CN118006585B - Optimized Cas protein and application thereof - Google Patents

Optimized Cas protein and application thereof Download PDF

Info

Publication number
CN118006585B
CN118006585B CN202410296507.XA CN202410296507A CN118006585B CN 118006585 B CN118006585 B CN 118006585B CN 202410296507 A CN202410296507 A CN 202410296507A CN 118006585 B CN118006585 B CN 118006585B
Authority
CN
China
Prior art keywords
cas
nucleic acid
protein
target
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202410296507.XA
Other languages
Chinese (zh)
Other versions
CN118006585A (en
Inventor
梁亚峰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Shunfeng Biotechnology Co Ltd
Original Assignee
Shandong Shunfeng Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Shunfeng Biotechnology Co Ltd filed Critical Shandong Shunfeng Biotechnology Co Ltd
Publication of CN118006585A publication Critical patent/CN118006585A/en
Application granted granted Critical
Publication of CN118006585B publication Critical patent/CN118006585B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases RNAses, DNAses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/465Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Analytical Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention belongs to the field of nucleic acid editing, in particular to the technical field of regularly clustered interval short palindromic repeat (CRISPR). In particular, the invention provides a Cas mutant protein with reduced off-target effect, which has wide application prospect compared with a wild-type parent Cas protein.

Description

Optimized Cas protein and application thereof
The present application claims priority from chinese patent application cn202310491001.X, with application date 2023, 4, 26. The present application incorporates the entirety of the above-mentioned chinese patent application.
Technical Field
The invention relates to the field of gene editing, in particular to the technical field of regular clustered interval short palindromic repeat (CRISPR). In particular, the invention relates to a Cas protein that reduces off-target efficiency and uses thereof.
Background
CRISPR/Cas technology is a widely used gene editing technology that uses RNA-guided specific binding of target sequences on the genome and cleavage of DNA to create double strand breaks, site-directed gene editing using biological non-homologous end joining or homologous recombination.
The CRISPR/Cas9 system is the most commonly used type II CRISPR system that recognizes the PAM motif of 3' -NGG and blunt-ends the target sequence. The CRISPR/Cas Type V system is a newly discovered class of CRISPR systems that have a 5' -TTN motif that performs cohesive end cleavage of a target sequence, e.g., cpf1, C2C1, casX, casY. However, the different CRISPR/Cas currently in existence each have different advantages and disadvantages. For example, cas9, C2C1 and CasX each require two RNAs for guide RNAs, whereas Cpf1 requires only one guide RNA and can be used for multiplex gene editing. CasX has a size of 980 amino acids, whereas common Cas9, C2C1, casY and Cpf1 are typically around 1300 amino acids in size. In addition, PAM sequences of Cas9, cpf1, casX, casY are all relatively complex and diverse, while C2C1 recognizes the stringent 5' -TTN, so its target site is easily predicted compared to other systems, thereby reducing potential off-target effects.
The application of China patent CN111757889B discloses a Cas protein Cas12f.4, and also discloses that the protein can be subjected to gene editing in eukaryotic cells, but has potential off-target effect.
Disclosure of Invention
Through a great deal of experiments and repeated growths, the inventor of the application improves the editing activity of the Cas12f.4 (called Cas12i3 or Cas12i.3) protein by site-directed mutagenesis, reduces the off-target effect in the gene editing process and expands the application range of the Cas12f.4 protein.
Cas effector proteins
In one aspect, the invention provides a Cas mutein with reduced off-target effect comprising a mutation in the amino acid sequence of the parent Cas protein at the following amino acid positions corresponding to the amino acid sequence shown in SEQ ID No. 1: 876 and/or 890.
In one embodiment, the Cas mutein has a mutation at amino acid position 876 described above; further, the amino acid sequence further comprises an amino acid position 890 mutation based on the 876 amino acid mutation.
In one embodiment, the Cas mutein has a mutation at amino acid 890 position described above; further, the amino acid sequence further comprises an 876 amino acid site mutation based on the 890 th amino acid mutation.
In one embodiment, the amino acid at position 876 is mutated to a non-D amino acid, e.g., a, V, G, L, Q, F, W, Y, N, S, E, K, M, T, C, P, H, R, I; preferably, R.
In one embodiment, amino acid 890 is mutated to an amino acid other than a, e.g., D, V, G, L, Q, F, W, Y, N, S, E, K, M, T, C, P, H, R, I; preferably, R.
Further, the Cas mutant protein also has a mutation at any one or any several of the following amino acid positions corresponding to the amino acid sequence shown in SEQ ID No.1, compared to the amino acid sequence of the parent Cas protein: bit 7, 233, 267, 369, 433.
In one embodiment, the amino acid at position 7 is mutated to a non-S amino acid, e.g., a, V, G, L, Q, F, W, Y, D, K, E, N, M, T, C, P, H, R, I; preferably R, H, K, M, F, P, A, W, I, V, L, Q, C or Y, preferably R.
In one embodiment, the amino acid at position 233 or 267 is mutated to an amino acid other than D, e.g., a, V, G, L, Q, F, W, Y, N, S, E, K, M, T, C, P, H, R, I; preferably, the amino acid at position 233 or the amino acid at position 267 is mutated to R.
In one embodiment, the amino acid at position 369 is mutated to a non-N amino acid, e.g., a, V, G, L, Q, F, W, Y, D, S, E, K, M, T, C, P, H, R, I; preferably, R.
In one embodiment, the amino acid at position 433 is mutated to a non-S amino acid, e.g., a, V, G, L, Q, F, W, Y, D, N, E, K, M, T, C, P, H, R, I; preferably, R.
In one embodiment, the amino acid at position 876 is mutated to a non-D amino acid, e.g., a, V, G, L, Q, F, W, Y, N, S, E, K, M, T, C, P, H, R, I; preferably, R.
In one embodiment, the amino acid at position 890 is mutated to an amino acid other than a, e.g., D, V, G, L, Q, F, W, Y, N, S, E, K, M, T, C, P, H, R, I; preferably, R.
In some embodiments, the parent Cas protein is a native wild-type Cas protein; in other embodiments, the parent Cas protein is an engineered Cas protein.
Cas proteins or Cas12i proteins from a variety of organisms may be used as parent Cas proteins, which in some embodiments have nuclease activity. In some embodiments, the parent Cas protein is a nuclease, i.e., cleaves both strands of a target duplex nucleic acid (e.g., duplex DNA). In some embodiments, the parent Cas protein is a nickase, i.e., a single strand that cleaves a target duplex nucleic acid (e.g., duplex DNA).
In one embodiment, the parent Cas protein is a Cas protein of the Cas12 family, preferably a Cas protein of the Cas12i family, e.g., cas12i1, cas12i2, cas12i3, etc.
In one embodiment, the amino acid sequence of the Cas protein of the Cas12 family has at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% or 100% sequence identity as compared to SEQ id No. 1.
In one embodiment, the amino acid sequence of the parent Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to SEQ ID No. 1.
In one embodiment, the Cas mutein is selected from any one of the following groups I-III:
I. A Cas mutein obtained by mutating the amino acid sequence shown in SEQ ID No.1 at a position comprising any one or any several of the following amino acid sites: 876 th and 879 th; optionally, the Cas mutein further comprises a mutation at any one or any several of the following amino acid positions of the amino acid sequence shown in SEQ ID No. 1: 7 th, 233 th, 267 th, 369 th, 433 th;
II. Compared to the Cas mutein of I, there is a mutation site as described in I; and, a Cas mutein having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to the Cas mutein of I;
III, compared to the Cas mutein of I, having the mutation site described in I; and, a sequence having one or more amino acid substitutions, deletions, or additions compared to the Cas mutein of I; the one or more amino acids include substitutions, deletions or additions of 1,2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids.
In another aspect, the invention also provides a Cas mutein with reduced off-target efficiency comprising a mutation at amino acid position 876 and/or 890 corresponding to the amino acid sequence shown in SEQ ID No.1, as compared to the amino acid sequence of the parent Cas protein; further, the Cas mutein further comprises any 1, any 2, any 3, any 4, or any 5 amino acid site mutation selected from the amino acid site 7, 233, 267, 369, or 433 of the amino acid sequence shown in SEQ ID No. 1.
In one embodiment, the Cas mutein has mutations at amino acid positions 876 and 890 described above; further, in addition to the aforementioned 876 and 890 amino acid mutations, any one or any several (e.g., any 2, any 3, any 4 or any 5) amino acid mutations selected from the amino acid positions 7, 233, 267, 369 or 433 are included. For example, the 876, 890 and 7 simultaneous mutations, the 876, 890, 7 and 233 simultaneous mutations, the 876, 890, 7, 233 and 267 simultaneous mutations, the 876, 890, 7, 233, 267 and 369 simultaneous mutations, the 876, 890, 7, 233, 267, 369 and 433 simultaneous mutations.
In one embodiment, the amino acid at position 7 is mutated to a non-S amino acid, e.g., a, V, G, L, Q, F, W, Y, D, K, E, N, M, T, C, P, H, R, I; preferably R, H, K, M, F, P, A, W, I, V, L, Q, C or Y, preferably R.
In one embodiment, the amino acid at position 233 or 267 is mutated to an amino acid other than D, e.g., a, V, G, L, Q, F, W, Y, N, S, E, K, M, T, C, P, H, R, I; preferably, the amino acid at position 233 or the amino acid at position 267 is mutated to R.
In one embodiment, the amino acid at position 369 is mutated to a non-N amino acid, e.g., a, V, G, L, Q, F, W, Y, D, S, E, K, M, T, C, P, H, R, I; preferably, R.
In one embodiment, the amino acid at position 433 is mutated to a non-S amino acid, e.g., a, V, G, L, Q, F, W, Y, D, N, E, K, M, T, C, P, H, R, I; preferably, R.
In one embodiment, the amino acid at position 876 is mutated to a non-D amino acid, e.g., a, V, G, L, Q, F, W, Y, N, S, E, K, M, T, C, P, H, R, I; preferably, R.
In one embodiment, the amino acid at position 890 is mutated to an amino acid other than a, e.g., D, V, G, L, Q, F, W, Y, N, S, E, K, M, T, C, P, H, R, I; preferably, R.
In one embodiment, the amino acid sequence of the parent Cas protein is shown as SEQ ID No. 1.
In some embodiments, the parent Cas protein is a native wild-type Cas protein; in other embodiments, the parent Cas protein is an engineered Cas protein.
Cas proteins or Cas12i proteins from a variety of organisms may be used as parent Cas proteins, which in some embodiments have nuclease activity. In some embodiments, the parent Cas protein is a nuclease, i.e., cleaves both strands of a target duplex nucleic acid (e.g., duplex DNA). In some embodiments, the parent Cas protein is a nickase, i.e., a single strand that cleaves a target duplex nucleic acid (e.g., duplex DNA).
In one embodiment, the parent Cas protein is a Cas protein of the Cas12 family, preferably a Cas protein of the Cas12i family, e.g., cas12i1, cas12i2, cas12i3, etc.
In one embodiment, the amino acid sequence of the Cas protein of the Cas12 family has at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% or 100% sequence identity as compared to SEQ id No. 1.
In one embodiment, the amino acid sequence of the parent Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to SEQ ID No. 1.
According to the application, when the amino acid locus is mutated into positively charged amino acid such as R, H or K or mutated into non-charged amino acid such as M, F, P, A, W, I, V, L, the editing activity of the Cas protein can be remarkably improved; when mutated to a partially nonpolar uncharged amino acid such as Q, C or Y, the editing activity of Cas protein can also be significantly improved.
It will be apparent to those skilled in the art that the structure of a protein may be altered without adversely affecting its activity and functionality, for example, one or more conservative amino acid substitutions may be introduced into the amino acid sequence of the protein without adversely affecting the activity and/or three-dimensional structure of the protein molecule. Examples and embodiments of conservative amino acid substitutions are apparent to those skilled in the art. In particular, the amino acid residue may be substituted with another amino acid residue belonging to the same group as the site to be substituted, i.e., with a nonpolar amino acid residue, with a polar uncharged amino acid residue, with a basic amino acid residue, with an acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions of one amino acid by another belonging to the same group are within the scope of the invention as long as the substitution does not result in inactivation of the biological activity of the protein. Thus, the proteins of the invention may comprise one or more conservative substitutions in the amino acid sequence, which are preferably made according to table 1. In addition, proteins that also contain one or more other non-conservative substitutions are also contemplated by the present invention, provided that the non-conservative substitutions do not significantly affect the desired function and biological activity of the proteins of the present invention.
Conservative amino acid substitutions may be made at one or more predicted nonessential amino acid residues. "nonessential" amino acid residues are amino acid residues that can be altered (deleted, substituted or substituted) without altering the biological activity, whereas "essential" amino acid residues are required for the biological activity. A "conservative amino acid substitution" is a substitution in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Amino acid substitutions may be made in non-conserved regions of the Cas muteins described above. In general, such substitutions are not made to conserved amino acid residues, or amino acid residues that are within a conserved motif, where such residues are required for protein activity. However, it will be appreciated by those skilled in the art that functional variants may have fewer conservative or non-conservative changes in the conserved regions.
TABLE 1
Initial residues Representative substitution Preferred substitution
Ala(A) Val;Leu;Ile Val
Arg(R) Lys;Gln;Asn Lys
Asn(N) Gln;His;Lys;Arg Gln
Asp(D) Glu Glu
Cys(C) Ser Ser
Gln(Q) Asn Asn
Glu(E) Asp Asp
Gly(G) Pro;Ala Ala
His(H) Asn;Gln;Lys;Arg Arg
Ile(I) Leu;Val;Met;Ala;Phe Leu
Leu(L) Ile;Val;Met;Ala;Phe Ile
Lys(K) Arg;Gln;Asn Arg
Met(M) Leu;Phe;Ile Leu
Phe(F) Leu;Val;Ile;Ala;Tyr Leu
Pro(P) Ala Ala
Ser(S) Thr Thr
Thr(T) Ser Ser
Trp(W) Tyr;Phe Tyr
Tyr(Y) Trp;Phe;Thr;Ser Phe
Val(V) Ile;Leu;Met;Phe;Ala Leu
It is well known in the art that one or more amino acid residues may be altered (substituted, deleted, truncated or inserted) from the N-and/or C-terminus of a protein while still retaining its functional activity. Thus, proteins that have one or more amino acid residues altered from the N and/or C terminus of the Cas protein while retaining their desired functional activity are also within the scope of the invention. These changes may include changes introduced by modern molecular methods such as PCR, including PCR amplification that alters or extends the protein coding sequence by including an amino acid coding sequence in the oligonucleotides used in the PCR amplification.
It will be appreciated that proteins may be altered in a variety of ways, including amino acid substitutions, deletions, truncations and insertions, and that methods for such manipulation are generally known in the art. For example, amino acid sequence variants of the above proteins can be prepared by mutation of DNA. Single or multiple amino acid substitutions, deletions and/or insertions may also be made by other forms of mutagenesis and/or by directed evolution, e.g., using known mutagenesis, recombination and/or shuffling (shuffling) methods, in combination with related screening methods.
Those skilled in the art will appreciate that these minor amino acid changes in the Cas proteins of the invention may occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site or other functional domain of the protein, the nature of the polypeptide may be altered, but the polypeptide may retain its activity. Smaller effects can be expected if mutations are present that are not close to the catalytic domain, active site or other functional domain.
The skilled artisan can identify the essential amino acids of the Cas muteins of the invention according to methods known in the art, such as site-directed mutagenesis or protein evolution or analysis of bioinformatics. The catalytic, active or other functional domains of a protein can also be determined by physical analysis of the structure, such as by the following techniques: such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in combination with mutations in the amino acids at putative key sites.
In the present invention, amino acid residues may be represented by single letters or by three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).
The term "AxxB" means that amino acid A at position xx is changed to amino acid B, and unless otherwise specified, all amino acids A at position xx from the N-terminus are changed to amino acids B. For example, D876R represents a mutation of D at position 876 to R. When a plurality of amino acid sites are mutated simultaneously, the mutation can be expressed in terms of D876R-A890R or D876R/A890R and the like, for example, D876R-A890R represents the mutation of D at position 876 to R and the mutation of A at position 890 to R.
The specific amino acid positions (numbering) within the proteins of the invention are determined by aligning the amino acid sequence of the protein of interest with SEQ ID No.1 using standard sequence alignment tools, such as by aligning the two sequences using the Smith-Waterman algorithm or using the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is highest. The alignment score may be calculated according to the method described in Wilbur,W.J.and Lipman,D.J.(1983)Rapid similarity searches ofnucleic acid and protein data banks.Proc.Natl.Acad.Sci.USA,80:726-730. Default parameters are preferably used in the ClustalW2 (1.82) algorithm: protein gap opening penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein/DNA endplay= -1; protein/DNAGAPDIST =4. The alignment program (part of group vectorNTI) is preferably used to determine the position of a particular amino acid within a protein according to the invention by aligning the amino acid sequence of the protein with SEQ ID No.1 with default parameters (gap opening penalty: 10, gap extension penalty 0.05) suitable for multiple alignments.
The amino acid sequence of either parent Cas protein can be compared and aligned (aligned) with SEQ ID No.1 or 3 using software commonly used in the art, such as Clustal Omega, to obtain the amino acid position in the parent Cas protein corresponding to the amino acid position defined based on SEQ ID No.1 or 3 as described herein.
The biological functions of the Cas protein include, but are not limited to, activity of binding to a guide RNA, endonuclease activity, activity of binding to and cleaving at a specific site of a target sequence under the guidance of a guide RNA, including, but not limited to Cis cleavage activity and Trans cleavage activity.
In the present invention, a "Cas mutein" may also be referred to as a mutated Cas protein, or a Cas protein variant.
The invention also provides a fusion protein comprising a Cas mutein as described above and other modifications.
In one embodiment, the modifying moiety is selected from the group consisting of an additional protein or polypeptide, a detectable label, or any combination thereof.
In one embodiment, the modifying moiety is selected from the group consisting of an epitope tag, a reporter gene sequence, a Nuclear Localization Signal (NLS) sequence, a targeting moiety, a transcriptional activation domain (e.g., VP 64), a transcriptional repression domain (e.g., KRAB domain or SID domain), a nuclease domain (e.g., fok 1), and a domain having an activity selected from the group consisting of: nucleotide deaminase, cytidine deaminase, adenosine deaminase, methylase activity, demethylase, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, single-stranded DNA cleavage activity, double-stranded DNA cleavage activity and nucleic acid binding activity; and any combination thereof. The NLS sequences are well known to those skilled in the art, examples of which include, but are not limited to, the SV40 large T antigen, EGL-13, c-Myc, and TUS proteins.
In one embodiment, the NLS sequence is located at, near, or near the terminus (e.g., N-terminus, C-terminus, or both) of the Cas protein of the invention.
Such epitope tags (tags) are well known to those skilled in the art, including but not limited to His, V5, FLAG, HA, myc, VSV-G, trx, etc., and other suitable epitope tags (e.g., purification, detection, or labeling) may be selected by those skilled in the art.
Such reporter sequences are well known to those skilled in the art, examples of which include, but are not limited to GST, HRP, CAT, GFP, hcRed, dsRed, CFP, YFP, BFP, etc.
In one embodiment, the fusion proteins of the invention comprise a domain capable of binding to a DNA molecule or an intracellular molecule, such as Maltose Binding Protein (MBP), the DNA binding domain of Lex a (DBD), the DBD of GAL4, and the like.
In one embodiment, the fusion proteins of the invention comprise a detectable label, such as a fluorescent dye, e.g., FITC or DAPI.
In one embodiment, the Cas protein of the invention is coupled, conjugated or fused to the modifying moiety, optionally through a linker.
In one embodiment, the modification is directly linked to the N-terminus or C-terminus of the Cas protein of the invention.
In one embodiment, the modifying moiety is linked to the N-terminus or C-terminus of the Cas protein of the invention by a linker. Such linkers are well known in the art, examples of which include, but are not limited to, linkers comprising one or more (e.g., 1,2,3, 4, or 5) amino acids (e.g., glu or Ser) or amino acid derivatives (e.g., ahx, β -Ala, GABA, or Ava), or PEG, etc.
The Cas protein, protein derivative or fusion protein of the present invention is not limited by the manner of its production, and for example, it may be produced by genetic engineering methods (recombinant techniques) or by chemical synthesis methods.
Nucleic acid of Cas protein
In another aspect, the invention provides an isolated polynucleotide comprising:
(a) Polynucleotide sequences encoding Cas muteins or fusion proteins of the invention;
or a polynucleotide complementary to the polynucleotide of (a).
In one embodiment, the nucleotide sequence is codon optimized for expression in a prokaryotic cell. In one embodiment, the nucleotide sequence is codon optimized for expression in eukaryotic cells.
In one embodiment, the cell is an animal cell, e.g., a mammalian cell.
In one embodiment, the cell is a human cell.
In one embodiment, the cell is a plant cell, such as a cell of a cultivated plant (e.g., cassava, maize, sorghum, wheat, or rice), algae, tree, or vegetable.
In one embodiment, the polynucleotide is preferably single-stranded or double-stranded.
Guide RNA (gRNA)
In another aspect, the invention provides a gRNA comprising a first segment and a second segment; the first segment is also referred to as a "framework region", "protein binding segment", "protein binding sequence", or "repeat in the same direction (DIRECT REPEAT) sequence"; the second segment is also referred to as a "targeting sequence of a targeting nucleic acid" or a "targeting segment of a targeting nucleic acid", or a "targeting sequence of a targeting nucleic acid".
The first segment of the gRNA is capable of interacting with the Cas protein of the invention, thereby forming a complex of Cas protein and gRNA.
In a preferred embodiment, the first segment is a homeotropic repeat as described above.
The targeting sequence of the targeting nucleic acid or targeting segment of the targeting nucleic acid of the invention comprises a nucleotide sequence complementary to a sequence in the target nucleic acid. In other words, the targeting sequence of the targeting nucleic acid or targeting segment of the targeting nucleic acid of the invention interacts with the target nucleic acid in a sequence-specific manner via hybridization (i.e., base pairing). Thus, the targeting sequence of the targeting nucleic acid or targeting segment of the targeting nucleic acid may be altered, or may be modified to hybridize to any desired sequence within the target nucleic acid. The nucleic acid is selected from DNA or RNA.
The targeting sequence of the targeting nucleic acid or the percentage of complementarity between the targeting segment of the targeting nucleic acid and the target sequence of the target nucleic acid can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%).
The "framework region", "protein binding segment", "protein binding sequence", or "cognate repeat" of the gRNA of the invention can interact with a CRISPR protein (or Cas protein). The gRNA of the invention directs its interacting Cas protein to a specific nucleotide sequence within the target nucleic acid through the action of the targeting sequence of the targeting nucleic acid.
Preferably, the guide RNA comprises a first segment and a second segment in the 5 'to 3' direction.
In the context of the present invention, the second segment is also understood as a guide sequence which hybridizes to the target sequence.
The gRNA of the invention is capable of forming a complex with the Cas protein.
Carrier body
The invention also provides a vector comprising a Cas mutein, an isolated nucleic acid molecule or a polynucleotide as described above; preferably, it further comprises a regulatory element operably linked thereto.
In one embodiment, the regulatory element is selected from one or more of the following group: enhancers, transposons, promoters, terminators, leader sequences, polyadenylation sequences, and marker genes.
In one embodiment, the vector comprises a cloning vector, an expression vector, a shuttle vector, an integration vector.
In some embodiments, the vectors included in the system are viral vectors (e.g., retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated vectors, and herpes simplex vectors), but may also be of the plasmid, viral, cosmid, phage, etc. type, which are well known to those skilled in the art.
CRISPR system
The present invention provides an engineered non-naturally occurring vector system, or CRISPR-Cas system, comprising a Cas mutein or a nucleic acid sequence encoding the Cas mutein and a nucleic acid encoding one or more guide RNAs.
In one embodiment, the nucleic acid sequence encoding the Cas mutein and the nucleic acid encoding one or more guide RNAs are synthetic.
In one embodiment, the nucleic acid sequence encoding the Cas mutein and the nucleic acid encoding one or more guide RNAs do not co-occur naturally.
The one or more guide RNAs target one or more target sequences in the cell. The one or more target sequences hybridize to a genomic locus of a DNA molecule encoding one or more gene products and the Cas protein is directed to the genomic locus of the DNA molecule of the one or more gene products, and the Cas protein, upon reaching the target sequence position, modifies, edits or cleaves the target sequence, whereby expression of the one or more gene products is altered or modified.
The cells of the invention include one or more of animals, plants or microorganisms.
In some embodiments, the Cas protein is codon optimized for expression in a cell.
In some embodiments, the Cas protein directs cleavage of one or both strands at the target sequence position.
The invention also provides an engineered non-naturally occurring carrier system that can include one or more carriers comprising:
a) A first regulatory element operably linked to the gRNA,
B) A second regulatory element operably linked to the Cas protein;
Wherein components (a) and (b) are on the same or different supports of the system.
The first and second regulatory elements include promoters (e.g., constitutive promoters or inducible promoters), enhancers (e.g., 35S promoter or 35S enhanced promoter), internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcriptional termination signals, such as polyadenylation signals and poly U sequences).
In some embodiments, the vectors in the system are viral vectors (e.g., retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated vectors, and herpes simplex vectors), but may also be of the plasmid, viral, cosmid, phage, etc. type, which are well known to those skilled in the art.
In some embodiments, the systems provided herein are in a delivery system. In some embodiments, the delivery system is a nanoparticle, liposome, exosome, microvesicle, or gene gun.
In one embodiment, the target sequence is a DNA or RNA sequence from a prokaryotic or eukaryotic cell. In one embodiment, the target sequence is a non-naturally occurring DNA or RNA sequence.
In one embodiment, the target sequence is present in a cell. In one embodiment, the target sequence is present in the nucleus or in the cytoplasm (e.g., organelle). In one embodiment, the cell is a eukaryotic cell. In other embodiments, the cell is a prokaryotic cell.
In one embodiment, the Cas protein has one or more NLS sequences attached. In one embodiment, the fusion protein comprises one or more NLS sequences. In one embodiment, the NLS sequence is linked to the N-terminus or C-terminus of the protein. In one embodiment, the NLS sequence is fused to the N-terminus or C-terminus of the protein.
In another aspect, the invention relates to an engineered CRISPR system comprising the Cas protein described above and one or more guide RNAs, wherein the guide RNAs comprise a homodromous repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid, the Cas protein is capable of binding to the guide RNAs and targeting a target nucleic acid sequence complementary to the spacer sequence.
Protein-nucleic acid complexes/compositions
In another aspect, the invention provides a complex or composition comprising:
(i) A protein component selected from the group consisting of: the Cas protein, the derivatized protein, or the fusion protein described above, and any combination thereof; and
(Ii) A nucleic acid component comprising (a) a guide sequence capable of hybridizing to a target sequence; and (b) a homeotropic repeat capable of binding to the Cas protein of the invention.
The protein component and the nucleic acid component are bound to each other to form a complex.
In one embodiment, the nucleic acid component is a guide RNA in a CRISPR-Cas system.
In one embodiment, the complex or composition is non-naturally occurring or modified. In one embodiment, at least one component of the complex or composition is non-naturally occurring or modified. In one embodiment, the first component is non-naturally occurring or modified; and/or, the second component is non-naturally occurring or modified.
Activated CRISPR complexes
In another aspect, the present invention also provides an activated CRISPR complex comprising: (1) a protein component selected from the group consisting of: the Cas protein, the derivatized protein, or the fusion protein of the invention, and any combination thereof; (2) A gRNA comprising (a) a guide sequence capable of hybridizing to a target sequence; and (b) a homeotropic repeat capable of binding to the Cas protein of the invention; and (3) a target sequence that binds to the gRNA. Preferably, the binding is binding to the target nucleic acid through a targeting sequence of the targeting nucleic acid on the gRNA.
The term "activated CRISPR complex", "activated complex" or "ternary complex" as used herein refers to a complex in a CRISPR system where Cas protein, gRNA bind to or are modified with a target nucleic acid.
The Cas proteins and grnas of the invention can form binary complexes that are activated upon binding to a nucleic acid substrate that is complementary to a spacer sequence in the gRNA (or, referred to as, a guide sequence that hybridizes to a target nucleic acid) to form an activated CRISPR complex. In some embodiments, the spacer sequence of the gRNA is perfectly matched to the target substrate. In other embodiments, the spacer sequence of the gRNA matches a portion (continuous or discontinuous) of the target substrate.
In preferred embodiments, the activated CRISPR complex may exhibit a sidebranch nuclease cleavage activity, which refers to the nonspecific cleavage activity or hackle activity of the activated CRISPR complex on single-stranded nucleic acids, also known in the art as trans cleavage activity.
Delivery and delivery compositions
Cas proteins, grnas, fusion proteins, nucleic acid molecules, vectors, systems, complexes, and compositions of the invention may be delivered by any method known in the art. Such methods include, but are not limited to, electroporation, lipofection, nuclear transfection, microinjection, sonoporation, gene gun, calcium phosphate mediated transfection, cationic transfection, lipofection, dendritic transfection, heat shock transfection, nuclear transfection, magnetic transfection, lipofection, puncture transfection, optical transfection, reagent enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, virosomes, artificial virosomes, and the like.
Accordingly, in another aspect, the present invention provides a delivery composition comprising a delivery vehicle, and one or more selected from any of the following: cas proteins, fusion proteins, nucleic acid molecules, vectors, systems, complexes, and compositions of the invention.
In one embodiment, the delivery vehicle is a particle.
In one embodiment, the delivery vehicle is selected from the group consisting of a lipid particle, a sugar particle, a metal particle, a protein particle, a liposome, an exosome, a microbubble, a gene gun, or a viral vector (e.g., replication defective retrovirus, lentivirus, adenovirus, or adeno-associated virus).
Host cells
The invention also relates to an in vitro, ex vivo or in vivo cell or cell line or their progeny comprising: cas proteins, fusion proteins, nucleic acid molecules, protein-nucleic acid complexes, activated CRISPR complexes, vectors, delivery compositions of the invention are described herein.
In certain embodiments, the cell is a prokaryotic cell.
In certain embodiments, the cell is a eukaryotic cell. In certain embodiments, the cell is a mammalian cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a non-human mammalian cell, e.g., a non-human primate, bovine, ovine, porcine, canine, simian, rabbit, rodent (e.g., rat or mouse) cell. In certain embodiments, the cells are non-mammalian eukaryotic cells, such as cells of poultry birds (e.g., chickens), fish, or crustaceans (e.g., clams, shrimps). In certain embodiments, the cell is a plant cell, e.g., a cell of a monocot or dicot or a cell of a cultivated plant or a food crop such as tapioca, corn, sorghum, soybean, wheat, oat, or rice, e.g., an algae, tree, or production plant, fruit, or vegetable (e.g., a tree such as citrus, nut, eggplant, cotton, tobacco, tomato, grape, coffee, cocoa, etc.).
In certain embodiments, the cell is a stem cell or stem cell line.
In certain instances, a host cell of the invention comprises a modification of a gene or genome that is not present in its wild type.
Gene editing method and application
The Cas muteins, nucleic acids, the above compositions, the above CIRSPR/Cas systems, the above vector systems, the above delivery compositions or the above activated CRISPR complexes or the above host cells of the invention can be used for any one or any of several of the following uses: targeting and/or editing a target nucleic acid; cleaving double-stranded DNA, single-stranded DNA, or single-stranded RNA; nonspecific cleavage and/or degradation of collateral nucleic acids; nonspecifically cleaving the single-stranded nucleic acid; detecting nucleic acid; detecting nucleic acid in a target sample; editing the double-stranded nucleic acid specifically; base editing double-stranded nucleic acid; base editing single-stranded nucleic acid; the off-target efficiency in the gene editing process is reduced. In other embodiments, it may also be used to prepare reagents or kits for any one or any of several of the uses described above.
The invention also provides the use of the Cas protein, nucleic acid, composition, CIRSPR/Cas system, vector system, delivery composition, or activated CRISPR complex described above in gene editing, gene targeting, or gene cleavage; or in the preparation of a reagent or kit for gene editing, gene targeting or gene cleavage.
In one embodiment, the gene editing, gene targeting or gene cleaving is performed intracellularly and/or extracellularly.
The invention also provides a method of editing, targeting, or cleaving a target nucleic acid comprising contacting the target nucleic acid with the Cas protein, nucleic acid, composition, CIRSPR/Cas system, vector system, delivery composition, or activated CRISPR complex described above. In one embodiment, the method is editing, targeting, or cleaving a target nucleic acid inside or outside a cell.
The gene editing or editing target nucleic acids include modifying genes, knocking out genes, altering expression of gene products, repairing mutations, and/or inserting polynucleotides, gene mutations.
The editing may be performed in prokaryotic and/or eukaryotic cells.
In another aspect, the invention also provides a method of reducing the off-target effect/off-target efficiency of gene editing, the method comprising contacting a target nucleic acid with the Cas protein, nucleic acid, composition, CIRSPR/Cas system, vector system, delivery composition, or activated CRISPR complex described above. In one embodiment, the method is editing, targeting, or cleaving a target nucleic acid inside or outside a cell.
In another aspect, the invention also provides the use of the Cas protein, the nucleic acid, the composition, the CIRSPR/Cas system, the vector system, the delivery composition, or the activated CRISPR complex described above in nucleic acid detection, or in the preparation of a reagent or kit for nucleic acid detection.
In another aspect, the invention also provides a method of cleaving a single-stranded nucleic acid, the method comprising contacting a nucleic acid population with the Cas protein and the gRNA described above, wherein the nucleic acid population comprises a target nucleic acid and a plurality of non-target single-stranded nucleic acids, the Cas protein cleaving the plurality of non-target single-stranded nucleic acids.
The gRNA is capable of binding to the Cas protein.
The gRNA is capable of targeting the target nucleic acid.
The contacting may be inside a cell in vitro, ex vivo or in vivo.
Preferably, the cleavage of single-stranded nucleic acid is a nonspecific cleavage.
In another aspect, the invention also provides the use of the Cas protein, the nucleic acid, the composition, the CIRSPR/Cas system, the vector system, the delivery composition, or the activated CRISPR complex described above for non-specifically cleaving a single stranded nucleic acid, or for the preparation of a reagent or kit for non-specifically cleaving a single stranded nucleic acid.
In another aspect, the invention also provides a kit for gene editing, gene targeting or gene cleavage comprising the Cas protein, gRNA, nucleic acid, the composition, the CIRSPR/Cas system, the vector system, the delivery composition, the activated CRISPR complex or the host cell described above.
In another aspect, the invention also provides a kit for reducing off-target effect/off-target efficiency in gene editing, the kit comprising the Cas protein, gRNA, nucleic acid, the composition, the CIRSPR/Cas system, the vector system, the delivery composition, the activated CRISPR complex, or the host cell described above.
In another aspect, the invention also provides a kit for detecting a target nucleic acid in a sample, the kit comprising: (a) a Cas protein, or a nucleic acid encoding the Cas protein; (b) A guide RNA, or a nucleic acid encoding the guide RNA, or a precursor RNA comprising the guide RNA, or a nucleic acid encoding the precursor RNA; and (c) a single stranded nucleic acid detector that is single stranded and does not hybridize to the guide RNA.
It is known in the art that precursor RNAs can be cleaved or processed into the mature guide RNAs described above.
In another aspect, the invention provides the use of the Cas protein, the nucleic acid, the composition, the CIRSPR/Cas system, the vector system, the delivery composition, the activated CRISPR complex, or the host cell described above in the preparation of a formulation or kit for:
(i) Gene or genome editing;
(ii) Target nucleic acid detection and/or diagnosis;
(iii) Editing a target sequence in a target locus to modify an organism or a non-human organism;
(iv) Treatment of disease;
(iv) Targeting the target gene.
Preferably, the gene or genome editing is performed in or out of a cell.
Preferably, the target nucleic acid detection and/or diagnosis is performed in vitro.
Preferably, the treatment of the disease is treatment of a condition caused by a defect in the target sequence in the target locus.
In another aspect, the invention provides a method of detecting a target nucleic acid in a sample, the method comprising contacting a sample with the Cas protein, a gRNA (guide RNA) comprising a region that binds to the Cas protein and a guide sequence that hybridizes to the target nucleic acid, and a single stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein cleaving single-stranded nucleic acid detector, thereby detecting a target nucleic acid; the single stranded nucleic acid detector does not hybridize to the gRNA.
Method for specifically modifying target nucleic acid
In another aspect, the invention also provides a method of specifically modifying a target nucleic acid, the method comprising: contacting a target nucleic acid with the Cas protein, nucleic acid, composition, CIRSPR/Cas system, carrier system, delivery composition, or activated CRISPR complex.
The specific modification may occur in vivo or in vitro.
The specific modification may occur either intracellularly or extracellularly.
In some cases, the cell is selected from a prokaryotic cell or a eukaryotic cell, e.g., an animal cell, a plant cell, or a microbial cell.
In one embodiment, the modification refers to cleavage of the target sequence, e.g., single/double strand cleavage of DNA, or single strand cleavage of RNA.
In some cases, the method further comprises contacting the target nucleic acid with a donor polynucleotide, wherein the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is integrated into the target nucleic acid.
In one embodiment, the modification further comprises inserting an editing template (e.g., an exogenous nucleic acid) into the break.
In one embodiment, the method further comprises: contacting an editing template with the target nucleic acid, or delivering into a cell comprising the target nucleic acid. In this embodiment, the method repairs the disrupted target gene by homologous recombination with an exogenous template polynucleotide; in some embodiments, the repair results in a mutation, including an insertion, deletion, or substitution of one or more nucleotides of the target gene, in other embodiments, the mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence.
Detection (non-specific cleavage)
In another aspect, the invention provides a method of detecting a target nucleic acid in a sample, the method comprising contacting the sample with the Cas protein, the nucleic acid, the composition, the CIRSPR/Cas system, the vector system, the delivery composition, or the activated CRISPR complex and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein cleaving single stranded nucleic acid detector, thereby detecting a target nucleic acid.
In the present invention, the target nucleic acid comprises ribonucleotides or deoxyribonucleotides; including single-stranded nucleic acids, double-stranded nucleic acids, e.g., single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA.
In one embodiment, the target nucleic acid is derived from a sample of a virus, bacterium, microorganism, soil, water source, human, animal, plant, or the like. Preferably, the target nucleic acid is a product of enrichment or amplification by PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM or the like.
In one embodiment, the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a specific nucleic acid associated with a disease, such as a specific mutation site or SNP site, or a nucleic acid that differs from a control; preferably, the virus is a plant virus or an animal virus, for example, papilloma virus, hepadnavirus, herpes virus, adenovirus, poxvirus, parvovirus, coronavirus; preferably, the virus is a coronavirus, preferably SARS, SARS-CoV2 (COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, mers-CoV.
In the present invention, the gRNA has a degree of match of at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90% with the target sequence on the target nucleic acid.
In one embodiment, when the target sequence contains one or more characteristic sites (e.g., specific mutation sites or SNPs), the characteristic sites are perfectly matched to the gRNA.
In one embodiment, the detection method may comprise one or more grnas with different targeting sequences to different target sequences.
In the present invention, the single-stranded nucleic acid detector includes, but is not limited to, single-stranded DNA, single-stranded RNA, DNA-RNA hybrids, nucleic acid analogs, base modifications, single-stranded nucleic acid detectors containing abasic spacers, and the like; "nucleic acid analogs" include, but are not limited to: locked nucleic acids, bridged nucleic acids, morpholino nucleic acids, ethylene glycol nucleic acids, hexitol nucleic acids, threose nucleic acids, arabinose nucleic acids, 2' oxymethyl RNAs, 2' methoxyacetyl RNAs, 2' fluoro RNAs, 2' amino RNAs, 4' thio RNAs, and combinations thereof, including optional ribonucleotide or deoxyribonucleotide residues.
In the present invention, the detectable signal is realized by: visual-based detection, sensor-based detection, color detection, fluorescent signal-based detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase change/dispersion, electrochemical detection, and semiconductor-based detection.
In the present invention, it is preferable that both ends of the single-stranded nucleic acid detector are provided with a fluorescent group and a quenching group, respectively, and that the single-stranded nucleic acid detector may exhibit a detectable fluorescent signal when cleaved. The fluorescent group is selected from one or more of FAM, FITC, VIC, JOE, TET, CY, CY5, ROX, texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, dabcy1 or Tamra.
In other embodiments, the 5 'end and the 3' end of the single-stranded nucleic acid detector are respectively provided with different labeling molecules, and colloidal gold test results before the single-stranded nucleic acid detector is cleaved by the Cas protein and after the single-stranded nucleic acid detector is cleaved by the Cas protein are detected by a colloidal gold detection mode; the single-stranded nucleic acid detector will exhibit different color development results on the detection line and the quality control line of colloidal gold before being cleaved by Cas protein and after being cleaved by Cas protein.
In some embodiments, the method of detecting a target nucleic acid may further comprise comparing the level of the detectable signal to a reference signal level, and determining the amount of the target nucleic acid in the sample based on the level of the detectable signal.
In some embodiments, the method of detecting a target nucleic acid may further comprise using RNA reporter nucleic acid and DNA reporter nucleic acid (e.g., fluorescent colors) on different channels, and sampling based on combining (e.g., using a minimum or product) the levels of the detectable signals by measuring the signal levels of the RNA and DNA reporter molecules, and determining the levels of the detectable signals by measuring the amounts of target nucleic acid in the RNA and DNA reporter molecules.
In one embodiment, the target gene is present in a cell.
In one embodiment, the cell is a prokaryotic cell.
In one embodiment, the cell is a eukaryotic cell.
In one embodiment, the cell is an animal cell.
In one embodiment, the cell is a human cell.
In one embodiment, the cell is a plant cell, such as a cell of a cultivated plant (e.g., cassava, maize, sorghum, wheat, or rice), algae, tree, or vegetable.
In one embodiment, the target gene is present in an in vitro nucleic acid molecule (e.g., a plasmid).
In one embodiment, the target gene is present in a plasmid.
Definition of terms
In the present invention, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Further, the procedures of molecular genetics, nucleic acid chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics and recombinant DNA, etc., as used herein, are all conventional procedures widely used in the corresponding field. Meanwhile, in order to better understand the present invention, definitions and explanations of related terms are provided below.
Nucleic acid cleavage or cleavage nucleic acids herein include DNA or RNA cleavage (Cis cleavage), cleavage of DNA or RNA in a side branch nucleic acid substrate (single-stranded nucleic acid substrate) in a target nucleic acid produced by a Cas enzyme described herein (i.e., non-specific or non-targeted, trans cleavage). In some embodiments, the cleavage is a double-stranded DNA break. In some embodiments, the cleavage is a single-stranded DNA cleavage or a single-stranded RNA cleavage.
CRISPR system
As used herein, the term "regularly clustered, spaced short palindromic repeats (CRISPR) -CRISPR-associated (Cas) (CRISPR-Cas) system" or "CRISPR system" is used interchangeably and has the meaning commonly understood by those skilled in the art, which generally comprises transcripts or other elements related to the expression of a CRISPR-associated ("Cas") gene, or transcripts or other elements capable of directing the activity of the Cas gene.
CRISPR/Cas complexes
As used herein, the term "CRISPR/Cas complex" refers to a complex formed by binding of a guide RNA (guide RNA) or mature crRNA to a Cas protein, comprising a direct repeat sequence that hybridizes to a guide sequence of a target and binds to a Cas protein, which complex is capable of recognizing and cleaving a polynucleotide that hybridizes to the guide RNA or mature crRNA.
Guide RNA (guide RNA, gRNA)
As used herein, the terms "guide RNA", "mature crRNA", "guide sequence" are used interchangeably and have the meaning commonly understood by those skilled in the art. In general, the guide RNA can comprise, consist essentially of, or consist of the same-directional repeat sequence (DIRECT REPEAT) and the guide sequence.
In certain instances, the guide sequence is any polynucleotide sequence that has sufficient complementarity to a target sequence to hybridize to the target sequence and direct specific binding of the CRISPR/Cas complex to the target sequence. In one embodiment, the degree of complementarity between a guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% when optimally aligned. It is within the ability of one of ordinary skill in the art to determine the optimal alignment. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, the Smith-Waterman algorithm (Smith-Waterman), bowtie, geneious, biopython, and SeqMan in ClustalW, matlab.
Target sequence
"Target sequence" refers to a polynucleotide targeted by a guide sequence in a gRNA, e.g., a sequence that has complementarity to the guide sequence, wherein hybridization between the target sequence and the guide sequence will promote the formation of a CRISPR/Cas complex (including Cas proteins and grnas). Complete complementarity is not necessary so long as sufficient complementarity exists to cause hybridization and promote the formation of a CRISPR/Cas complex.
The target sequence may comprise any polynucleotide, such as DNA or RNA. In some cases, the target sequence is located either inside or outside the cell. In some cases, the target sequence is located in the nucleus or cytoplasm of the cell. In some cases, the target sequence may be located within an organelle of a eukaryotic cell, such as a mitochondria or chloroplast. Sequences or templates that can be used for recombination into a target locus comprising the target sequence are referred to as "editing templates" or "editing polynucleotides" or "editing sequences". In one embodiment, the editing template is an exogenous nucleic acid. In one embodiment, the recombination is homologous recombination.
In the present invention, a "target sequence" or "target polynucleotide" or "target nucleic acid" may be any polynucleotide that is endogenous or exogenous to a cell (e.g., a eukaryotic cell). For example, the target polynucleotide may be a polynucleotide that is present in the nucleus of a eukaryotic cell. The target polynucleotide may be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or unwanted DNA). In some cases, the target sequence should be related to the Protospacer Adjacent Motif (PAM).
Off-target effect
As used herein, the term "off-target effect" or "off-target efficiency" refers to the phenomenon that, when a gene is edited using the CRISPR/Cas technology system, a designed specific guide RNA ((guide RNA, gRNA) recognizes and localizes the target site, a mismatch between DNA and gRNA, and a genomic sequence similar to the target site is recognized and cleaved by Cas-gRNA complex, so that off-target phenomenon occurs, that is, if the gRNA is completely matched with the target site and edited, it is called precise localization, and if the gRNA forms a mismatch with the non-target DNA sequence, an unexpected mutation occurs in the gene site, which is called off-target effect (off-TARGET EFFECTS).
There are 2 forms of local mismatches of the gRNA at non-target sites: (1) The off-target DNA sequence and the gRNA only have base mismatching and have consistent length; (2) The length of the off-target DNA sequence is different from that of the gRNA, and base mismatches are caused by insertion or deletion of the DNA sequence. Studies have shown that off-target not only reduces genome editing efficiency, but also results in chromosomal rearrangements and even disruption of genes that are not perfectly matched. In addition, functional genes may be rendered inactive.
Single-stranded nucleic acid detector
The single-stranded nucleic acid detector according to the present invention means a detector comprising a sequence of 2 to 200 nucleotides, preferably 2 to 150 nucleotides, preferably 3 to 100 nucleotides, preferably 3 to 30 nucleotides, preferably 4 to 20 nucleotides, more preferably 5 to 15 nucleotides. Preferably a single-stranded DNA molecule, a single-stranded RNA molecule or a single-stranded DNA-RNA hybrid.
The single-stranded nucleic acid detector comprises different reporter groups or marker molecules at both ends, which do not exhibit a reporter signal when in an initial state (i.e., not cleaved), and which exhibit a detectable signal when cleaved, i.e., a detectable distinction between cleaved and pre-cleaved.
In one embodiment, the reporter or marker molecule comprises a fluorophore and a quencher, wherein the fluorophore is selected from one or more of FAM, FITC, VIC, JOE, TET, CY, CY5, ROX, texas Red, or LC Red 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, dabcy1 or Tamra.
In one embodiment, the single stranded nucleic acid detector has a first molecule (e.g., FAM or FITC) attached to the 5 'end and a second molecule (e.g., biotin) attached to the 3' end. The reaction system containing the single-stranded nucleic acid detector is matched with a flow strip to detect target nucleic acid (preferably, a colloidal gold detection mode). The flow strip is designed with two capture lines, with an antibody binding to a first molecule (i.e., a first molecular antibody) at the sample contact end (colloidal gold), an antibody binding to the first molecular antibody at the first line (control line), and an antibody binding to a second molecule (i.e., a second molecular antibody, such as avidin) at the second line (test line). When the reaction flows along the strip, the first molecular antibody binds to the first molecule carrying the cleaved or uncleaved oligonucleotide to the capture line, the cleaved reporter will bind to the antibody of the first molecular antibody at the first capture line, and the uncleaved reporter will bind to the second molecular antibody at the second capture line. Binding of the reporter group at each line will result in a strong readout/signal (e.g., color). As more reporter is cut, more signal will accumulate at the first capture line and less signal will appear at the second line. In certain aspects, the invention relates to the use of a flow strip as described herein for detecting nucleic acids. In certain aspects, the invention relates to a method of detecting nucleic acids using a flow strip as defined herein, e.g. a (lateral) flow test or a (lateral) flow immunochromatographic assay. In certain aspects, the molecules in the single stranded nucleic acid detector may be interchanged or the positions of the molecules may be changed, so long as the reporting principle is the same or similar to that of the present invention, and the modified manner is also included in the present invention.
The detection method provided by the invention can be used for quantitative detection of target nucleic acid to be detected. The quantitative detection index can be quantified according to the signal intensity of the reporter group, such as the luminous intensity of the fluorescent group, the width of the color-developing strip, and the like.
Wild type
As used herein, the term "wild-type" has the meaning commonly understood by those skilled in the art, which refers to a typical form of an organism, strain, gene, or a characteristic that, when it exists in nature, differs from a mutant or variant form, which may be isolated from a source in nature and not intentionally modified by man.
Derivatization
As used herein, the term "derivatization" refers to a chemical modification of an amino acid, polypeptide, or protein in which one or more substituents have been covalently attached to the amino acid, polypeptide, or protein. Substituents may also be referred to as side chains.
A derivatized protein is a derivative of the protein, in general, derivatization of the protein does not adversely affect the desired activity of the protein (e.g., binding to a guide RNA, endonuclease activity, binding to a specific site of a target sequence under the guidance of a guide RNA and cleavage activity), that is, the derivative of the protein has the same activity as the protein.
Derivatizing proteins
Also referred to as "protein derivatives" refers to modified forms of a protein, for example, wherein one or more amino acids of the protein may be deleted, inserted, modified and/or substituted.
Non-naturally occurring
As used herein, the terms "non-naturally occurring" or "engineered" are used interchangeably and refer to human involvement. When these terms are used to describe a nucleic acid molecule or polypeptide, it means that the nucleic acid molecule or polypeptide is at least substantially free from at least one other component to which it is associated in nature or as found in nature.
Orthologs (orthologue, ortholog)
As used herein, the term "ortholog (orthologue, ortholog)" has the meaning commonly understood by those skilled in the art. As a further guidance, an "ortholog" of a protein as described herein refers to a protein belonging to a different species that performs the same or similar function as the protein as its ortholog.
Identity of
As used herein, the term "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent identity" between two sequences is a function of the number of matched positions shared by the two sequences divided by the number of positions to be compared x 100. For example, if 6 out of 10 positions of two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (3 out of 6 positions in total are matched). Typically, the comparison is made when two sequences are aligned to produce maximum identity. Such alignment may be conveniently performed using, for example, a computer program such as the Align program (DNAstar, inc.) Needleman et al (1970) j.mol.biol.48: 443-453. The percent identity between two amino acid sequences can also be determined using the algorithm of E.Meyers and W.Miller (Comput. Appl biosci.,4:11-17 (1988)) which has been integrated into the ALIGN program (version 2.0), using the PAM120 weight residue table (weight residue table), the gap length penalty of 12 and the gap penalty of 4. Furthermore, percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J MoI biol.48:444-453 (1970)) algorithms that have been incorporated into the GAP program of the GCG software package (available on www.gcg.com) using the Blossum 62 matrix or PAM250 matrix and the GAP weights (GAP WEIGHT) of 16, 14, 12, 10, 8, 6 or 4 and the length weights of 1,2, 3, 4, 5 or 6.
Carrier body
The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid molecule linked thereto. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; a nucleic acid molecule comprising one or more free ends, free ends (e.g., circular); a nucleic acid molecule comprising DNA, RNA, or both; and other diverse polynucleotides known in the art. The vector may be introduced into a host cell by transformation, transduction or transfection such that the genetic material elements carried thereby are expressed in the host cell. A vector may be introduced into a host cell to thereby produce a transcript, protein, or peptide, including from a protein, fusion protein, isolated nucleic acid molecule, or the like (e.g., a CRISPR transcript, such as a nucleic acid transcript, protein, or enzyme) as described herein. A vector may contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may also contain a replication origin.
One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA fragments may be inserted, for example, by standard molecular cloning techniques.
Another type of vector is a viral vector in which a virus-derived DNA or RNA sequence is present in a vector used to package a virus (e.g., retrovirus, replication-defective retrovirus, adenovirus, replication-defective adenovirus, and adeno-associated virus). Viral vectors also comprise polynucleotides carried by a virus for transfection into a host cell. Certain vectors (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors) are capable of autonomous replication in a host cell into which they are introduced.
Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors".
Host cells
As used herein, the term "host cell" refers to a cell that can be used to introduce a vector, including, but not limited to, prokaryotic cells such as e.g. escherichia coli or bacillus subtilis, eukaryotic cells such as microbial cells, fungal cells, animal cells and plant cells.
Those skilled in the art will appreciate that the design of the expression vector may depend on factors such as the choice of host cell to be transformed, the desired level of expression, and the like.
Regulatory element
As used herein, the term "regulatory element" is intended to include promoters, enhancers, internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly U sequences), the detailed description of which may be found in goldel (Goeddel), gene expression techniques: methods in enzymology (GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY) 185, academic Press (ACADEMIC PRESS), san Diego (San Diego), calif., 1990. In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells as well as those sequences that direct expression of the nucleotide sequence in only certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters may primarily direct expression in a desired tissue of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or specific cell types (e.g., lymphocytes). In some cases, regulatory elements may also direct expression in a time-dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue or cell type specific. In certain instances, the term "regulatory element" encompasses enhancer elements, such as WPRE; a CMV enhancer; the R-U5' fragment in the LTR of HTLV-I (mol. Cell. Biol., volume 8 (1), pages 466-472, 1988), the SV40 enhancer, and the intron sequence between exons 2 and 3 of rabbit beta-globin (Proc. Natl. Acad. Sci. USA., volume 78 (3), pages 1527-31, 1981).
Promoters
As used herein, the term "promoter" has a meaning well known to those skilled in the art and refers to a non-coding nucleotide sequence located upstream of a gene that is capable of initiating expression of a downstream gene. Constitutive (constitutive) promoters are nucleotide sequences of which: when operably linked to a polynucleotide encoding or defining a gene product, it results in the production of the gene product in the cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence which, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in a cell, essentially only when an inducer corresponding to the promoter is present in the cell. Tissue specific promoters are nucleotide sequences that: when operably linked to a polynucleotide encoding or defining a gene product, it results in the production of the gene product in the cell substantially only if the cell is a cell of the tissue type to which the promoter corresponds.
NLS
A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein for introduction into the nucleus by nuclear transport, i.e., a protein with NLS is transported to the nucleus. Typically, NLS contains positively charged Lys or Arg residues exposed at the protein surface. Exemplary nuclear localization sequences include, but are not limited to, NLS from: SV40 large T antigen, EGL-13, c-Myc, and TUS proteins. In some embodiments, the NLS comprises PKKKRKV sequence. In some embodiments, the NLS comprises the AVKRPAATKKAGQAKKKKLD sequence. In some embodiments, the NLS comprises the PAAKRVKLD sequence. In some embodiments, the NLS comprises the MSRRRKANPTKLSENAKKLAKEVEN sequence. In some embodiments, the NLS comprises the KLKIKRPVK sequence. Other nuclear localization sequences include, but are not limited to, the acidic M9 domain of hnRNP A1, sequences KIPIK in yeast transcription repressor Mat. Alpha.2, and PY-NLS.
Operatively connected to
As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
Complementarity and method of detecting complementary
As used herein, the term "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence by means of a conventional watson-crick or other non-conventional type. Percent complementarity means the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary). "fully complementary" means that all consecutive residues of one nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in one second nucleic acid sequence. "substantially complementary" as used herein refers to a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids that hybridize under stringent conditions.
Stringent conditions
As used herein, "stringent conditions" for hybridization refers to conditions under which a nucleic acid having complementarity to a target sequence hybridizes predominantly to the target sequence and does not substantially hybridize to non-target sequences. Stringent conditions are typically sequence-dependent and will vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence.
Hybridization
The term "hybridization" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA, DNA) comprises a nucleotide sequence that enables it to bind non-covalently, i.e., form base pairs and/or G/U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to the complementary nucleic acid), "anneal" or "hybridize".
Hybridization requires that the two nucleic acids contain complementary sequences, although there may be mismatches between bases. Suitable conditions for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, variables well known in the art. Typically, the hybridizable nucleic acid is 8 nucleotides or more in length (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).
It will be appreciated that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. Polynucleotides may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target region in a target nucleic acid sequence to which it hybridizes.
Hybridization of the target sequence to the gRNA represents that at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the target sequence and the nucleic acid sequence of the gRNA can hybridize to form a complex; or at least 12, 15, 16, 17, 18, 19, 20, 21, 22 or more bases of the nucleic acid sequence representing the target sequence and the gRNA may be complementarily paired and hybridized to form a complex.
Expression of
As used herein, the term "expression" refers to a process whereby a polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcript) and/or a process whereby the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. Transcripts and encoded polypeptides may be collectively referred to as "gene products". If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells.
Joint
As used herein, the term "linker" refers to a linear polypeptide formed from multiple amino acid residues joined by peptide bonds. The linker of the invention may be an amino acid sequence that is synthesized artificially, or a naturally occurring polypeptide sequence, such as a polypeptide having the function of a hinge region. Such linker polypeptides are well known in the art (see, e.g., holliger, P. Et al (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; poljak, R.J. Et al (1994) Structure 2:1121-1123).
Treatment of
As used herein, the term "treating" refers to treating or curing a disorder, delaying the onset of symptoms of a disorder, and/or delaying the progression of a disorder.
A subject
As used herein, the term "subject" includes, but is not limited to, various animals, plants, and microorganisms.
Animals
Such as mammals, e.g., bovine, equine, ovine, porcine, canine, feline, lagomorph (e.g., mice or rats), non-human primate (e.g., macaque or cynomolgus) or human. In certain embodiments, the subject (e.g., human) has a disorder (e.g., a disorder resulting from a disease-related gene defect).
Plants and methods of making the same
The term "plant" is understood to mean any differentiated multicellular organism capable of photosynthesis, including crop plants, in particular monocotyledonous or dicotyledonous plants, at any stage of maturity or development, vegetable crops, including artichoke, broccoli, sesame seed, leek, asparagus, lettuce (e.g., head lettuce, leaf lettuce), chinese cabbage (bok choy), yellow arrowroot, melons (e.g., melon, watermelon, crohawa, white melon, cantaloupe), rape crops (e.g., cabbage, broccoli, chinese cabbage, kohlrabi, chinese cabbage), artichoke, carrot, cabbage (napa), okra, onion, celery, parsley, chick pea, parsnip, chicory, pepper, potato, cucurbit (e.g., zucchini, cucumber, zucchini, melon, pumpkin), radish, dried onion, turnip cabbage, purple eggplant (also known as eggplant), salon, chicory, green onion, chicory, garlic, spinach, green onion, melon, green vegetables (greens), beet (sugar beet and fodder beet), sweet potato, lettuce, horseradish, tomato, turnip, and spice; fruits and/or vines, such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, oranges, blueberries, boy raspberries (boysenberry), redberries, currants, rozerland berries, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwi fruits, persimmons, pomegranates, pineapples, tropical fruits, pome fruits, melons, mangoes, papaya, and litchis; field crops, such as clover, alfalfa, evening primrose, white mango, corn/maize (forage maize, sweet maize, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereal crops (barley, oat, rye, wheat, etc.), sorghum, tobacco, kapok, leguminous plants (beans, lentils, peas, soybeans), oleaginous plants (rape, mustard, poppy, olives, sunflower, coconut, castor oil plants, cocoa beans, groundnut), arabidopsis, fibrous plants (cotton, flax, hemp, jute), camphorridae (cinnamon, camphordons), or a plant such as coffee, sugar cane, tea, and natural rubber plants; and/or flower bed plants, such as flowering plants, cactus, fleshy plants and/or ornamental plants, and trees, such as forests (broadleaf and evergreen trees, e.g., conifers), fruit trees, ornamental trees, and nut-bearing trees, and shrubs and other seedlings.
Advantageous effects of the invention
The invention reduces the off-target effect of the Cas12i3 protein through mutation and has wide application prospect.
Embodiments of the present invention will be described in detail below with reference to the accompanying drawings and examples, but it will be understood by those skilled in the art that the following drawings and examples are only for illustrating the present invention and are not to be construed as limiting the scope of the present invention. Various objects and advantageous aspects of the present invention will become apparent to those skilled in the art from the following detailed description of the preferred embodiments and the accompanying drawings.
Drawings
Figure 1. Detection of off-target effects of cas proteins at different targets.
FIG. 2 is a block diagram of the Cas12i3Max protein.
Figure 3 verification of editing efficiency of Cas proteins with different amino acid site mutations.
Figure 4 off-target effect test of Cas proteins with different amino acid site mutations.
FIG. 5 mismatch tolerance test of different muteins at T8 site.
FIG. 6-detection of the efficiency of editing and off-target targeting of the Cas12i3Max protein and the AP44 protein.
Figure 7 Cas protein off-target effect test for amino acid site combination mutations.
Detailed Description
The following examples are only intended to illustrate the invention and are not intended to limit it. The experiments and methods described in the examples were performed substantially in accordance with conventional methods well known in the art and described in various references unless specifically indicated. For example, for the conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA used in the present invention, reference may be made to Sambrook (Sambrook), friech (Fritsch) and manitis (Maniatis), molecular cloning: laboratory Manual (MOLECULAR CLONING: A LABORATORY MANUAL), edit 2 (1989); the handbook of contemporary molecular biology (CURRENT PROTOCOLS IN MOLECULAR BIOLOGY) (edited by f.m. ausubel et al, (1987)); the enzyme methods series (METHODS IN ENZYMOLOGY) (academic publishing Co): PCR 2: practical methods (PCR 2:A PRACTICAL APPROACH) (m.j. Maxfresen (m.j. Macpherson), b.d. black ms (b.d. hames) and g.r. taylor (1995)), harlow and Lane (Lane) edits (1988), antibodies: laboratory Manual (ANTIBODIES, A LABORATORY MANUAL), animal cell CULTURE (ANIMAL CELL CULTURE) (R.I. French Lei Xieni (R.I. Freshney) eds. (1987)).
In addition, the specific conditions are not specified in the examples, and the process is carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention. Those skilled in the art will appreciate that the examples describe the invention by way of example and are not intended to limit the scope of the invention as claimed. All publications and other references mentioned herein are incorporated by reference in their entirety.
EXAMPLE 1 acquisition of Cas muteins
For the known Cas protein (cas12f.4 in CN111757889B, in this example, it is called Cas12i 3), applicants predicted key amino acid sites that might affect their biological functions by bioinformatics and mutated the amino acid sites, resulting in Cas muteins with improved editing activity. Specifically, the coding sequence of the Cas12i3 is subjected to codon optimization and synthesis, the amino acid sequence of the wild Cas12i3 is shown as SEQ ID No.1, the nucleic acid sequence of the wild Cas12i3 is shown as SEQ ID No.2, and the amino acid which is combined with the target sequence is subjected to site-directed mutation by a bioinformatics method.
SEQ ID No.1:
mkkvevsrpyqslllpnhrkfkyldetwnayksvksllhrflvcaygavpfnkfvevvekvdndqlvlafavrlfrlvpvestsfakvdkanlakslanhlpvgtaipanvqsyfdsnfdpkkymwidcaweadrlaremglsasqfseyattmlwedwlplnkddvngwgsvsglfgegkkedrqqkvkmlnnllngikknppkdytqylkillnafdakshkeavknykgdstgrtasylseksgeitelmleqlmsniqrdigdkqkeislpkkdvvkkylesesgvpydqnlwsqayrnaassikktdtrnfnstlekfknevelrgllsegddveilrskffssefhktpdkfvikpehigfnnkynvvaelyklkaeatdfesafatvkdefeekgikhpiknileyiwnnevpvekwgrvarfnqseekllrikanptvecnqgmtfgnsamvgevlrsnyvskkgalvsgehggrligqnnmiwlemrllnkgkwethhvpthnmkffeevhaynpsladsvnvrnrlyrsedytqlpssitdglkgnpkakllkrqhcalnnmtanvlnpklsftinkknddytviivhsvevskprrevlvgdylvgmdqnqtasntyavmqvvkpkstdaipfrnmwvrfvesgsiesrtlnsrgeyvdqlnhdgvdlfeigdtewvdsarkffnklgvkhkdgtlvdlstaprkayafnnfyfktmlnhlrsnevdltllrneilrvangrfspmrlgslswttlkalgsfkslvlsyfdrlgakemvdkeakdkslfdllvainnkrsnkreertsriasslmtvaqkykvdnavvhvvvegnlsstdrsaskahnrntmdwcsravvkkledmcnlygfnikgvpafytshqdplvhradyddpkpalrcryssysradfskwgqnalaavvrwasnkksntcykvgaveflkqhglfadkkltveqflskvkdeeiliprrggrvfltthrllaestfvylngvkyhscnadevaavniclndwvipckkkmkeessasg
SEQ ID No.2:
atgaagaaggtggaggtgtccagaccctaccagtccctcctcctgcccaaccacaggaagtttaagtacctcgatgagacctggaacgcctacaagagcgtcaagagcttgctgcataggttcctggtgtgcgcctacggcgccgtgcccttcaacaagttcgtggaggtggtggagaaggtggacaacgatcagctggtgctggccttcgccgtgcggctgtttaggctggtcccagtcgagagcaccagctttgccaaggtggacaaggctaacctggcaaagtccctggccaaccacctgcccgtgggcacagccatccctgctaacgtccagtcctactttgatagcaacttcgaccccaagaagtacatgtggatcgactgcgcctgggaggccgataggctggccagggagatggggctgagcgccagccagtttagcgagtacgccacaacaatgctctgggaggattggctgcccttgaataaggatgacgtgaacgggtgggggtcagtgagcgggctgttcggagaggggaagaaggaggataggcagcagaaggtgaagatgctgaacaacctgctgaacgggattaagaagaacccccctaaggattacacccagtacctcaagatcctgctgaacgccttcgacgctaagtctcataaggaggccgtgaagaactacaagggagatagcaccggccggactgcttcctacctttccgagaagagcggcgagattaccgagctgatgctggagcagctgatgagcaacatccagcgggacattggcgataagcagaaggagattagtctgcccaagaaggatgtggtgaagaagtacctggagtccgagtcaggggtgccatacgaccagaacctctggagccaggcctaccggaacgccgctagctccatcaaaaagaccgatacaaggaactttaactccacactggagaagtttaagaacgaggtcgagctgcggggcttgctgagcgagggcgatgacgtggagatcctgaggagcaagttcttctcctctgagttccacaagacacctgacaagttcgtgatcaagccagagcacatcggctttaacaacaagtacaacgtggtcgccgagctgtacaagctgaaggctgaggccactgacttcgagtcagcctttgccacagtcaaggatgagttcgaggagaaggggattaagcaccccattaagaacattctggagtacatctggaacaacgaggtccccgtggagaagtggggcagggtggcccggtttaaccagtctgaggagaagctgctgcggatcaaggccaaccccacagtcgagtgtaaccaggggatgacctttgggaacagcgccatggtgggggaggtgctgcggtccaactacgtgagcaagaagggggccctggtctcaggggaacacgggggccggctgatcggccagaacaacatgatttggctcgagatgagattgttgaacaagggaaagtgggagacccaccacgtgcccacccacaacatgaagttcttcgaggaggtccacgcctacaaccctagcctcgccgactcagtcaacgtcaggaaccggctgtaccgcagcgaagattacactcagctgccctccagcattactgatggcctgaaggggaaccccaaggccaagctcctgaagagacagcactgcgccttgaacaacatgacagccaacgtgctgaaccccaagctgagcttcacaattaacaagaagaacgatgactacaccgtgattattgtgcacagcgtggaggtctccaagccacggagggaggtgctggtgggggattacctggtgggcatggaccagaaccagaccgcctccaacacctacgccgtgatgcaggtggtgaagcctaagtccactgatgccatcccctttaggaacatgtgggtgagattcgtcgagtccgggagcattgagtccagaacactgaacagcagaggagagtacgtcgaccagctgaaccatgatggggtggatctcttcgagatcggggacactgaatgggtcgactccgcccggaagttcttcaacaagctcggcgtgaagcacaaagacgggaccctggtcgatttgtctaccgcccctcggaaggcctacgcctttaacaacttttacttcaagacaatgctgaaccacctccggtctaacgaggtggacctcacactgctccggaacgagatcctcagagtggccaacggccggttcagccctatgaggctgggctccttgtcctggacaaccctcaaggctctgggcagcttcaagtctctggtgctgagctactttgataggctgggcgccaaggagatggtcgacaaggaggccaaggataagagcctcttcgacctcctcgtcgccatcaacaacaagcggtccaacaagcgggaggagcggacatccaggatcgccagcagcctgatgaccgtcgcccagaagtacaaggtggataacgccgtggtccacgtcgtcgtggagggcaacctcagctccaccgaccggtctgctagcaaggcccataaccggaacaccatggactggtgctccagggccgtcgtgaagaagctggaggatatgtgcaacctctatggctttaacattaagggggtccccgccttttacacctcccaccaggaccccctggtgcatcgggccgactacgatgaccccaagcccgccctgaggtgccggtactcctcctacagccgggccgactttagcaagtggggccagaacgccttggccgccgtggtgaggtgggccagcaacaagaagagcaacacttgctacaaggtcggggccgtggagttcctgaagcagcatggcctgttcgctgataagaagctgacagtcgagcagttcctcagcaaggtgaaggacgaggagatcctgattccccgccggggcggcagggtgtttctgactacacaccggctgctggccgagagcactttcgtgtacctgaacggcgtgaagtaccactcctgtaacgccgacgaggtggccgccgtcaacatctgcttgaacgattgggtcatcccatgcaagaagaagatgaaggaggagagcagcgccagcggg
Variants of Cas protein were generated by PCR-based site-directed mutagenesis. The specific method is to design a DNA sequence of the Cas12i3 protein into two parts by taking a mutation site as a center, design two pairs of primers to amplify the two parts of DNA sequences respectively, introduce the sequences to be mutated on the primers, and finally load the two fragments on a pcDNA3.3-eGFP vector in a Gibson cloning mode. The combination of mutants was constructed by splitting the DNA of Cas12i3 protein into multiple segments using PCR, gibson clone. Fragment amplification kit: TRANSSTART FASTPFU DNA POLYMERASE (containing 2.5mM dNTPs), and the detailed experimental procedures are shown in the specification. Glue recovery kit: gel DNAExtraction Mini Kit the detailed experimental flow is shown in the specification. Kit for vector construction: pEASY-Basic Seamless Cloning and Assembly Kit (CU 201-03), the specific experimental procedures are described in the specification.
Cas12i3Max (also called Cas-SF 01) with obviously improved editing activity is obtained after screening, and compared with a sequence shown in SEQ ID No.1, amino acids at 7 th, 233 th, 267 th, 369 th and 433 th of an N end are mutated into R respectively (the Cas12i3Max is also recorded in Chinese patent application, patent application number: 202310088437.4), and the amino acid sequence of the Cas12i3Max is shown in SEQ ID No. 3.
SEQ ID No.3:
mkkvevrrpyqslllpnhrkfkyldetwnayksvksllhrflvcaygavpfnkfvevvekvdndqlvlafavrlfrlvpvestsfakvdkanlakslanhlpvgtaipanvqsyfdsnfdpkkymwidcaweadrlaremglsasqfseyattmlwedwlplnkddvngwgsvsglfgegkkedrqqkvkmlnnllngikknppkdytqylkillnafdakshkeavknykgrstgrtasylseksgeitelmleqlmsniqrdigrkqkeislpkkdvvkkylesesgvpydqnlwsqayrnaassikktdtrnfnstlekfknevelrgllsegddveilrskffssefhktpdkfvikpehigfnrkynvvaelyklkaeatdfesafatvkdefeekgikhpiknileyiwnnevpvekwgrvarfnqreekllrikanptvecnqgmtfgnsamvgevlrsnyvskkgalvsgehggrligqnnmiwlemrllnkgkwethhvpthnmkffeevhaynpsladsvnvrnrlyrsedytqlpssitdglkgnpkakllkrqhcalnnmtanvlnpklsftinkknddytviivhsvevskprrevlvgdylvgmdqnqtasntyavmqvvkpkstdaipfrnmwvrfvesgsiesrtlnsrgeyvdqlnhdgvdlfeigdtewvdsarkffnklgvkhkdgtlvdlstaprkayafnnfyfktmlnhlrsnevdltllrneilrvangrfspmrlgslswttlkalgsfkslvlsyfdrlgakemvdkeakdkslfdllvainnkrsnkreertsriasslmtvaqkykvdnavvhvvvegnlsstdrsaskahnrntmdwcsravvkkledmcnlygfnikgvpafytshqdplvhradyddpkpalrcryssysradfskwgqnalaavvrwasnkksntcykvgaveflkqhglfadkkltveqflskvkdeeiliprrggrvfltthrllaestfvylngvkyhscnadevaavniclndwvipckkkmkeessasg
Example 2 off-target efficacy validation of Cas muteins
Reference (Yang,Yi,et al."Highly efficient and rapid detection of the cleavage activity of Cas9/gRNA via a fluorescent reporter."Applied biochemistry and biotechnology 180.4(2016):655-667.) builds a fluorescence report system suitable for verifying the cutting of Cas12i3, designs targets T5, T6 and T8 at GFFP, builds a mismatched crRNA vector by taking 2bp base as a window, and verifies the off-target effect of Cas12i3Max, wherein the mutation principle is A-C, T-A, C-G and G-A. The crRNA containing the 2bp mutation was annealed to the BbsI site to give the pCas i3Max_ GFFP _crRNA_ Mxx plasmid containing GFFP and mCherry fluorescent tags. And (3) paving: HEK293T cells were plated to 80% confluency and plated into 24 well plates. Mixing evenly: mu.l of opti-MEM was added with 1.5ug of plasmid and mixed well. The diluted HIEFF TRANS TM liposome nucleic acid transfection reagent is uniformly mixed with the diluted plasmid, and incubated for 15min at room temperature. The incubated mixture was added to the cell-plated medium for transfection, and after 24 hours of transfection, each transfection well was replaced with 1000. Mu.L of DMEM medium. The cells were then incubated for an additional 24 hours before they were collected for flow cytometry. After removal of the medium, the transfected cells were digested per well with 300. Mu.L of 0.25% trypsin. Digestion was stopped by adding 300. Mu.L of medium, and after centrifugation at 100rpm for 3min, resuspended in 500. Mu.L of medium. The cell pipette was then transferred to a 5mL round bottom polystyrene tube with a cell filter clamp cap and refrigerated. Cells with GFP signal were sorted by flow cytometry (FACS), GFFP were not luminescent, and recombined into GFP fluorescence after editing. mCherry fluorescence was detected with Y610 (561/610 nm) and GFP fluorescence was detected with B525 (488/525 nm). Editing efficiency was calculated by dividing mCherry and GFP cell numbers by GFP cell numbers.
As shown in the figure 1, the designed target and the off-target effect detection result are shown in the figure 1, wherein T5, T6 and T8 targets are respectively designed at the corresponding positions GFFP, mis and Mis respectively, the designed mismatch sites are designed at the 1 st and 2 nd positions of the PAM end, mis represents the designed mismatch sites of the gRNA at the 3 rd and 4 th positions of the PAM end, mis represents the designed mismatch sites of the gRNA at the 5 th and 6 th positions of the PAM end, mis and 78 represents the designed mismatch sites of the gRNA at the 7 th and 8 th positions of the PAM end, mis and 910 represents the designed mismatch sites of the gRNA at the 9 th and 10 th positions of the PAM end, mis and 1112 represents the designed mismatch sites of the gRNA at the 11 th and 12 th positions of the PAM end, mis and 1314 represent the designed mismatch sites of the gRNA at the 13 th and 14 th positions of the PAM end, mis and 1516 represents the designed mismatch sites of the gRNA at the 15 th and 16 th positions of the PAM end, mis and 1718 represents the designed mismatch sites of the gRNA at the 17 th and 18 th positions of the PAM end, mis represents the designed mismatch sites of the gRNA at the 19 th and 20 th positions of the PAM end, 20 th position, and 20 represents the designed mismatch sites of the gRNA at the right side, and 20 th position of the mismatch site, and 15 th position of the target is different from the target effect, and the target effect is shown by the figure, and the target effect is more apparent from the target effect.
The Cas12i3Max protein is further optimized, and off-target effect is reduced while editing activity is improved.
Example 3 mutant site screening to reduce off-target Effect of Cas proteins
The predicted amino acid sites are mutated by using a rapid mutation kit by using a Cas12i3Max protein structure diagram in FIG. 2 to obtain 80 sites in total, and the mutated fragments are inserted into a Cas12i3Max-T5/T8 vector through Afe I and PstI restriction enzymes after PCR cloning. The editing efficiency of the 80 mutants obtained was screened, and the screening method was as described in example 2, using GFFP fluorescent reporter system at the T5 target, to select sites with editing efficiency reduced by no more than 3.5%.
As shown in FIG. 3, the single amino acid mutation sites were numbered according to the amino acid sequence order from AP01 to AP80, 16 sites with editing efficiency not lower than 3.5% compared with the control (Cas 12i3Max in the figure) were screened out altogether, namely AP5, AP6, AP20, AP27, AP31, AP35, AP37, AP39, AP44, AP48, AP49, AP54, AP58, AP70, AP74, AP76, and the editing activity of the remaining mutants was significantly reduced. Verification of off-target experiments was performed on the 16 mutants described above.
The detection results of the off-target effect experiments are respectively carried out by selecting the target T8, the T8mis78 and the T8mis910, the detection results are shown in the figure 4, T8 shows the editing efficiency of the target T8, T8mis78 shows the editing efficiency of the mismatch at the 7 th and 8 th positions of the PAM end at the target T8, T8mis910 shows the editing efficiency of the mismatch at the 9 th and 10 th positions of the PAM end at the target T8, the results show that the mutations at the amino acid positions 876 and 890 on the AP44 (based on Cas12i3 Max) are obviously reduced, namely the mutation of the amino acid at the 876 th position of the sequence shown by SEQ ID No.1 is R, and the AP58 (based on Cas12i3Max is carried out, the amino acid at the 890 th position of the sequence shown by SEQ ID No.1 is R), and the editing efficiency of the mismatch at the 890 th position of the sequence shown by SEQ ID No.3 is obviously reduced, namely the mismatch tolerance of the amino acid positions 876 and 890 can be obviously reduced, and the off-target effect of the mismatch can not be influenced by Cas12i3 Max.
EXAMPLE 4 off-target Effect and edit efficiency test experiments of muteins
The off-target effect and editing efficiency of the AP44 protein (also called Cas-SF01 HiFi) screened in the above example were tested, and reference example 2 was made to design mismatch sites at target T8 of GFFP, and as a result, as shown in FIG. 5, M12 represents the design mismatch site of gRNA at positions 1 and 2 of the PAM end, M34 represents the design mismatch site of gRNA at positions 3 and 4 of the PAM end, M56 represents the design mismatch site of gRNA at positions 5 and 6 of the PAM end, M78 represents the design mismatch site of gRNA at positions 7 and 8 of the PAM end, M910 represents the design mismatch site of gRNA at positions 9 and 10 of the PAM end, M1112 represents the design mismatch site of gRNA at positions 11 and 12 of the PAM end, M1314 represents the design mismatch site of gRNA at positions 13 and 14 of the PAM end, M1516 represents the 15 th and 16 th mismatch sites of the gRNA at the PAM end, M1718 represents the 17 th and 18 th mismatch sites of the gRNA at the PAM end, M1920 represents the 19 th and 20 th mismatch sites of the gRNA at the PAM end, cas-SF01 represents the mutant protein Cas12i3Max, cas-SF01HiFi represents the mutant protein AP44, and according to the graph of FIG. 5, the editing efficiency of the mutant protein AP44 with the 3 rd-16 th mismatch at the T8 site is lower than that of the Cas12i3Max mutant protein, namely the mismatch tolerance of the 3 rd-16 th mismatch at the T8 site of the AP44 is lower than that of the Cas12i3Max mutant protein, which indicates that the 876 th amino acid mutation at the amino acid site can remarkably reduce the mismatch tolerance and reduce the off-target effect of the Cas protein.
Comparing the target editing efficiency and the target removing efficiency of Cas12i3Max and AP44 in the TTR gene, wherein the TTR gene designs target TTR-target11 (shown as ON in figure 6) and the target removing site (shown as OFF in figure 6) detected by GUIDE-seq, and the TTR-target11 target sequence information is as follows: 5'-ATTTGTAGAAGGGATATACAAAGT-3', off-target site sequence information: 5'-ATTTGTAGAAGGAATATACAAGTA-3', italics is PAM sequence; as shown in fig. 6, each dot represents 2 repetitions, and at the target point, the target editing efficiency of the mutant proteins Cas-SF01HiFi (i.e., the mutant protein AP 44) and Cas-SF01 (i.e., the mutant protein Cas12i3 Max) is high, but the editing efficiency of the Cas-SF01HiFi (i.e., the mutant protein AP 44) at the off-target site is significantly reduced.
Further research on a target point for reducing the off-target effect of Cas12I3Max, carrying out combined mutation on AP44 and AP588 (mutation is carried out on both positions D876R and A890R corresponding to the sequence position of SEQ ID No.1 on the basis of Cas12I3 Max) to obtain AP44+AP58 (namely, mutation is carried out on amino acids 876 and 890 in the sequence shown in SEQ ID No.3 to R), and verifying the off-target effect at a target point T8 mis78, wherein the editing efficiency of the combined off-target site of AP44+AP58 is obviously reduced compared with that of the control Cas12I3Max (I3 Max in the figure), and the editing efficiency of the combined off-target site of AP44+AP58 is obviously reduced as shown in figure 7; this further demonstrates that the combined mutation of amino acids 876 and 890 from the N-terminus of the sequence shown in SEQ ID No.1 can further reduce mismatch tolerance, further reducing the off-target effect of Cas protein.
Meanwhile, mutation is performed on 876 and/or 890 sites of the wild type Cas12i3 (SEQ ID No. 1), and off-target effect is verified. The wild-type Cas12i3 (the amino acid sequence is shown as SEQ ID No. 0.1) is subjected to mutation and combined mutation at 876 th and 890 th respectively, and detection of off-target effect experiments at target points T8, T8mis78 and T8mis910 respectively by referring to the experimental method shows that when the wild-type Cas2i3 has mutation at 876 th or 890 th, namely D876R (corresponding to mutation at 876 th of SEQ ID No.1 protein sequence as R) or A890R (corresponding to mutation at 890 th of SEQ ID No.1 protein sequence as R), the editing efficiency is obviously reduced under the condition that the gRNA is mismatched with a target point, and when the Cas12i3 has D876R-A890R (corresponding to simultaneous mutation at 876 th and 890 th of SEQ ID No.1 protein sequence as R) simultaneously exists, the editing efficiency is further reduced under the condition that the gRNA is mismatched with the target point of interest.
Thus, it can be seen that mutation of position 876 and/or 890 of Cas12i3 protein can significantly reduce the off-target effect of Cas protein due to gRNA mismatch.
Although specific embodiments of the invention have been described in detail, those skilled in the art will appreciate that: many modifications and variations of details may be made to adapt to a particular situation and the invention is intended to be within the scope of the invention. The full scope of the invention is given by the appended claims together with any equivalents thereof.

Claims (15)

1. A Cas mutein having a mutation compared to the amino acid sequence of the parent Cas protein at the following amino acid positions corresponding to the amino acid sequence set forth in SEQ ID No. 1: 876 and/or 890, the amino acid at position 876 and the amino acid at position 890 are both mutated to R; the parent Cas protein is selected from any one of the following groups:
(1) The parent Cas protein is Cas mutant protein generated on the basis of an amino acid sequence shown in SEQ ID No.1, and the mutation is that all amino acids at 7 th, 233 rd, 267 th, 369 th and 433 th of the SEQ ID No.1 are mutated into R;
(2) The amino acid of the parent Cas protein is shown as SEQ ID No. 1.
2. A fusion protein comprising the Cas mutein of claim 1 and other modifying moieties that are detectable markers.
3. An isolated polynucleotide, wherein the polynucleotide is a polynucleotide sequence encoding the Cas mutein of claim 1 or a polynucleotide sequence encoding the fusion protein of claim 2.
4. A carrier, characterized in that, the vector comprising the polynucleotide of claim 3 operably linked to regulatory elements.
5. A CRISPR-Cas system, characterized in that the system comprises the Cas mutein of claim 1 and at least one gRNA;
The gRNA is capable of binding to the Cas mutein of claim 1.
6. A composition, characterized in that it comprises:
(i) A protein component selected from the group consisting of: the Cas mutein of claim 1 or the fusion protein of claim 2;
(ii) A nucleic acid component that is a gRNA comprising a cognate repeat sequence capable of binding to the Cas mutein of claim 1 and a guide sequence capable of targeting a target sequence;
The protein component and the nucleic acid component are bound to each other to form a complex.
7. An engineered host cell comprising the Cas mutein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6.
8. The Cas mutein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6, or the host cell of claim 7 for use in any or any of several selected from the group consisting of: gene targeting, gene cutting and nucleic acid detection, and the efficiency of gene editing off-target is reduced.
9. The use of claim 8, wherein the gene cleavage comprises cleavage of double-stranded DNA, single-stranded RNA.
10. The use of claim 8, wherein the gene cleavage comprises a nonspecific cleavage of a collateral nucleic acid, and a nonspecific cleavage of a single-stranded nucleic acid.
11. Use of the Cas mutein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6, or the host cell of claim 7 in gene editing or in the preparation of a kit for non-disease diagnostic or therapeutic purposes.
12. The use of claim 11, wherein the gene editing comprises base editing double-stranded nucleic acids, base editing single-stranded nucleic acids.
13. A method of targeting a target nucleic acid or cleaving a target nucleic acid or reducing off-target efficiency in gene editing, the method comprising contacting the target nucleic acid with a Cas mutein of claim 1, or a fusion protein of claim 2, or a polynucleotide of claim 3, or a vector of claim 4, or a CRISPR-Cas system of claim 5, or a composition of claim 6, or a host cell of claim 7, the method being a method for non-disease diagnosis or therapeutic purposes.
14. A method of editing a target nucleic acid comprising contacting the target nucleic acid with a Cas mutein of claim 1, or a fusion protein of claim 2, or a polynucleotide of claim 3, or a vector of claim 4, or a CRISPR-Cas system of claim 5, or a composition of claim 6, or a host cell of claim 7, the method being a method of non-disease diagnosis or treatment.
15. A kit comprising the Cas mutein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6, or the host cell of claim 7.
CN202410296507.XA 2023-04-26 2024-03-15 Optimized Cas protein and application thereof Active CN118006585B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202310491001 2023-04-26
CN202310491001X 2023-04-26

Publications (2)

Publication Number Publication Date
CN118006585A CN118006585A (en) 2024-05-10
CN118006585B true CN118006585B (en) 2024-08-09

Family

ID=90950675

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410296507.XA Active CN118006585B (en) 2023-04-26 2024-03-15 Optimized Cas protein and application thereof

Country Status (1)

Country Link
CN (1) CN118006585B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111757889A (en) * 2018-10-29 2020-10-09 中国农业大学 Novel CRISPR/Cas12f enzymes and systems
CN116004573A (en) * 2022-10-25 2023-04-25 山东舜丰生物科技有限公司 Cas protein with improved editing activity and application thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114517190B (en) * 2021-02-05 2022-12-23 山东舜丰生物科技有限公司 CRISPR enzymes and systems and uses
CN114672473B (en) * 2022-05-31 2022-08-26 舜丰生物科技(海南)有限公司 Optimized Cas protein and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111757889A (en) * 2018-10-29 2020-10-09 中国农业大学 Novel CRISPR/Cas12f enzymes and systems
CN116004573A (en) * 2022-10-25 2023-04-25 山东舜丰生物科技有限公司 Cas protein with improved editing activity and application thereof

Also Published As

Publication number Publication date
CN118006585A (en) 2024-05-10

Similar Documents

Publication Publication Date Title
CN116334037A (en) Novel Cas enzymes and systems and uses
CN115992115B (en) Novel CRISPR enzymes and systems and uses
CN116004572A (en) CRISPR enzyme and system and application
CN114410609B (en) Cas protein with improved activity and application thereof
CN116004573B (en) Cas protein with improved editing activity and application thereof
CN117106752A (en) Optimized Cas12 proteins and uses thereof
CN116286739A (en) Mutant Cas proteins and uses thereof
CN116555227B (en) Novel Cas enzyme and application
CN114277015B (en) CRISPR enzyme and application
CN118006585B (en) Optimized Cas protein and application thereof
CN116555225B (en) Cas proteins with improved activity and uses thereof
CN117070498B (en) Mutant CRISPR-Cas proteins and uses thereof
CN116083401B (en) Cas enzymes and systems and uses
CN116790559B (en) HNH domain-fused V-type Cas enzyme and application thereof
CN115975986B (en) Mutant Cas12j proteins and uses thereof
CN115851666B (en) Novel Cas enzymes and systems and uses
CN117050971A (en) Cas muteins and uses thereof
CN117286123A (en) Optimized Cas protein and application thereof
CN118147110A (en) Mutant Cas proteins and uses thereof
CN117247920A (en) Novel CRISPR enzyme, system and application
CN117603943A (en) Cas protein with improved editing efficiency and application thereof
WO2023173682A1 (en) Optimized cas protein and use thereof
CN116200369A (en) Novel Cas enzyme and application thereof
CN118076730A (en) Cas proteins with improved activity and uses thereof
CN116286733A (en) Cas12b gene editing enzymes and systems and uses

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant