CN118006559A - Regulated dopaminergic nerve cell, and preparation method and application thereof - Google Patents

Abstract

The invention relates to a regulated dopaminergic nerve cell, a preparation method and application thereof, wherein the preparation method comprises the steps of carrying out gene editing on an induced nerve stem cell to enable the induced nerve stem cell to express an excitatory receptor hM3Dq or an inhibitory receptor hM4Di, so as to obtain the edited induced nerve stem cell; and carrying out differentiation culture on the edited induced neural stem cells to enable the induced neural stem cells to express the markers of the dopaminergic nerve cells, and thus preparing the regulated dopaminergic nerve cells. The preparation method can be used for obtaining the dopaminergic nerve cells by in-vitro high-efficiency directional differentiation, and the CNO can regulate and control the cell functions; the cell is transplanted into a parkinsonism mouse model, can be differentiated into dopaminergic neurons in a midbrain A9 region in brain, improves parkinsonism mouse behaviours and is remotely regulated and controlled by CNO.

Description

Regulated dopaminergic nerve cell, and preparation method and application thereof

Technical Field

The invention relates to the technical field of biomedicine, in particular to a regulated dopaminergic nerve cell, a preparation method and application thereof.

Background

Parkinson's Disease (PD) is the second most common neurodegenerative disease worldwide, with a vast population of ill people. The pathogenesis of PD is a decrease in midbrain nigra dopaminergic cells. Therefore, replacement therapy of PD with stem cells is the focus of current research therapies.

In the field of nervous system stem cells, the ability of stem cells to differentiate into dopaminergic (dopamine, DA) neurons, differentiation efficiency, in vivo survival rate, clinical safety, availability of donor tissues, ethical issues, and the like have been the focus of interest to researchers. Researchers have studied various cell types such as fetal brain cells, embryonic Stem Cells (ESCs), induced Pluripotent Stem Cells (iPSCs), mesenchymal Stem Cells (MSCs), and the like. ESCs and iPSCs are the most widely used stem cells of the nervous system at present. They can differentiate into a variety of cell types, including dopaminergic neuron precursor cells (DAP), which provide a basis for stem cell therapy for parkinson's disease. But the use of ESC, iPSC may increase the risk of tumorigenesis.

In recent years, induced neural stem cell-derived dopaminergic precursor cells (induced neural stem cell-derived dopaminergic precursors cells, irsc-DAPs) exhibit good therapeutic effects in vitro and in vivo experiments in animals, and have the characteristics of low immunogenicity and low tumorigenicity. However, there is still uncontrollable cell replacement therapy PD due to the introduction of foreign cells, with side effects of graft-induced catabolism.

Disclosure of Invention

The invention aims to provide a regulated dopaminergic nerve cell, a preparation method and application thereof, wherein the dopaminergic nerve cell can be obtained by in-vitro high-efficiency directional differentiation through the preparation method, and the CNO can regulate the cell function of the dopaminergic nerve cell; the cell is transplanted into a parkinsonism mouse model, can be differentiated into dopaminergic neurons in a midbrain A9 region in brain, improves parkinsonism mouse behaviours and is remotely regulated and controlled by CNO.

To this end, in a first aspect, the present invention provides a method for preparing a regulated dopaminergic neural cell, comprising genetically editing an Induced Neural Stem Cell (iNSCs) to express the excitatory receptor hM3Dq or the inhibitory receptor hM4Di, to obtain an edited induced neural stem cell; and carrying out differentiation culture on the edited induced neural stem cells to enable the induced neural stem cells to express the markers of the dopaminergic nerve cells, and thus preparing the regulated dopaminergic nerve cells.

The method provided by the invention can be used for preparing dopaminergic nerve cells regulated by clozapine-n-oxide (CNO). The cell function of the recombinant strain is proved to be regulated and controlled by CNO in vitro and in vivo, and the recombinant strain has good clinical application prospect.

In some embodiments, the marker comprises at least one of FoxA2, NURR1, TH, tuj 1. For example, the marker is at least one of FoxA2 and NURR 1.

Among the above markers, foxA2 is a dopaminergic precursor cell (dopaminergic precursor cells, DAP) -specific protein in the basal area, suggesting that the cell is differentiated into a DA neuron in the midbrain A9 area. NURR1 is a surface marker of mature DA neurons in the midbrain A9 region. TH, tuj1 are molecular markers of mature DA neurons, expressed in both the A9 region and the A10 region.

In some embodiments, the step of differentiating culturing comprises: the following culture is sequentially carried out on the edited induced neural stem cells:

Culturing in the first stage, wherein the first stage culture medium is used for culturing 10 days before differentiation culture; the first stage medium contains SAG1 and FGF8;

Culturing in the second stage, wherein after culturing in the first stage, culturing in the second stage culture medium is applied; the second stage medium contains cAMP, DAPT, ascorbic acid, BDNF, GDNF, TGF-b3.

In some embodiments, the second stage culture is performed for a period of 3 to 26 days.

In some embodiments, the first stage medium comprises: DMEM/F12, insulin (Insulin), N2 additive, B27 additive, glutaMAX, ENAA, SAG, FGF8.

In some embodiments, the second stage medium comprises: DMEM/F12, insulin (Insulin), N2 additive, B27 additive, glutaMAX, ENAA, cAMP, DAPT, ascorbic acid (ascorbic acid), BDNF, GDNF, TGF-B3.

In some embodiments, the method of gene editing comprises: the CRISPR/Cas9 technology was used to knock-in the expression of the excitatory receptor hM3Dq or the inhibitory receptor hM4Di into the AAVS1 site of the induced neural stem cells.

In some embodiments, the method of gene editing comprises: transfecting the induced neural stem cells with a plasmid expressing Cas9, a gRNA targeting the AAVS1 site, a donor plasmid of excitatory receptor hM3Dq or inhibitory receptor hM4 Di.

In some embodiments, the gRNA has the sequence of SEQ ID NO:1.

In some embodiments, the construction method of the Cas 9-expressing AAVS1 site-targeted gRNA plasmid comprises: the corresponding DNA sequence of the gRNA was operably linked to the px458 plasmid.

In some embodiments, the method of constructing the donor plasmid of the inhibitory recipient hM4Di comprises: the mCherry of AAVS1-Pur-CAG-hM4Di-mCherry plasmid was cleaved and a T2A-ZsGreen fragment was inserted downstream of hM4Di, allowing the hM4Di and T2A-ZsGreen fragments to be joined by a T2A sequence, i.e., the donor plasmid of the inhibitory recipient hM4 Di.

In some embodiments, the method of constructing the donor plasmid for the excitatory receptor hM3Dq comprises: the mCherry of AAVS1-Pur-CAG-hM3Dq-mCherry plasmid was cleaved and a T2A-ZsGreen fragment was inserted downstream of hM3Dq, allowing the hM3Dq and T2A-ZsGreen fragment to be joined by a T2A sequence, i.e., the donor plasmid of the excitatory receptor hM3 Dq.

In a second aspect of the invention, there is provided a modulated dopaminergic neural cell produced by the method of the first aspect of the invention.

In some embodiments, the dopaminergic neural cell is at least one of a dopaminergic precursor cell (DAP), a Dopaminergic (DA) neuron.

Differentiation culture is carried out to lead the edited induced neural stem cells to differentiate towards the direction of the dopaminergic neurons; in this process, the edited induced neural stem cells are sequentially differentiated into dopaminergic precursor cells and dopaminergic neurons. The dopaminergic precursor cells can be obtained by characterization and differentiation through positive FoxA2 markers; differentiation to dopaminergic neurons can be characterized when NURR1, TH or Tuj1 markers are positive. In some embodiments, according to the differentiation culturing step provided by the invention, dopaminergic precursor cells can be obtained by culturing for 10 days in the first stage and for 0-8 days in the second stage; dopaminergic neurons can be obtained from the first stage culture and the second stage culture for 20 days or more.

In some embodiments, the dopaminergic neuron is a region A9 dopaminergic neuron. Dopaminergic neurons of the A9 region can be characterized by NURR1 marker positivity.

In some embodiments, the modulated dopaminergic neural cells include first stage cells and second stage cells;

The first-stage cells are prepared by the following method: culturing the edited induced neural stem cells in a first stage; the first stage culturing includes culturing using a first stage medium; the first stage medium contains SAG1 and FGF8; the first-stage culture time is 10 days;

The second-stage cells are prepared by the following method: the following culture is sequentially carried out on the edited induced neural stem cells:

Culturing in the first stage, wherein the first stage culture medium is used for culturing 10 days before differentiation culture; the first stage medium contains SAG1 and FGF8;

Second-stage culture, after the first-stage culture, using a second-stage culture medium for 3 days; the second stage medium contains cAMP, DAPT, ascorbic acid, BDNF, GDNF, TGF-b3;

The ratio of the first stage cells to the second stage cells is 1-2:7; for example, may be 1:7.

In a third aspect, the invention provides the use of said modulated dopaminergic neurons in the manufacture of a medicament for the treatment of parkinson's disease.

Compared with the prior art, the technical scheme of the invention has the following beneficial effects:

the invention provides a method for preparing regulated dopaminergic nerve cells from induced nerve stem cells. The method can be used for efficiently and rapidly preparing the dopaminergic nerve cells regulated by CNO, and has been verified by in vivo and in vitro experiments.

The knock-in of the irnsc into the exogenous gene may damage the characteristics of the neural stem cells of the irnsc itself, and make the irnsc lose the ability of stem, self-renewal and directional differentiation into the neural cells. According to the method provided by the invention, after the excitatory receptor hM3Dq or the inhibitory receptor hM4Di is knocked in, the iNSC can be directionally differentiated in vitro to prepare the dopaminergic precursor cells and the dopaminergic neurons; dopaminergic precursor cells obtained through in vitro differentiation are transplanted into a parkinsonism mouse model, and can be further differentiated into DA neurons, and the accurate regulation and control of drug dependence are carried out by CNO administration.

Drawings

Various other advantages and benefits will become apparent to those of ordinary skill in the art upon reading the following detailed description of the preferred embodiments. The drawings are only for purposes of illustrating the preferred embodiments and are not to be construed as limiting the invention. In the drawings:

Fig. 1: an irsc identification result;

Wherein, (a) an irsc immunofluorescent staining identifies: SOX1, SOX2, PAX6, NESTIN, olig2, ki67 were positive results; ruler: 200.μm; (B) identification of imsc immunofluorescence staining: OCT4, SSEA4 and TRA-1-60 are all negative results; ruler: 200.μm; (C) The results of the irsc karyotype analysis showed that induction did not mutate the genome of the cells;

fig. 2: AAVS1-hM4Di-T2A-ZsGreen plasmid model map;

fig. 3: AAVS1-hM3Dq-T2A-ZsGreen plasmid model map;

Fig. 4: identification results of EGFP-iNSC, hM4Di-iNSC and hM3 Dq-iNSC;

Wherein, (A) EGFP-iNSC, hM4Di-iNSC, hM3Dq-iNSC three cell lines live cell fluorescence photograph, show that each clone and cell in clone express green fluorescence; the upper graph is a photo-mirror photograph; the lower panel is a fluorescence photograph; ruler: 100 μm; (B) The Genotyping PRC results show that the EGFP-iNSC, the hM4Di-iNSC and the hM3Dq-iNSC all obtain two clones of heterogeneity (red stars) and homogeneity (white stars); the upper graph is an insertion site correctness detection DNA electrophoresis graph, and the arrow indicates the band position of the correct insertion site; the lower panel shows cell homogeneity and heterogeneity detection, with arrows indicating the position of the bands of heterogeneity or non-inserted exogenous genes;

Fig. 5: EGFP-iNSC, hM4Di-iNSC and hM3Dq-iNSC can be directionally differentiated in vitro towards DA neurons;

Wherein, (a) an iNSC in vitro directed DA neuron differentiation strategy schematic; (B) Immunofluorescence staining results show that FoxA2, NURR1, TH and Tuj1 all show positive results and have positive signals; ruler: 200. μm; (C) The quantitative result of immunofluorescence staining identification in the step (B) shows that more than 90% of FoxA2+ cells can be obtained, more than 90% of NURR1+ cells can be obtained, about 20% of TH+ cells exist, and the proportion of the double positive cells of FoxA2+TH+ to TH+ cells is about 95%;

Fig. 6: EGFP-iDA, hM4Di-iDA, hM3Dq-iDA whole-cell patch clamp results;

wherein, (A) baseline, CNO addition, CNO elution real-time action potential; (B) Statistical results of action potential frequency and resting membrane potential at baseline, CNO addition, CNO elution; n=3;

Fig. 7: survival and differentiation of EGFP-DAP, hM4Di-DAP, hM3Dq-DAP cell lines in a mouse model of Parkinson's disease;

Wherein, (a) immunofluorescence photographs show the position, survival and TH and ZsGreen expression of the grafts after transplantation of the parkinson's disease mouse model; white boxes indicate grafts; ruler: 500. μm; (B) Immunofluorescence photographs show survival and differentiation of three cell lines in a mouse model of parkinson's disease; three groups of grafts survived and differentiated in vivo, expressing FoxA2, TH, NURR1, HNA, tuj1, STEM121 and ZsGreen or EGFP; wherein ZsGreen or EGFP, foxA2 and TH, zsGreen or EGFP, NURR1 and TH are coexpressed; ruler: the left large picture is 100 μm and the right small picture is 250 μm; (C) Quantitatively analyzing the expression quantity of FoxA2, TH and NURR1 in the implant and the statistics of the co-expression of FoxA2 and TH and NURR1 and TH;

Fig. 8: statistical graphs of apomorphine-induced rotation results before and after cell transplantation; shows the induced rotation results of EGFP group, hM4Di group, hM3Dq group, 6-OHDA unilateral injury group, sham operation group and normal group before, 4 weeks, 8 weeks and 12 weeks after transplantation;

fig. 9: a statistical graph of the results of the rod rotating test before and after cell transplantation; drop time results of EGFP group, hM4Di group, hM3Dq group, 6-OHDA unilateral injury group, sham surgery group and normal group before transplantation (bT), 4weeks after transplantation (pT 4 weeks), 8weeks (pT 8 weeks) are shown;

Fig. 10: applying CNO to the mice after cell transplantation, and carrying out a statistical graph of the influence results of the mouse rod-rotating test; shows drop time results of EGFP group, hM4Di group, hM3Dq group, 6-OHDA unilateral injury group, sham operation group and normal group before transplantation (bT), 4 weeks after transplantation (pT) intraperitoneal injection of physiological Saline (Saline), CNO metabolism (pCNO);

In the above figures, p <0.05, p <0.01, p <0.001, and p <0.0001.

Detailed Description

Exemplary embodiments of the present disclosure will be described in more detail below with reference to the accompanying drawings. While exemplary embodiments of the present disclosure are shown in the drawings, it should be understood that the present disclosure may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the disclosure to those skilled in the art.

Sendai virus transfection kit (CytoTune. Delta. IPS 2.0 Sendai Reprogramming Kit), purchased from Life Technologies.

PBMC complete medium: stemPro ^TM -34 medium, 100 ng/mL recombinant human stem cell growth factor SCF,20 ng/mL IL-3, 20 ng/mL IL-6, 100 ng/mL FLT-3, 2mM L-Glutamine.

PBMC medium: stemPro ^TM -34 medium, 1 XGlutaMax.

INSCs basal medium (calculated as 500 mL): 240mL of DMEM/F12, 240mL NeuralBasal-A,5mL of N2 additive, 5mL of B27 additive, 5mL GlutaMAX,5mL ENAA.

INSCs complete medium: iNSCs basal medium, 3. Mu.M CHIR99021, 2. Mu.M SB431542, 10 ng/mL hrLIF.

INSCs differentiation basal medium (calculated as 500 mL): 480 mL DMEM/F12,5 μg/mLInsulin,5mL N2 additive, 5mL B27 additive, 5mL GlutaMAX,5mL ENAA.

INSCs in vitro DA differentiation one-stage medium: iNSCs differentiation basal medium, 1. Mu. MSAG1, 100 ng/mLFGF.

INSCs in vitro DA differentiation two-stage medium: iNSCs differentiation basal medium, 10 ng/mLBDNF,10 ng/mL GDNF,0.2 mL Ascorbic acid,0.5 mM cAMP,10. Mu.M DAPT,1 ng/mL TGF-. Beta.III.

Px458 plasmid, available from Addgene under accession number #48138.

AAVS1-Pur-CAG-hM4Di-mCherry plasmid, available from Addgene under accession number #80947.

AAVS1-Pur-CAG-hM3Dq-mCherry plasmid, available from Addgene under accession number #80948.

AAVS1-Pur-CAG-EGFP plasmid, available from Addgene under accession number #80945.

Cell culture conditions were all 37℃and 5% CO ₂, unless otherwise indicated.

Example 1

Blood Mononuclear Cells (PBMCs) of healthy volunteers were reprogrammed to induced neural stem cells (induced neural STEM CELLS, iNSCs) using sendai virus (SEV), and the obtained iNSCs cell characteristics were confirmed by immunofluorescent staining experiments and karyotype analysis. The method specifically comprises the following steps:

One healthy volunteer was included and blood was drawn from volunteer 80 mL. The fresh blood obtained was subjected to gradient density centrifugation using Ficoll, PBMCs were isolated, and cultured using PBMC complete medium for 4 days. Day 0, SEV carrying c-MYC, KOS, klf4 was transfected into PBMC using sendai virus transfection kit to obtain SEV-PBMC, when the cell culture medium was PBMC basal medium. Day 3, SEV-PBMCs were placed into PDL/Laminin coated six well plates for culture and the cell culture supernatant was replaced with iNSC complete medium. Day 7 cells were observed and the presence of the irsc clone was seen. When Day 14-21, obvious proliferation of the iNSC cell clone was observed, and the iNSC cell clone with irregular cell morphology, tight cell-cell connection and polar distribution of cell clone was selected for clone selection. And placing the selected cell clone into a six-hole plate coated with PDL/Laminin for continuous culture, and repeating clone selection for a plurality of times to obtain the stable-maintained iNSC cell clone.

Performing immunofluorescence staining identification on the cell clone obtained in the step, wherein the large amount of SOX1, SOX2, PAX6 and Ki67 are expressed in the nucleus of the iNSC, and the expression quantity (compared with DAPI expression) can reach more than 95 percent (figure 1A); the expression of a large amount of NESTIN, olig2 proteins was seen in the cytoplasm, with an expression level (comparative DAPI expression) exceeding 90% (FIG. 1A). Meanwhile, the irscs showed negative expression in OCT4, SSEA4, TRA-1-60, with an expression level of less than 1% (fig. 1B). Identification of the induced irscs was carried out and was found to be consistent with normal healthy cell karyotypes (fig. 1C). In view of this, it is shown that the above-described inscs induced by SEV belong to neural stem cells, have the stem property and self-renewal ability of neural stem cells, and have the ability of neural stem cells to differentiate toward neural system cells. At the same time, the intervention of SEV does not cause alterations in the karyotype of the genome, and does not cause irreversible changes and damage to the genome.

Example 2

In this example, iNSC cells were obtained by knocking in hM4Di and hM3Dq, respectively, and control cells were set by knocking in EGFP. The method comprises the following specific steps:

(1) Selection of gRNA and construction of Cas9-gRNA plasmid

Designing a plurality of gRNAs targeting the AAVS1 region, constructing the gRNAs into a px458 plasmid, and then transfecting the constructed gRNA-px458 plasmid into HEK293T cells by a liposome transfection method; culturing transfected cells, selecting cells expressing green fluorescence for genome extraction, detecting and testing the activity of each gRNA through T7 touchdown PCR, and screening to obtain gRNA with highest activity as SEQ ID NO:1 (GTCACCAATCCTGTCCCTAG), selecting the gRNA-px458 plasmid constructed by the gRNA for subsequent gene editing.

(2) Construction of hM4Di donor plasmid and hM3Dq donor plasmid

Firstly, AAVS1-Pur-CAG-hM4Di-mCherry plasmid is adopted as donor plasmid (donor plasmid) for knocking in hM4Di, the donor plasmid is co-transfected with gRNA-px458 constructed in the step (1) to cells, and target cell lines are attempted to be screened through red fluorescence and green fluorescence, however, in actual operation, it is found that green fluorescence expressed by gRNA-px458 cannot be captured, and the red fluorescence signal of AAVS1-Pur-CAG-hM4Di-mCherry is weak, which is unfavorable for observation, so that the screening efficiency is remarkably low.

In view of this, the AAVS1-Pur-CAG-hM4Di-mCherry plasmid was subjected to mCherry cleavage and a T2A-ZsGreen fragment (both of which were ligated by T2A sequence) was inserted downstream of hM4Di, and the resulting plasmid was abbreviated as AAVS1-hM4Di-T2A-ZsGreen, and the plasmid spectrum thereof was shown in FIG. 2. Thus, when the target cell line is knocked into a genome, green fluorescence can be expressed, and the aim of screening the target cell line can be achieved through single fluorescence (green fluorescence).

Similarly, an hM3Dq donor plasmid was constructed. The AAVS1-Pur-CAG-hM3Dq-mCherry plasmid was subjected to mCherry cleavage and a T2A-ZsGreen fragment (both of which were ligated by T2A sequence) was inserted downstream of hM3Dq, and the resulting plasmid was abbreviated as AAVS1-hM3Dq-T2A-ZsGreen, and the plasmid spectrum thereof was shown in FIG. 3.

(3) HM4Di-iNSC cells, hM3Dq-iNSC cells and control cells

The AAVS1-hM4Di-T2A-ZsGreen plasmid and the gRNA-px458 plasmid obtained in the step (1) are transfected into the iNSC cells prepared in the example 1 by using a CRISPR/Cas9 technology through liposome transfection, and after 72 hours of transfection, cells expressing green fluorescence can be observed through a fluorescence microscope, and then the cells expressing green fluorescence are obtained through sorting by using a flow cytometer. Continuously culturing the separated cells for one week, and separating the cells expressing green fluorescence by a flow cytometer again; the cells were further cultured for ten days to proliferate to form a monoclonal, clones in which all the cells in the clone expressed green fluorescence were retained (FIG. 4A), and genotyping PCR detection was performed (primers: primer 1-F: AACCTGTCGTGCCAGCGGAT, primer 1-R: TGAGTTTGCCAAGCAGTCACCC; primer 2-F: GCTCAGTCTGGTCTATCTGCC, primer 2-R: GATCCTCTCTGGCTCCATCG) and, based on the detection result (FIG. 4B), it was confirmed that the cell monoclonal in which the target gene was knocked in the correct site and DNA double strand was knocked in the target gene was obtained, and this was designated as hM4Di-iNSC cell.

AAVS1-hM3Dq-T2A-ZsGreen plasmid and gRNA-px458 plasmid are transfected into iNSC cells by adopting the same method, and the hM3Dq-iNSC cells are obtained by culturing and screening.

In addition, AAVS1-Pur-CAG-EGFP was used as EGFP donor plasmid, and EGFP-iNSC as control cell was obtained by the same method.

Immunofluorescence staining identification is carried out on the three cell lines of the hM4Di-iNSC, the hM3Dq-iNSC and the EGFP-iNSC, and the identification results show that SOX1, SOX2, PAX6, NESTIN, olig2 and Ki67 are positive results and the quantitative results show that the positive rate is more than 90 percent; MAP2, NEUN, S100b are positive results.

Example 3

In this example, three cell lines of hM4Di-iNSC, hM3Dq-iNSC and EGFP-iNSC were subjected to directed differentiation to obtain dopaminergic neurons (DA neurons).

Inscs have the ability to direct differentiation into neural cells, including DA neurons. In the state of natural differentiation, i.e., without any induced differentiation small molecules, only normal nutrition of cells is maintained, DA neurons are visible to the iNSC differentiated cells, but the differentiation efficiency is low, and only 1% of cells can see DA neuron-specific proteins.

Therefore, the present invention introduces induced differentiation small molecules to increase differentiation efficiency, and referring to fig. 5A, in vitro directed differentiation DA neurons are divided into two culture stages:

(1) The first stage: adding SAG1 and FGF8 to the culture medium for the first stage differentiation of the iNSC 10 days before differentiation culture; the culture medium adopted is specifically as follows: iNSCs in vitro DA differentiation one-stage medium (iNSCs differentiation basal medium, 1. Mu. MSAG1, 100 ng/mLFGF), liquid exchange every other day;

(2) And a second stage: after SAG1 and FGF8 are acted for 10 days, the two small molecules are removed, and cAMP, DAPT, ascorbic acid and BDNF, GDNF, TGF-b3 small molecules are added to conduct second-stage differentiation; the culture medium adopted is specifically as follows: iNSCs in vitro DA differentiation two-stage medium (iNSCs differentiation basal medium, 10 ng/mL BDNF,10 ng/mL GDNF,0.2 mL Ascorbic acid,0.5 mM cAMP,10. Mu.M DAPT,1 ng/mL TGF-. Beta.III), liquid changes every other day.

At the time of differentiation to different days, fixed cells were sampled and the following markers were identified by immunofluorescence: foxA2, a floor area DAP specific protein, could suggest that cells differentiate towards the midbrain A9 area DA neurons; NURR1, a surface marker of mature DA neurons in the midbrain A9 region; the molecular markers of TH and Tuj1 mature DA neurons are expressed in the A9 region and the A10 region mature DA neurons. By identifying the above markers, it is possible to observe whether cells differentiate directionally into DA neurons and their differentiation efficiency. Cells identified as day 10 (DIV 10) to day 8 (DIV 18) of first stage differentiation have the ability to differentiate towards DA neurons in the midbrain A9 region, known as dopaminergic precursor cells (DAP), which can be designated hM4Di-DAP, hM3Dq-DAP, respectively.

Cells were fixed on day 5 (DIV 15), day 8 (DIV 18) and day 20 (DIV 30) of two-stage differentiation, and the above markers were identified by immunofluorescence, and the imaging results of immunofluorescence identification are shown in fig. 5.

As can be seen from FIG. 5, the directionally differentiated cells largely comprise FoxA2+, NURR1+, TH+ and Tuj1+ cells (FIG. 5B), wherein FoxA2+ cells can be more than 90%; also nurr1+ cells can reach more than 90%; th+ cells were present at about 20%. The proportion of foxa2+, th+ biscationic cells to th+ cells was about 95% (fig. 5C). In summary, hM4Di-iNSC, hM3Dq-iNSC and EGFP-iNSC can directionally differentiate into DA neurons in the midbrain A9 area, the differentiation efficiency is high, NURR1+ cells can reach 90% when differentiating to 30 days (DIV 30), and the cells are named as hM4Di-iDA, hM3Dq-iDA and EGFP-iDA, which indicate that a large number of dopaminergic neuron cells (DA) are obtained. In addition, when three cell lines are directionally differentiated in vitro towards the DA direction, a real-time fluorescence microscope and immunofluorescence staining detection show that the differentiated cells always express green fluorescence of EGFP or ZsGreen, and three exogenous genes of EGFP, hM4Di and hM3Dq are proved to be stably expressed in the DA differentiation process.

Example 4

This example demonstrates that the DA neuronal cell line differentiated in example 3 has electrophysiological activity in vitro and is CNO-regulated. The method comprises the following specific steps:

According to the differentiation method in example 3, differentiated cells were taken out and examined at the time of in vitro differentiation for 36 days (DIV 36). Differentiated cells were placed in a chamber containing artificial cerebrospinal fluid and incubated for 30 minutes. After 30 minutes, using capillary glass microneedle with resistance of 5M Ω as electrode, selecting neuron cells with complete and full cell morphology and green fluorescence for whole cell patch clamp experiment. The resting potential and evoked action potential upon application of 5mV electrical stimulation were recorded: baseline measurements were performed for 8 minutes followed by 50 μm clozapine-n-oxide (CNO) addition to the cell liquid and measurement for 16 minutes; the cell fluid was replaced with artificial cerebrospinal fluid without CNO and rinsed for 15min and measured for 5 min. The measurement results are shown in fig. 6.

Baseline measurements showed that the in vitro differentiated DA neurons of the three cell lines all had a resting potential of about-70 mV, while the ability to evoke action potentials upon exogenous artificially administered electrical stimulation (5 mV). Thus, DA neurons differentiated in vitro from EGFP, hM4Di, hM3Dq cell lines have complete neuronal function and can produce neuroelectric activity.

Measurement results after CNO addition show that EGFP-iDA as a control group maintains consistent membrane resting potential, evoked action potential and baseline level under the action of CNO. Under the action of CNO, hM4Di-iDA has hyperpolarization phenomenon of membrane resting potential compared with the baseline level, and the potential negative value is increased; the frequency of evoked action potentials is significantly reduced. In contrast, the hM3Dq-iDA has the unplanned phenomenon of membrane resting potential and the negative potential value is reduced compared with the baseline level under the action of CNO; the frequency of the evoked action potential is obviously improved.

Measurement results after CNO elution showed that the membrane resting potential, evoked action potential, and baseline levels of EGFP-iDA remained consistent. The membrane resting potential and evoked action potential of both hM4Di-iDA and hM3Dq-iDA return to baseline levels.

The result shows that the DA neuron obtained by differentiation according to the technical scheme of the invention has complete mature neuron function and nerve electrophysiological activity; CNO can inhibit hM4Di-iDA, activate neuron electrical activity of hM3Dq-iDA, regulate cell function, and control neurotransmitter release, and simultaneously, binding and eluting of CNO can not cause electrophysiological injury to the above differentiated DA neurons.

Example 5

This example identifies the survival and differentiation of hM4Di-DAP and hM3Dq-DAP in the brain of a mouse model of Parkinson's disease.

The method comprises the following specific steps:

And taking the SCID-Beige immunodeficiency mice as an animal model, injecting hexahydroxydopamine (6-OHDA) into a unilateral brain region to perform modeling operation, and constructing and obtaining a unilateral 6-OHDA damage parkinsonism mouse model through behavioral evaluation and brain slice immunohistochemical staining evaluation.

After grouping and baseline collection, the molding side cell transplantation procedure was started at week 5 after the unilateral 6-OHDA molding procedure. The three cell lines EGFP-iNSC, hM4Di-iNSC, hM3Dq-iNSC were directionally differentiated in vitro towards DA neurons according to the method of example 3, and the cells on day 10 and day 13 of differentiation were mixed at a ratio of 1:7, with a total cell concentration of 1X 10 ⁵/μl, and the injection site was identical to the 6-OHDA injection site. After the end of the transplantation operation, mice were fed normally.

After 12 weeks after the cell transplantation operation, mice were perfused after the acquisition of the behaviours, and mouse brain pieces were obtained for immunofluorescent staining of the following markers: foxA2, NURR1, TH, tuj1, STEM121, HNA, etc., were used to evaluate survival and differentiation of transplanted cells in the brain of mice for 12 weeks.

Immunofluorescence results as shown in fig. 7, the brain endograft in three groups of transplanted mice had a large amount of green fluorescence expression, and it was observed that most of green fluorescence was distributed at the original site of transplantation, and no cell migration occurred (fig. 7A). FoxA2, NURR1, TH, tuj1, STEM121, HNA were expressed in all three groups of grafts (FIG. 7B). TH+ cells were seen to overlap either EGFP+ or ZsGreen+ demonstrating that all three cell lines transplanted differentiated into dopaminergic neurons in the mouse brain with a ratio of about 6% TH+ZsGreen+/HNA+ and TH+EGFP+/HNA+. On the other hand, the transplanted cells were present in the mouse brain in a large number of foxa2+ cells, with a ratio of foxa2+hna+/hna+ of about 90% (fig. 7C); meanwhile, it was observed that some cells had the coexpression of FoxA2 and TH, and the ratio of FoxA2+ TH+/TH+ was about 95% (FIG. 7C), which indicated that the transplanted cells differentiated toward DA neurons in the midbrain A9 region in the mouse brain. In addition, nurr1+ cells were seen in the transplanted cells, with a nurr1+/hna+ ratio of about 7% (fig. 7C); coexpression of NURR1 and TH also occurred, with a ratio of TH+NURR1+/HNA+ of about 6% (FIG. 7C). Whereas Tuj1+, STEM121+ cells were also found in transplanted cells, tuj1 and TH, STEM121 and TH were co-expressed (FIG. 7B). Therefore, three groups of grafts survive well in the mouse brain and can differentiate into the brain A9 area DA neurons, exerting their function.

Example 6

This example examined the behavioral improvement of mice models of Parkinson's disease after transplanting hM4Di-DAP and hM3 Dq-DAP.

The unilateral 6-OHDA parkinsonism mouse model has asymmetric limb movement characteristics mainly because the injured side loses DA neuron innervation, which leads to contralateral limb movement dysfunction, muscle spasm and involuntary movement reduction. The motor impairment of the unilateral 6-OHDA parkinson's disease mouse model was assessed by apomorphine-induced rotation assay, the rotarod assay.

Prior to the cell transplantation procedure of example 5, apomorphine-induced rotation test, stick test, baseline were performed on EGFP group, hM4Di group, hM3Dq group, 6-OHDA group (molded, but without subsequent transplantation of cells), sham group (Sham group, without 6-OHDA injection, without subsequent transplantation of cells), normal group (Normal group, without molded, and without subsequent surgery); 4 weeks, 8 weeks, 12 weeks after the cell transplantation surgery, the same experiment was performed to evaluate the mice for behavioral improvement.

1. Apomorphine-induced spin assay

The apomorphine-induced rotation assay is one of the classical assays for evaluating motor impairment in a mouse model of unilateral 6-OHDA parkinson's disease. Apomorphine is one of the DA receptor agonists, and entry into the body activates DA neurons in the brain to release dopaminergic neurotransmitters. The 6-OHDA injury side DA neurons are largely lost, so that the DA content of the brain regions at two sides is obviously different, and further asymmetric limb movement is caused.

The results of apomorphine-induced rotation assay are shown in FIG. 8, in which EGFP group, hM4Di group, hM3Dq group, and 6-OHDA group were induced to the intact side for a mean number of rotations of about 200/30 min before cell transplantation; there was no induced rotational behavior in the Sham group and Normal group. The induced rotation behaviors of the EGFP group, the hM4Di group and the hM3Dq group are improved 4 weeks after the cell transplantation operation, the average number of induced rotation turns is about 120 turns/30 min, and the tendency is reduced; the 6-OHDA group induced rotation number remained about 200 turns/30 min. The number of induced rotations of EGFP group, hM4Di group and hM3Dq group is reduced in 8 weeks after the cell transplantation operation compared with the previous induced rotations, and the average number is about 50 circles/30 min; the 6-OHDA group induced rotation number remained about 200 turns/30 min. The induced rotation number of EGFP group, hM4Di group and hM3Dq group still keeps decreasing trend after 12 weeks of cell transplantation operation, and the average number is about 15 circles/30 min; the 6-OHDA group induced a decrease in the number of rotations, with a mean of about 180 rotations/30 min, with no statistical difference. During the course of the behavioural collection, none of the Sham group and Normal group had induced rotational behaviour at each time point.

2. Rotating rod test

The rod rotating test can evaluate the coordination condition of the brain region of the mice to govern the movement of limbs. When the brain region of the mouse innervates the limbs to move normally and the limbs move coordinately, the movement is agile, the mouse can be quickly adapted to a rotating rod fatigue meter, and continuously runs on the rotating rod; when the brain region of the mouse has reduced ability to govern limbs and asymmetric limb movement, the movement is slow, the mouse can not adapt to the rotating rod fatigue instrument, and the mouse can quickly fall from the rotating rod. The main manifestations are: after 3 days of rod rotating training, a normal mouse can move on the uniform acceleration rod for a long time in a formal test, and the time before falling is longer; the damaged side of the single-side 6-OHDA parkinsonism mouse model governs limb movement capacity to be reduced and slow in movement, and the model can not move on a uniformly-accelerated rotating rod for a long time in a formal test and can fall off from the rotating rod quickly.

The results of the rotarod test are shown in fig. 9, and the vertical axis represents the time elapsed from the start of rotarod to the fall of the mouse. Before transplanting cells, EGFP group, hM4Di group, hM3Dq group and 6-OHDA group all have behavior disorder performance compared with Sham group and Normal group, and the behavior disorder performance is particularly that the drop time of a rotating rod is accelerated. At 4 weeks and 8 weeks after the cell transplantation operation, EGFP group, hM4Di group and hM3Dq group are recovered compared with the 6-OHDA group, the behavior before the transplantation is recovered, and the dropping time of the rotating rod is reduced.

The results show that the EGFP group, the hM4Di group and the hM3Dq group induce the rotation behavior to be obviously improved after the cell transplantation, and the cells are alive to differentiate and secrete DA in the brain, so that the behavior disorder of mice is improved; meanwhile, the results of the control group 6-OHDA group, the Sham group and the Normal group show that the spontaneous behavior of the side 6-OHDA model is not improved, and the operation has no influence on the brain area of the mice.

Example 7

On the basis of example 6 that cell transplantation was validated for the treatment of unilateral 6-OHDA parkinson's disease mice model, this example tested whether cell lines in the mouse brain could be remotely regulated without stereotactic, direct cell contact.

The rod-transfer test data were collected before the cell transplantation operation (indicated as bT in the figure) and 4 weeks after the cell transplantation operation (indicated as pT in the figure), in the EGFP group, the hM4Di group, the hM3Dq group, the 6-OHDA group, the Sham group, and the Normal group. The CNO regulation function is tested 4 weeks after the cell transplantation operation, firstly, the behavioural data of the physiological Saline injected into the abdominal cavity is collected and used as a control (marked as Saline in the figure); then, the mice were injected with CNO (1.2 mg/kg) intraperitoneally, and 20 minutes after the injection, the behavioural data collection under the action of CNO (CNO in the figure) was performed; finally, five days after CNO injection, CNO metabolism was completed (pCNO in the figure) and a further round of three behavioural acquisitions was performed.

The statistical result of the rotating rod test data is shown in fig. 10, when the CNO is injected into the abdominal cavity, compared with the physiological saline injection, the visible dropping time of the hM4Di group mice is obviously shortened, and the statistical significance is achieved, wherein the dropping time of the hM4Di group mice is equivalent to that of the 6-OHDA group; in contrast, mice in the hM3Dq group were seen to have significantly prolonged drop times, but did not reach the Sham group Normal group drop time level. When CNO is injected into the abdominal cavity for 5 days and CNO metabolism is finished, the visible dropping time of the hM4Di mice is restored to the level of normal saline injection, and compared with the obvious extension of CNO injection into the abdominal cavity, the hM4Di mice have statistical difference; in contrast, mice in the hM3Dq group were seen to fall off at a time comparable to that seen when CNO was intraperitoneally injected, returning to normal saline levels. Meanwhile, the falling time performance of EGFP group, 6-OHDA group, sham group and Normal group mice under the action of CNO and after CNO metabolism is not different, and the falling time performance is similar to that of Normal saline injection, but EGFP group is prolonged and has statistical difference compared with that before cell transplantation.

The results show that CNO can remotely regulate and control and activate hM4Di group cells and inhibit hM3Dq group cells by intraperitoneal injection on the premise of not carrying out stereotactic brain injection and directly contacting cells, so that DA release is reduced or increased, and the body movement function of a mouse is regulated to achieve balance.

The present invention is not limited to the above-mentioned embodiments, and any changes or substitutions that can be easily understood by those skilled in the art within the technical scope of the present invention are intended to be included in the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.

Claims (10)

1. A preparation method of a regulated dopaminergic nerve cell is characterized by comprising the steps of carrying out gene editing on an induced nerve stem cell to enable the induced nerve stem cell to express an excitatory receptor hM3Dq or an inhibitory receptor hM4Di, so as to obtain the edited induced nerve stem cell; and carrying out differentiation culture on the edited induced neural stem cells to enable the induced neural stem cells to express the markers of the dopaminergic nerve cells, and thus preparing the regulated dopaminergic nerve cells.

2. The method of preparing a modulated dopaminergic neural cell of claim 1, wherein the marker comprises at least one of FoxA2, NURR1, TH, tuj 1.

3. The method of preparing a modulated dopaminergic neural cell of claim 1, wherein the step of differentiating culturing comprises: the following culture is sequentially carried out on the edited induced neural stem cells:

Culturing in the first stage, wherein the first stage culture medium is used for culturing 10 days before differentiation culture; the first stage medium contains SAG1 and FGF8;

Culturing in a second stage, wherein after the culturing in the first stage, a second stage culture medium is used for culturing; the second stage medium contains cAMP, DAPT, ascorbic acid, BDNF, GDNF, and TGF-b3.

4. The method of preparing a modulated dopaminergic neural cell of claim 1, wherein the method of gene editing comprises: knocking in the AAVS1 site of the induced neural stem cells to express an excitatory receptor hM3Dq or an inhibitory receptor hM4Di by using CRISPR/Cas9 technology;

Transfecting the induced neural stem cells with a plasmid expressing Cas9, a gRNA targeting AAVS1 site, a donor plasmid of excitatory receptor hM3Dq or inhibitory receptor hM4 Di; the sequence of the gRNA is SEQ ID NO:1.

5. The method of preparing a regulated dopaminergic neural cell according to claim 4, wherein the method of constructing the donor plasmid for the inhibitory receptor hM4Di comprises: mCherry cleavage of AAVS1-Pur-CAG-hM4Di-mCherry plasmid and insertion of T2A-ZsGreen fragment downstream of hM4Di, joining hM4Di and T2A-ZsGreen fragment from T2A sequence, i.e. donor plasmid of the inhibitory recipient hM4 Di; and/or the number of the groups of groups,

The construction method of the donor plasmid of the excitatory receptor hM3Dq comprises the following steps: the mCherry of AAVS1-Pur-CAG-hM3Dq-mCherry plasmid was cleaved and a T2A-ZsGreen fragment was inserted downstream of hM3Dq, allowing the hM3Dq and T2A-ZsGreen fragment to be joined by a T2A sequence, i.e., the donor plasmid of the excitatory receptor hM3 Dq.

6. A modulated dopaminergic neural cell prepared by the method of any one of claims 1 to 5.

7. The modulated dopaminergic neural cell of claim 6, wherein the modulated dopaminergic neural cell is at least one of a dopaminergic precursor cell, a dopaminergic neuron.

8. The modulated dopaminergic neuron of claim 7, wherein the dopaminergic neuron is a region A9 dopaminergic neuron.

9. The modulated dopaminergic neural cell of claim 6, wherein said modulated dopaminergic neural cell comprises a first stage cell and a second stage cell;

The first-stage cells are prepared by the following method: culturing the edited induced neural stem cells in a first stage; the first stage culturing includes culturing using a first stage medium; the first stage medium contains SAG1 and FGF8; the first-stage culture time is 10 days;

The second-stage cells are prepared by the following method: the following culture is sequentially carried out on the edited induced neural stem cells:

Culturing in the first stage, wherein the first stage culture medium is used for culturing 10 days before differentiation culture; the first stage medium contains SAG1 and FGF8;

Second-stage culture, after the first-stage culture, using a second-stage culture medium for 3 days; the second stage medium contains cAMP, DAPT, ascorbic acid, BDNF, GDNF, TGF-b3;

the ratio of the first stage cells to the second stage cells is 1-2:7.

10. Use of a modulated dopaminergic neural cell according to any one of claims 6 to 9 in the manufacture of a medicament for the treatment of parkinson's disease.