CN118006735A - SNP chip and preparation method and application thereof - Google Patents

Abstract

The invention relates to a SNP chip and a preparation method and application thereof, wherein the SNP chip comprises a solid phase carrier modified with two primers, a cluster of oligonucleotide probes prepared from a plurality of library sequences is immobilized on the solid phase carrier through the primers, the oligonucleotide probes sequentially comprise a P7 sequence from the 5 'end to the 3' end, a linker sequence 1, a specific hybridization sequence and a sequence of at least four nucleotides generated by enzyme digestion of the library sequences, and the nucleotides are arbitrarily selected from A, T, C, G. The invention also provides a preparation method of the SNP chip and a kit formed by the SNP chip, wherein the SNP chip has high density, can detect more than 2000 thousands of SNP loci, has higher flux, can meet the requirement of detecting SNP variation loci in a large flux, and reduces the cost through scale effect.

Description

SNP chip and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a SNP chip and a preparation method and application thereof.

Background

A gene chip (also called a single nucleotide polymorphism (single nucleotide polymorphism, SNP) microarray (array), in which millions of DNA marker sequences are regularly arranged on a glass slide or a special silicon wafer, and immobilized to form a DNA or SNP probe array. The working principle is that the DNA marker sequence fixed on the chip and the target genome undergo base pairing reaction, so that the gene information is accurately identified. The most widely used SNP chip in plant breeding is to detect a large number of SNP mutation sites in biological individuals by using on-chip SNP probes, so that the genotype and key genetic variation of the genome can be deduced. SNP chips specifically designed for genomic breeding are called "genomic breeding chips". Currently, there are two U.S. biotechnology companies on the market, illumina and Affymetrix, providing genomic breeding chip fabrication techniques. The Illumina company mainly manufactures SNP chips based on Infinium platform technology, and the Affymetrix company manufactures SNP chips by Axiom platform technology. Illumina Infinium the chip is a high density chip based on optical fiber microbeads, and a specific gene probe sequence is coupled with microbeads with the diameter of 3 μm, and then self-assembled in micropores of a matrix, thereby forming a microbead chip. AffymetrixAxiom the chip adopts in situ photolithography technology, and the gene probe sequence is synthesized on the substrate in situ by photolithography. The two chips are widely applied to human and animal genome variation researches and are also applied to plant genome breeding in recent years.

At most, the SNP chip manufactured by the conventional method can detect more than 500 tens of thousands of SNP loci, the flux is relatively small, and the cost is high. However, plant genome breeding involves SNP chips requiring large throughput, and how to realize SNP chips with higher throughput is still further developed.

Disclosure of Invention

Based on the above, the invention aims to provide an SNP chip, and a preparation method and application thereof, and the preparation method can be used for manufacturing high-density SNP chips, detecting more than 1000 thousands of SNP loci, has higher flux and simultaneously reduces cost through scale effect.

The technical scheme for achieving the purpose comprises the following steps.

In a first aspect of the present invention, there is provided a SNP chip comprising a solid support modified with two primers, a cluster of oligonucleotide probes prepared from a plurality of library sequences immobilized on the solid support via the primers, the oligonucleotide probes comprising, in order from the 5 'end to the 3' end, a P7 sequence, a linker sequence 1, a specific hybridization sequence and a sequence of at least four nucleotides generated by cleavage of the library sequences, the nucleotides being arbitrarily selected from A, T, C, G.

In a second aspect, the present invention provides a method for preparing any one of the SNP chips, including the steps of:

S1, designing at least one library sequence, wherein the library sequence sequentially comprises a P7 sequence, a linker sequence 1, a specific hybridization sequence, a restriction enzyme cleavage site sequence, a linker sequence 2 and a P5 sequence from the 5' end to the 3' end, and the restriction enzyme cleavage site sequence is a sequence capable of generating at least four arbitrary nucleotides at the 3' end after enzyme cleavage;

S2, mixing at least one library sequence, loading the mixture onto a solid phase carrier, amplifying and sequencing, wherein a library sequence cluster is fixed on the solid phase carrier, and the P7 sequence is hybridized with a primer on the solid phase carrier so as to amplify the library on the surface of a chip;

S3, performing enzyme digestion, forming an oligonucleotide probe cluster fixed on the solid phase carrier after enzyme digestion of the library sequence, and drying to obtain the oligonucleotide probe cluster.

In some of these embodiments, the restriction enzyme is an enzyme capable of generating at least four arbitrary nucleotides at the 3' end of the cleavage site sequence after cleavage, and in some preferred embodiments, baeI, bar I.

In some of these embodiments, the at least four arbitrary nucleotides are 4-6 nucleotides, the nucleotides being arbitrarily selected from A, T, C, G.

In some of these embodiments, the ratio of the amounts of each of the library sequences used in the mixing is equal.

In some of these embodiments, the amplification and sequencing in step S2 is performed in a single-ended sequencing manner.

In a third aspect, the invention provides an application of any one of the SNP chips in detecting SNP variation sites in plant breeding.

In a fourth aspect, the present invention provides a method for detecting SNP mutation sites of a species, comprising the steps of:

S1) obtaining any one of the SNP chips;

S2) hybridizing the sample to be detected with the SNP chip, capturing the corresponding gene by the probe after hybridization, performing one-base extension reaction by taking the gene as a template, wherein dNTPs used for extension are blocked dNTPs with fluorescent groups, and photographing the chip after extension to obtain the base types polymerized in each capturing region.

In some embodiments, the species is a plant or animal.

In a fifth aspect, the invention provides a kit for detecting SNP mutation sites of a species, comprising any one of the SNP chips.

In some embodiments, a restriction enzyme is also included, preferably the restriction enzyme is Bae i, bar i.

Compared with the prior art, the invention has the following beneficial effects:

The invention is to manufacture SNP chip based on sequencing chip, generate various probes in the amplifying mode in the sequencing process, and obtain the position information of the probes in the sequencing mode; the capture probes are obtained by restriction enzyme digestion, and since the detection of SNP loci on a chip requires the detection of various genes, the probe sequences of each different cluster region are different, and thus the used endonucleases must be the enzymes that produce 3' -terminal NNNNNN sequences after digestion, such as BaeI, bar I, etc. The SNP chip obtained by the invention can detect 70-80 samples at the same time at most under the condition of detecting the same number of SNP loci, or can detect 2000-2500 ten thousand SNP loci at most under the condition of detecting the same number of samples, the flux is obviously improved, the SNP chip can be widely used for detecting SNP variation loci in plant genome breeding, and the cost is reduced through scale effect.

Drawings

FIG. 1 is a schematic diagram of the composition of library sequences.

FIG. 2 is a schematic diagram of amplification, sequencing and cleavage at the time of SNP chip preparation.

FIG. 3 is a schematic diagram showing the result of scanning photographing of the chip prepared in example 1 by Salus Pro sequencer.

FIG. 4 is a schematic diagram showing the result of calculating the cleavage efficiency of the chip prepared in example 1 by fluorescence signal.

FIG. 5 is a schematic representation of the position information of the cluster site generated on-chip for each of SEQ ID NO.1-SEQ ID NO.4 libraries.

FIG. 6 is a diagram showing SNP basic information detection.

Detailed Description

The present invention will be described more fully hereinafter in order to facilitate an understanding of the present invention. This invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

The experimental methods, which are not specified in the following examples, are generally carried out according to conventional conditions, such as Green and Sambrook-s.A.fourth edition, molecular cloning, instruction manual (Molecular Cloning: ALaboratory Manual), published in 2013, or according to the conditions recommended by the manufacturer. The various chemicals commonly used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

In some embodiments of the present invention, there are provided a method of preparing an SNP chip and a detection method using the SNP chip, including the steps of:

Designing a library: the library sequences are mainly divided into 5 parts, wherein P5 and P7 are sequences amplified on a substrate (a solid phase carrier modified with two primers) constituting a chip before sequencing, a linker sequence 1 and a linker sequence 2 (a adaptor1 and a adaptor 2) are two fixed sequences, the linker sequence 2 is a primer for sequencing a probe (a specific hybridization sequence) to obtain probe position information, the probe is used for hybridization with DNA of a sample to be tested, which is required to detect SNP sites, a restriction endonuclease is included between the linker sequence 2 and the probe, and the restriction endonuclease can be any one of 3' -terminal NNNNNNN (N is any nucleotide selected from A, T, C, G) after the restriction endonuclease, such as BaeI, barI and the like, so that the probe ends are exposed by the restriction endonuclease after the sequencing. The construction of the library sequences is shown in FIG. 1.

Wherein the "solid support" refers to any insoluble substrate or matrix to which the nucleotide molecules can attach, such as latex beads, dextran beads, polystyrene surfaces, polypropylene surfaces, polyacrylamide gels, gold surfaces, glass surfaces, and silicon wafers. The solid support may be a flat glass surface. The solid support may be mounted inside a flow-through cell to allow various reagent solutions to interact. The solid phase carrier forms the substrate of the chip.

In certain embodiments, the solid support may comprise an inert substrate or matrix that has been "functionalized", for example by the addition of a layer or coating of an intermediate material comprising reactive groups that allow covalent attachment to molecules such as polynucleotides. As a non-limiting example, such a carrier may comprise a polyacrylamide hydrogel layer on an inert substrate, such as glass. In such embodiments, the polynucleotide may be directly covalently attached to the intermediate layer (e.g., a hydrogel), but the intermediate layer itself may be non-covalently attached to other layers of the substrate or matrix (e.g., a glass substrate). Covalent attachment to a solid support should therefore be construed as encompassing such designs.

Amplification, sequencing and cleavage: amplification and sequencing were performed in a single-ended sequencing fashion. Loading the designed library onto the chip surface, modifying the complementary sequences of P7 and P5 on the chip surface, so that the library is hybridized onto the chip surface, then carrying out the cyclic processes of polymerase extension, denaturation, polymerase extension and denaturation until amplification is completed, then carrying out sequencing to obtain the position information of each probe region on the chip surface, and then carrying out enzyme digestion to obtain the chip capable of finally capturing the sample. See fig. 2.

Hybridization and detection: the chip is hybridized with a sample to be detected (for example, a DNA sample to be detected), the probe captures a corresponding gene after hybridization, the gene is used as a template for one base extension reaction, dNTPs used for extension are blocking dNTPs with fluorescent groups, the chip is photographed after extension to obtain polymerized base types of all capture areas, and registration is carried out with a photograph of the first sequencing, so that the probe position information and polymerized base information are obtained, and SNP information of the gene is analyzed.

The present invention will be described in further detail with reference to specific examples.

Example 1: SNP chip manufacturing and enzyme digestion efficiency detection

The following four library sequences were synthesized in the Kirschner Biotechnology Co., ltd., and the synthesized sequence dry powder was diluted to 4nM with Low TE buffer at the concentration indicated on the synthesis tube, then 2ul of each of the four libraries was mixed together in equal proportions, and 1992ul of 3XSSC solution was added to mix well with shaking to obtain 2ml of mixed library solution.

The following four library sequences, respectively, comprise, in order from the 5 'end to the 3' end, a P7 sequence, a linker sequence 1, a specific hybridization sequence (underlined), a restriction enzyme cleavage site sequence, a linker sequence 2, and a P5 sequence.

SEQ ID NO.1:

CAAGCAGAAGACGGCATACGAGATTCACTGCGATGCTGGATGTTTGCACTCTGGATTCATCTCTGTTTTTCTTTAAGTTttcacNNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNNCCCGTTCGCAACATGTCTGGCGTCATATCTTGTGACTACAGCACCCTCGACTCTCGC.

SEQ ID NO.2:

CAAGCAGAAGACGGCATACGAGATGCAGCCTGCTATCTGTTTACGTATCTCCTTCAAGTTTCTAAGTCAGTGTGGCAAGcccaaNNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNNCCCGTTCGCAACATGTCTGGCGTCATATCTTGTGACTACAGCACCCTCGACTCTCGC.

SEQ ID NO.3:

CAAGCAGAAGACGGCATACGAGATATTTTTCCTGAAACAATCAAGGGATAGAAAAGAAAAACATGTGATACAAATCTCCtcattNNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNNCCCGTTCGCAACATGTCTGGCGTCATATCTTGTGACTACAGCACCCTCGACTCTCGC.

SEQ ID NO.4:

CAAGCAGAAGACGGCATACGAGATGAGCTGTGTACCCCGTATGCCATCTCAAAATGGTTGAGGGACGTAATGGTTTATAttcatNNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNNCCCGTTCGCAACATGTCTGGCGTCATATCTTGTGACTACAGCACCCTCGACTCTCGC.

Wherein N refers to any one of ATCG and Y represents any one of CT.

2Ml of the solution mixed in the first step is added into a sample well of Salus Pro sequencing kit (SRM-SE 75), wherein the sequencing kit comprises a sequencing kit and a sequencing chip (a solid phase carrier modified with two primers, namely a P5 sequence and a P7 sequence respectively), the SNP capture chip is manufactured on the basis of the sequencing chip, and then the sequencing chip is subjected to SE75 sequencing on a Salus Pro sequencer by referring to the sequencing kit specification, and the sequencing results are shown in Table 1.

Position information of the cluster spot (FIG. 5) generated on the chip by each of SEQ ID NO.1-SEQ ID NO.4 library was obtained by basecall algorithm on Salus Pro sequencer ((each of SEQ ID NO.1-SEQ ID NO.4 library corresponds to SEQ 1 library, SEQ 2 library, SEQ 3 library, SEQ 4 library in FIGS. 5 and 6, respectively).

Table 1. Sequencing results:

3) After sequencing, two flow channels are arranged on the sequencing chip, namely a flow channel 1 and a flow channel 2, the chip is cleaned by 200ul washbuffer, then 100ul BaeI (10 ul rCutSmartbuffer, 5ul BaeI and 85ul of nucleic-FREE WATER) solution is taken to be added into the flow channel 2 of the chip for BaeI or BarI enzyme digestion, and the chip is placed in a 37 ℃ oven for 30min.

4) After the reaction is completed, 100ul formamide is added into two flow channels of a sequencing chip, the reaction is carried out for 10min at 55 ℃, then 200ul washbuffer is used for cleaning the chip, the SNP capturing chip is manufactured, at the moment, the flow channel 1 of the chip is used as a control group, and a probe end (red mark) is exposed after a library sequence on the flow channel 2 of the chip has been digested, as shown below;

SEQ ID NO.5:

CAAGCAGAAGACGGCATACGAGATTCACTGCGATGCTGGATGTTTGCACTCTGGATTCATCTCTGTTTTTCTTTAAGTTTTCAC. Wherein TTCAC is the random sequence of the 3' end left on the oligonucleotide probe after cleavage.

SEQ ID NO.6:

CAAGCAGAAGACGGCATACGAGATGCAGCCTGCTATCTGTTTACGTATCTCCTTCAAGTTTCTAAGTCAGTGTGGCAAGCCCAA. Wherein CCCAA is the random sequence of the 3' end left on the oligonucleotide probe after cleavage.

SEQ ID NO.7:

CAAGCAGAAGACGGCATACGAGATATTTTTCCTGAAACAATCAAGGGATAGAAAAGAAAAACATGTGATACAAATCTCCTCATT. Wherein TCATT is the random sequence of the 3' end left on the oligonucleotide probe after cleavage.

SEQ ID NO.8:

CAAGCAGAAGACGGCATACGAGATGAGCTGTGTACCCCGTATGCCATCTCAAAATGGTTGAGGGACGTAATGGTTTATATTCAT. Wherein TTCAT is the random sequence of the 3' end left on the oligonucleotide probe after cleavage.

5) The following fluorescent primers (SEQ ID NO. 9) were synthesized in Shanghai, the synthesized fluorescent primer dry powder was diluted to 100. Mu.M by using Low TE buffer according to the standard concentration on the synthesis tube, then 2uL of the diluted primers were dissolved in 198 uL of 3XSSC solution, 100 uL of solution was introduced into each of the two channels of the chip, then the reaction was carried out at 55℃for 3min and at 25℃for 3min, after the reaction was completed, the chip was washed with 200uL washbuffer, and was placed on a Salus Pro sequencer for scanning and photographing, and the photographing results are shown in FIG. 3. The signal of the fluorescent primer hybridized with SEQ ID NO.9 is stronger because the enzyme digestion is not carried out on the flow channel 1, the probe end is exposed by the enzyme digestion of the flow channel 2, and the sequence of the fluorescent primer hybridized with the flow channel is already excised, so that the generated fluorescent signal is weakened.

The efficiency of cleavage was calculated to be about 65% by fluorescence signal, as shown in FIG. 4.

SEQ ID NO.9:Cy5-TATGACGCCAGACATGTTGCGAACGGG。

6) Sample detection is carried out: adding 100ul DNA samples needing SNP locus detection into a chip, reacting for 10min at 42 ℃, then using the sequencing kit in the step 2 to extend by 1 base additionally, photographing by a sequencer to obtain fluorescence emitted by each cluster point on a picture so as to judge the base information of the SNP locus, and simultaneously comparing the photographed picture with the sequencing picture in the step 2 to obtain the gene information of each corresponding cluster point to finish SNP detection (figure 6); taking a probe formed by enzyme digestion of a SEQ ID NO.1 library as an example, after SE75 sequencing in the step 2, obtaining the position information of the SEQ ID NO.1 probe on a chip, then carrying out additional base extension after hybridization detection of a sample, obtaining the base information on the corresponding position extension through sequencing pictures, and indicating that the base of a SNP locus of a gene detected by the SEQ ID NO.1 in the sample is A base when a corresponding cluster point in FIG. 6 emits light in an A base channel; the same can be deduced that the SNP locus of the gene detected by SEQ ID NO.2 is a C base, the SNP locus of the gene detected by SEQ ID NO.3 is a T base, and the SNP locus of the gene detected by SEQ ID NO.4 is a G base. The probes formed by the 4 libraries are described, SNP base information of corresponding genes in a sample is captured, and the information can be applied to downstream raw letter analysis after the information is obtained.

Compared with the prior art, the invention has higher detection flux, can detect more SNP loci in the same sample, or detect a plurality of samples at the same time, obviously reduce detection cost through scale effect under the condition of higher flux, take SNP chips of illumina and Affymetrix as an example, the chip can only detect more than 500 tens of thousands of SNP loci at the same time, 8-24 samples are detected, the result of the table 1 can be deduced, raw Q30 of the table 1 shows the sequencing quality, total reads shows the quantity of 4 libraries on the chip, and each library is about 21230K on average; if a 50K site of a sample is to be detected, 50K libraries are required, each library is repeated 80 times, and the total is 4000K libraries, according to the number 84919K in Table 1 divided by 4000K, it is indicated that one flow channel can detect at least 20 samples, and one chip can be made into 4 flow channels, and one chip can detect 80 samples; if the number of samples is reduced, and only 4 samples are detected in one flow channel, 250K sites of one sample can be detected, and the information can be corresponding to the information listed above. Therefore, 70-80 samples can be detected at most under the condition of detecting the same number of SNP loci, or 2000-2500 ten thousand SNP loci can be detected at most under the condition of detecting the same number of samples, so that the flux is obviously improved.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims (11)

1. A SNP chip comprising a solid support modified with two primers, on which a cluster of oligonucleotide probes prepared from a plurality of library sequences is immobilized by said primers, said oligonucleotide probes comprising, in order from the 5 'end to the 3' end, a P7 sequence, a linker sequence 1, a specific hybridization sequence and a sequence of at least four nucleotides resulting from the cleavage of said library sequences, said nucleotides being arbitrarily selected from A, T, C, G.

2. The SNP chip according to claim 1, wherein the library sequence comprises, in order from the 5' end to the 3' end, a P7 sequence, a linker sequence 1, a specific hybridization sequence, a restriction enzyme cleavage site sequence, a linker sequence 2, and a P5 sequence, wherein the restriction enzyme cleavage site sequence is a sequence capable of generating at least four arbitrary nucleotides at the 3' end after cleavage.

3. The preparation method of the SNP chip is characterized by comprising the following steps:

S1, designing at least one library sequence, wherein the library sequence sequentially comprises a P7 sequence, a linker sequence 1, a specific hybridization sequence, a restriction enzyme cleavage site sequence, a linker sequence 2 and a P5 sequence from the 5' end to the 3' end, and the restriction enzyme cleavage site sequence is a sequence capable of generating at least four arbitrary nucleotides at the 3' end after enzyme cleavage;

S2, mixing at least one library sequence, loading the mixture onto a solid phase carrier, amplifying and sequencing, wherein a library sequence cluster is fixed on the solid phase carrier, and the P7 sequence is hybridized with a primer on the solid phase carrier so as to amplify the library on the surface of a chip;

S3, performing enzyme digestion, forming an oligonucleotide probe cluster fixed on the solid phase carrier after enzyme digestion of the library sequence, and drying to obtain the oligonucleotide probe cluster.

4. The method for preparing SNP chip according to claim 3, wherein the restriction enzyme is an enzyme capable of generating at least four arbitrary nucleotides at the 3' -end of the cleavage site sequence after cleavage, preferably BaeI, barI.

5. The method for preparing SNP chip according to claim 3, wherein the ratio of the amounts of each library sequence used in mixing is equal.

6. The method of preparing SNP chip according to claim 3, wherein the amplification and sequencing in step S2 are performed according to single-ended sequencing.

7. Use of the SNP chip of claim 1 or 2 for detecting SNP variation sites in plant breeding.

8. A kit for detecting a SNP variation site in a species, comprising a SNP chip as set forth in any one of claims 1 or 2.

9. The kit of claim 8, further comprising a restriction enzyme.

10. A method for detecting a SNP variant site in a species, comprising the steps of:

S1) obtaining the SNP chip of any one of claims 1 or 2;

S2) hybridizing the sample to be detected with the SNP chip, capturing the corresponding gene by the probe after hybridization, performing one-base extension reaction by taking the gene as a template, wherein dNTPs used for extension are blocked dNTPs with fluorescent groups, and photographing the chip after extension to obtain the base types polymerized in each capturing region.

11. The method of claim 10, wherein the species is a plant, or an animal.