically, they are found on the outer surface of the cell. O-and N-linked glycans are very common in eukaryotes, but can also be found in prokaryotes, although less common.

As used herein, the term "glycan-containing structure" refers to any structure to which glycans can be attached in any manner, e.g., proteins, lipids, etc.

The term "N-acetyl-galactosamine containing moiety" is the structure to which N-acetyl-galactosamine is attached. Such structures include, but are not limited to, carbohydrates and the like.

As used herein, "mucin" or "mucins" refers to a glycan-peptide of mucus secreted by epithelial cells that forms a mucosal barrier to protect various tissues, such as the eye, pancreas, intestine, exocrine glands, hepatobiliary ducts, respiratory tract, and genital tract. There are approximately 20 different types of mucins known in the art, such as MUC 1, MUC 2, MUC 5AC and MUC 5B, among others. Typically, mucins form extremely large oligomers by linking glycoprotein monomers using disulfide bonds. Generally, such glycoproteins are large, >100,000 daltons, and typically consist of about 75% carbohydrate and 25% protein. As used herein, mucin has at least one L-fucose moiety.

As used herein, "fucose" refers to fucose in a general sense, which is a deoxy sugar, 6-deoxy-galactose, having a chemical formula of C ₆H₁₂O₅, a molecular weight of 164.16, a melting point of 163 ℃, and a specific rotation of-76 °, and is classified into hexoses and monosaccharides. Form L is widely found in nature in the form of L-fucoside in animals (e.g., in intestinal mucins) and plants. Form O is also present in animals (e.g., pigs; see HESSELAGER et al, 2016, glycobiology, 26 (6): 607-622). In mammals and plants, fucose is found on the N-linked sugar chains on the cell surface.

As used herein, an "effective amount" or "therapeutically effective amount" is an amount that provides a nutritional, physiological, or medical benefit to an animal.

As used herein, "symbiotic" refers to a symbiotic relationship in which one species (e.g., an animal) benefits while another species (e.g., a microorganism, such as an intestinal microorganism) is unaffected, or in which an organism participates in a symbiotic relationship in which one species (e.g., an animal) benefits while another species is unaffected (e.g., a microorganism, such as an intestinal microorganism). A "symbiotic bacterium" is a microorganism (e.g., enterobacteria) that provides a benefit to a host (e.g., a monogastric animal). Non-limiting examples of symbiotic bacteria include Prevotella species, mesomyces species, and Barnus species.

As used herein, the term "methanogen" or "methanogenic archaea" refers to methanogenic organisms, including both methanogenic bacteria and archaea (previously classified as archaea). The methanogenic pathway of all methanogenic species has in common the conversion of methyl groups to methane; however, the sources of methyl groups vary. Most species are capable of reducing carbon dioxide (CO ₂) to methyl groups using molecular hydrogen (H ₂) or formic acid as a reducing agent. The methane (CH ₄) production pathway in methanogens that utilize CO ₂ and H ₂ involves a specific methanogenic enzyme that catalyzes a unique reaction using a unique coenzyme. In some embodiments, the methanogen is a methanobacterium sp.

As used herein, the term "animal" includes all non-ruminants (including humans) and ruminants. In particular embodiments, the animal is a non-ruminant animal, such as a horse and a monogastric animal. Examples of monogastric animals include, but are not limited to, pigs (pigs and swines), such as piglets, growing pigs, sows; poultry such as turkeys, ducks, chickens, broiler chickens, and lower layers; fish such as salmon, trout, tilapia, catfish and carp; and crustaceans such as shrimps and prawns. In further embodiments, the animal is a ruminant, including, but not limited to, cattle, calves, goats, sheep, giraffes, bison, elk, yaks, buffalo, deer, camels, alpacas, llamas, antelope horn, and deer horn.

As used herein, the term "weaning" refers to the removal of piglets (i.e., piglets) from lactating sows. By "weaned" pig is meant a piglet (i.e., a piglet) that is no longer in contact with the lactating sow. The term "new weaned" refers to piglets that have been recently (e.g., over 1,2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days or more) removed from a lactating sow.

As used herein, the term "pathogen" means the causative agent of any disease. Such pathogens may include, but are not limited to, bacteria, viruses, fungal pathogens, and the like.

"Feed" and "food" mean any natural or artificial diet, meal, etc., respectively, or component of such a meal, which is intended to or suitable for consumption, ingestion, digestion, respectively, by non-human animals and humans. As used herein, the term "food" is used in a broad sense and encompasses foods and food products for humans as well as foods (i.e., feeds) for non-human animals. The term "feed" is used in relation to a product that is fed to an animal when raised. The terms "feed" and "animal feed" are used interchangeably. In a preferred embodiment, the food or feed is for non-ruminant animals and ruminant animals.

As used herein, the term "feed conversion rate" refers to the amount of feed that is fed to an animal to increase the weight of the animal by a specified amount. Improved feed conversion means lower feed conversion. By "lower feed conversion rate" or "improved feed conversion rate" is meant that the amount of feed required to be fed to an animal to increase the weight of the animal by a specified amount is lower when using a feed additive composition, feed or diet comprising a fucosidase in the feed than when the feed does not comprise the feed additive composition, feed or diet comprising a fucosidase.

As used herein, the term "direct fed microorganism" ("DFM") is a source of viable (viable) naturally occurring microorganisms. The class of DFMs includes Bacillus, lactic acid bacteria and yeast. Bacillus is a unique, spore forming gram positive bacillus. These spores are very stable and can withstand environmental conditions such as heat, moisture and a range of pH. These spores germinate into active vegetative cells when ingested by animals and can be used in meal and pellet diets. Lactic acid bacteria are gram-positive cocci that produce lactic acid that antagonizes pathogens. Lactic acid bacteria are not used in pellet diets because they appear to be somewhat heat sensitive. The species of lactic acid bacteria include Bifidobacterium (bifidobacteria), lactobacillus and Streptococcus (Streptococcus). Yeast is not a bacterium. These microorganisms belong to the group of plant fungi.

The term "isolated" means a substance in a form or environment that does not exist in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance, including but not limited to, any host cell, enzyme, variant, nucleic acid, protein, peptide, or cofactor, that is at least partially removed from one or more or all of the naturally occurring components with which it is naturally associated; (3) Any material that has been artificially modified with respect to the material found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated.

The term "purified" as applied to a nucleic acid or polypeptide generally refers to a nucleic acid or polypeptide that is substantially free of other components, as determined by analytical techniques well known in the art (e.g., the purified polypeptide or polynucleotide forms discrete bands in an electrophoretic gel, chromatographic eluate, and/or medium subjected to density gradient centrifugation). For example, a nucleic acid or polypeptide that produces substantially one band in an electrophoresis gel is "purified". The purified nucleic acid or polypeptide is at least about 50% pure, typically at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, about 99.6%, about 99.7%, about 99.8% or more pure (e.g., on a molar weight percent basis). In a related sense, the molecules in the composition are enriched when there is a substantial increase in the concentration of the molecules after the application of the purification or enrichment technique.

The terms "peptide," "protein," and "polypeptide" are used interchangeably herein and refer to a polymer of amino acids joined together by peptide bonds. A "protein" or "polypeptide" comprises a polymeric sequence of amino acid residues. Single letter and 3 letter codes for amino acids conforming to the definition of the IUPAC-IUB joint biochemical nomenclature committee (Joint Commission on Biochemical Nomenclature) (JCBN) are used throughout this disclosure. The single letter X refers to any of the twenty amino acids. It will also be appreciated that due to the degeneracy of the genetic code, a polypeptide may be encoded by more than one nucleotide sequence.

As used herein, with respect to amino acid residue positions, "corresponding to (corresponding to or corresponds to)" or "corresponding" refers to amino acid residues at the recited positions in a protein or peptide, or amino acid residues that are similar, homologous, or identical to the recited residues in a protein or peptide. As used herein, "corresponding region" generally refers to a similar location in a related protein or reference protein.

The terms "derived from" and "obtained from" refer not only to proteins produced by or producible by the strain of the organism in question, but also to proteins encoded by DNA sequences isolated from such strains and produced in host organisms containing such DNA sequences. Furthermore, the term refers to proteins encoded by DNA sequences of synthetic and/or cDNA origin and having the identifying characteristics of the protein in question.

The term "amino acid" refers to the basic chemical structural unit of a protein or polypeptide. Thus, the codon for the amino acid alanine (hydrophobic amino acid) may be replaced with a codon encoding another less hydrophobic residue (e.g., glycine) or a more hydrophobic residue (e.g., valine, leucine or isoleucine). Similarly, changes that result in one negatively charged residue replacing another negatively charged residue (e.g., aspartic acid replacing glutamic acid) or one positively charged residue replacing another positively charged residue (e.g., lysine replacing arginine) can also be expected to produce a functionally equivalent product. In many cases, nucleotide changes that result in changes in the N-terminal and C-terminal portions of a protein molecule will also not be expected to alter the activity of the protein. Each of the proposed modifications is well within the routine skill in the art, such as determining the retention of biological activity of the encoded product.

The term "codon optimized" when it refers to a coding region of a gene or nucleic acid molecule for transformation of various hosts refers to altering codons in the coding region of the gene or nucleic acid molecule to reflect typical codon usage of the host organism without altering the polypeptide encoded by the DNA.

The term "gene" refers to a nucleic acid molecule that expresses a particular protein, including regulatory sequences preceding (5 'non-coding sequences) and following (3' non-coding sequences) the coding sequence. "native gene" refers to a gene found in nature that has its own regulatory sequences. "endogenous gene" refers to a native gene located in its natural location in the genome of an organism. "foreign" genes refer to genes that are not normally found in the host organism, but are introduced into the host organism by gene transfer. The foreign gene may comprise a native gene or a chimeric gene inserted into a non-native organism. A "transgene" is a gene that is introduced into the genome by a transformation procedure.

The term "coding sequence" refers to a nucleotide sequence that encodes a particular amino acid sequence. "suitable regulatory sequences" refer to nucleotide sequences that are located upstream (5 'non-coding sequences), internal or downstream (3' non-coding sequences) of a coding sequence and affect transcription, RNA processing or stability, or translation of the relevant coding sequence. Regulatory sequences may include promoters, translation leader sequences, RNA processing sites, effector binding sites and stem loop structures.

The term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid molecule such that the function of one nucleic acid fragment is affected by the other.

For example, a promoter is operably linked to a coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter) when it is capable of affecting the expression of the coding sequence. The coding sequence may be operably linked to the regulatory sequence in a sense or antisense orientation.

As used herein, the term "transformation" refers to the transfer or introduction of a nucleic acid molecule into a host organism. The nucleic acid molecule may be introduced as a linear or circular form of DNA. The nucleic acid molecule may be an autonomously replicating plasmid, or it may be integrated into the genome of the production host. The production host containing the transformed nucleic acid is referred to as a "transformed" or "recombinant" or "transgenic" organism or "transformant".

As used herein, the term "recombinant" refers to the artificial combination of two otherwise isolated nucleic acid sequence segments, e.g., by chemical synthesis or by manipulation of the isolated nucleic acid segments by genetic engineering techniques. For example, DNA in which one or more segments or genes have been inserted, either naturally or by laboratory procedures, from a different molecule, another part of the same molecule, or an artificial sequence, results in the introduction of a new sequence in the gene and subsequently in the organism. The terms "recombinant," "transgenic exothermic," "transformed," "engineered," or "modified for expression of a foreign gene" are used interchangeably herein.

The terms "recombinant construct", "expression construct", "recombinant expression construct" and "expression cassette" are used interchangeably herein. Recombinant constructs comprise artificial combinations of nucleic acid fragments, e.g., regulatory and coding sequences that are not found together in nature. For example, a construct may comprise regulatory sequences and coding sequences derived from different sources, or regulatory sequences and coding sequences derived from the same source but arranged in a manner different from that found in nature. Such constructs may be used alone or in combination with a vector. If a vector is used, the choice of vector will depend on the method to be used to transform the host cell as is well known to those skilled in the art. For example, a plasmid vector may be used. The skilled artisan will appreciate that genetic elements must be present on the host cell vector in order to successfully transform, select and propagate. The skilled artisan will also recognize that different independent transformation events may result in different expression levels and patterns (Jones et al, (1985) EMBO J [ European society of molecular biology ]4:2411-2418; de Almeida et al, (1989) Mol GEN GENETICS [ molecular and general genetics ] 218:78-86), and thus multiple events are typically screened to obtain lines exhibiting the desired expression levels and patterns. Such screening may be standard molecular biological assays, biochemical assays, and other assays completed, including southern blot analysis, northern analysis of mRNA expression, PCR, real-time quantitative PCR (qPCR), reverse transcription PCR (RT-PCR), immunoblot analysis of protein expression, enzyme or activity assays, and/or phenotypic analysis.

The terms "production host", "host" and "host cell" are used interchangeably herein and refer to any organism or cell thereof, whether human or non-human, in which recombinant constructs can be stably or transiently introduced to express a gene. The term encompasses any progeny of a parent cell that is different from the parent cell due to mutations that occur during propagation.

The term "percent identity" is the relationship between two or more polypeptide sequences or two or more polynucleotide sequences as determined by comparing sequences. In the art, "identity" also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the number of matched nucleotides or amino acids between such sequence strings. "identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in the following documents: computational Molecular Biology [ computer molecular biology ] (Lesk, a.m. edit) Oxford University Press [ oxford university press ], new york (1988); biocomputing: informatics and Genome Projects [ biological calculation: informatics and genome project ] (Smith, d.w. edit), ACADEMIC PRESS [ academic press ], new york (1993); computer Analysis of Sequence Data, part I [ computer analysis of sequence data, part I ] (Griffin, A.M. and Griffin, H.G. editions) Humana Press [ Hu Mana Press ], new Jersey (1994); sequence ANALYSIS IN Molecular Biology [ Sequence analysis of molecular biology ] (von Heinje, g. Edit), ACADEMIC PRESS [ academic press ] (1987); sequence ANALYSIS PRIMER [ Sequence analysis primer ] (Gribskov, M. And Devereux, J. Edit) Stockton Press [ Stoketon Press ], new York (1991). Methods of determining identity and similarity are programmed into publicly available computer programs.

As used herein, "% identity" or "percent identity" or "PID" refers to protein sequence identity. The percent identity may be determined using standard techniques known in the art. Useful algorithms include the BLAST algorithm (see Altschul et al, J Mol Biol [ journal of molecular biology ],215:403-410,1990; and Karlin and Altschul, proc NATL ACAD SCI USA [ Proc Natl Acad. Sci. USA ],90:5873-5787,1993). The BLAST program uses several search parameters, most of which are set to default values. The NCBI BLAST algorithm finds the most relevant sequences in terms of biological similarity, but is not recommended for query sequences of less than 20 residues (Altschul et al, nucleic Acids Res [ nucleic acids research ],25:3389-3402,1997; and Schaffer et al, nucleic Acids Res [ nucleic acids research ]29:2994-3005,2001). Exemplary default BLAST parameters for nucleic acid sequence searches include: adjacent word threshold = 11; e value cutoff = 10; scoring matrix = nuc.3.1 (match = 1, mismatch = -3); vacancy open = 5; and vacancy extension = 2. Exemplary default BLAST parameters for amino acid sequence searches include: word length = 3; e value cutoff = 10; score matrix = BLOSUM62; vacancy open = 11; and vacancy extension = 1. The percent (%) amino acid sequence identity value is determined by dividing the number of matching identical residues by the total number of residues of the "reference" sequence (including any gaps created by the program for optimal/maximum alignment). The BLAST algorithm refers to the "reference" sequence as a "query" sequence.

As used herein, "homologous protein" or "homologous enzyme" refers to proteins having different similarities in primary, secondary and/or tertiary structure. When proteins are aligned, protein homology may refer to the similarity of linear amino acid sequences. Homology searches for protein sequences can be performed using BLASTP and PSI-BLAST from NCBI BLAST using a threshold value of 0.001 (E value cutoff). (Altschul et al Nucleic Acids Res [ nucleic acids research ]1997 group 1; 25 (17): 3389-402). Using this information, the protein sequences can be grouped. Amino acid sequences can be used to construct phylogenetic trees. Sequence alignment and percent identity calculations can be performed using the Megalign program of the LASERGENE bioinformatics calculation package (DNASTAR company (DNASTAR inc.), madison, wi), the AlignX program of Vector NTI v.7.0 (Informax company (inc.), besselda, maryland) or the EMBOSS open software package (EMBL-EBI; rice et al, TRENDS IN GENETICS [ genetics trend ]16, (6): 276-277 (2000)). Multiple alignments of sequences can be performed using CLUSTAL alignment methods (e.g., CLUSTALW; e.g., version 1.83) (Higgins and Sharp, CA BIOS [ computer applications in biosciences ],5:151-153 (1989); higgins et al, nucleic Acids Res [ nucleic acids Ind. 22:4673-4680 (1994); and Chenna et al, nucleic Acids Res [ nucleic acids Ind. 31 (13): 3497-500 (2003)), available from European molecular biology laboratories by European bioinformatics institute). Suitable parameters for CLUSTALW protein alignment include gap existence penalty = 15, gap extension = 0.2, matrix = Gonnet (e.g., gonnet 250), protein ENDGAP = -1, protein GAPDIST = 4, and KTUPLE = 1. In one embodiment, the fast or slow speed comparison uses a default setting in the case of a slow speed comparison. Alternatively, parameters using the CLUSTALW method (e.g., version 1.83) may be modified to also use KTUPLE =1, gap penalty=10, gap extension=1, matrix=blosum (e.g., BLOSUM 64), window=5, and stored top diagonal=5.

Certain ranges are presented herein with the numerical prefix term "about. The term "about" is used herein to provide literal support for the exact number following it and numbers near or approximating the number following the term. In determining whether a number is close or approximate to a particular recited number, the close or approximate non-recited number may be a number that provides a substantial equivalent of the particular recited number in the context in which it is presented. For example, with respect to a numerical value, the term "about" refers to a range of-10% to +10% of the numerical value, unless the term is specifically defined in the context.

As used herein, the singular terms "a" and "an" and "the" include plural referents unless the context clearly dictates otherwise.

It should be further noted that the claims may be drafted to exclude any optional element. Accordingly, this statement is intended to serve as antecedent basis for use of exclusive terminology such as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.

It is still noted that as used herein, the term "consisting essentially of … … (consisting essentially of)" refers to a composition in which one or more components following the term, in the presence of other known one or more components, are less than 30% by weight of the total composition and do not affect or interfere with the action or activity of the one or more components.

It is further noted that the term "comprising" as used herein is meant to include, but is not limited to, one or more components following the term "comprising". One or more components after the term "comprising" is necessary or mandatory, but the composition that comprises the one or more components may further include other optional or optional one or more components.

It is also noted that as used herein, the term "consisting of … …" is meant to include and be limited to one or more components following the term "consisting of … …". Thus, one or more components following the term "consisting of … …" are necessary or mandatory, and one or more other components are not present in the composition.

Every maximum numerical limitation given throughout this specification is intended to include every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.

Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

Other definitions of terms may appear throughout this specification.

II composition

A. Glycoside hydrolase

Within the scope of the present disclosure are compositions for improving intestinal health of an animal comprising administering to the animal an effective amount of a glycoside hydrolase enzyme capable of removing at least one alpha-1, 2-L-fucose moiety from an intestinal mucin layer. In all aspects, improved intestinal health includes, but is not limited to, one or more of the following: promoting the growth of one or more commensal enterobacteria; reducing the growth of one or more methanogenic archaea; increasing the amount of intestinal IgA, including but not limited to the amount of intestinal IgA bound to fecal microorganisms; an amount that reduces intestinal neutrophil levels; increasing the feed intake of animals; and/or reducing Feed Conversion Rate (FCR).

In all aspects disclosed herein, the α -L-fucosidase is capable of removing terminal α -1, 2-linked fucose groups from glycan-containing structures, alone or in combination with enzymes capable of removing N-acetylgalactosamine-containing moieties from glycan-containing structures. This is further discussed in the examples below.

Without being bound by theory, it is believed that the hydrolysis of terminal alpha-1, 2-linked fucose from the intestinal mucin promotes the growth of one or more commensal bacteria (e.g., prevotella) in the intestine. Any enzyme capable of removing at least one fucosyl moiety from an intestinal mucin, such as glycoside hydrolase, may be used. In one embodiment, an alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) polypeptide may be used. Glycoside hydrolases of the present disclosure, e.g., alpha-L-fucosidase polypeptides, include isolated, recombinant, substantially pure, or non-naturally occurring polypeptides.

In some embodiments, the alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) polypeptide is from glycoside hydrolase family 95 (GH 95) or glycoside hydrolase family 29 (G29). Most preferably, such a-L-fucosidase polypeptide belongs to the GH95 family.

It may be desirable to engineer the alpha-L-fucosidase so that it is stable at low pH and also stable to pepsin. Suitable alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) may be derived from a variety of sources, such as from Bacillus (Arcanobacterium), bacillus, bacteroides (bacteriodes), corynebacterium (Corynebacterium), streptococcus, pelargonium (Dictyostelium), fusarium (Fusarium), aspergillus (Aspergillus), bifidobacterium, synechococcus (IGNISPHAERA), mahella, cellulars (Cellulophaga), rubinisphaera, niastella, toxobacter (Haliscomenobacter), pyricularia (Rhodopirellula), mycobacterium (Mycotacterium), clostridium, flavobacterium (Flavobacteriaceae), cellularum (Ktedonobacter), listeria (Paludibacter), salmonella (Prunus), propionibacterium (Propionibacterium), rumex, thermomyces (Thermomyces), flavomyces (Listeria), and Lactobacillus. Examples of species from which alpha-L-fucosidase can be derived include: bacillus, bacillus cereus, bacillus thuringiensis, bacillus species TS-2, bacillus badavictima, bacillus nicotinic acid, bacillus J13, bacillus J37, bacillus halodurans, bacillus alcalophilus, bacillus megaterium, bacillus amyloliquefaciens, bacillus hemitruck, bacillus pseudoalcalophilus, bacillus autumn, bacillus fulgidus, bacteroides fragilis, bacteroides ulcerans, streptococcus mitis, streptococcus pneumoniae, streptococcus pennisetum, bacillus flavus () S85, fusarium graminearum, aspergillus niger, bifidobacterium bifidum, bifidobacterium longum, mycobacterium tuberculosis, clostridium perfringens, listeria, bacillus pumilus, sweet almond, propisochromus, acne vulgaris, ruminococcus (Ruminococcus torques), thermotoga maritima (Thermotoga maritima), lactobacillus paracasei (Lactobacillus paracasei), lactobacillus casei (Lactobacillus casei).

In still other embodiments, any alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) can be used to practice the methods and compositions disclosed herein. For example, a polypeptide having fucosidase activity may be derived from: bacillus subtilis, bacillus cereus, bacillus thuringiensis, bacillus species TS-2, bacillus badaveii, bacillus nicotinic acid, bacillus species J13, bacillus species J37, bacillus lehensis, salt tolerant bacillus, bacillus alcalophilus, bacillus megaterium, bacillus amyloliquefaciens, bacillus hemiliquefaciens, bacillus okuhidensis, bacillus butanolivorans, bacillus pseudoalcalophilus, bacillus bogoriensis, bacillus autumn, bacillus fulgidus, bacteroides fragilis, bacteroides ulcerous, streptococcus mitis B6, bicoccus pneumoniae, flavobacterium genus S85, fusarium graminearum, aspergillus niger, bifidobacterium bifidum, bifidobacterium longum 、Ignispheaera aggregans、Mahella australiensis、Cellulophaga lytica、Cellulophaga algicola、Rubinisphaera brasinliensis、Niastella koreensis、 soft hair, mycobacterium tuberculosis, clostridium perfringens, ktedonobacter racemifer, listeria monocytogenes, paludibacter propionicigenes, semen Armeniacae amarum, propionibacterium acnes, active ruminococcus, rumex, hai, lactobacillus paracasei, lactobacillus casei and cassava, fusarium wilt (Xanthomonas manihotis), or with a bacterial strain derived from Bacillus lysosteganensis, bacillus cereus, bacillus thuringiensis, bacillus species TS-2, bacillus badaviensis, bacillus nicotinic acid, bacillus species J13, bacillus species J37, bacillus lehensis, bacillus halodurans, bacillus alcalophilus, bacillus megaterium, bacillus amyloliquefaciens, bacillus hemisolensis, bacillus okuhidensis, bacillus butanolivorans, bacillus pseudoalcalophilus, bacillus bogoriensis, bacillus autumn, bacillus fulgidus, bacteroides fragilis, bacteroides ulcerous, streptococcus mitis B6, diplococcus pneumoniae, pediococcus dish, flavobacterium S85, fusarium graminearum, aspergillus niger, bifidobacterium bifidum, bifidobacterium 、Ignispheaera aggregans、Mahella australiensis、Cellulophaga lytica、Cellulophaga algicola、Rubinisphaera brasinliensis、Niastella koreensis、 soft-hair bacteria, mycobacterium tuberculosis, clostridium perfringens, ktedonobacter racemifer, listeria monocytogenes, paludibacter propionicigenes, sweet almond, propionibacterium acnes, ruminococcus livens, ruminococcus twisted, thermotoga maritima, lactobacillus paracasei, lactobacillus casei and Xanthomonas (Xanthomonas) have a fucosidase sequence having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 95%, 98%, 99% identity, or a polypeptide differing from any of the above mentioned sequences by one or several amino acid additions, deletions and/or substitutions; or a polynucleotide expressing any of the above fucosidase sequences.

In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60％、61％、62％、63％、64％、65％、66％、67％、68％、69％、70％、71％、72％、73％、74％、75％、76％、77％、78％、79％、80％、81％、82％、83％、84％、85％、86％、87％、88％、89％、90％、91％、92％、93％、94％、95％、96％、97％、98％、99％ or 100% identical (i.e., shared sequence identity percentages), including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

As described herein, homology between two amino acid sequences can be determined by amino acid sequence alignment, for example, using programs such as BLAST, ALIGN, or CLUSTAL. In some embodiments, the polypeptide is an isolated, recombinant, substantially pure, or non-naturally occurring enzyme capable of removing at least one fucosyl moiety.

Preferably, the enzyme has alpha-L-fucosidase activity, or catalyzes the cleavage of terminal alpha-1, 2-linked fucose groups from a polysaccharide (e.g., alpha-L-fucoside).

It will be apparent to those skilled in the art that full length and/or mature alpha-L-fucosidase can be prepared using any of the techniques well known in the art.

B. Nucleic acids and vectors

In another aspect, any isolated, recombinant, substantially pure, synthetically derived, or non-naturally occurring nucleic acid comprising a nucleotide sequence encoding any polypeptide (including any fusion protein, etc.) is capable of removing at least one fucosyl moiety from at least an intestinal mucin.

Also of interest are vectors comprising polynucleotides encoding glucose hydrolases (e.g., alpha-L-fucosidase (e.g., alpha-L-1, 2-fucosidase) that hydrolyzes L-fucose moieties from alpha-1, 2-L-fucoside). It will be apparent to the skilled person that the vector may be any suitable expression vector and that the choice of vector may vary depending on the type of cell into which the vector is to be inserted. Suitable vectors include pGAPT-PG, pRAX1, pGAMD, pGPT-pyrG1, pC194, pJH101, pE194 and pHP13 (see Harwood and Cutting [ eds. ], chapter 3, molecular Biological Methods for Bacillus [ methods of molecular biology against Bacillus ], john Wiley & Sons [ John Wili father company ] [1990 ]). See also, perego, integrational Vectors for Genetic Manipulations in Bacillus subtilis [ integration vectors for genetic manipulation in Bacillus subtilis ], sonenshein et al [ eds. ] Bacillus subtilis and Other Gram-Positive Bacteria:biochemistry, physiology and Molecular Genetics [ Bacillus subtilis and other gram positive bacteria: biochemistry, physiology and molecular genetics ], american Society for Microbiology [ American society of microbiology ], washington (1993), pages 615-624), and p2JM103BBI.

The expression vector may be one of any number of vectors or cassettes for transformation of a suitable production host known in the art. Typically, the vector or cassette will include sequences that direct transcription and translation of the relevant gene, selectable markers, and sequences that allow autonomous replication or chromosomal integration. Suitable vectors typically include a5 'region containing a gene for transcription initiation control and a 3' region of a DNA fragment for transcription termination control. Both control regions may be derived from genes homologous to genes of the transformed production host cell and/or genes native to the production host, although such control regions need not be so derived.

The DNA fragments that control transcription termination may also be derived from various genes that are native to the preferred production host cell. In certain embodiments, the inclusion of a termination control region is optional. In certain embodiments, the expression vector includes a termination control region derived from a preferred host cell.

The expression vector may be comprised in a production host, in particular in a cell of a microbial production host. The production host cell may be a microbial host found in a fungal or bacterial family and which grows at a wide range of temperatures, pH values and solvent tolerance. For example, it is contemplated that any of bacteria, algae, and fungi (e.g., filamentous fungi and yeast) may suitably house the expression vector.

The inclusion of an expression vector in a production host cell may be used to express the protein of interest such that it may be present intracellularly, extracellularly, or in a combination of intracellular and extracellular. Extracellular expression makes it easier to recover the desired protein from the fermentation product, compared to methods used to recover the protein produced by intracellular expression.

The recombinant expression vector may be any vector, such as a plasmid or virus, which can be conveniently subjected to recombinant DNA procedures and results in expression of the nucleotide sequence. The choice of vector typically depends on the compatibility of the vector with the production host into which the vector is to be introduced. The vector may be a linear or closed loop plasmid. The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for ensuring self-replication.

Alternatively, the vector may be one that, when introduced into a production host, integrates into the genome and replicates with the chromosome into which it has been integrated. Some non-limiting examples of such vectors are provided in Fungal Genetics Stock Center Catalogue of Strains [ the fungal genetics inventory center strain catalog ] (FGSC, < www.fgsc.net), additional examples of suitable expression and/or integration vectors are provided in Sambrook et al, (1989) supra, ausubel (1987) supra, van den Hondel et al (1991) Bennett and Lasure (eds.) MORE GENE MANIPULATIONS IN FUNGI [ more genetic manipulation in fungi ], ACADEMIC PRESS [ academic Press ],396-428 and U.S. Pat. No. 5,874,276.

Particularly useful vectors include pTREX, pFB6, pBR322, PUCI8, pUCIO0 and pENTR/D. Suitable plasmids for bacterial cells include pBR322 and pUC19, which allow replication in E.coli, and pE194, which allows replication in Bacillus, for example. Briefly, for production in a production host cell, reference may be made to Sambrook et al, (1989) supra, ausubel (1987) supra, van den Hondel et al, (1991) Bennett and Lasure (eds.) MORE GENE MANIPULATIONS IN FUNGI [ more genetic manipulation in fungi ], ACADEMIC PRESS [ academic Press ] (1991), pages 76 and 396-428; nunberg et al, (1984) mol. Cell Biol [ molecular and cell biology ]4:2306-2315; boel et al, (1984) 30EMBO [ journal of European molecular biology ] 1:1581-1585; finkelstein in BIOTECHNOLOGY OF FILAMENTOUS FUNGI [ biotechnology of filamentous fungi ], by Finkelstein et al, butterworth-Heinemann [ Butterworth-Zerniman ], boston, massachusetts (1992), chapter 6; kinghorn et al (1992), APPLIED MOLECULAR GENETICS OF FILAMENTOUS FUNGI [ applied molecular genetics of filamentous fungi ], blackie ACADEMIC AND Professional [ British academy and specialty ], CHAPMAN AND HALL [ Chapman and Hall Press ], london; kelley et al, (1985) EMBO [ journal of European molecular biology ] 1:475-479; penttila et al, (1987) Gene [ Gene ]61:155-164; U.S. patent No. 5,874,276.

A list of suitable vectors can be found in Fungal Genetics Stock Center Catalogue of Strains [ fungal genetics inventory center strain catalog ] (FGSC, www at FGSC. Net). Suitable vectors include those obtained from, for example, the company Invitrogen, life technology company (Life Technologies), and Promega (Promega). Specific vectors suitable for use in fungal host cells include, for example, pFB6, pBR322, pUC 18, pUC100, pDONTm, pDONRTm221, pENTRTm, pGEM (vectors such as D3Z and pGEM (D4Z).

The vector system may be a single vector or plasmid, or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon.

The vector may also contain one or more selectable markers to allow for easy selection of transformed cells. Selectable markers are genes, the products of which provide biocide or viral resistance, and the like. Examples of selectable markers include markers that confer antimicrobial resistance. Nutritional markers may also be used in the present invention, including those markers known in the art as amdS, argB and pyr 4. Markers useful for transformation of Trichoderma are known in the art (see, e.g., finkelstein, chapter 6, at Biotechnology of Filamentous Fungi [ biotechnology for filamentous fungi ], finkelstein et al, editions of Butterworth-Heinemann [ Butterworth Hin press ], boston, massachusetts (1992) and Kinghorn et al, (1992) Applied Molecular Genetics of Filamentous Fungi [ applied molecular genetics for filamentous fungi ], blackie ACADEMIC AND Profestive [ British academy of sciences and professionals ], CHAPMAN AND HALL [ Chapman and Hall press ], london). In some embodiments, the expression vector also includes a replicon, a gene encoding antibiotic resistance that allows selection of bacteria carrying the recombinant plasmid, and unique restriction sites in non-essential regions of the plasmid that allow insertion of heterologous sequences. The particular antibiotic resistance gene selected is not critical; any of a number of resistance genes known in the art are suitable. The prokaryotic sequences are preferably chosen such that they do not interfere with the replication or integration of the DNA in Trichoderma reesei (Trichoderma reesei).

The vector may also comprise elements that allow stable integration of the vector into the production host genome or autonomous replication of the vector in the production host independent of the cell genome. For integration into the host cell genome, the vector may rely on the nucleotide sequence encoding aspartic protease or any other element of the vector for stable integration of the vector into the genome by homologous or nonhomologous recombination.

For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the production host.

More than one copy of a nucleotide sequence encoding an alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) can be inserted into a production host to increase production of the alpha-L-fucosidase. The increase in the number of copies of the nucleotide sequence may be obtained by integrating at least one additional copy of the sequence into the genome of the production host or by including an amplifiable selectable marker gene, and thus the additional copy of the nucleotide sequence may be selected by culturing the production host cell in the presence of an appropriate selection agent.

A vector comprising a nucleotide sequence encoding an alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) is introduced into a production host such that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector. Integration is generally considered an advantage because the nucleotide sequence is more likely to be stably maintained in the production host.

As discussed above, integration of the vector into the production host chromosome may occur by homologous or non-homologous recombination.

Exemplary vectors include, but are not limited to pGXT (identical to the pTTTpyr2 vector described in published PCT application WO 2015/017256). Standard bacterial expression vectors can also be mentioned, including phages X and M13, as well as plasmids such as pBR322 based plasmids, pSKF, pET23D, and fusion expression systems such as MBP, GST and LacZ. Epitope tags (e.g., c-myc) may also be added to recombinant proteins to provide a convenient method of isolation. Examples of suitable expression and/or integration vectors are provided in Sambrook et al, (1989) supra, bennett and Lasure (eds.) More Gene Manipulations in Fungi [ more genetic manipulation in fungi ], (1991) ACADEMIC PRESS [ academic Press ], pages 70-76 and pages 396-428, and the articles cited therein; USP 5,874,276 and Fungal Genetics Stock Center Catalogue of Strains [ inventory of fungal genetics center strains ] (FGSC).

Useful vectors are available from Promega and Enjetty. Some specific useful vectors include pBR322, pUC18, pUC100, pDONTm, pENTRTm, pGEN (11) 3Z and pGEN4D4Z. However, other forms of expression vectors that perform equivalent functions and are or become known in the art may also be used. Thus, a variety of host/expression vector combinations may be used in expressing the DNA sequences disclosed herein. For example, useful expression vectors may consist of segments of chromosomal, nonchromosomal and synthetic DNA sequences, various known derivatives such as 5V40 and known bacterial plasmids (e.g., plasmids from e.coli including col El, pCR1, pBR322, pMb, pUC 19 and derivatives thereof), more extensive host range plasmids (e.g., RP 4), phage DNA (e.g., various derivatives of phage λ, e.g., NM 989), and other DNA phages (e.g., M13 and filamentous single-stranded DNA phages), yeast plasmids (e.g., 2.Mu plasmids or derivatives thereof).

C. Production host

The choice of production host may be any suitable microorganism, such as bacteria, fungi and algae. Typically, the selection will depend on the gene encoding the glycoside hydrolase of interest, such as an alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase).

Examples of suitable production hosts include, but are not limited to, bacteria, fungi, plant cells, and the like. Preferably, the production host may be selected from the group consisting of E.coli, streptomyces (Streptomyces), hansenula (Hansenula), trichoderma (in particular Trichoderma reesei (T. Reesei)), bacillus (e.g.Bacillus subtilis) or Bacillus licheniformis (B. Lichenifermis)), lactobacillus, aspergillus (in particular Aspergillus niger (A. Niger)), plant cells and/or spores of the genera Bacillus, trichoderma or Aspergillus.

In some embodiments, recombinant alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) can be used in the methods and compositions disclosed herein. In a preferred aspect, a food or feed additive is provided comprising an alpha-L-fucosidase which is capable of removing L-fucose from an alpha-L-fucose moiety from an intestinal mucin layer.

Many standard transfection methods can be used to generate bacterial and filamentous fungal (e.g., aspergillus or Trichoderma) cell lines that express a large number of desired glycoside hydrolases, such as alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase). However, any well-known procedure for introducing foreign nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, gene gun methods, liposomes, microinjection, protoplast vectors, viral vectors, and any other well known method for introducing cloned genomic DNA, cDNA, synthetic DNA, or other foreign genetic material into a host cell. Also used are Agrobacterium (Agrobacterium) -mediated transfection methods described in U.S. Pat. No. 6,255,115. Only specific genetic engineering procedures are required that can successfully introduce at least one gene into a host cell capable of expressing the gene.

Depending on the host cell used, post-transcriptional and/or post-translational modifications may be performed. One non-limiting example of post-transcriptional and/or post-translational modification is "cleavage" or "truncation" of the polypeptide. For example, this can result in a change of a glycoside hydrolase as described herein, such as an α -L-fucosidase (e.g., α -L-1,2 fucosidase), from an inactive or substantially inactive state to an active state, as is the case for a pro peptide to become an enzymatically active mature peptide upon further post-translational processing. In another instance, the cleavage can result in obtaining a mature glycoside hydrolase (e.g., an α -L-fucosidase polypeptide) as described herein and further removing the N-or C-terminal amino acid to produce a truncated form of the α -L-fucosidase that retains enzymatic activity.

Other examples of post-transcriptional or post-translational modifications include, but are not limited to, myristoylation, glycosylation, truncation, lipidation, and tyrosine, serine, or threonine phosphorylation. Those skilled in the art will recognize that the type of post-transcriptional or post-translational modification a protein may undergo may depend on the host organism in which the protein is expressed. alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) may be expressed with and/or without signal sequences, thereby facilitating intracellular expression and/or extracellular expression.

Transformation methods of Aspergillus and Trichoderma are described, for example, in Yelton et al (1984) Proc. Natl. Acad. Sci. USA [ Proc. Natl. Acad. Sci. USA ]81:1470-1474; berka et al, (1991) in Applications of Enzyme Biotechnology [ enzyme biotechnology applications ], editions by Kelly and Baldwin, plenum Press [ Proneum Press ] (New York); cao et al, (2000) Sci. [ science ]9:991-1001; campbell et al (1989) Curr.Genet. [ contemporary genetics ]16:53-56; leong and Berka, MARCEL DEKKER INC [ makerl de-kr ], new york (1992) pages 129-148). For transformation of Fusarium strains, reference may also be made to WO 96100787 and Bajar et al, (1991) Proc. Natl. Acad. Sci. USA [ Proc. Natl. Acal. Sci. USA ]88:8202-28212.

After the expression vector is introduced into the cell, the transfected or transformed cell is cultured under conditions conducive to gene expression under the control of the promoter sequence. In some cases, the promoter sequence is a cbhl promoter.

Large batches of transformed cells can be cultured as described in Ilmen et al 1997 ("Regulation of cellulase gene expression in the filamentous fungus Trichoderma reesei. [ regulation of cellulase gene expression in Trichoderma reesei, a filamentous fungus ]" appl. Envir. Microbiol. [ applied and environmental microbiology ] 63:1298-1306). The medium used to culture the cells may be any conventional medium suitable for growing the host cells and obtaining expression of the alpha-fucosidase polypeptide. Suitable media and media components are available from commercial suppliers or may be prepared according to published recipes (e.g., as described in catalogues of the American type culture Collection (AMERICAN TYPE Culture Collection)).

In some embodiments, the preparation of the spent whole fermentation broth of the recombinant microorganism may be accomplished using any culture method known in the art, resulting in the expression of the enzyme of interest. Thus, fermentation is understood to include shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) performed in laboratory or industrial fermentors and performed in a suitable medium and under conditions allowing the enzyme to be expressed or isolated. The term "spent whole fermentation broth" is defined herein as the unfractionated content of fermentation material including culture medium, extracellular proteins (e.g., enzymes), and cellular biomass. It should be understood that the term "spent whole fermentation broth" also encompasses cellular biomass that has been lysed or permeabilized using methods well known in the art.

The host cell may be cultured under suitable conditions that allow expression of the alpha-fucosidase. Expression of these enzymes may be constitutive, such that they can be produced continuously, or inducible, requiring stimulation to initiate expression. In the case of inducible expression, protein production can be initiated when desired by, for example, adding an inducer, such as dexamethasone or IPTG or sophorose, to the medium.

The polypeptides may also be recombinantly produced in an in vitro cell-free system, such as TNTTm (Promega) rabbit reticulocyte system. The expression host may also be cultured under aerobic conditions in a medium suitable for the host. A combination of shaking or agitation and aeration may be provided wherein production occurs at a temperature appropriate to the host (e.g., from about 25 ℃ to about 75 ℃ (e.g., 30 ℃ to 45 ℃), depending on the need of the host and the desired production of alpha-fucosidase).

Incubation may occur for from about 12 to about 100 hours or more (and any hour values therebetween, such as from 24 to 72 hours). Typically, the pH of the culture broth is from about 4.0 to about 8.0, again depending on the culture conditions required for the host relative to the production of the enzyme of interest (e.g., fucosidase). Since the production host and the transformed cells can be cultivated in conventional nutrient media. The medium used for the transformed host cells may be suitably modified to activate the promoter and select the transformed cells. Specific culture conditions (e.g., temperature, pH, etc.) may be those for expression of the selected host cell and will be apparent to those skilled in the art. Furthermore, preferred culture conditions can be found in the scientific literature, for example in Sambrook, (1982) supra; kieser, T, MJ.Bibb, MJ.Buttner, KF chaner and d.a. hopwood (2000) PRACTICAL STREPTOMYCES GENETICS [ streptomyces sp. Genetics ]. John Innes Foundation [ john sony foundation ], novice, uk; harwood et al, (1990) MOLECULAR BIOLOGICAL METHODS FOR BACILLUS [ methods of molecular biology of the genus Bacillus ], john Wiley [ John Wiley Verlag ], and/or from the American type culture Collection (AMERICAN TYPE Culture Collection, ATCC).

Any fermentation process known in the art may be suitably used to ferment the transformed or derived fungal strains as described above. Classical batch fermentation is a closed system in which the composition of the medium is set at the beginning of the fermentation and does not change during the fermentation. At the beginning of the fermentation, the medium is inoculated with one or more desired organisms. In other words, the entire fermentation process takes place without adding any components to the fermentation system throughout.

Alternatively, batch fermentation is qualified as "batch" with respect to the addition of a carbon source. In addition, attempts are often made to control factors such as pH and oxygen concentration throughout the fermentation process. Typically, the metabolite and biomass composition of a batch system is continually changing until such time as fermentation is stopped. In batch culture, cells progress through a static lag phase to a high growth log phase, and finally enter a stationary phase where the growth rate is reduced or stopped. Without treatment, cells in the stationary phase will eventually die. Generally, cells in the log phase are responsible for the high production of the product. A suitable variation of the standard batch system is a "fed-batch fermentation" system. In this variation of a typical batch system, the substrate is added in increments as the fermentation progresses. Fed-batch systems are useful when catabolite repression is known to inhibit metabolism of cells and/or where it is desirable to have a limited amount of substrate in the fermentation medium.

Measurement of actual substrate concentration in fed-batch systems is difficult and is therefore estimated based on changes in measurable factors such as pH, dissolved oxygen and partial pressure of exhaust gases (e.g., CO ₂). Batch and fed-batch fermentations are well known in the art.

Continuous fermentation is another known fermentation process. It is an open system in which defined fermentation medium is continuously added to a bioreactor while an equal amount of conditioned medium is removed for processing. Continuous fermentation generally maintains the culture at a constant density, with cells being maintained mainly in log phase growth. Continuous fermentation allows for modulation of one or more factors that affect cell growth and/or product concentration. For example, limiting nutrients (such as carbon or nitrogen sources) may be maintained at a fixed rate and allow for adjustment of all other parameters. In other systems, many factors affecting growth may be constantly changing, while the cell concentration measured by turbidity of the medium remains unchanged. Continuous systems strive to maintain steady state growth conditions. Therefore, the cell loss due to the withdrawal of the medium should be balanced with the cell growth rate in the fermentation. Methods for modulating nutrients and growth factors for continuous fermentation processes and techniques for maximizing the rate of product formation are well known in the art of industrial microbiology.

Isolation and concentration techniques are known in the art and conventional methods may be used to prepare concentrated solutions or broths comprising the alpha-fucosidase polypeptides of the invention. After fermentation, a fermentation broth is obtained, from which microbial cells and various suspended solids (including remaining crude fermentation material) are removed by conventional separation techniques, in order to obtain an enzyme-containing solution. Filtration, centrifugation, microfiltration, rotary vacuum drum filtration, ultrafiltration, centrifugation followed by ultrafiltration, extraction or chromatography, etc. are generally used.

It may sometimes be desirable to concentrate a solution or broth containing the polypeptide of interest to optimize recovery. The use of unconcentrated solutions or culture solutions typically increases the incubation time in order to collect the enriched or purified enzyme precipitate. The enzyme-containing solution may be concentrated using conventional concentration techniques until the desired enzyme level is obtained. Concentration of the enzyme-containing solution may be accomplished by any of the techniques discussed herein. Examples of enrichment and purification methods include, but are not limited to, rotary vacuum filtration and/or ultrafiltration.

Various assays known in the art can be used to test the activity of glycoside hydrolases described herein (e.g., alpha-L-fucosidase). For example, the activity can be tested by combining the enzyme with a glycoprotein or oligosaccharide and water as desired. The activity can be measured by analyzing the reaction product, which can be isolated and visualized by, for example, thin layer chromatography or spectrophotometry. An example of a fucose spectrophotometry is the Megazyme K-FUCOSE kit (Cao et al, (2014) J Biol Chem [ journal of biochemistry ]289 (37): 25624-38).

D. Feed and feed additive formulation

Glycoside hydrolases (e.g., alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase), alone or in combination with at least one direct fed microorganism), alone and/or in combination with at least one other enzyme, can be encapsulated for use in an animal feed or premix. Furthermore, the glycoside hydrolase (e.g., alpha-L-fucosidase, alone or in combination with at least one directly fed microorganism) alone and/or in combination with at least one protease, amylase, xylanase, beta-glucosidase, and/or phytase, whether or not encapsulated, may be in the form of granules.

Animal feed may include plant material such as corn, wheat, sorghum, soybean, canola, sunflower, or mixtures of any of these plant materials or plant protein sources for poultry, swine, ruminants, aquaculture and pets. The terms "animal feed," "feed," and "silage" are used interchangeably and may comprise one or more feed materials selected from the group consisting of: a) Cereals, such as small grain (e.g. wheat, barley, rye, oats and combinations thereof) and/or large grain, such as maize or sorghum; b) Byproducts from cereals such as corn gluten meal, distillers dried grains with solubles (DDGS), especially corn-based distillers dried grains with solubles (cDDGS), wheat bran, wheat middlings, rice bran, rice hulls, oat hulls, palm kernel, and citrus pulp; c) Proteins obtained from the following sources: such as soybean, sunflower, peanut, lupin, pea, broad bean, cotton, canola, fish meal, dried plasma protein, meat and bone meal, potato protein, whey, copra, sesame; d) Oils and fats obtained from plant and animal sources; and/or e) minerals and vitamins.

When used as or in the preparation of a feed (e.g. a functional feed), the enzyme or feed additive composition of the invention may be used in combination with one or more of the following: a nutritionally acceptable carrier, a nutritionally acceptable diluent, a nutritionally acceptable excipient, a nutritionally acceptable adjuvant, a nutritionally active ingredient. For example, at least one component selected from the group consisting of: proteins, peptides, sucrose, lactose, sorbitol, glycerol, propylene glycol, sodium chloride, sodium sulfate, sodium acetate, sodium citrate, sodium formate, sodium sorbate, potassium chloride, potassium sulfate, potassium acetate, potassium citrate, potassium formate, potassium acetate, potassium sorbate, magnesium chloride, magnesium sulfate, magnesium acetate, magnesium citrate, magnesium formate, magnesium sorbate, sodium metabisulfite, methyl parahydroxybenzoate, and propyl parahydroxybenzoate.

In a preferred embodiment, the enzyme or feed additive composition of the invention is mixed with feed components to form a feed. As used herein, "feed component" means all or part of the feed. A portion of the feed may mean one component of the feed or more than one (e.g., 2 or 3 or 4 or more) component of the feed. In one embodiment, the term "feed component" encompasses a premix or premix ingredients.

Preferably, the feed may be a silage or a premix thereof, a compound feed or a premix thereof. The feed additive composition according to the invention may be mixed with or into a premix of a compound feed, a compound feed component or into a silage, a silage component or a premix of silage.

As used herein, the term "silage" means any food provided to an animal (rather than the animal having to feed on its own). The fodder covers the already cut plants. In addition, stover includes silage, compressed and pelletised feed, oil and mixed ration, and also sprouted grain and beans.

The fodder may be obtained from one or more of the following plants selected from: corn (maize), alfalfa (alfalfa), barley, centella, brassica, huff Ma Liu cabbage (Chau moellier), kale, rapeseed (canola), turnip cabbage (swedish cabbage), radish, clover, hybrid clover, red clover, underground clover, white clover, fescue, sparrow, millet, oat, sorghum, soybean, tree (pruned tree shoots for use as hay), wheat, and leguminous plants.

The term "compound feed" means a commercial feed in the form of meal, pellets, balls (nut), cakes or scraps. The compound feed can be blended from various raw materials and additives.

These blends are formulated according to the specific needs of the target animal.

The compound feed may be a complete feed that provides all daily required nutrients, a concentrate that provides a portion of the ration (protein, energy) or a supplement that provides only additional micronutrients such as minerals and vitamins. The main ingredients used in the compound feed are feed grains including corn, wheat, canola meal, rapeseed meal, lupin, soybean, sorghum, oat, and barley.

Suitably, a "premix" as referred to herein may be a composition of minor ingredients such as vitamins, minerals, chemical preservatives, antibiotics, fermentation products and other essential ingredients. The premix is typically a composition suitable for blending into commercial ration.

As used herein, the term "contacted" refers to the indirect or direct application of a glycoside hydrolase as described herein, such as an alpha-L-fucosidase (or a composition comprising a glycoside hydrolase as described herein, such as an alpha-L-fucosidase), to a product (e.g., a feed). Examples of application methods that may be used include, but are not limited to: the product is treated in a material comprising a feed additive composition, applied directly by mixing the feed additive composition with the product, spraying the feed additive composition onto the surface of the product or immersing the product in a formulation of the feed additive composition. In one embodiment, the feed additive composition of the present invention is preferably mixed with a product (e.g., a feed). Alternatively, the feed additive composition may be contained in an emulsion or in the original ingredients of the feed.

It is also possible that the α -L-fucosidase (or a composition comprising α -L-fucosidase) described herein may be homogenized to produce a powder. In alternative embodiments, a glycoside hydrolase as described herein, such as an alpha-L-fucosidase (or a composition comprising a glycoside hydrolase as described herein (e.g., an alpha-L-fucosidase)), may be formulated as a particle as described in (referred to as TPT particle) or WO 1997/016076 or WO 1992/012645, which are incorporated herein by reference. "TPT" means thermal protection technology.

In another aspect, when the feed additive composition is formulated as particles, the particles comprise a hydrated barrier salt coated on a protein core. Such a salt coating has the advantage of improving heat resistance, improving preservation stability and protecting against other feed additives which would otherwise adversely affect the enzyme. Preferably, the salt used for the salt coating has a water activity of greater than 0.25 or a constant humidity of greater than 60% at 20 ℃. In some embodiments, the salt coating comprises Na ₂SO₄.

The method of making a glycoside hydrolase as described herein, e.g., an alpha-L-fucosidase (or a composition comprising a glycoside hydrolase as described herein, e.g., an alpha-L-fucosidase), may further comprise the step of further granulating the powder. The powder may be mixed with other components known in the art. The powder or mixture comprising the powder may be forced through a die and the resulting strands cut into pellets of suitable different lengths.

Optionally, the granulating step may include a steam treatment or conditioning stage prior to forming the pellets. The mixture comprising the powder may be placed in a conditioner, for example a mixer with steam injection. The mixture is heated in a regulator to a specified temperature, for example from 60 ℃ to 100 ℃, typical temperatures will be 70 ℃,80 ℃, 85 ℃, 90 ℃ or 95 ℃. Residence times may vary from seconds to minutes to hours. Such as 5 seconds, 10 seconds, 15 seconds, 30 seconds, 1 minute, 2 minutes, 5 minutes, 10 minutes, 15 minutes, 30 minutes, and 1 hour. It will be appreciated that glycoside hydrolases as described herein, such as an alpha-L-fucosidase (or a composition comprising a glycoside hydrolase as described herein (e.g., an alpha-L-fucosidase)), are suitable for addition to any suitable feed material.

The skilled person will appreciate that different animals may require different feeds, even the same animal may require different feeds, depending on the purpose for which the animal is raised. Optionally, the feed may also contain additional minerals (e.g., calcium) and/or additional vitamins. In some embodiments, the feed is a corn soybean meal mixture.

The feed is typically produced in a feed mill in which the raw materials are first ground to a suitable particle size and then mixed with suitable additives. The feed may then be produced into a paste or pellet; the latter typically involves a process by which the temperature is raised to a target level and then the feed is passed through a die to produce pellets of a particular size. The pellets were allowed to cool. Subsequently, liquid additives such as fats and enzymes may be added. The production of the feed may also involve additional steps including extrusion or expansion prior to pelleting, particularly by suitable techniques which may include at least the use of steam.

The feed may be a feed for: monogastric animals such as poultry (e.g., broiler chickens, laying hens, broiler breeder chickens, broiler chickens, turkeys, ducks, geese, waterfowl) and swine (all age categories); ruminants, such as cows (e.g., cows or bulls (including calves)), horses, sheep, pets (e.g., dogs, cats) or fish (e.g., gastreless fish, gastrokinetic fish, freshwater fish, such as salmon, cod, trout and carp (e.g., koi carp), sea fish (such as black weever), and crustaceans such as shrimp, mussel and scallop).

The feed additive composition and/or the feed comprising it may be used in any suitable form. The feed additive composition may be used in the form of a solid or liquid formulation or a substitute therefor. Examples of solid formulations include powders, pastes, large pellets (boluses), capsules, pellets, tablets, powders and granules, which may be wettable, spray-dried or freeze-dried. Examples of liquid formulations include, but are not limited to, aqueous, organic or aqueous-organic solutions, suspensions and emulsions.

In some applications, the feed additive composition may be mixed with feed or applied in drinking water.

A feed additive composition comprising mixing a fucosidase as taught herein with a feed acceptable carrier, diluent or excipient, and (optionally) packaging.

The feed and/or feed additive composition may be admixed with at least one mineral and/or at least one vitamin. The compositions derived therefrom may be referred to herein as premixes. The feed may comprise at least 0.0001% by weight of feed additive. Suitably, the feed may comprise at least 0.0005% by weight; at least 0.0010%; at least 0.0020%; at least 0.0025%; at least 0.0050%; at least 0.0100%; at least 0.020%; at least 0.100%, at least 0.200%; at least 0.250%; at least 0.500% of feed additive.

Preferably, the food or feed additive composition may further comprise at least one physiologically acceptable carrier. The physiologically acceptable carrier is preferably selected from at least one of the following: maltodextrin, limestone (calcium carbonate), cyclodextrin, wheat or wheat components, sucrose, starch, na ₂SO₄, talc, PVA and mixtures thereof. In further embodiments, the food or feed supplement may further comprise a metal ion chelator. The metal ion chelating agent may be selected from EDTA or citric acid.

In some embodiments, the food or feed additive composition comprises a glycoside hydrolase as described herein, e.g., an alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) level of at least 0.0001g/kg, 0.001g/kg, at least 0.01g/kg, at least 0.1g/kg, at least 1g/kg, at least 5g/kg, at least 7.5g/kg, at least 10.0g/kg, at least 15.0g/kg, at least 20.0g/kg, at least 25.0g/kg.

In some embodiments, the food or feed additive comprises a level of alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) such that when added to the food or feed material, the feed material comprises alpha-L-fucosidase in the range of 1mg/kg to 500mg/kg, 1mg/kg to 100mg/kg, 2mg/kg to 50mg/kg, or 2mg/kg to 10mg/kg. In some embodiments of the invention, the food or feed material comprises at least 100, 1000, 2000, 3000, 4000, 5000, 10000, 20000, 30000, 50000, 100000, 500000, 1000000 or 2000000 units of glycoside hydrolase (e.g., α -L-fucosidase) per kg of feed or food material. In some embodiments, one unit of alpha-1, 2-fucosidase activity may be defined as the amount of enzyme that can catalyze the release of one mole of L-fucose from 2' -fucosyllactose per minute under standard assay conditions.

Formulations comprising any glycoside hydrolase as described herein, such as an alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) and the compositions described herein, can be prepared in any suitable manner to ensure that the formulation comprises an active enzyme. Such formulations may be in the form of liquids, dry powders or granules. Preferably, the feed additive composition is in solid form, suitable for addition to or on a feed pellet.

The dry powder or granulate may be prepared by means known to those skilled in the art, such as high shear granulation, drum granulation, extrusion, spheronization, fluid bed agglomeration, fluid bed spray drying.

Glycoside hydrolases as described herein, such as alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) and compositions as described herein, can be coated, e.g., encapsulated. In one embodiment, the coating protects the enzyme from heat and may be considered a thermal inhibitor. In one embodiment, the coating protects the enzyme from low pH. Ewing is one example of a coating material that may be used.

The feed additive compositions described herein may be formulated as dry powders or granules, as described in WO 2007/044968 (referred to as TPT granules) or WO 1997/016076 or WO 1992/012645 (each of which is incorporated herein by reference).

In one embodiment, the animal feed can be formulated as pellets of a feed composition comprising: a core; an active agent; and at least one coating that retains at least 50% activity, at least 60% activity, at least 70% activity, at least 80% activity of the active agent of the particle after being subjected to conditions selected from one or more of the following: a) a feed pelletization process, b) a steam heated feed pretreatment process, c) storage, d) storage as an ingredient in an ungranulated mixture, and e) storage as an ingredient in a feed base mixture or feed premix comprising at least one compound selected from the group consisting of: trace minerals, organic acids, reducing sugars, vitamins, choline chloride, and compounds that produce an acidic or basic feed base mixture or feed premix.

With respect to the particles, the at least one coating may comprise at least 55% w/w of the moisture hydrating material of the particles; and/or at least one coating may comprise two coatings. The two coatings may be a moisture hydrating coating and a moisture barrier coating. In some embodiments, the moisture hydrating coating may comprise 25% w/w to 60% w/w of the particles, and the moisture barrier coating may comprise 2% w/w to 15% w/w of the particles. The moisture hydrating coating may be selected from inorganic salts, sucrose, starch, and maltodextrin, and the moisture barrier coating may be selected from polymers, gums, whey, and starch.

The feed additive composition may be formulated as a pellet for animal feed, the pellet comprising: a core; an active agent, the active agent of the granules remaining at least 80% active after storage and after a steam heated granulation process of the granules as one component; a moisture barrier coating; and a moisture hydrating coating comprising at least 25% w/w of the particles, the particles having a water activity of less than 0.5 prior to the steam heated granulation process.

The particles may have a moisture barrier coating selected from polymers and gums and the moisture hydrating material may be an inorganic salt. The moisture hydrating coating may comprise 25% to 45% w/w of the particles and the moisture barrier coating may comprise 2% to 10% w/w of the particles.

The granules may be produced using a steam heated granulation process which may be carried out at 85 ℃ to 95 ℃ for up to several minutes.

Alternatively, the composition is in a liquid formulation suitable for consumption, preferably such liquid consumable contains one or more of the following: buffers, salts, sorbitol and/or glycerol.

In addition, the feed additive composition may be formulated by applying (e.g., spraying) the enzyme onto a carrier substrate, such as ground wheat. In one embodiment, the feed additive composition may be formulated as a premix. For example only, the premix may comprise one or more feed components, such as one or more minerals and/or one or more vitamins.

In one embodiment, at least one DFM and/or glycoside hydrolase such as an alpha-L-fucosidase (whether encapsulated or not) and/or at least one protease, amylase, xylanase, beta-glucosidase, and/or phytase is formulated with at least one physiologically acceptable carrier selected from at least one of the following: maltodextrin, limestone (calcium carbonate), cyclodextrin, wheat or wheat components, sucrose, starch, na ₂SO₄, talc, PVA, sorbitol, benzoate, sorbate, glycerol, sucrose, propylene glycol, 1, 3-propanediol, glucose, parabens, sodium chloride, citrate, acetate, phosphate, calcium, metabisulfite, formate and mixtures thereof.

In some embodiments, a glycoside hydrolase such as an alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) is in a physiologically acceptable carrier. Suitable carriers may be large, slowly metabolizing macromolecules such as proteins, polypeptides, liposomes, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers and inactivated viral particles.

Pharmaceutically acceptable salts may be used, for example inorganic acid salts such as hydrochloride, hydrobromide, phosphate and sulfate, or organic acid salts such as acetate, propionate, malonate and benzoate. The pharmaceutically acceptable carrier in the therapeutic composition may additionally contain liquids such as water, saline, glycerol and ethanol. In addition, auxiliary substances (e.g., wetting or emulsifying agents or pH buffering substances) may be present in such compositions. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries and suspensions for ingestion by the patient. Once formulated, the compositions of the invention may be administered directly to a subject. The subject to be treated may be an animal. However, in one or more embodiments, these compositions are suitable for administration to a human subject.

III method

A. methods for improving intestinal health

The present disclosure relates to a method of improving intestinal health in an animal comprising administering to the animal an effective amount of a glycoside hydrolase enzyme capable of removing at least one alpha-1, 2-L-fucose moiety from an intestinal mucin layer. In some embodiments, the glycoside hydrolase is an alpha-L-fucosidase (e.g., an alpha-L-1, 2 fucosidase), such as an alpha-L-fucosidase from glycoside hydrolase family 95 (GH 95) or glycoside hydrolase family 29 (GH 29). In some embodiments, a glycoside hydrolase (e.g., α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from an intestinal mucin layer is administered to an animal for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, 35 days, 36 days, 37 days, 38 days, 39 days, 40 days, 41 days, 42 days, 43 days, 44 days, 45 days, 46 days, 47 days, 48 days, 49 days, 50 days, 51 days, 52 days, 53 days, 54 days, 55 days, 56 days, 57 days, 58 days, 59, 60, 61, 62, 64, 68, or more. In other embodiments, a glycoside hydrolase (e.g., α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from an intestinal mucin layer is administered to an animal for at least 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks, 25 weeks, 26 weeks, 27 weeks, 28 weeks, 29 weeks, 30 weeks, or more. In some embodiments, the animal is a weaned animal, such as a piglet. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

1. Symbiotic intestinal bacterial population

In one embodiment, improving intestinal health includes promoting the growth of one or more commensal enterobacteria. Non-limiting examples of enterobacteria whose growth may be promoted after the glycoside hydrolase is administered include Prevotella species, mesosphaerella species, clostridium species, blueTorulopsis species, ruminococcus species, vibrio species and/or Barnus species.

Prevotella is a genus of gram-negative bacteria, including species commonly found in the oral, vaginal and intestinal microbiota. Non-limiting examples of Prevotella species include Arabidopsis (Prevotella albensis), achnia (Prevotella amnii), primei (Prevotella bergensis), erasepsis (Prevotella bivia), brevibacterium (Prevotella brevis), primei (Prevotella bryantii), primei buchneri (Prevotella buccae), primei buchneri (Prevotella buccalis), primei faecalis (Prevotella copri), primei dental (Prevotella dentalis), primei denticola (Prevotella dentalis), leimei lypopcorn (Prevotella dentalis), primei tissue Primei (Prevotella dentalis), spottei Primei (Prevotella dentalis), primei Prevotella dentalis), prevotella dentalis, primei melanogenesis (Prevotella dentalis), primei iridis (Prevotella dentalis), primei polymorphi (Prevotella dentalis), primei melanosis (Prevotella dentalis), primei buchneri (Prevotella dentalis), primei stomati (Prevotella dentalis), primei Klebi (Prevotella dentalis), primei gingivai (Prevotella dentalis), primei gingi (Prevotella dentalis), primei (Prevotella dentalis) and Primei salivary (Prevotella dentalis) Primei, primei (Prevotella dentalis) or Primei (Prevotella dentalis).

In some embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from the enteromucin layer results in an increase (e.g., an increase of any one value of about 5％、10％、15％、20％、25％、30％、35％、40％、45％、50％、55％、60％、65％、70％、80％、85％、90％、95％、100％、105％、110％、115％、120％、125％、130％、135％、140％、145％、150％、155％、160％、165％、170％、175％、180％、185％、190％、195％、200％、250％、300％、350％、400％、450％、500％、550％、600％、650％、700％、750％、800％、850％、900％、950％、1000％、1100％、1200％、1300％、1400％、1500％、1600％、1700％、1800％、1900％、2000％、2100％、2200％、2300％、2400％、2500％ or more, including all values between these percentages) in one or more of the prasuvorexa species (e.g., fecal prasuvorexa) in the enteromicrobiota compared to the amount of prasuvorexa species in the enteromicrobiota of the animal that is not administered an effective amount of the glycoside hydrolase capable of removing at least one α -1, 2-L-fucose moiety from the enteromucin layer. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

The genus megasphaerella is a genus of which the genus of the genus Zostertagia is classified as a negative class of bacteria (Negativicutes). Non-limiting examples of megasphaeria species include human megasphaeria (MEGASPHAERA HOMINIS), brettanomyces (MEGASPHAERA CEREVISIAE), megasphaeria elsdenii (MEGASPHAERA ELSDENII), megasphaeria micronucleus (MEGASPHAERA MICRONUCIFORMIS), megasphaeria febrile (MEGASPHAERA PAUCIVORANS), and/or MEGASPHAERA SUECIENSIS.

In some embodiments, administering to the animal an effective amount of a glycohydrolase (e.g., an α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer results in an increase (e.g., an increase of any one value of about 5％、10％、15％、20％、25％、30％、35％、40％、45％、50％、55％、60％、65％、70％、80％、85％、90％、95％、100％、105％、110％、115％、120％、125％、130％、135％、140％、145％、150％、155％、160％、165％、170％、175％、180％、185％、190％、195％、200％、250％、300％、350％、400％、450％、500％、550％、600％、650％、700％、750％、800％、850％、900％、950％、1000％、1100％、1200％、1300％、1400％、1500％、1600％、1700％、1800％、1900％、2000％、2100％、2200％、2300％、2400％、2500％ or more, including all values between these percentages) in one or more megasphaera species (e.g., megasphaera ericae) in the intestinal microbiota compared to the amount of megasphaera species in the intestinal microbiota of the animal that is not administered an effective amount of the glycohydrolase capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

Clostridium is a genus of gram-positive bacteria comprising about 250 species including the common autotrophic bacteria (free-living bacteria) and important pathogens. The genus is a diverse group of species and several species are the protozoa of the healthy gastrointestinal microbiota of mammals. Non-limiting examples of Clostridium species are those of Clostridium clusters IV and XIVa (Clostridium pseudoglobosum (Clostridium coccoides) and Clostridium tenella (Clostridium leptum) populations, respectively; see Guo et al, 2020,Journal of Animal Science and Biotechnology [ journal of animal science and biotechnology ],11:24, incorporated herein by reference).

In some embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer results in an increase (e.g., an increase of any value of about 5％、10％、15％、20％、25％、30％、35％、40％、45％、50％、55％、60％、65％、70％、80％、85％、90％、95％、100％、105％、110％、115％、120％、125％、130％、135％、140％、145％、150％、155％、160％、165％、170％、175％、180％、185％、190％、195％、200％、250％、300％、350％、400％、450％、500％、550％、600％、650％、700％、750％、800％、850％、900％、950％、1000％、1100％、1200％、1300％、1400％、1500％、1600％、1700％、1800％、1900％、2000％、2100％、2200％、2300％、2400％、2500％ or more, including all values between these percentages) in one or more clostridium species in the intestinal microbiota compared to the amount of clostridium species in the intestinal microbiota of the animal that is not administered an effective amount of the glycoside hydrolase capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

The genus BlueTourette is a genus of anaerobic bacteria with probiotic characteristics, widely present in the faeces and intestines of mammals (see Liu et al, 2021,Gut Microbes [ intestinal microorganisms ].3 (1): 1875796, incorporated herein by reference). Non-limiting examples of species of the genus Blautia include Blautia globosa (Blautia coccoides), blautia hansenii (Blautia hansenii), blautia hydrogenotrophic (Blautia hydrogenotrophica), lushi Blautia (Blautia luti), blautia producens (Blautia producta), shen Kebu laque (Blautia schinkii), blautia weissella (Blautia wexlerae), laque Lu Shibu laque (Blautia glucerasea), blautia fecal (Blautia stercoris), blautia faecalis (Blautia faecis), buque brute's (Blautia obeum), blautia cecum (Blautia caecimuris), bubali (Blautia massiliensis), blautia phocaeensis, blautia marasmi, prowang brute (Blautia provencensis), human Blautia hominis (Blautia), blautia argi, blautia brookingsii, and/or Blautia faecicola.

In some embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an alpha-L-fucosidase) capable of removing at least one alpha-1, 2-L-fucose moiety from the enteromucin layer results in an increase (e.g., an increase of any of about 5％、10％、15％、20％、25％、30％、35％、40％、45％、50％、55％、60％、65％、70％、80％、85％、90％、95％、100％、105％、110％、115％、120％、125％、130％、135％、140％、145％、150％、155％、160％、165％、170％、175％、180％、185％、190％、195％、200％、250％、300％、350％、400％、450％、500％、550％、600％、650％、700％、750％、800％、850％、900％、950％、1000％、1100％、1200％、1300％、1400％、1500％、1600％、1700％、1800％、1900％、2000％、2100％、2200％、2300％、2400％、2500％ or more, including all values between these percentages) in one or more of the species of the genus blautia in the enteromicrobiota compared to the amount of the species of the genus blautia in the enteromicrobiota of the animal that is not administered the effective amount of the glycoside hydrolase capable of removing at least one alpha-1, 2-L-fucose moiety from the enteromucin layer. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

The genus ruminococcus is a genus of bacteria in the class clostridia. They are anaerobic gram-positive intestinal microorganisms found in large numbers in the human intestinal microbiota. Non-limiting examples of species of the genus ruminococcus include ruminococcus albus (Ruminococcus albus), ruminococcus buchneri (Ruminococcus bromii), ruminococcus smart (Ruminococcus callidus), ruminococcus flavus (Ruminococcus flavefaciens), ruminococcus johnsonii (Ruminococcus gauvreauii), ruminococcus livens (Ruminococcus gnavus), ruminococcus acidophilus (Ruminococcus lactaris), ruminococcus oococcus (Ruminococcus obeum), and/or ruminococcus twistans (Ruminococcus torques).

In some embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an alpha-L-fucosidase) capable of removing at least one alpha-1, 2-L-fucose moiety from the enteromucin layer results in an increase (e.g., an increase of any of about 5％、10％、15％、20％、25％、30％、35％、40％、45％、50％、55％、60％、65％、70％、80％、85％、90％、95％、100％、105％、110％、115％、120％、125％、130％、135％、140％、145％、150％、155％、160％、165％、170％、175％、180％、185％、190％、195％、200％、250％、300％、350％、400％、450％、500％、550％、600％、650％、700％、750％、800％、850％、900％、950％、1000％、1100％、1200％、1300％、1400％、1500％、1600％、1700％、1800％、1900％、2000％、2100％、2200％、2300％、2400％、2500％ or more, including all values between these percentages) in one or more species of the genus ruminococcus in the enteromicrobiota compared to the amount of species of the genus ruminococcus in the enteromicrobiota of the animal that is not administered an effective amount of the glycoside hydrolase capable of removing at least one alpha-1, 2-L-fucose moiety from the enteromucin layer.

The genus Barnus is a genus of the family Barnaceae (Barnesiellaceae) and is a gram-negative, anaerobic and non-spore forming bacterium. Non-limiting examples of the species of the genus Barnus include Versecobanches (Barnesiella viscericola) and intestinal Barnus (Barnesiella intestinihominis).

In some embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an alpha-L-fucosidase) capable of removing at least one alpha-1, 2-L-fucose moiety from the intestinal mucin layer results in an increase (e.g., an increase of any of about 5％、10％、15％、20％、25％、30％、35％、40％、45％、50％、55％、60％、65％、70％、80％、85％、90％、95％、100％、105％、110％、115％、120％、125％、130％、135％、140％、145％、150％、155％、160％、165％、170％、175％、180％、185％、190％、195％、200％、250％、300％、350％、400％、450％、500％、550％、600％、650％、700％、750％、800％、850％、900％、950％、1000％、1100％、1200％、1300％、1400％、1500％、1600％、1700％、1800％、1900％、2000％、2100％、2200％、2300％、2400％、2500％ or more, including all values between these percentages) in one or more of the barnacles species in the intestinal microbiota, as compared to the amount of barnacles species in the intestinal microbiota of the animal that is not administered an effective amount of the glycoside hydrolase capable of removing at least one alpha-1, 2-L-fucose moiety from the intestinal mucin layer. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

The genus Vibrio is a genus of gram-negative sulfate reducing bacteria. The Vibrio species are typically present in aquatic environments with high levels of organic matter, as well as in ponding soil, and constitute the major community members of extremely nutrient-poor habitats, such as deep granite-slit rock aquifers. Like other sulfate reducing bacteria, vibrio species have long been considered obligately anaerobic. Strictly speaking this is incorrect: although growth may be limited, these bacteria are able to survive in an O ₂ -rich environment. These types of bacteria are known to be oxygen tolerant. Non-limiting examples of species of the genus Vibrio include Vibrio acrylic acid desulfur (D.acrylic), vibrio oxytolerant desulfur (D.aerolyticus), vibrio aescifur (D.aespoensis), vibrio africanus (D.africanus), vibrio alaska desulfur (D.alaskensis), D.alaskolivorans, alkali-resistant Vibrio desulfur (D.alaskolicus), amino acid desulfur (D.aminophilus), vibrio arcticus (D.arcticus), vibrio papilis (D.baarctii), D.bacitratus nit thiovibrio (D.bacitracins), D.biadheiensis, vibrio parapsilosis (D.bizertis), D.burkensis, vibrio butyricum (D.butyricum), vibrio polym Mao Tuoliu (D.calcaneus), D.carnauba, D.pastoris), vibrio parapsins (D.thiofiducidus), vibrio parapsins (D.d.thiofiducidus), vibrio parapsins (D.d). Frigidius, vibrio fructolyticus (D. Fructivorans), D. Furfurfurals, vibrio ganaxacum (D. Gabonensis), vibrio megaterium (D. Giganteus), vibrio megaterium (D. Gigas), vibrio cilium (D. Gracilis), vibrio halophilus (D. Halophilus), vibrio hydrothermalis (D. Hydrothermalis), D. Idahonensis, vibrio indonesis (D. Indonesis), vibrio parapsida, vibrio enterophyllus (D. Intestinalis) Legalli, D.alitalalis, D.longreachen, vibrio longus (D.longus), vibrio magnetically desulphurized (D.magneticus), vibrio maritimus (D.marinus), vibrio maritimus (D.mariinidimini), vibrio marrakechensis, vibrio mexicana (D.mexicas), D.multispirans, D.oceanii, D.oxamics, D.oxydane, D.paque, D.pizophilus, vibrio pigua (D.pigram), portus, vibrio profundus (D.profundus), vibrio cold-tolerant (D.psychrotolylans), vibrio putida (D.puteis), D.salixigens, D.sapovorans, D.senezii, vibrio simplex (D.simplex), D.sulfodistans, vibrio termitis (D.termitis), vibrio thermophilus (D.thermophilus), vibrio parapsilosis (D.tunisis), vibrio vietnaensis (D.vietnamensis), vibrio vulgaris (D.vulgaris) and Vibrio meticulosus (D.zosterae).

In some embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an alpha-L-fucosidase) capable of removing at least one alpha-1, 2-L-fucose moiety from the enteromucin layer results in an increase (e.g., an increase of any value of about 5％、10％、15％、20％、25％、30％、35％、40％、45％、50％、55％、60％、65％、70％、80％、85％、90％、95％、100％、105％、110％、115％、120％、125％、130％、135％、140％、145％、150％、155％、160％、165％、170％、175％、180％、185％、190％、195％、200％、250％、300％、350％、400％、450％、500％、550％、600％、650％、700％、750％、800％、850％、900％、950％、1000％、1100％、1200％、1300％、1400％、1500％、1600％、1700％、1800％、1900％、2000％、2100％、2200％、2300％、2400％、2500％ or more, including all values between these percentages) in one or more species of the Vibrio sp. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

In some embodiments, a glycoside hydrolase (e.g., α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from an intestinal mucin layer is administered to an animal for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, 35 days, 36 days, 37 days, 38 days, 39 days, 40 days, 41 days, 42 days, 43 days, 44 days, 45 days, 46 days, 47 days, 48 days, 49 days, 50 days, 51 days, 52 days, 53 days, 54 days, 55 days, 56 days, 57 days, 58 days, 59, 60, 61, 62, 64, 68, or more. In other embodiments, a glycoside hydrolase (e.g., α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from an intestinal mucin layer is administered to an animal for at least 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks, 25 weeks, 26 weeks, 27 weeks, 28 weeks, 29 weeks, 30 weeks, or more. In some embodiments, the animal is a weaned animal, such as a piglet.

The increase in growth or number of one or more commensal enterobacteria can be detected by standard methods, including direct or indirect sampling of the intestinal microbiota followed by 16s rRNA sequencing, whole genome sequencing, or according to the methods described in the examples herein.

2. Methanogenic intestinal populations

In another embodiment, improving intestinal health comprises reducing the growth of one or more methanogenic archaea in the intestine. Non-limiting examples of methanogenic archaea that can reduce the growth of glycoside hydrolases after their administration include Brevibacterium species and methanogenic mosaic species (e.g., lu Mini methanogenic mosaic (Methanomassiliicoccus luminyensis)).

The genus Methanobacillus is a genus of the family Methanobacilaceae (Methanobacteriaceae). Species within the genus methanobacterium are strictly anaerobic archaea, producing methane mainly by reduction of carbon dioxide via hydrogen. Most species live in the intestines of larger organisms (such as termites) and cause them to produce large amounts of greenhouse gases. Non-limiting examples of species of the genus Methanobacterium include Brevibacterium acidophilus (M.acidophilus), brevibacterium arborescens (M.arboriphilus), brevibacterium campylobacter (M.curvatus), brevibacterium epidermidis (M.cutacularis), brevibacterium filiformis (M.filiforme), M.gottscheklkii, brevibacterium miehei (M.millare), brevibacterium australis (M.olleyae), brevibacterium stomatalis (M.oralis), brevibacterium ruminant (M.ruminantium), brevibacterium smithii, brevibacterium co-existence (M.tharieri), brevibacterium uzmethane (M.woesei) and/or Wo Lini Brevibacterium (M.woleii).

In some embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from an intestinal mucin layer results in a reduction (e.g., by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 85%, 90%, 95%, or 100% of any value in the intestinal microbiota (e.g., smith) compared to the amount of the methanoculm species present in the intestinal microbiota of the animal not administered an effective amount of the glycoside hydrolase capable of removing the at least one α -1, 2-L-fucose moiety from the intestinal mucin layer, including all values between these percentages. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

In other embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from the enteromucin layer results in a reduction (e.g., by about any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 85%, 90%, 95%, or 100%, inclusive of all values between these percentages) of one or more methanomosaic species (e.g., lu Mini methanomosaic) in the enteromicrobiota, as compared to the amount of methanomosaic species in the enteromicrobiota of the animal that is not administered an effective amount of the glycoside hydrolase capable of removing the at least one α -1, 2-L-fucose moiety from the enteromucin layer.

The reduction in growth or number of one or more methanogenic archaea in the intestine can be detected by standard methods, including direct or indirect sampling of the intestinal microbiota followed by 16s rRNA sequencing, whole genome sequencing, or according to the methods described in the examples herein.

3. Secretory IgA

In further embodiments, improving intestinal health includes increasing secretory IgA (SIgA) levels in the intestine, for example by increasing the amount of intestinal IgA, including but not limited to the amount of intestinal IgA bound to fecal microorganisms. SIgA is the predominant antibody species secreted at all mucosal surfaces, where it enhances barrier function through specific interactions with pathogenic commensal microorganisms, microbial metabolites and ingested macromolecules. In addition to excluding potentially harmful interactions with host tissues, SIgA can also affect the composition and metabolic activity of microorganisms living within the mucosa, helping to actively select beneficial microflora. SIga (including SIgA attached to fecal microbial surfaces) are positively correlated with good health status and are used as markers for assessing mucosal immune function in human and animal studies.

In some embodiments, administering an effective amount of a glycoside hydrolase (e.g., an α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from an intestinal mucin layer to an animal results in an increase in SIgA levels in the intestine (e.g., any value of about 5％、10％、15％、20％、25％、30％、35％、40％、45％、50％、55％、60％、65％、70％、80％、85％、90％、95％、100％、105％、110％、115％、120％、125％、130％、135％、140％、145％、150％、155％、160％、165％、170％、175％、180％、185％、190％、195％、200％、250％、300％、350％、400％、450％、500％、550％、600％、650％、700％、750％、800％、850％、900％、950％、1000％、1100％、1200％、1300％、1400％、1500％、1600％、1700％、1800％、1900％、2000％、2100％、2200％、2300％、2400％、2500％ or more, including all values between these percentages) (e.g., an increase in the amount of SIgA bound to fecal microorganisms) compared to the amount of SIgA levels in the intestine of an animal that is not administered an effective amount of the glycoside hydrolase capable of removing at least one α -1, 2-L-fucose moiety from an intestinal mucin layer. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

Detection of SIgA levels in the gut, including detection of SIgA bound to fecal microorganisms, can be performed by standard techniques according to the methods described in the examples herein.

4. Neutrophils

In further embodiments, improving intestinal health comprises reducing the amount of neutrophil levels in the intestine. Neutrophils are a type of white blood cells that help heal damaged tissue and resolve infections. Neutrophil blood levels naturally increase in response to infection, injury, and other types of stress. Inflammation is associated with increased neutrophil levels, so lower levels indicate that there is less inflammation.

In some embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from an intestinal mucin layer results in a neutropenia (e.g., a reduction of about any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 85%, 90%, 95%, or 100%, inclusive of all values between these percentages) in the animal's intestine compared to the amount of neutrophils in the intestinal microbiota of the animal that is not administered an effective amount of the glycoside hydrolase capable of removing the at least one α -1, 2-L-fucose moiety from the intestinal mucin layer. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

Detection of neutrophil levels in the intestine may be performed by standard techniques according to the methods described in the examples herein.

5. Feed intake and FCR

In another embodiment, improving intestinal health comprises increasing food intake of the animal. Feed intake in certain livestock species is related to certain taxa in microbiome. For example, in one study on commercial Duroc pigs, animals carrying an intestinal form predominantly of Prevotella have been shown to have significantly higher Average Daily Feed Intake (ADFI). Furthermore, prevotella has been shown to be the central bacterium in a co-abundance network, exhibiting a strong positive correlation with ADFI (Yang et al 2018,BMC Microbiol[BMC microbiology ].2018,18,215).

In some embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer results in an increase in ADFI (e.g., an increase of any value of about 5％、10％、15％、20％、25％、30％、35％、40％、45％、50％、55％、60％、65％、70％、80％、85％、90％、95％、100％、105％、110％、115％、120％、125％、130％、135％、140％、145％、150％、155％、160％、165％、170％、175％、180％、185％、190％、195％、200％ or more, including all values between these percentages) compared to ADFI of an animal not administered an effective amount of the glycoside hydrolase capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

In some embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer results in a reduction (e.g., by any of about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 85%, 90%, 95%, or 100%, inclusive of all values between these percentages) in FCR compared to the Feed Conversion (FCR) of an animal not administered an effective amount of the glycoside hydrolase capable of removing the at least one α -1, 2-L-fucose moiety from the intestinal mucin layer. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

6. Number of deaths

In another embodiment, improving intestinal health includes reducing the number of deaths in an animal (e.g., a weaned animal, such as a piglet). Maturation of adaptive immunity in animals (e.g., piglets) depends on signals received from the weaning process by microorganisms colonizing the intestines. Sudden weaning is common in large-scale livestock production and may lead to interruption of immune development due to inflammation or the establishment of a microflora that does not support proper immune development. This can lead to excessive mortality in the weaned animal.

In some embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer results in a reduction (e.g., by any of about 1％、2％、3％、4％、5％、6％、7％、8％、9％、10％、11％、12％、13％、14％、15％、16％、17％、18％、19％、20％、25％、30％、35％、40％、45％、50％、55％、60％、65％、70％、80％、85％、90％、95％ or 100%, including all values between these percentages) in the number of deaths in the animal (e.g., the just-weaned animal) compared to the number of deaths in an animal (e.g., the just-weaned animal) not administered an effective amount of the glycoside hydrolase capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

B. method for reducing methane emissions

Methane is an important greenhouse gas. In terms of its global warming potential, one ton of methane corresponds to about 21 to 22 tons of carbon dioxide. Thus, reducing methane emissions by 1 ton may be considered to achieve a reduction of 21 tons or more of carbon dioxide, and may result in about 21 tons of carbon credits (in terms of carbon dioxide) in the evolving greenhouse gas (GHG) market. Furthermore, methane has a half-life of about 12 years in the atmosphere and grows worldwide at a rate of about five percent (0.5%) per year. Thus, it is desirable to reduce the current emission of excess methane into the atmosphere.

Emissions of greenhouse gases (GHG), including methane from livestock, are considered to be an important contributor to global warming. Some scientists estimate that livestock contribute up to thirty-seven percent (37%) of the total budget of global methane (CH ₄).

Provided herein are methods of reducing methane emissions in an animal comprising administering to the animal an effective amount of a glycoside hydrolase enzyme capable of removing at least one alpha-1, 2-L-fucose moiety from an intestinal mucin layer. Without being bound by theory, it is believed that a reduction in growth of one or more methanogenic archaea species (e.g., methanobrevis species, such as methanobrevis smith) in the gut of an animal following administration of the glycoside hydrolase results in a reduction in methane emissions from the animal.

In some embodiments, administering to the animal an effective amount of a glycoside hydrolase (e.g., an α -L-fucosidase) capable of removing at least one α -1, 2-L-fucose moiety from the intestinal mucin layer results in a reduction (e.g., by any of about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 85%, 90%, 95%, or 100%, inclusive of all values between these percentages) in methane emissions from the intestine of the animal compared to methane emissions from an animal not administered an effective amount of the glycoside hydrolase capable of removing the at least one α -1, 2-L-fucose moiety from the intestinal mucin layer. In some embodiments, the glycoside hydrolase comprises a polypeptide that is at least about 60% identical (such as about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, including values between these percentages) to the glycoside hydrolase encoded by SEQ ID No. 3.

C. co-administration with DFM or other enzymes

The methods disclosed herein further comprise administering to the animal an effective amount of a glycoside hydrolase, such as an alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase), alone or in combination with at least one other enzyme, in combination with at least one direct fed microorganism.

Furthermore, glycoside hydrolases as described herein (e.g., an alpha-L-fucosidase (e.g., an alpha-L-1, 2 fucosidase), alone or in combination with at least one direct fed microorganism), alone and/or in combination with at least one other enzyme, can be encapsulated for use in an animal feed or premix. Furthermore, the glycoside hydrolase (e.g., alpha-L-fucosidase, alone or in combination with at least one direct fed microorganism) as described herein, alone and/or in combination with at least one other enzyme, whether encapsulated or not, may be in the form of granules.

It is believed that glycoside hydrolases as described herein, e.g., an alpha-L-fucosidase as described herein (e.g., an alpha-L-1, 2 fucosidase), may be used in combination with one or more additional enzymes. In some embodiments, the one or more additional enzymes are selected from the group consisting of: those enzymes involved in protein degradation, including carboxypeptidase (preferably carboxypeptidase a, carboxypeptidase Y), aspergillus niger aspartic protease (PEPAa, PEPAb, PEPAc and PEPAd), elastase, aminopeptidase, pepsin or pepsin-like protease, trypsin or trypsin-like protease, acid fungal protease and bacterial protease (including subtilisin and variants thereof); and those enzymes involved in starch metabolism, fiber degradation, lipid metabolism; proteins or enzymes involved in glycogen metabolism; enzymes that degrade other contaminants; acetyl esterase, amylase, arabinoxylase, arabinofuranosidase, exo-and endopeptidases, catalase, cellulase, chitinase, chymosin, cutinase, deoxyribonuclease, epimerase, esterase, amidase, galactosidase, exoglucanase, glucanolytic enzyme, endoglucanase, glucoamylase, glucose oxidase, glucosidase (e.g., a or 13-glucosidase), glucuronidase, hemicellulase, hydrolase, invertase, isomerase, laccase, phenol oxidase, lipase, lyase, mannosidase, oxidase, oxidoreductase, pectinase, pectate lyase, pectoacetase, pectin depolymerase, peptidase, pectin methylesterase, pectolytic enzyme, peroxidase, phenol oxidase, phytase, polygalacturonase, rhamnose-galacturonase, ribonuclease, thaumatin, transferase, transporter, transglutaminase, xylanase, hexose oxidase (D-hexose) (3/4-oxidoreductase, 1.3) and/or other phosphatase acid reductase, 1.5.5. These include, for example, enzymes that adjust the viscosity of the composition or feed.

Furthermore, glycoside hydrolases as described herein, such as alpha-L-fucosidase (e.g., alpha-L-1, 2 fucosidase) may be encapsulated to withstand the acidic pH present in the stomach. Glycoside hydrolase enzymes as described herein, such as alpha-L-fucosidase, whether encapsulated or not, can be used alone or in combination with at least one direct fed microorganism, and can be administered in animal feed or premix. Furthermore, glycoside hydrolases as described herein, such as alpha-L-fucosidase, whether encapsulated or not, can be used alone or in combination with at least one direct fed microorganism, and can be administered in animal feed or premix, and the alpha-L-fucosidase can be in particulate or liquid form. The preferred form is a granule.

The invention may be further understood by reference to the following examples, which are provided for purposes of illustration and are not intended to be limiting.

Examples

Example 1: effects of dietary supplementation with fucosidase on ETEC-infected pigs

This example 1) investigated the effect of dietary supplementation of Fucosidase (FE) on diarrhea scoring, growth performance, fecal excretion and whole blood cell count in weaned pigs experimentally infected with enterotoxigenic escherichia coli (ETEC); and 2) samples were generated for future determination of the effect of dietary FE on ETEC adhesion, intestinal barrier function and integrity, systemic immunity and intestinal microbiome in weaned pigs infected with ETEC.

Materials and methods

A total of 60 weaned pigs (about 21 days old) were used in this experiment, with the same number of castrated boars (barrow) and gilts (gilt). All piglets were genotyped for the F18 receptor status by RFLP and PCR tests to ensure that all enrolled piglets were susceptible to F18 ETEC infection. Blood genotyping of sows and boars was analyzed in an external laboratory and studied using only piglets sensitive to ETEC (H blood group, same as O blood group, determined by FUT genotyping).

Piglets were weaned and kept individually in pens for 21 days, including 7 days before the first ETEC challenge (pre-vaccination) and 14 days after the first challenge (post-vaccination). In this experiment, there were 15 replicates of each treatment, totaling 60 pigs. The experiment was a randomized complete block design with body weight in gender and litter as the block and pigs as the experimental units. After 7 days of acclimation, all piglets were vaccinated orally with 3ml f18 ETEC/day, for 3 consecutive days from day 0 to day 2 post vaccinations. F18 ETEC was originally isolated from field outbreaks by the veterinary diagnostic laboratory at the state university of illinois (University of Illinois, VETERINARY DIAGNOSTIC LAB) in the united states. F18 ETEC expresses heat labile toxins, heat stable toxin b, and Shiga (Shiga) -like toxins, and is provided at a dose of 10 ¹⁰ cfu/3mL in PBS.

The piglets can eat and drink water at will. Providing an environmental capacity for each pig. The lights in the environmental control unit are on at 07:00 and off at 19:00 a day. Throughout the experiment, the room temperature was 25℃to 27 ℃. Throughout the 21-day study, experimental diets were provided to piglets. The 4 experimental diets were as follows:

1) Control diet based on corn and soybean meal

2) Control diet supplemented with 50mg FE/kg feed

3) Control diet supplemented with 100mg FE/kg feed

4) Control diet supplemented with 200mg FE/kg feed

The diet is formulated to meet the nutritional needs of the pig (NRC, 2012). The diet does not contain spray dried plasma and high levels of zinc oxide in excess of nutritional requirements. The diet also does not include the use of antibiotics and phytase. All diets were provided in dietary form.

All pigs were euthanized at day 14 post inoculation. Pigs were anesthetized by intramuscular injection of a 1mL mixture of 100mg of tulathrozole, 50mg of ketamine and 50mg of xylazine (2:1:1) prior to euthanasia. After anesthesia, 78mg sodium pentobarbital/1 kg body weight was injected intracardially for euthanizing pigs.

Response criteria and sampling:

The growth performance is as follows: diarrhea and alertness were scored twice daily during the experiment from day 0 before inoculation to day 14 after inoculation. Diarrhea scores were assessed visually by 2 independent assessors using a 5-point system (1=normal stool, 2=wet stool, 3=mild diarrhea, 4=severe diarrhea, 5=watery diarrhea). Diarrhea frequency was calculated as the percentage of days in pens (pen) with diarrhea score of 3 or higher. Alertness scores were assessed using a 3-point system (1=normal, 2=slightly depressed or unequivocal acquisitions, 3=severely depressed or lying). Pigs were weighed on weaning day (d-7), day 0, day 7 and day 14 post inoculation. Feed intake was recorded throughout the experiment. Average daily gain, average daily feed intake and gain: the feeding amount was calculated for each interval from day-7 to day 0, day 0 to day 7 (PI), day 7 to day 14 after inoculation, and the cumulative amount from day-7 to day 14 (PI) and day 0 to day 14 after inoculation.

ETEC fecal excretion: fecal samples were collected from the rectum using fecal circles or cotton swabs on day 0 before E.coli inoculation, day 2, day 5, day 7, day 10 and day 14 post inoculation to test the beta-hemolytic E.coli flora and percentage (Song et al 2012; liu et al 2013).

Whole blood count analysis: blood samples were collected from the jugular veins of all pigs with EDTA at the beginning of the experiment, day 0 (pre-inoculation) and day 2, day 5 and day 14 post-inoculation to obtain whole blood. Whole blood samples were used to measure total blood cell counts and blood cell class counts using a multiparameter automated programmed hematology analyzer (Drew/ERBA science 950FS hematology analyzer, delukesciences Corp (DREW SCIENTIFIC Inc.), miami, florida, USA).

Fecal sample: also at the start of the experiment, day 0 post inoculation (pre-inoculation), day 5 and day 14 were collected from the rectum and stored in a-80 ℃ refrigerator for intestinal microbiome analysis.

Blood sample: at the start of the experiment, day 0 (pre-inoculation) and day 2, day 5 and day 14 post-inoculation, plasma was obtained from jugular veins of all pigs without EDTA. Serum samples were analyzed for proinflammatory cytokines (TNF- α, IL-1 β), cortisol, and acute phase proteins (C-reactive protein and haptoglobin) using commercial ELISA kits.

Statistical analysis

The data were validated for normalization and the UNIVARIATE program (SAS software company (SAS inst. Inc.) was used, north carolina, usa. Outliers were identified as values that deviate from the process average by more than 3 times the quartile spacing and were removed. Data were analyzed by analysis of variance using PROC MIXED of SAS (SAS software company, kari, north carolina, usa) in a randomized complete block design with pigs as experimental units. The statistical model receives diet as the dominant effect and groups as the stochastic effect. The processing is differentiated by using the LSMEANS statement of PROC MIXED and PDIFF options. The dose effect (linear and quadratic) of FE was analyzed using the comparison statement. Diarrhea frequency was analyzed using the chi-square test. Statistical significance and trend were identified with P <0.05 and 0.05.ltoreq.P <0.10, respectively.

Results

As shown in table 1, the growth performance data from this study showed a linear and quadratic increase in daily feed intake (P < 0.05) from day 0 to day 7, from day 7 to day 14, and from day 7 to day 14 post-inoculation as the FE dose was increased. However, body weights at day 7 and day 14 post inoculation showed a numerical improvement only after enzyme supplementation.

Table 1: body weight, ADG, ADFI, diarrhea and fecal scores from study

/>

^ab LS mean values with different superscripts were different (student t test, P < 0.05)

* Interaction of time with treatment, P <0.05

Similarly, the weight gain during the post-inoculation period also showed a numerical improvement with the addition of enzyme. Piglets fed a diet supplemented with 50mg FE showed a significant decrease in diarrhea frequency when compared to the control. On days 10 and 14 post-inoculation, the fecal excretion of ETEC decreased significantly with increasing FE dose, except that on day 10 the 200mg FE dose showed no difference (P > 0.05) compared to the control. For whole blood counts, the neutrophil count on day 0 showed a significant (P < 0.05) treatment effect, with FE supplementation showing a linear decrease in neutrophil levels, see fig. 1 and table 2 below.

Table 2:

* Time effect, P <0.01; granule effect, P <0.01; treatment x granule, p=0.083

Example 2: use of fucosidase to increase IgA secretion levels in pigs

IgA levels bound to fecal microbial surfaces are related to luminal concentration, specificity and affinity of IgA secreted across intestinal epithelium. Low-level IgA binding in weaned pigs may mean delayed maturation of mucosal adaptive immunity in response to increasingly diverse signals from microorganisms and food antigens. To assess the maturation status of piglets receiving experimental feed formulations containing fucosidase, the present example measured IgA levels by immunolabeling fecal microorganisms and analyzing the bound fractions by flow cytometry.

Materials and methods

Faecal samples collected on day 0, day 5 and day 14 were freshly collected and cryopreserved (-80 ℃). Sampling days were defined as follows: day 0 was collected seven days after the experimental feeding regimen and prior to the first inoculation of ETEC, day 5 peak period of the post-ETEC challenge symptom period, day 14 end of the test period, where most animals had recovered completely from the effects of ETEC challenge.

All fecal samples were thawed and approximately 100mg fecal material was transferred to wells of a deep well assay plate containing 1.0ml of PBS, 2mM EDTA and 1% BSA. The plates were spun at 300Xg for 2 minutes in a centrifuge to pellet the particulate fecal material, and then 250ul of bacterial-containing supernatant was transferred to a new plate containing PBS, 2mM EDTA, 1% BSA. The second round of centrifugation, aspiration and re-suspension was performed by centrifuging at 5000Xg for 10 minutes at4℃to pellet the resuspended fecal bacteria and aspirate the supernatant and re-suspend the bacterial cell pellet in 1.0ml PBS, 2mM EDTA, 1% BSA as done in the previous step.

Mu.l of the resuspended pellet was incubated with a volume of 20. Mu.l of goat anti-pig IgA-FITC antibody (Besepal laboratories (Bethyl Laboratories)) and incubated on ice for 40 minutes. After incubation with anti-IgA antibodies, 160. Mu.l of PBS, 2mM EDTA, 1% BSA containing 1:2000 dilution of SYTO 62 (Invitrogen) was added to the bacterial/antibody primary incubation to label DNA-containing bacterial cells with fluorescent signals for use as trigger thresholds, thereby excluding non-bacterial small fragments from the sample from flow cytometry analysis.

Flow cytometry was performed on Acea NovoCyte flow cytometer and analyzed with NovoExpress software. The analysis gate was drawn to cover cells with green fluorescence emission signal from FITC-labeled anti-IgA antibody, which also excludes unbound cell fractions. An irrelevant goat antibody labeled with FITC was used to identify the boundary between unlabeled and labeled cell populations. The average fluorescence signal of the IgA-bound population was used as a relative measure of the IgA-bound quality per animal and at each time point. Statistical analysis and data graphs were generated using GRAPHPAD PRISM.1.2.

Results

The results indicated that IgA levels on the microbial surface from piglets receiving the feed supplemented with fucosidase were significantly higher than animals receiving the control feed. The observed increase in IgA measurements in response to fucosidase treatment was significantly different between groups (virgi anova d0p=0.0007.d5p=0.0009.d14p=0.02) and followed a linear dosing trend at all time points. (FIG. 2).

Furthermore, fecal IgA measurements were found to be significantly increased by feeding fucosidase and strongly correlated with improved growth performance indicators. Table 3 summarizes the correlation between IgA levels on day 0 (D0), day 5 (D5) and day 14 (D14) and Body Weight (BW), average Daily Gain (ADG) and Average Daily Food Intake (ADFI).

Table 3: a significant correlation between IgA secretion levels and growth performance indicators was determined by calculating pearson correlation statistics between variables. Pearson statistics are reported that are statistically significant for at least one IgA measurement. Pearson r values meeting the 95% confidence threshold are shaded in bold gray.

The IgA measured by D0 is correlated with all subsequent IgA measurements; d5 (r=0.6666) and D14 (r= 0.4776) indicate that IgA levels obtained in the first week after weaning are largely persistent in individuals throughout ETEC challenge and recovery. Animals with higher body weight by D0 correlated positively with IgA at D0 (r= 0.3865). Higher IgA values on day 0 correlated with ADFI (r= 0.4468) and ADG (r= 0.4888) on day 7 post-weaning. While all animals experienced slow growth throughout the ETEC infection period, animals with higher IgA continued to eat more feed throughout the infection and recovery period following ETEC challenge. Since maternal secretory IgA from milk is unlikely to be the major source of IgA measured in the sample to D0, these measurements represent only the IgA secretory output of piglets and are markers of the mucosal immune system maturation status of piglets.

Taken together, these results indicate that enhanced IgA secretion due to early post-weaning administration of fucosidase correlates with stronger performance prior to ETEC challenge and is maintained at higher levels after ETEC symptom relief. This indicates that feeding fucosidase has a positive impact on long-term performance improvement and infection recovery.

Example 3: changing piglet manure microbiota by feeding fucosidase

This example shows how exogenous fucosidase affects a population of microorganisms by analyzing the 16s ribosomal RNA sequences of the microorganisms in fecal samples collected at various time points.

Materials and methods

Faecal samples were collected at the test sites on day-7, day 0, day 5 and day 14. Approximately 100mg of freshly thawed fecal material was transferred to 96-well assay blocks and genomic DNA extraction was performed using magatlact microbial DNA extraction kit (Qiagen) according to the manufacturer's protocol. Purified metagenomic DNA for 16S colony sequencing was treated as follows for 16S bacterial population sequencing: mu.l of metagenomic DNA was added to the PCR reaction together with 25ul of the UNG-free ABI Universal TaqMan reaction mixture (Sieimerfeier Co. (ThermoFisher) # 4326614), 0.1. Mu.l of 100. Mu.M each PCR primer (Illumina-V4-515F-RJ：TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCCAGCMGCCGCGGTAA(SEQ ID NO:1)),Illumina-V4-806R-RJ：GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT(SEQ ID NO:2)) and 24.8. Mu.l of molecular biology grade water (total volume 50. Mu.l).

The reaction was subjected to thermal cycling as follows: 35 cycles were performed at 95℃for 10min followed by 95℃for 15 seconds +55℃for 30 seconds +72℃for 2 min. Amplification reactions were purified using an Agilent Bravo automated robotic workstation using Ampure XP magnetic beads (Beckman Coulter) A63881 according to the manufacturer's instructions. Then indexing was performed in a second PCR reaction using Illumina XT index primer (Illumina XT Index Primers) (Illumina XT v 2.0#FC-131-2001-2004) for 15 cycles under the same conditions as described above to index each amplicon pool of 2. Mu.l. The indexed amplicons were then pooled and purified on an agilent Bravo robotic workstation using AmPure XP magnetic beads. Pooled, indexed amplicons were quantified using Kapa Illumina library quantification kit (Kapa Illumina Library Quantification Kit) (kapa#kk 4835) according to manufacturer's instructions. The purified, quantified, indexed pool was loaded onto Illumina MiSeq with 15% Illumina PhiX (Illumina FC-110-3001) at a final concentration of 8pM.

Sequencing was run 2×250 paired-end cycles and FASTQ files were exported for analysis. Sequence reads were assembled and aligned with 16s reference sequences from an internally collated reference database to assign taxonomic identities to nearest known species, sequence reads without species matching were assigned to separate taxonomic groupings labeled with nearest species names with% identity to the reference sequences. The change in microbial abundance due to treatment effect was analyzed using the kruercal-wales test and the danen multiplex comparison correction.

Results

The population of microorganisms is significantly altered in response to treatment with the fucosidase. Most notable is the concomitant change between Sulfate Reducing Bacteria (SRB) inert vibrio desulphate and methanogenic archaea smith in the D0 sample (fig. 3). Brevibacterium smith is widely abundant in all fecal samples collected on day-7. By D0, animals receiving fucosidase had significantly lower levels of brevibacterium smith, compared to control animals. The decrease in Brevibacterium smith is associated with an increase in the abundance of inert Vibrio desulphus. The relationship between inert vibrio desulphurisation and the schmidt methanoculleus abundance pattern is highly inversely correlated, ρ= -0.3217, p=0.01 (table 4).

Table 4: the Spearman (Spearman) correlation table shows Spearman statistics (ρ) and corresponding P values between a) brevibacterium smith or b) vibrio inert desulphurized and individual animal performance measurements. Abundance%, igA, and blood cell levels were all from the D0 time point. Growth and feed intake measurements are averaged over several time intervals, defined herein as (week 1) equal to D-7 to D0, (week 2) equal to D0 to D7, and (week 3) equal to day 7 to day 14

There is an inverse relationship with IgA measurement values, in which Brevibacterium smith shows negative correlation ρ= -0.466, p=0.0002, and vibrio inert desulfator shows positive correlation ρ=0.3039, p=0.018. The inert Vibrio desulphatus also showed positive Szechwan correlation with lymphocytes and negative correlation with basophils (Table 4). D0 methanogen abundance was also inversely related to ADG in the first week post weaning and correlated with the decrease in average daily feed intake for all experimental time intervals.

Taken together, these data indicate that feeding fucosidase causes consumption of Brevibacterium smith in the intestine, whereas inert Vibrio desulphurisation is enriched in the intestine and is associated with favorable immune and growth performance indicators.

Furthermore, in addition to changes in methanogenic and sulfate-reducing bacteria, fucosidase treatment also alters the abundance of species within the genus Prevotella. Fig. 4 shows the relative abundance of fecal prasuvorexant and closely related species (including stencescens) per treatment group. Increasing the abundance of prasuvorexant in response to fucosidase treatment indicates effective transitional adaptation and diversification of the intestinal microbiota from breast milk to a cereal-based diet.

Example 4: fucosidase treatment affects lymphocyte and neutrophil levels

In this example, the levels of lymphocytes and neutrophils from fucosidase-treated pigs were examined compared to controls.

Materials and methods

Leukocyte levels were measured in samples taken at the beginning of the experiment (day-7), after the first week of receiving experimental diet (day 0), and at several time points after challenge with ETEC (days 2, 5 and 14). CBC (whole blood count) analysis was performed at the comparative pathology laboratory (Comparative Pathology Laboratory) of the university of california, davis division (University of California, davis). Whole blood samples were collected from the jugular veins of all pigs with EDTA and used to measure total blood cell counts and blood cell classification counts by a multiparameter automated programmed hematology analyzer (Drew/ERBA science 950FS hematology analyzer, delu science company, miami, florida, usa). CBC levels are expressed as absolute counts (1000 cells per microliter of blood) or as a percentage of total leukocytes. Significant differences in treatment effect were analyzed using one-way anova. In addition, the neutrophil/lymphocyte ratio (NLR) was calculated. NLR measurements were determined as non-Gaussian distributions and analyzed for significance using the non-parametric Krueschel-Wolis test. The linear trend per treatment dose group was tested in the one-way analysis of variance package of GRAPHPAD PRISM.1.2.

Results

The percentage of neutrophils in animals receiving fucosidase was found to be significantly lower (analysis of variance p=0.02), while lymphocytes had a linear trend of significant rise with dose (p=0.025), analysis of variance (p=0.15). NLR is also significantly lower (krukar-walis p=0.045; fig. 5). Neutrophil and lymphocyte levels are affected by a number of factors including cytokines, microbial metabolites, cortisol levels and catecholamines. An elevated NLR value may be predictive of poor clinical outcome for human infection. In the context of the present study and without being bound by theory, changes in neutrophil and lymphocyte values in the blood of animals receiving fucosidase may mean that the localization of many signaling molecules present in large numbers in the intestine to systemic signaling receptors (compartmentalization) is improved.

Example 5: role of fucosidase supplementation in weaned piglets

The purpose of this example was to investigate the effect of exogenous fucosidase supplementation on the growth performance, immune response and microbiota conversion of weaned pigs.

From the date of weaning, 216 total weaned piglets (n=12, ratio of male to female 1:1) weighing 6kg to 7kg were group-fed (6 piglets per column) and randomly allocated to 3 diet treatments. Piglets were fed an enzyme-containing diet from day 0 (weaning) to day 21, and all pigs were fed a control diet without enzyme from day 22 to day 42.

10 Piglets were bled and blood collected (whole blood and serum) before the study was started on day 0 (weaning day). They were then euthanized to collect digesta (jejunum, ileum, and cecum) and tissue samples (ileum and cecum).

The 12 piglets (1 head/column) from each treatment were collected on days 15 and 29 to collect blood (whole blood and plasma) and then euthanized to collect digesta (jejunum, ileum and cecum) and tissue samples (ileum and cecum). Pigs were anesthetized by intramuscular injection of a mixture of 50mg ketamine and 50mg xylazine (1:1) prior to euthanasia. After anesthesia, 78mg sodium pentobarbital/1 kg body weight was injected intracardially for euthanizing pigs.

Body weight and feed intake were recorded weekly from day 0 (weaning) to day 42.

Allowing piglets to eat and drink water at will. A lighting program of 16 hours light and 8 hours darkness was then performed. The room temperature was maintained at 30 ℃ during cycle 1 and gradually decreased to 24 ℃ by week 6. The experimental diet provided to the piglets throughout the 21 day period was as follows:

a) Control diet based on corn, wheat and soybean meal ¹

B) Control diet supplemented with 100ppm FE (uncoated-WGW)

C) Supplemented with 100ppm FE (coated)) Is a control diet of (2)

From day 22 to day 42, all piglets were given an unsupplemented control diet (diet a).

Response criteria and sampling

Diarrhea score: diarrhea was scored twice daily during the experiment from day 0 to day 14. Diarrhea scores were assessed visually by 2 independent assessors using a 5-point system (1=normal stool, 2=wet stool, 3=mild diarrhea, 4=severe diarrhea, 5=watery diarrhea).

The growth performance is as follows: body weight was recorded weekly and then average daily body weight gain was calculated. Feed intake and residual feed for each pen was recorded weekly, and then the average daily feed intake was calculated.

Whole blood count analysis: on day 0, day 15 and day 29, blood samples were collected from the jugular veins of all pigs with EDTA to obtain whole blood. Whole blood samples are used to measure total blood cell counts and differential blood cell counts using a multiparameter automated programmed hematology analyzer.

Serum samples: on day 0, day 15 and day 29, blood samples were collected from the jugular veins of all pigs to isolate serum. Serum samples were analyzed for proinflammatory cytokines (IL-1. Beta., IL-6, IL-10, TNF, IL-12) and acute phase proteins (C-reactive protein and haptoglobin) using commercial ELISA kits.

Intestinal tissue sample: sections of jejunum, ileum and cecum were collected on day 0, day 15 and day 29 and stored at-80 ℃ for further use in gene expression (tight junctions, mucins and F4/F18 receptors)

Enzymatic Activity of the digest samples: samples of digesta from the stomach, mid jejunum, ileum were collected on day 15 to determine enzyme recovery.

The digests were subjected to microbiome analysis: samples of digesta from the ileum and cecum were collected on day 0, day 15 and day 29 for microbiome analysis.

Fecal and digests: the feces were rapidly frozen until use. Frozen feces were re-hydrated in PBS and suspended by vortexing. Supernatants were collected after centrifugation for ELISA. For digests, rinse with PBS and filter. Supernatants were collected for ELISA.

ELISA: SIgA (total SIgA) was measured by ELISA. All ELISA kits were purchased from Mybosch (MyBiosource) and the experiments followed the instructions of the suppliers. The ELISA assay is a sandwich ELISA. Each sample was performed in duplicate.

Results

From day 0 to day 20, 0 deaths were observed in pigs fed with feeds supplemented with fucosidase. In sharp contrast, 5 animals in the non-supplemented control group died three weeks prior to the trial. Once the fucosidase supplementation ended, pigs in both experimental groups were observed to die, with 2 pigs in the WCW group and 4 pigs in the coating group. The death number data is shown in table 5. The total mortality of the control group was 4.63%, the total mortality of the WGW group was 1.85%, and the total mortality of the coated group was 3.7%.

Table 5: death number data in fucosidase supplementation assay

Multivariate potential class model (LCA) statistical analysis was performed on FCR data.

Process variance testing (in terms of variable levels) is performed to allow a determination of which individual variables are up-and down-regulated by the process. In the cells of table 6 are the Z scores of the information carrier, and these scores are explained by the sign (direction of action) and the size (intensity, such that the higher the absolute value the more pronounced). The significant effect at the 5% level (i.e. absolute Z score > 1.96) as determined by the double-sided test is indicated with color coding (shading = positive score of the information carrier).

Table 6: feed Conversion Ratio (FCR) of the treatment group in the fucosidase supplementation assay

"Trt_1" is the average value of the comparison (trt=1=control) compared to (trt=2=wgw) and (trt=3=coated).

"Trt_2" is the average value of the comparison (trt=2=wgw) compared to (trt=1=control) and (trt=3=coated).

"Trt_3" is the average value of the comparison (trt=3=coated) compared to (trt=1=control) and (trt=2=wgw).

"Trt1_2" is a pairwise comparison (trt=1=control) compared to (trt=2=wgw).

"Trt1_3" is a pairwise comparison (trt=1=control) compared to (trt=3=coated).

"Trt2_3" is a pairwise comparison (trt=2=wgw) compared to (trt=3=coated).

"Trt1_23" is the average value of the comparison (trt=1=control) compared to (trt=2=wgw) and (trt=3=coated; substantially the same as "trt_1").

AUC is area under the curve and is the statistical data for FCR over the study period (day 0-day 42).

D21—0 is statistical data of FCR after the first 21 days (=period of feeding pigs with fucosidase)

D42—21 is statistical data for FCR between 21 and 42 days (=period of feeding pigs with a control diet without fucosidase).

For FCR, the optimal direction of the variable is low, optimality is successful if "trt1_23" is positive (> 1.96, "shadow" colored).

Thus, for FCR (where lower FCR is optimal/preferred), the treatment was observed to have beneficial effects compared to control for the_subgroup_ = AUC and the_subgroup_ = d21_0, but not for the_subgroup_ = d42_21.

Thus, this experiment shows that feeding 100ppm of coated fucosidase had a significant improvement in FCR during the period of feeding the enzyme (day 0-day 21) and that feeding WGW formulated fucosidase (day 0-day 21) had a tendency to produce a positive effect.

When measured throughout the test period (day 0-day 42), feeding the average of the WGW formulated fucosidase and the two fucosidase enzyme preparations (WGW plus coated) resulted in a significant improvement in FCR, although the enzyme was not fed on days 21-42.

As shown in FIG. 6, in piglets treated with fucosidase, there was a significantly higher amount of total SIgA in the feces compared to control (Tr3: 38.4+ -6.2 ng/ml compared to control: 16.8+ -4.1 ng/ml, p < 0.01). An increase in the number of SIgA in the ileal content was observed in the Tr3 treated piglets (11.5±1.6ng/ml in Tr3 versus 10.7±1.7ng/ml in control; 10.4±2.7ng/ml in Tr3 versus 8.8±1.3ng/ml in control; 11.3±2.9ng/ml in Tr3 versus 9.4±2.5ng/ml in control on day 42). This represents an increase of 7.5%, 18.2% and 20.2% in the Tr3 treated piglets at 15, 30 and 42 days, respectively. Upregulation of antibodies is class-specific in that only sIgA is affected, while IgG is not.

Sequence(s)

GDGDTSKDDWLWYKQPASQTDATATAGGNYGNPDNNRWQQTTLPFGNGKIGGTVWGEVSRERVTFNEETLWTGGPGSSTSYNGGNNETKGQNGATLRALNKQLANGAETVNPGNLTGGENAAEQGNYLNWGDIYLDYGFNDTTVTEYRRDLNLSKGKADVTFKHDGVTYTREYFASNPDNVMVARLTASKAGKLNFNVSMPTNTNYSKTGETTTVKGDTLTVKGALGNNGLLYNSQIKVVLDNGEGTLSEGSDGASLKVSDAKAVTLYIAAATDYKQKYPSYRTGETAAEVNTRVAKVVQDAANKGYTAVKKAHIDDHSAIYDRVKIDLGQSGHSSDGAVATDALLKAYQRGSATTAQKRELETLVYKYGRYLTIGSSRENSQLPSNLQGIWSVTAGDNAHGNTPWGSDFHMNVNLQMNYWPTYSANMGELAEPLIEYVEGLVKPGRVTAKVYAGAETTNPETTPIGEGEGYMAHTENTAYGWTAPGQSFSWGWSPAAVPWILQNVYEAYEYSGDPALLDRVYALLKEESHFYVNYMLHKAGSSSGDRLTTGVAYSPEQGPLGTDGNTYESSLVWQMLNDAIEAAKAKGDPDGLVGNTTDCSADNWAKNDSGNFTDANANRSWSCAKSLLKPIEVGDSGQIKEWYFEGALGKKKDGSTISGYQADNQHRHMSHLLGLFPGDLITIDNSEYMDAAKTSLRYRCFKGNVLQSNTGWAIGQRINSWARTGDGNTTYQLVELQLKNAMYANLFDYHAPFQIDGNFGNTSGVDEMLLQSNSTFTDTAGKKYVNYTNILPALPDAWAGGSVSGLVARGNFTVGTTWKNGKATEVRLTSNKGKQAAVKITAGGAQNYEVKNGDTAVNAKVVTNADGASLLVFDTTAGTTYTITKK(SEQ ID NO:3)

Claims

1. A method of improving intestinal health in an animal, the method comprising administering to the animal an effective amount of a glycoside hydrolase enzyme capable of removing at least one α -1, 2-L-fucose moiety from an intestinal mucin layer.

2. The method of claim 1, wherein improving intestinal health comprises one or more of: a) Promoting the growth of one or more commensal enterobacteria; b) Reducing the growth of one or more methanogenic archaea; c) Increasing the amount of intestinal IgA; d) An amount that reduces intestinal neutrophil levels; e) Increasing Average Daily Food Intake (ADFI) of the animal; f) Reducing the death number; and/or g) improving Feed Conversion Ratio (FCR).

3. The method of claim 1 or claim 2, wherein the commensal bacteria comprise a Prevotella spp and/or a Megasphaera spp.

4. The method of any one of claims 1-3, wherein the methanogenic archaea comprises a methanoculleus species (Methanobrevibacter spp.).

5. The method of claim 4, wherein the methanogenic archaea comprises Brevibacterium smith (M.smithii).

6. The method of any one of claims 1-5, wherein the glycoside hydrolase is an alpha-L-1, 2 fucosidase.

7. The method of claim 6, wherein the alpha-L-fucosidase is selected from the group consisting of glycoside hydrolase family 95 (GH 95) and glycoside hydrolase family 29 (GH 29).

8. The method of any one of claims 1-7, wherein the method further comprises administering to the animal an effective amount of at least one direct fed microorganism.

9. The method of any one of claims 1-8, wherein the method further comprises administering to the animal an effective amount of one or more additional enzymes selected from the group consisting of: proteases, xylanases, beta-glucanases, phytases and amylases.

10. The method of any one of claims 1-9, wherein the alpha-L-1, 2 fucosidase and/or additional enzyme is encapsulated.

11. A method according to any one of claims 1-10, wherein the alpha-L-1, 2 fucosidase and/or the direct fed microorganism and/or the additional enzyme are administered in an animal feed or premix.

12. The method of any one of claims 1-11, wherein the alpha-L-1, 2 fucosidase and/or additional enzyme is in the form of particles.

13. The method of any one of claims 1-12, wherein the animal is a pig.

14. The method of claim 13, wherein the pig is a piglet, a growing pig or a sow.

15. The method of claim 14, wherein the piglet is a weaned piglet.

16. The method of any one of claims 1-15, wherein the glycoside hydrolase capable of removing at least one alpha-1, 2-L-fucose moiety from an intestinal mucin layer is not administered to treat or prevent an enteropathogenic infection and/or diarrhea.

17. The method of any one of claims 1-16, wherein the glycoside hydrolase capable of removing at least one alpha-1, 2-L-fucose moiety from the intestinal mucin layer is administered for at least 3 weeks.

18. The method of any one of claims 2-17, wherein the intestinal IgA binds to fecal microorganisms.

19. A method of reducing methane emissions from an animal, the method comprising administering to the animal an effective amount of a glycoside hydrolase enzyme capable of removing at least one α -1, 2-L-fucose moiety from an intestinal mucin layer.

20. The method of claim 19, wherein the reduced methane emissions are due to a reduction in the growth of one or more methanogenic archaea in the intestinal tract of the animal.

21. The method of claim 19 or claim 20, wherein the methanogenic archaea comprises a methanobrevibacterium species.

22. The method of any one of claims 19-21, wherein the methanogenic archaea comprises brevibacillus smith.

23. The method of any one of claims 19-22, wherein the glycoside hydrolase is an alpha-L-1, 2 fucosidase.

24. The method of claim 23, wherein the alpha-L-1, 2 fucosidase is selected from the group consisting of glycoside hydrolase family 95 (GH 95) and glycoside hydrolase family 29 (GH 29).

25. The method of any one of claims 19-24, wherein the alpha-L-1, 2 fucosidase is encapsulated.

26. The method of any one of claims 19-25, wherein the alpha-L-1, 2 fucosidase is in an animal feed or premix.

27. The method of any one of claims 19-26, wherein the alpha-L-1, 2 fucosidase is in the form of particles.

28. The method of any one of claims 19-27, wherein the animal is a pig.

29. The method of claim 28, wherein the pig is a piglet, a growing pig or a sow.

30. The method of claim 29, wherein the piglet is a weaned piglet.

31. The method of any one of claims 19-30, wherein the glycoside hydrolase capable of removing at least one alpha-1, 2-L-fucose moiety from the intestinal mucin layer is administered for at least 3 weeks.