CN117987446A

CN117987446A - Genetic mutation engineering bacteria for producing phenazine-1-carboxylic acid, construction method and application thereof

Info

Publication number: CN117987446A
Application number: CN202410214630.2A
Authority: CN
Inventors: 马金成; 林敏�; 王海洪; 张文彬; 胡喆; 余永红
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2024-02-27
Filing date: 2024-02-27
Publication date: 2024-05-07

Abstract

The invention discloses a phenazine-1-carboxylic acid producing gene mutation engineering bacterium, a construction method and application thereof, and belongs to the technical field of genetic engineering. The invention takes a pseudomonas aeruginosa strain CICC20240 with higher yield of pyocin as a starting strain, replaces Pa acpP with Ec acpP in the starting strain CICC20240, and simultaneously knocks out genes PA0051, PA5332, PA4209 and PA4217 to construct a genetic engineering strain with high PCA for production fermentation.

Description

Genetic mutation engineering bacteria for producing phenazine-1-carboxylic acid, construction method and application thereof

Technical Field

The invention relates to the technical field of bioengineering, in particular to a phenazine-1-carboxylic acid gene mutation engineering bacterium, a construction method and application thereof.

Background

Phenazine-1-carboxylic acid (PCA) is a secondary metabolite secreted by Pseudomonas aeruginosa (Pseudomonas aeruginosa) and has a significant ability to inhibit a variety of plant pathogens. PCA is light yellow needle-shaped crystal at normal temperature, is slightly soluble in diethyl ether, benzene, chloroform and the like, and is difficult to dissolve in water. PCA has a melting point of 241-242 ℃ due to its special chemical structure, and is stable to heat and humidity. Scientists start with a PCA structural framework, carry out a large amount of chemical structural modification on the PCA structural framework, and design and synthesize a plurality of PCA derivatives with high biological activity. In 2011, PCA was registered as a novel biosynthetic fungicide, named "shenzinomycin". Experiments prove that the traditional Chinese medicine composition has good treatment effects on fusarium wilt, scab and sheath blight of melons, fruits, vegetables, cotton, wheat, rice and the like.

In pseudomonas aeruginosa, the biosynthetic pathway for PCA consists of phz (phzABCDEFG) gene clusters, which synthesizes a series of phenazine compounds including PCA with chorismate as a precursor. The chemical synthesis of phenazine pesticides is technically feasible, but has low yield and serious environmental pollution. Therefore, how to utilize microbial fermentation to biosynthesize phenazine compounds is an environment-friendly technology replacing chemical synthesis methods and is receiving extensive attention from researchers.

Disclosure of Invention

The invention aims to provide a phenazine-1-carboxylic acid producing gene mutation engineering bacterium, a construction method and application thereof, so as to solve the problems in the prior art.

In order to achieve the above object, the present invention provides the following solutions:

The invention provides a construction method of a phenazine-1-carboxylic acid producing genetic mutation engineering bacterium, which takes a wild strain CICC20240 as an original strain, knocks out phzM genes, crc genes, phzS genes and phzH genes, replaces the genes with Pa acpP genes, and finally obtains a strain CICC-M5 (delta Pa acpP:: ec acpP delta crcdelta phzH delta phzS delta phzM), namely the phenazine-1-carboxylic acid producing genetic mutation engineering bacterium.

Preferably, the nucleotide sequence of the phzM gene is shown as SEQ ID NO. 4.

Preferably, the nucleotide sequence of the crc gene is shown in SEQ ID NO. 2.

Preferably, the nucleotide sequence of phzS gene is shown in SEQ ID NO. 5.

Preferably, the nucleotide sequence of phzH gene is shown as SEQ ID NO. 3.

Preferably, the nucleotide sequence of the Pa acpP gene is shown as SEQ ID NO. 1.

The invention also provides the phenazine-1-carboxylic acid gene mutation engineering bacteria constructed by the construction method.

The invention also provides application of the phenazine-1-carboxylic acid producing genetically modified engineering bacteria in the production of phenazine-1-carboxylic acid.

The invention also provides a method for producing the phenazine-1-carboxylic acid, which utilizes the phenazine-1-carboxylic acid producing gene mutation engineering bacteria to produce the phenazine-1-carboxylic acid.

The invention also provides application of the phenazine-1-carboxylic acid producing genetically modified engineering bacteria in preparing plant disease-resistant preparations.

Based on the technical scheme, the invention has the following technical effects:

The invention takes a pseudomonas aeruginosa strain CICC20240 with higher yield of pyocin as a starting strain, replaces Pa acpP with Ec acpP, and simultaneously knocks out genes PA0051, PA5332, PA4209 and PA4217 to construct a genetic engineering strain with high PCA for production fermentation.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a block diagram of a phenazine-1-carboxylic acid (PCA);

FIG. 2 is a schematic diagram of the principle of homologous recombination knockout;

FIG. 3 is a PCR verification of the invention for CICC-M5 (ΔPa acpP:: ec acpP ΔcrcΔ phzH Δ phzS ΔphzM) mutants; wherein, lane 1 is a DNA fragment amplified by using a wild strain as a template and EcacpP P HindIII primer and EcacpP P BamHI primer, and lane 2 is a DNA fragment amplified by using a mutant strain as a template and the same primer; b. lane 1 is a DNA fragment amplified using a wild-type strain as a template, a phzM P1 HindIII primer and a phzM P4 BamHI primer, lane 2 is a DNA fragment amplified using a mutant strain as a template, a same primer is used, c.1 is a DNA fragment amplified using a wild-type strain as a template, a phzS P HindIII primer and a phzS P BamHI primer, lane 2 is a DNA fragment amplified using a mutant strain as a template, a same primer is used, d.1 is a DNA fragment amplified using a wild-type strain as a template, a phzH P HindIII primer and a phzH P BamHI primer, lane.1 is a DNA fragment amplified using a wild-type strain as a template, a crc P1 HindIII primer and a crP 4I primer, and Lane.2 is a DNA fragment amplified using a same primer; m represents DNA MARKER;

FIG. 4 is a chromatogram of HPLC analysis of a PCA standard;

FIG. 5 shows the measurement results of growth curve and PCA production curve of the Pseudomonas aeruginosa wild type CICC20240 and mutant CICC-M5 strain in PPM culture medium by shake flask fermentation; wherein A is the growth curve of each strain in LB culture medium, B is the PCA production curve of each strain in PPM culture medium;

FIG. 6 is a PCA production curve of Pseudomonas aeruginosa mutant CICC-M5 in PPM medium using a 10L fermenter.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the application described herein without departing from the scope or spirit of the application. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present application. The specification and examples of the present application are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

The technical scheme of the invention is conventional in the field, and the reagents or raw materials are purchased from commercial sources or are disclosed.

The embodiment of the invention aims to provide a pseudomonas aeruginosa mutant strain with high PCA yield, which is used for constructing and breeding genetic engineering bacteria of phenazine secondary metabolites. The genes involved in the invention are as follows:

The DNA sequence shown in SEQ ID No.1 is a sequence in the genome of Pseudomonas aeruginosa CICC20240, which is basically identical to the corresponding Gene Pa acpP in PAO1 (PA 2966, NCBI Gene ID: 879895) and consists of 237 nucleotides.

SEQ ID NO.1：ATGAGCACCATCGAAGAACGCGTTAAGAAGATCGTCGCTGA ACAACTCGGCGTGAAGGAAGAAGATGTCACCAACAGCGCTTCCTTCGTCCAAGACCTGGGCGCCGACTCCCTTGACACCGTCGAGCTGGTGATGGCTCTGGAAGAGGAATTCGAGACCGAAATCCCTGACGAGAAAGCTGAAAAGATCACCACCGTTCAGGAAGCCATCGACTACATCGTTGCTCACCAGCAATAA.

The DNA sequence shown in SEQ ID No.2 is a regulatory factor crc sequence (PA 5332, NCBI Gene ID: 878037) of a carbon source catabolism inhibition system in the P.aeruginosa PAO1 genome, and consists of 780 nucleotides.

SEQ ID NO.2：ATGCGGATCATCAGTGTGAACGTGAATGGTATTCAGGCTGCG GCCGAGCGCGGTTTGCTCAGTTGGCTGCAAGCACAGAATGCCGACGTGATCTGCTTGCAGGACACCCGAGCCTCCGCCTTCGATCTGGATGACCCGTCCTTCCAACTGGACGGCTACTTCCTTTATGCCTGCGATGCCGAGCTACCCGAACAGGGCGGTGTCGCACTCTACAGCCGTTTGCAGCCCAAAGCTGTGATCAGCGGCTTAGGTTTCGAAACGGCCGATCGTTACGGGCGCTACCTGCAAGCCGACTTCGACAAGGTGAGTATCGCCACCCTGCTGCTGCCTTCCGGGCAGAGCGGAGACGAGAGCTTGAACCAGAAATTCAAGTTCATGGACGACTTCACCCATTACTTGAGCAAGCAGCGTCGCAAGCGCCGCGAATACATCTACTGCGGCTCGCTGTACGTCGCCCATCAGAAGATGGATGTGAAGAACTGGCGCGAATGTCAGCAGATGCCGGGCTTCCTCGCGCCCGAACGGGCCTGGCTGGACGAAGTGTTCGGCAACCTCGGCTATGCCGACGCCCTGCGCGAAGTCAGCCGCGAAGGCGACCAGTTCAGCTGGTGGCCGGACAGCGAACAGGCCGAGATGCTCAACCTCGGCTGGCGCTTCGACTACCAGGTGCTGACCCCCGGCCTACGCCGCTTCGTGCGCAACGCCAAGCTGCCGCGCCAGCCGCGCTTCTCCCAGCATGCGCCGCTGATCGTCGACTACGACTGGCAGTTGAGCATCTGA.

The DNA sequence shown in SEQ ID NO.3 is the glutamine hydrolase phzH sequence in the P.aeruginosa PAO1 genome (PA 0051, NCBI Gene ID: 878637), consisting of 1833 nucleotides.

SEQ ID NO.3：ATGTGCGGTCTCGCGGGTTGGGTGGATTACACGCGCAAGCTC GACGACGAATTTCCGGCGATCTTCGCCATGACCGATACGCTCGCCTTGCGCGGGCCGGATGCCGAGGGCATCTGGAAGCACCGCAACGCCCTGCTGGGTCACCGGCGGCTGGCGGTCATCGACCTCAGCGGCGGCGTGCAGCCGATGTCCTATCGCTTTCCCACCGGCCAGGAGGTCACCCTCGTCTACACCGGCGAGGTGTACAACCACGATGCCC

TGCGCGAGCGGTTGCGCCGGGCCGGACATGAGTTCCGCACCCGCAGCGATACCG

AGGTGGTCCTGCACGCCTATCTGCAATGGGGCGAGCGTTGTTGCGAGTACCTGA

CCGGGATGTTCGCCTTCGCCGTCTTCGATGGCCGCGACGGCCACCTGCTGCTGGT

GCGCGACCGCCTGGGCATCAAGCCGCTGTATTACGCGCGGCACCGCGAGGGACT

GCTGTTCGGCTCGGAGATCAAGTCCATCCTGGCGCATCCGGAATTCGCCGCCAG

GCTCGACGCGGTCGGCCTGGTCGACCTCCTGACGCTGTCCCGGGGCACTTCGCA

GACGCCGTTCCGCGAGGTCCAGGAACTGCTGCCCGGCCACCTGCTGTCCTGGCG

TCCCAATTCCCAGGCGAAGTTGCGCCGCTACTGGGAGGTGCGCCGCCAGGAGCA

TGCCGACGACCTGCAGAGCACCGTGCAGCGCACCCGCGAACTGGTCACCCGCGC

CCTGGGGGCGCAATTGCACGCCGACGTTCCGGTGTGTTCGCTGCTATCGGGTGG

GCTCGATTCGACCGCCCTGACCGGCATCGCCCAGCGCATCGCGAAGGCGGAGCA

CGGCGGCGACATCAATTCGTTCTCGGTGGACTTCGTCGGCCAGGCCGAGCAGTT

CCGCAGCGACGACCTGCGTCCCGACCAGGACCAGCCGTTCGCCCTGCTGGCCGC

GCAGTACATCGGCAGCCGTCATCGCACCGTGCTCATCGACAATGCCGAACTGGT

CTGCGAACGAGCGCGCGAAGAGGTATTCCGGGCCAAGGACGTACCTTTCACCTT

CGGCGACATGGATACCTCGCTGCACCTGATGTTCGGCGAGATCCGCCGGCATTC

CACGGTGGCCATCTCCGGTGAAGGCGCCGACGAGCTGTTCGGTGGCTACGGCTG

GTTCCGCGATCCGCAGGCGGTGGCTGCGGCGCGCTTCCCCTGGGCCTCCAGGGT

GCGCCTGCCGGCCGGCTTCATCGACGCCGGTTTCAACCGCCGCTGCGATCTCCTC

CAGTACCAGCAGGCCAGCTACGACGATGGGCTGCGCCAGGTCGAACACCTGGCC

GGCGACAGCCCGGAGGAGCGGCGGATGCGCGAGTTCAGCCACCTGCATCTGAA

GCGCTGGATGGTGCTGCTGCTCGAACGCAAGGATCGCCTGAGCATGTGCAACGG

CCTGGAGGTGCGGGTGCCCTACACCGACCATGAGCTGGTGGAGTACGTCTACAA

CGTGCCCTGGTCGATCAAGAGCCGGGACGGCGAGGAGAAGTGGCTGCTCAAGC

GGGCCTGCGCCGACTATGTCCCGGAAGCCGTGCTCAAGCGCCGCAAGAGCCCTT

ATCCGACTTCTGCCAACCTCGGCTACGAGCGTTTCCTGCGCGGGAGCGTGCGGC

GCCTGCTGGAGGACGCGGTGAACCCGGTGTTCGGCATCGTTTCGCGAGAGTTCC

TGGCCGCCGAACTGGAGCATCCGGAGGGGTACTTCAACACCCAGGTGAGCCGCC

ACAACCTGGAGACCGCACTGGCGCTGGAAGGCTGGCTCAGGTTGTACGGGCTCTCCGCCTGA。

The DNA sequence shown in SEQ ID No.4 is the phenazine specific methyltransferase phzM sequence in the P.aeruginosa PAO1 genome (PA 4209, NCBI Gene ID: 880514), consisting of 1005 nucleotides.

SEQ ID NO.4：ATGAATAATTCGAATCTTGCTGCTGCGCGTAATTTGATACAA GTTGTTACCGGGGAATGGAAGTCCCGTTGCGTCTACGTCGCTACGCGCCTCGGGCTGGCCGATCTGATCGAGAGCGGGATCGACAGCGACGAGACGCTGGCCGCCGCGGTCGGTTCCGATGCCGAGCGCATCCATCGACTGATGCGCCTGCTGGTGGCCTTCGAGATCTTCCAGGGCGATACCCGCGACGGCTACGCCAATACCCCCACCAGCCACCTGCTGAGGGATGTCGAGGGCTCCTTCCGCGACATGGTGCTGTTCTACGGCGAGGAGTTCCACGCCGCCTGGACGCCCGCCTGCGAGGCGCTGCTCAGCGGTACCCCAGGCTTCGAGCTGGCGTTCGGCGAAGACTTCTACAGCTACCTGAAGCGCTGCCCGGATGCCGGCCGGCGCTTCCTGCTGGCGATGAAGGCGAGCAACCTGGCATTCCACGAGATCCCCAGGCTCCTGGATTTCCGCGGGCGTAGCTTCGTCGACGTCGGTGGCGGTTCCGGCGAATTGACCAAGGCCATCCTGCAGGCCGAGCCCAGCGCCCGGGGCGTGATGCTCGACCGCGAGGGTTCCCTCGGCGTGGCCCGCGACAACCTTTCCAGCCTGTTGGCAGGGGAGCGCGTCAGCCTGGTGGGCGGCGACATGCTGCAAGAGGTGCCGTCCAACGGCGATATCTACCTGCTGTCGCGGATCATCGGCGATCTGGACGAAGCCGCCAGCCTGCGGTTGCTCGGCAATTGCCGCGAGGCGATGGCCGGCGACGGCCGGGTGGTGGTGATCGGCGGACCATCTCGGCCAGCGAGCCGTCGCCGATGTCGGTGCTCTGGGACGTGCACCTGTTCATGGCCTGCGCTGGCCGTCACCGCACCACCGAGGAGGTGGTCGACCTGCTCGGGCGCGGCGGCTTCGCGGTGGAGCGGATCGTCGACCTGCCGATGGAAACCCGCATGATCGTCGCTGCCAGGGCCTGA.

The DNA sequence shown in SEQ ID No.5 is a sequence in the genome of Pseudomonas aeruginosa PAO1, and the coding Gene phzS (PA 4217, NCBI Gene ID: 881836) consists of 1209 nucleotides.

SEQ ID NO.5：ATGAGCGAACCCATCGATATCCTCATCGCCGGCGCCGGCAT CGGCGGCCTCAGTTGCGCCCTGGCCCTGCACCAGGCCGGCATCGGCAAGGTCACGCTGCTGGAAAGCAGCAGCGAGATACGCCCCCTTGGCGTCGGCATCAATATCCAGCCGGCGGCGGTCGAGGCCCTTGCCGAACTGGGCCTCGGCCCGGCGCTGGCGGCCACCGCCATCCCCACCCACGAGCTGCGCTACATCGACCAGAGCGGCGCCACGGTATGGTCCGAGCCGCGCGGGGTGGAAGCCGGCAACGCCTATCCGCAGTACTCGATCCATCGCGGCGAACTGCAGATGATCCTGCTCGCCGCGGTGCGCGAGCGCCTCGGCCAACAGGCGGTACGCACCGGTCTCGGCGTGGAGCGTATCGAGGAGCGCGACGGCCGCGTGCTGATCGGCGCCCGCGACGGACACGGCAAGCCCCAGGCGCTCGGTGCCGATGTGCTGGTCGGCGCCGACGGTATCCATTCGGCGGTCCGCGCGCACCTGCATCCCGACCAGAGGCCGCTGTCCCACGGTGGGATCACCATGTGGCGCGGCGTCACCGAGTTCGACCGCTTCCTCGACGGCAAGACCATGATCGTCGCCAACGACGAGCACTGGTCGCGCCTGGTCGCCTATCCGATCTCGGCGCGTCACGCGGCCGAAGGCAAGTCGCTGGTGAACTGGGTGTGCATGGTGCCGAGCGCCGCCGTCGGCCAGCTCGACAACGAGGCCGACTGGAACCGCGACGGGCGCCTGGAGGACGTGCTGCCGTTCTTCGCCGACTGGGACCTGGGCTGGTTCGACATCCGCGACCTGCTGACCCGCAACCAGTTGATCCTGCAGTACCCGATGGTAGACCGCGATCCGCTGCCGCACTGGGGCCGGGGACGCATCACCCTGCTCGGCGACGCCGCCCACCTGATGTATCCGATGGGCGCCAACGGCGCTTCGCAAGCAATCCTCGACGGCATCGAGCTGGCCGCCGCGCTGGCGCGCAACGCCGACGTGGCCGCAGCCCTGCGCGAATACGAAGAAGCGCGGCGGCCGACCGCCAACAAGATCATCCTGGCCAACCGAGAACGGGAAAAAGAGGAATGGGCCGCGGCTTCGCGACCGAAGACCGAGAAGAGCGCGGCGCTGGAAGCGATCACCGGCAGCTACCGCAACCAGGTGGAACGGCCACGCTAG.

In the embodiment of the invention, a wild strain CICC20240 is purchased from China center for type culture Collection of industrial microorganisms, escherichia coli S17-1 and suicide plasmid pK18mobsacB are used as the units for preservation, and knocked-out plasmids pK18DM, pK18DacpP, pK18DS, pK18DH and pK18Dcrc are used as the structures of the invention;

Reagents such as restriction enzymes, ligases, etc. were purchased from the division of biological engineering (Shanghai);

PCR primers were synthesized by Guangzhou division, a division of biological engineering (Shanghai) Co.

EXAMPLE 1 construction of CICC-M5 (ΔPa acpP::: ec acpP ΔcrcΔ phzH Δ phzS ΔphzM) Gene knockout mutant

Primers were designed based on the target gene and the upstream and downstream sequences (see Table 1, the underlined part is the cleavage site):

TABLE 1 primer sequences

Construction of CICC ΔphzM mutant:

To obtain the CICC ΔphzM mutant, a phzM knockout vector is first constructed based on the PA4209 gene and upstream and downstream sequences. The total DNA of pseudomonas aeruginosa CICC20240 is used as a template, and primers P1, P2, P3 and P4 are respectively used for amplification to obtain fragments of about 600bp on the upstream and downstream of the phzM gene.

25. Mu.L amplification system: 1. Mu.L of total DNA, 1. Mu.L of each primer, and 22. Mu.L of PCR Mix.

Amplification conditions: pre-denaturation at 98℃for 12min, denaturation at 98℃for 10s, annealing at 60℃for 10s, and extension at 72℃for 15s. Number of program cycles: 35 cycles.

In the invention, P2 and P3 are reversely complemented in advance during primer design, and the upstream and downstream fragment genes of the phzM gene can be spliced by using P1 and P4 as primers by utilizing an overlap extension PCR method.

25. Mu.L amplification system: 1. Mu.L of each of the P1 and P2 fragments and the P3 and P4 fragments, 1. Mu.L of each of the P1 and P4 primers, and 21. Mu.L of PCR Mix.

Amplification conditions: pre-denaturation at 98℃for 12min, denaturation at 98℃for 10s, annealing at 60℃for 10s, and extension at 72℃for 30s. Number of program cycles: 35 cycles.

The P1, P4 knockout cassette fragments after overlap extension were digested with plasmid pK18mobsacB using restriction endonucleases HindIII and BamHI (restriction conditions: 25. Mu.L for DNA fragment or plasmid, 10 Xrestriction buffer 5. Mu.L for BamHI 2. Mu.L, hindIII 2. Mu.L for double distilled water to 50. Mu.L for reaction at 37℃for 4 hours), and the two were ligated by T4 DNA LIGASE (ligation conditions: 2. Mu.L for linearized vector DNA, 15. Mu.L for insert DNA, 10 Xrestriction buffer 2. Mu.L for T4 DNA ligase 0.2. Mu.L, double distilled water to 20. Mu.L for metal bath incubation at 22 ℃) and colony PCR screening (10. Mu.L for amplification system: 1. Mu.L for positive recombinant bacteria, 0.5. Mu.L for primers P1, P4 each, dNTP 0.5. Mu.L for each, and Mix 8. Mu.L for PCR: 98℃for pre-denaturation 12min,98℃denaturation 10s,60℃annealing 10s for 30 cycles at 72 ℃).

Screening to obtain positive recombinant and sequencing to obtain knocked out plasmid pK18DM.

The plasmid pK18DM after sequencing is transformed into the escherichia coli S17-1 strain by heat shock, the plasmid is transferred into pseudomonas aeruginosa cells by bacterial conjugation, and homologous recombination occurs (the recombination principle schematic diagram is shown in figure 2). The primary recombinant conjugation product was plated on LB solid medium containing Gm (100. Mu.g/mL), and the single colony obtained was a primary recombinant. After identification and streaking purification by colony PCR, one recombinant was selected and cultured overnight in a non-resistant LB liquid medium at 220rpm, the supernatant was removed after centrifugation of the bacterial liquid, and transferred to a non-resistant ME liquid medium containing 20% sucrose for 2 hours. The cultures were then spread on a non-resistant ME solid medium containing 20% sucrose for 2 days until single colonies developed. The recombinants were identified by PCR using primers P1, P4 to determine whether the obtained strain was the desired strain (results are shown in FIG. 3).

By the same method, a single mutant strain CICC delta phzM starting strain is used for knocking out the crc gene to obtain a double mutant strain delta phzM delta crc, and then the double mutant strain is used as the starting strain to step-wise knock out phzS and phzH and replace Pa acpP genes, so that the strain CICC-M5 (delta Pa acpP: ec acpP delta crc delta phzH delta phzS delta phzM) is finally obtained.

EXAMPLE 2 detection of the content of CICC-M5 phenazine-1-carboxylic acid in the mutant

The extraction and detection method of phenazine-1-carboxylic acid comprises the following steps:

1. Target bacteria were inoculated into 15mL centrifuge tubes containing 5mL of non-resistant LB liquid medium and shake-cultured overnight at 37 ℃.

2. 5ML of the seed solution was transferred to a 250mL triangular flask containing 100mL of PPM medium, and the flask was placed in a shaking table at 37℃for shake culture at a rotation speed of 220rpm.

3. 180 Mu L of thallus is taken every 12h, 20 mu L of 6M hydrochloric acid is added, and the mixture is stirred and mixed for 10 seconds.

4. 540 Μl of chloroform was added and shaken for two minutes. The organic phase was separated from the aqueous phase by centrifugation at 12000rpm for 10min, and the chloroform phase was taken in 300. Mu.L to a clean 1.5mL centrifuge tube, concentrated by centrifugation and evaporated to dryness.

5. The evaporated sample was resuspended in 900. Mu.L of chloroform and after sufficient dissolution, the sample was centrifuged at 12000rpm for 10min to remove impurities.

6. 200. Mu.L of the upper aqueous phase was taken and subjected to HPLC detection.

PCA was quantitatively detected by HPLC.

Instrument model: shimadzu LC-20A;

analytical column: aglient XDB C18.5 μm, 4.6X105 mm;

Mobile phase: 40% A:10mM ammonium acetate 60% B: acetonitrile;

Sample injection amount: 20. Mu.L;

Column temperature: 28 ℃;

Ultraviolet detection wavelength: 254nm;

Flow rate: 0.7ml/min.

PCA standard samples with different concentrations are configured for detection, and a standard curve is drawn according to the linear relation between peak area and concentration: PCA (mg/L) =0.000002 x-1.7768 (R ² =0.999), the chromatogram is shown in FIG. 4, the ultraviolet detection wavelength is 254nm, and the peak time is 3.9min.

Example 3

The PCA yields of the original strain CICC20240 and the mutant CICC-M5 mutant were determined by shake flask fermentation in PPM medium. As shown in FIG. 5a, the growth curve of the original strain CICC20240 and CICC-M5 in LB medium has no obvious difference, the maximum OD _600nm is 1.84, the strain enters the stabilization period after 36h, and the gene knockout has little effect on the growth of bacteria. The measurement result of the PCA yield is shown in FIG. 5b, and the PCA concentration of the penta-mutant strain CICC-M5 reaches a maximum value 81.42mg/L after 60 hours of culture. In LB medium, the PCA yield of CICC-M5 is improved by about 19.86 times compared with that of the original strain CICC 20240. Mutant CICC-M5 was cultured in a 10L fermenter using PPM medium and its PCA yield was determined. As shown in FIG. 6, the mutant CICC-M5, which was fermented in PPM medium, reached the maximum concentration of PCA at 48 hours, which was 1052.7mg/L, and at this time, a rapid decrease in dissolved oxygen was observed, presumably due to exhaustion of nutrients in the medium, and the bacteria died in large amounts, and continued metabolism was not possible to produce PCA.

In summary, the invention takes the pseudomonas aeruginosa strain CICC20240 with higher yield of the pyocin as an original strain, the CICC20240 is identified as pseudomonas aeruginosa, and the experiment refers to the pseudomonas aeruginosa PAO1 genome sequence and a sequencing fragment obtained by PCR amplification of the total DNA of the bacteria CICC20240 to design primers. The Pa acpP is replaced by the Ec acpP in the original strain CICC20240, meanwhile, the synthesis process of the pyocin is blocked, and the genes PA0051, PA5332, PA4209 and PA4217 are knocked out, so that the genetically engineered strain with high PCA is constructed for producing fermentation.

It is to be understood that the above examples of the present invention are provided for clarity of illustration only and are not limiting of the embodiments of the present invention. Other variations or modifications of the above description will be apparent to persons of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. Any modification, equivalent replacement, improvement, etc. which come within the spirit and principles of the invention are desired to be protected by the following claims.

Claims

1. A construction method of a phenazine-1-carboxylic acid producing genetic mutation engineering bacterium is characterized in that a wild strain CICC20240 is taken as an original strain, phzM genes, crc genes, phzS genes and phzH genes are knocked out and replaced by Pa acpP genes, and a strain CICC-M5 (delta Pa acpP:: ec acpP delta crcdelta phzH delta phzS delta phzM) is finally obtained, namely the phenazine-1-carboxylic acid producing genetic mutation engineering bacterium.

2. The construction method according to claim 1, wherein the nucleotide sequence of the phzM gene is shown in SEQ ID No. 4.

3. The construction method according to claim 1, wherein the nucleotide sequence of the crc gene is shown in SEQ ID NO. 2.

4. The construction method according to claim 1, wherein the nucleotide sequence of phzS gene is shown in SEQ ID NO. 5.

5. The construction method according to claim 1, wherein the nucleotide sequence of phzH gene is shown in SEQ ID NO. 3.

6. The construction method according to claim 1, wherein the nucleotide sequence of the Pa acpP gene is shown as SEQ ID No. 1.

7. The phenazine-1-carboxylic acid producing genetically engineered bacterium constructed by the construction method according to any one of claims 1 to 6.

8. The use of the genetically engineered bacterium for producing phenazine-1-carboxylic acid according to claim 7 in the production of phenazine-1-carboxylic acid.

9. A method for producing phenazine-1-carboxylic acid, wherein the phenazine-1-carboxylic acid is produced by using the phenazine-1-carboxylic acid producing genetically engineered bacterium of claim 7.

10. The use of a phenazine-1-carboxylic acid producing genetically engineered bacterium as defined in claim 7 in the preparation of a plant disease resistant formulation.