CN117987387A - Plant ALS double-site mutant gene, coded protein and application thereof - Google Patents

Abstract

The invention relates to the technical field of agricultural biology, in particular to a plant ALS double-site mutant gene, a coded protein and application thereof. The plant ALS mutant protein provided by the invention can enable plants to generate higher resistance to various ALS inhibitor herbicides, can be used for cultivating herbicide-resistant plant varieties, can also be used for developing a plant genetic transformation screening system by taking herbicide resistance genes as screening markers, and has better application value.

Description

Plant ALS double-site mutant gene, coded protein and application thereof

Technical Field

The invention relates to the technical field of agricultural biology, in particular to a plant ALS double-site mutant gene, a coded protein and application thereof.

Background

Acetolactate synthase (acetolactate synthase, ALS; EC 2.2.1.6) is a key enzyme (Herrera Estrella L,Block M D,M essens E,et al.Chimeric genes as dominant selectable markers in plant cells.The EM BO Journal,1983,2(6):987-995.), that catalyzes the initial step of synthesis of branched-chain amino acids (leucine, isoleucine and valine) in plants, is a plant-specific enzyme that is absent from animals. Therefore, under the condition of no harm to human and livestock, the ALS is inhibited to block the biosynthesis of branched chain amino acid, so that the synthesis of protein is damaged, DNA synthesis in the cell division stage is blocked, and further, the plant is stopped growing, and the purpose of removing weeds can be achieved. At present, various ALS inhibitor herbicides (such as sulfonylurea, imidazolinone, pyrimidine salicylic acid, sulfonamide herbicides, etc.) have been developed for the enzyme and have been widely used. An alteration in the amino acid sequence of ALS may result in an alteration in its protein structure, which in turn may result in the failure of ALS inhibitors to bind to it, resulting in decreased sensitivity of ALS to ALS inhibitor herbicides, and thus in plants resistant to certain herbicides. The ALS mutant genes reported at present have the problems of low herbicide resistance level and limited herbicide resistance variety, so that the development of novel ALS resistance mutants has important significance for the development of herbicide resistant plants.

Disclosure of Invention

The invention provides a plant ALS mutant protein and a coding gene thereof, provides a plant transgenic screening expression box and a screening carrier which take plant endogenous genes as screening markers based on the ALS mutant protein and the coding gene thereof, and further provides a preparation method of transgenic plants.

Specifically, the invention provides the following technical scheme:

In a first aspect, the present invention provides a plant ALS mutein comprising a mutation of amino acid 169 to asparagine and of amino acid 170 to glutamine as compared to the wild-type ALS protein of rice.

The existing ALS muteins are generally low in resistance level and are more resistant to a single herbicide type. The invention discovers that the double-site combined mutation from the 169 th amino acid mutation to asparagine and the 170 th amino acid mutation to glutamine can obviously improve the resistance of ALS protein to ALS inhibitor herbicides, and simultaneously increase the types of ALS protein herbicide resistance, thereby endowing plants with high resistance to ALS inhibitor herbicides such as pyrimidylsalicylic acid (such as bispyribac) and imidazolinones (such as imazethapyr and imazethapyr). The combined mutation of the 169 th amino acid and the 170 th amino acid is found for the first time and obtains better ALS inhibitor herbicide resistance effect.

Preferably, the ALS mutant protein contains a mutation from glutamine 169 to asparagine and a mutation from valine 170 to glutamine as compared to the rice wild-type ALS protein.

Preferably, the amino acid sequence of the ALS mutein is shown in SEQ ID NO. 1.

The ALS mutant protein provided by the invention has higher resistance to pyrimidine salicylic acid (such as bispyribac-sodium) and imidazolinone (such as imazethapyr) herbicides.

In a second aspect, the invention provides a nucleic acid molecule encoding a plant ALS mutein as described above.

The nucleic acid molecules described above include DNA or RNA.

Based on the amino acid sequence and codon regularity of the above-described plant ALS muteins, the skilled person will be able to obtain the nucleotide sequence of the nucleic acid molecule encoding said ALS muteins, which is not unique based on the degeneracy of the codons, but all nucleic acid molecules capable of encoding the production of said ALS muteins are within the scope of the invention.

In some embodiments of the invention, the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO. 2.

In a third aspect, the invention provides a biological material comprising said nucleic acid molecule or expressing said plant ALS mutein.

Preferably, the biological material is an expression cassette, vector or host cell.

Wherein the host cell does not comprise a plant cell capable of developing into a plant whole plant. The host cell may be a microbial cell or an animal cell.

In some embodiments of the invention, the expression cassette is operably linked to the nucleic acid molecule from a promoter.

In some embodiments of the invention, the expression cassette is operably linked to a promoter, the nucleic acid molecule, and a terminator.

In some embodiments of the invention, the vector is a plasmid vector, including replicative vectors and non-replicative vectors.

In some embodiments of the present invention, the host cell is escherichia coli or agrobacterium, but the kind of host cell is not limited thereto, and may be any microbial cell or animal cell that can be used for protein expression.

In a fourth aspect, the present invention provides a plant transgenic selection expression cassette comprising a nucleic acid molecule as described above and promoters and terminators for initiating and terminating transcription of the nucleic acid molecule.

In some embodiments of the invention, the plant transgenic screen expression cassette comprises a gene encoding a plant ALS mutein having the amino acid sequence shown in SEQ ID No. 1. The ALS mutant protein is more suitable to be used as a plant transgenic screening marker, can more effectively play the function of the screening marker in the plant gene transformation process, and realizes higher screening efficiency.

In some embodiments of the invention, the plant transgenic screen expression cassette comprises a gene encoding an ALS mutein having the sequence shown in SEQ ID No. 2.

In the above expression cassette, the promoter may be a plant constitutive promoter or a plant tissue specific promoter, and the terminator is a DNA sequence which can terminate transcription of a gene in a plant.

Preferably, the promoter is rice ALS gene promoter, ubi promoter of rice or corn, action promoter, rubisco small subunit promoter or Cab promoter; the terminator is rice ALS gene terminator or Ubi terminator.

In some embodiments of the invention, the promoter is a rice ALS gene promoter and the terminator is a rice Ubi terminator. The invention discovers that the ALS gene promoter and the Ubi terminator of rice are matched to regulate and control the transcription of the ALS mutant protein coding gene, so that the high-efficiency, stable and moderate expression of the gene can be better controlled, and the ALS mutant protein can better play the function of a screening mark.

In some embodiments of the invention, the nucleotide sequence of the plant transgenic screen expression cassette is shown in SEQ ID NO. 3.

In a fifth aspect, the present invention provides a plant genetic transformation selection vector comprising a nucleic acid molecule as described above or the plant transgenic selection expression cassette.

Preferably, the plant genetic transformation selection vector is genetically transformed by cloning additional expression cassettes into the vector, wherein the additional expression cassettes refer to expression cassettes other than the plant transgenic selection cassettes described above, including but not limited to fluorescent protein cassettes, GUS reporter gene cassettes, insect-resistant cassettes, herbicide-resistant cassettes, and the like.

In some embodiments of the invention, the plant genetic transformation selection vector is a plant binary expression vector.

In some embodiments of the invention, the plant genetic transformation selection vector further comprises a series of multiple cloning sites, such as EcoRI, sacI, aleI, kpnI, pmeI, etc., for subsequent cloning of the gene of interest.

In some embodiments of the invention, the nucleotide sequence of the plant genetic transformation selection vector is set forth in SEQ ID NO. 4.

The plant genetic transformation screening vector can be prepared by the following method:

(1) Constructing a plant transgenic screening expression cassette: the ALS mutant protein coding gene with the sequence shown as SEQ ID NO.2 is placed under the drive of a rice ALS gene promoter ALSpro to express, and the expression is stopped by a rice Ubi terminator at the downstream of the ALS mutant protein coding gene to obtain a plant transgenic screening expression box with the sequence shown as SEQ ID NO. 3;

(2) And (3) connecting the plant transgenic screening expression cassette obtained in the step (1) into a plant binary expression vector pC1300-ALSpro-MCS-OsubiT to obtain a plant genetic transformation screening vector.

In a sixth aspect, the present invention provides the use of any one of said plant ALS mutein or said nucleic acid molecule or said biological material or said plant transgenic selection expression cassette or said plant genetic transformation selection vector:

(1) Use in conferring resistance to ALS inhibitor herbicides to plants;

(2) Use in increasing resistance of a plant to ALS inhibitor herbicides;

(3) Use in reducing phytotoxicity of ALS inhibitor herbicides to plants;

(4) The application in weed control;

(5) Application in genetic breeding or seed production of plants;

(6) Use as a plant transgene screening marker.

The use as described in (1), (2) and (3) above, which can be used for imparting resistance to an ALS inhibitor herbicide, improving resistance to an ALS inhibitor herbicide or reducing phytotoxicity of an ALS inhibitor herbicide to a plant by allowing the plant to express the ALS mutein or introducing the nucleic acid molecule or an expression cassette or vector comprising the nucleic acid molecule.

The application described in the above (4) includes: allowing the plant to contain said nucleic acid molecule or express said ALS mutein and applying an effective dose of an ALS inhibitor herbicide during the plant growing process.

In the above (6), the ALS mutein or the nucleic acid molecule is used as a screening marker for plant transgenesis to screen positive plants in the transgenesis process.

In a seventh aspect, the present invention provides a method of preparing an anti-ALS inhibitor herbicide plant, the method comprising: allowing the plant to contain said nucleic acid molecule or to express said plant ALS mutein.

In the present invention, the ALS inhibitor herbicides include, but are not limited to, imidazolinone, pyrimidinyl salicylic acid, sulfonylurea, or sulfonamide herbicides. Wherein the imidazolinone herbicide comprises imazethapyr and imazethapyr; pyrimidine salicylic acid herbicides include bispyribac-sodium.

In the present invention, the plants include, but are not limited to, rice, corn, wheat, soybean, sorghum, peanut, sesame, cotton, linseed, germ, oat, rapeseed, barley, rye, millet, tobacco, highland barley, arabidopsis, and the like. Preferably, the plant is rice, soybean, maize, wheat, sorghum, peanut or millet.

The beneficial effects of the invention at least comprise: the invention provides ALS mutein, which can make rice, corn, soybean and other plants have higher resistance to various ALS inhibitor herbicides, and transgenic plants introduced with the mutein coding gene have high resistance to pyrimidine salicylic acid, imidazolinone and other herbicides. The mutant protein can obviously improve the resistance level of plants to ALS inhibitor herbicides, obviously increase the variety of ALS inhibitor herbicides with resistance of the plants, can exert better effect in various plants, can be used for cultivating herbicide-resistant plant varieties, and can also be used for developing plant genetic transformation screening systems by taking herbicide resistance genes as screening marks.

The invention also provides a plant transgenic screening expression cassette and a plant genetic transformation screening vector which use the ALS mutant gene as a screening marker. The plant genetic transformation screening vector can be used as a transgenic screening vector to be added with other functional elements for plant gene transformation, can realize higher positive screening efficiency, has the screening markers of plant endogenous genes, does not introduce exogenous screening marker genes such as bacterial sources and the like in the transgenic process, enriches the plant transgenic screening method, can effectively reduce the potential safety risk of transgenic plants caused by exogenous genes and the worry of the public on the safety of the transgenic plants, is favorable for the commercialization application of the transgenic plants, and has better application value.

Drawings

In order to more clearly illustrate the invention or the technical solutions of the prior art, the following description will briefly explain the drawings used in the embodiments or the description of the prior art, and it is obvious that the drawings in the following description are some embodiments of the invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 is an electrophoresis chart of a gene fragment of ALSm purpose amplified in example 2 of the present invention; wherein M is Marker,1-5 is ALSm, and the fragment size is about 1.935kb; the sizes of the bands are correct, and the DNA is recovered by tapping.

FIG. 2 is a map of pC1300-ALSpro-MCS-OsubiT scaffold vector in example 2 of the present invention.

FIG. 3 is an electrophoretogram of pC1300-ALSpro-MCS-OsubiT cleaved by SmaI and PstI in example 2 of the present invention; wherein M is Marker, CK+ is pC1300-ALSpro-MCS-OsubiT skeleton vector without enzyme, 1-7 is pC1300-ALSpro-MCS-OsubiT skeleton vector without enzyme, fragment with size of 11kb can be cut out, and DNA is recovered by tapping.

FIG. 4 is an electrophoresis chart of the recombinant plasmid pCALSm in example 2 of the present invention verified by HindIII single cleavage and KpnI+PmeI double cleavage; wherein M is Marker, CK+ is pCALSm11 recombinant plasmid, 1-2 is pCALSm recombinant plasmid which is digested, a single digestion can cut out a fragment with the size of about 1kb, double digestion can cut out a fragment with the size of about 2.5kb, and the digested strips are correct.

FIG. 5 is a vector map of pCALSm A vector in example 2 of the present invention.

FIG. 6 shows the result of PCR detection electrophoresis of Agrobacterium after transformation in example 3 of the present invention; wherein M is Marker, CK+ is pCALSm11 recombinant plasmid positive control, 1-14 is the result of PCR of pCALSm recombinant plasmid agrobacterium monoclonal colony.

FIG. 7 shows the growth of pCALSm.sup.11 transgenic lines T1 generation rice in example 6 of the present invention after spraying bispyribac, imazethapyr and imazethapyr at a certain concentration; wherein, bispyribac-sodium 45 is 13500mg/L, imazethapyr 15 is 1125mg/L, imazethapyr 10 is 7200mg/L, and the arrow indicates negative control ZH11.

Detailed Description

The invention utilizes CRISPR/Cas9 gene editing technology to edit ALS genes to obtain ALS mutant proteins, and compared with rice wild ALS proteins, the ALS mutant proteins contain 169 th glutamine mutation to asparagine and 170 th valine mutation to glutamine.

For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings, and it is apparent that the described embodiments are some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

EXAMPLE 1ALS mutein acquisition

The invention utilizes CRISPR/Cas9 gene editing technology to edit rice ALS genes, obtains gene editing lines with higher resistance to bispyribac-sodium, imazethapyr and imazethapyr in T0 generation, sequences ALS genes of one of the resistance lines to find that ALS is mutated, and compared with rice wild ALS protein, the 169 th glutamine mutation and 170 th valine mutation of the ALS mutant protein are asparagine and the 170 th valine mutation to glutamine (the mutant gene is named ALSm, the amino acid sequence is shown as SEQ ID NO.1, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO. 2). In view of the higher ALS inhibitor resistance of the ALS mutein, its function in transgenic screening was further identified.

EXAMPLE 2 construction of screening vectors for genetic transformation of plants containing ALS mutant Gene

The construction method of the plant transgenic screening expression cassette OsALSP-ALSm11-OsubiT (the sequence is shown as SEQ ID NO. 3) and the plant genetic transformation screening vector pCALSm (the sequence is shown as SEQ ID NO. 4) comprises the following steps: amplifying a target fragment sequence, carrying out double enzyme digestion on a vector pC1300-ALSpro-MCS-OsubiT by using SmaI and PstI, and connecting the target fragment with the vector, wherein the specific steps are as follows:

1. amplification of ALS mutant Gene (ALSm 11)

Amplifying a target gene ALSm11 from a rice mutant obtained by performing target mutation by using a CRISPR/Cas9 gene editing technology by using a primer 1300-ALS-F2/1300-ALS-Rv, wherein the gene size is 1935bp; wherein, the 5' end of the primer 1300-ALS-F2/1300-ALS-Rv has about 25 and 24 nucleotide sequences which are repeated with the corresponding connection positions of the carrier; the upstream primer does not retain the cleavage site and the downstream primer retains the cleavage site.

The primer sequences are as follows:

1300-ALS-F2(SEQ ID NO.5)：

TAGTCCTAGGTTAATTAAGGTACCCATGGCTACGACCGCCGC

1300-ALS-Rv(SEQ ID NO.6)：

agctctatggctgaggacctgcagTTAATACACAGTCCTGCCATCACC

The PCR amplification reaction system is shown in Table 1.

TABLE 1 PCR amplification reaction System

The PCR amplification procedure was as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 55-65℃for 30s, extension at 68℃for 3min,35 cycles; extending at 68 ℃ for 10min and ending at 16 ℃.

The PCR products amplified by primers 1300-ALS-F2 and 1300-ALS-Rv were 1935bp fragments of ALSm11, and the 1935bp products were recovered by 1.2% agarose gel electrophoresis (FIG. 1).

2. Vector construction

The ALSm gene amplification product in the above 1 was inserted into pC1300-ALSpro-MCS-OsubiT vector using Gibson Assembly method (the inventors modified depending on the pC1300 vector backbone, pC1300-ALSpro-MCS-OsubiT vector was an expression cassette composed of ALS promoter and rice Ubi terminator linked to pC1300, and map of pC1300-ALSpro-MCS-OsubiT vector was shown in FIG. 2).

The specific method comprises the following steps:

(1) And (3) enzyme cutting: the vector plasmid pC1300-ALSpro-MCS-OsubiT was digested with SmaI and PstI and subjected to agarose gel electrophoresis (FIG. 3), followed by the use of Gel Extraction kit (Omega, supra) recovered about 11kb bands to give pC1300-ALSpro-MCS-OsubiT linear fragments.

The SmaI and PstI double cleavage reaction system is shown in Table 2.

TABLE 2 double cleavage reaction System

(2) And (3) connection: ligation kit using 2X LIGHTENING CLONING KITThe connection and connection system are shown in Table 3.

Table 3 connection system

And (3) connection procedure: 50℃for 30min.

(3) Conversion: taking 1 mu L of the connection product, adding the connection product into competent cells of escherichia coli, and slightly and uniformly mixing; e.coli competent cells are transformed by 1.8KV electric shock through an electrotransformation instrument; 1mL of SOC medium was added, the culture was performed at 37℃and 220rpm with shaking for 1 hour, centrifugation was performed at 5000rpm for 30 seconds, 800. Mu.L of the supernatant was discarded, and the remaining cells were mixed with the medium and spread on LB plates containing kanamycin. Culturing at 37deg.C for about 16 hr, picking single colony, performing colony PCR with specific primers (0309-F2 and 0309-R2), selecting positive colony, shaking at 37deg.C and 220rpm overnight, extracting plasmid with high purity plasmid small extraction kit (ZHONGKERITAI), enzyme cutting to obtain correct result as shown in figure 4, preserving strain, sequencing, and identifying correct plasmid as pCALSm11, and carrying out carrier map as shown in figure 5.

The primer sequences are as follows:

0309-F2：GGGCCATACTTGTTGGATATCAT(SEQ ID NO.7)；

0309-R2：TTGTTCATGGCGTAATGTCTCC(SEQ ID NO.8)。

example 3 Agrobacterium transformation, identification and Rice genetic transformation

1 Μl of the correctly sequenced pCALSm plasmid constructed in example 2 was added to Agrobacterium EHA105 competent cells stored at-80deg.C, and transformed by 2.5KV electric shock. Coating on a YEP culture plate containing kanamycin, rifampicin and streptomycin, culturing at 28 ℃ for about 48 hours, picking single colony, shaking and culturing overnight, performing bacterial liquid PCR verification by using specific primers (0309-F2 and 0309-R2) (figure 6), amplifying to obtain about 950bp target fragment, selecting positive clone (engineering agrobacterium), shaking and culturing for 36-48 hours, and preserving bacterial liquid for infection.

Taking rice as an example, the engineering agrobacterium obtained above is transformed into rice ZH11 callus by agrobacterium-mediated genetic transformation, and links such as screening, differentiation, rooting and the like under the screening pressure of ALS inhibitor herbicides such as bispyribac-sodium (BS) or imidazolinone and the like are carried out. 300 calli are screened together to obtain 112 positive calli, and the positive calli are differentiated and rooted to finally obtain the transformation efficiency of 37.3%.

Example 4 determination of Critical concentration of Bispyribac-sodium, imazethapyr and imazethapyr in seedling stage of Normal Rice

Bispyribac-sodium is herbicide for paddy fields, and common paddy rice has resistance to the bispyribac-sodium, so that the herbicide with the prescribed concentration of the pesticide sprayed on the paddy rice cannot cause damage to the paddy rice, and the safety concentration of most of spraying is 30mg/L; the imazethapyr imidazolinone herbicide is mainly used for preventing and killing gramineous weeds and broadleaf weeds of leguminous crops, has the advantages of strong selectivity, wide herbicide controlling spectrum, high activity and the like, and has weak resistance to common rice and corn, and most recommended concentration is 75mg/L. The imazethapyr belongs to imidazolinone herbicides and is mainly used for preventing and killing annual gramineous weeds, broadleaf weeds and sedge weeds in peanut fields. Has the characteristics of stable drug effect, broad herbicide controlling spectrum, strong systemic property and the like, and common rice and corn have weak resistance to the drug effect, and the recommended concentration is 720mg/L.

The critical concentration of the common rice on the resistance to bispyribac-sodium, imazethapyr and imazethapyr is analyzed by the embodiment, and the critical concentration is obtained by experimental tests: for bispyribac-sodium, the rice ZH11 is sprayed at a recommended concentration of 20 x or more in the seedling stage to die, so that 20 x is taken as a critical concentration; for imazethapyr, the rice ZH11 is sprayed at a recommended concentration of 2x or more to die in the seedling stage, so that 2x is taken as a critical concentration; for imazapic, japonica rice ZH11 withered and died at 10 x or more of the recommended concentration sprayed at the seedling stage, and therefore 10 x was used as the critical concentration.

Example 5 identification of transgenic lines

In order to identify whether the obtained strain is a transgenic strain, the present example performs PCR verification on a part of positive transgenic plants obtained by the screening culture, the differentiation culture and the rooting culture in the above-described example 3.

Firstly, extracting sample DNA, wherein the DNA extraction steps are as follows: taking rice leaves with the length of about 2cm, and placing the rice leaves into a 2mL centrifuge tube; 800. Mu.L of 1.5 XCTAB was added to a mortar, the leaves were ground to homogenize and poured back into a centrifuge tube; water bath at 65 ℃ for 20-30min, and mixing for 1 time after reversing every 5min; centrifuging at 12000rpm for 10min; sucking 400 mu L of supernatant to a new centrifuge tube, adding 2 times of absolute ethyl alcohol precooled by ice, and placing the mixture on ice at-20 ℃ for 20min; centrifuging at 12000rpm for 10min; discarding the supernatant, adding 500 μL of 75% ethanol, rinsing upside down, centrifuging at 8000rpm for 5min; the supernatant was discarded, and the mixture was placed on a super clean bench for drying or naturally airing, and 100. Mu.L of ddH ₂ O was added to dissolve DNA.

In order to distinguish rice endogenous genes, a pair of primers (0309-F2/0309-R2) is designed to carry out PCR amplification detection on a transgenic strain genome DNA sample, wherein the primer pair takes an endogenous rice genome as a template and cannot be amplified to obtain fragments, and takes a transgenic expression cassette containing ALS mutant genes as the template and is amplified to obtain fragments with the size of about 950 bp.

The PCR reaction procedure was as follows: pre-denaturation at 94℃for 5min, denaturation at 94℃for 45s, annealing at 55-65℃for 45s; extending at 72 ℃ for 1.5min;30-35 cycles; extending at 72 ℃ for 10min; ending at 16 ℃.

The PCR reaction system is shown in Table 4.

TABLE 4 PCR reaction system

The PCR products are subjected to agarose gel electrophoresis, and the electrophoresis results show that most of transgenic samples contain transgenic bands of about 950 bp.

Example 6 identification of herbicide resistance phenotype of transgenic Rice

Selecting a part of rooting materials of ALS mutant gene (ALSm) transgenic rice lines in example 5, and performing herbicide spraying concentration test after transplanting for 7-14 days (about 3-5 leaf period), wherein the spraying concentrations of the herbicide are respectively 1200mg/L (40×), 1350mg/L (45×), 1500mg/L (50×), 1650mg/L (55×) and 1800mg/L (60×) of bispyribac-sodium, and the wild type control ZH11 shows leaf yellowing under each spraying concentration 3-7 days after spraying. After 21 days, wild type control ZH11 is withered and fatalities under each spraying concentration, the transgenic line grows normally under the spraying of 1200mg/L (40×) to 1500mg/L (50×) of bispyribac-sodium, and a small part of leaves appear withered and yellow; the transgenic lines were all dead under 1650mg/L (55X) bispyribac-sodium spray.

Selecting a part of rooting materials of ALS mutant gene (ALSm) transgenic rice lines in example 5, and spraying 750mg/L (10×), 1125mg/L (15×), 1500mg/L (20×), 2250mg/L (30×), 2625mg/L (35×), 3000mg/L (40×) of imazethapyr respectively after 7-14 days (about 3-5 leaf period) after transplanting, wherein leaf blight appears in wild type control ZH11 at each spraying concentration. After 21 days, the wild type control ZH11 was dead and yellow at each spray concentration, and the transgenic line was still healthy at a spray concentration of 750mg/L (10×) to 2250mg/L (30×). Most seedlings survived but were slightly dwarfed at 2625mg/L (35X) of imazethapyr spray.

Selecting a part of rooting materials of ALS mutant gene (ALSm 11) transgenic rice lines in example 5, and spraying 3600mg/L (5×), 7200mg/L (10×), 10800mg/L (15×), 14400mg/L (20×), 14400mg/L (25×) of imazapyr respectively 7-14 days after transplanting (about 3-5 leaf periods), wherein leaf blight appears in wild type control ZH11 at each spraying concentration. After 21 days, the wild type control ZH11 is withered and fatally cured at each spraying concentration, and most single plants of the transgenic line can grow normally under the spraying of 3600mg/L (5×) to 7200mg/L (10×) of imazethapyr.

The T0 generation transgenic seeds with the anti-bispyribac-sodium are collected, screened by a rooting medium containing hygromycin and then planted to obtain T1 generation transgenic plants, and 1350mg/L (45×) bispyribac-sodium is sprayed after 7-14 days of transplanting (about 3-5 leaf period) (left graph of FIG. 7). 3-7 days after spraying, leaf blight appears in wild type control ZH 11. After 7 days, the wild control ZH11 is withered, yellow and deadly, most plants of the transgenic line grow normally, and a small part of leaves are yellow. After 21 days, the wild-type control ZH11 and the transgenic sensitive lines had died completely and the surviving lines were bispyribac-sodium resistant lines (left panel of fig. 7).

The T0 generation transgenic seeds of the verified imazethapyr resistant are collected, screened by a rooting medium containing hygromycin and then planted to obtain T1 generation transgenic plants, 1125mg/L (15×) imazethapyr is sprayed after 7-14 days of transplanting (about 3-5 leaf period) (middle graph of FIG. 7), and after 7 days, wild type control ZH11 shows different degrees of wither, wither or death, but transgenic positive lines grow normally, and surviving lines are imazethapyr resistant lines (middle graph of FIG. 7).

The T0 generation transgenic seeds of the verified imazethapyr resistant are collected, screened by a rooting medium containing hygromycin and then planted to obtain T1 generation transgenic plants, 7200mg/L (10×) imazethapyr is sprayed after 7-14 days of transplanting (about 3-5 leaf period) (right graph of FIG. 7), and after 7 days, wild type control ZH11 shows different degrees of wither, wither or death, but transgenic positive lines grow normally, and surviving lines are imazethapyr resistant lines (right graph of FIG. 7).

Example 7 identification of herbicide resistance in transgenic corn

By using a method similar to the genetic transformation of rice in example 3, corn transgenic plants are obtained, herbicide spraying verification is carried out on T0 generation transgenic plants, and plants with high resistance to bispyribac-sodium, imazethapyr and imazethapyr are obtained. Collecting and planting T0 generation seeds of the three herbicide plants with high resistance, obtaining T1 generation transgenic plants, and carrying out herbicide phenotype identification to obtain T1 generation plant lines with high resistance to bispyribac-sodium, imazethapyr and imazethapyr.

Example 8 identification of herbicide resistance of transgenic soybeans

By using a method similar to the genetic transformation of rice in example 3, soybean transgenic plants are obtained, and bispyribac-sodium spraying verification is carried out on T0 generation transgenic plants, so that highly-resistant bispyribac-sodium plants are obtained. And collecting and planting T0 generation seeds of the high-resistance bispyribac-sodium plants, obtaining T1 generation transgenic plants, and carrying out bispyribac-sodium phenotype identification to obtain high-resistance bispyribac-sodium T1 generation plants.

The above results indicate that transgenic lines obtained by transforming ALS mutant genes in rice are highly resistant to bispyribac-sodium and simultaneously resistant to imazethapyr and imazethapyr; transgenic lines obtained by transforming ALS mutant genes in corn are highly resistant to bispyribac-sodium and simultaneously resistant to imazethapyr and imazethapyr; transgenic lines obtained by transformation of ALS mutant genes in soybean are highly resistant to bispyribac-sodium.

The three herbicides are only representative of the classes of herbicides, and the obtained transgenic lines have high resistance not only to the three herbicides, but also to other imidazolinones, pyrimidinylsalicylic acids (such as bensulfuron-methyl, chlorsulfuron, pyrithione, pyriminobac-methyl and the like), sulfonylurea herbicides.

The pCALSm obtained by the invention is used as a plant binary expression vector, and other expression cassettes (such as a fluorescent protein expression cassette, a GUS reporter gene expression cassette, an insect-resistant expression cassette, a herbicide-resistant expression cassette, other functional gene expression cassettes and the like) can be cloned into the vector for genetic transformation to obtain corresponding characters.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims (10)

1. A plant ALS mutein comprising a mutation of amino acid 169 to asparagine and of amino acid 170 to glutamine compared to the wild-type ALS protein of rice.

2. The plant ALS mutein according to claim 1, characterized in that the amino acid sequence of the ALS mutein is shown in SEQ ID No. 1.

3. A nucleic acid molecule encoding the plant ALS mutein of claim 1 or 2.

4. A nucleic acid molecule according to claim 3, wherein the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID No. 2.

5. A biological material comprising the nucleic acid molecule of claim 3 or 4 or expressing the plant ALS mutein of claim 1 or 2.

6. A plant transgenic screen expression cassette comprising the nucleic acid molecule of claim 3 or 4 and a promoter and terminator for initiating and terminating transcription of the nucleic acid molecule.

7. The expression cassette of claim 6, wherein the promoter is a rice ALS gene promoter, a Ubi promoter of rice or maize, an action promoter, a Rubisco small subunit promoter, or a Cab promoter;

and/or, the terminator is an ALS gene terminator or a Ubi terminator of rice;

preferably, the promoter is a rice ALS gene promoter, and the terminator is a rice Ubi terminator;

More preferably, the nucleotide sequence of the expression cassette is shown in SEQ ID NO. 3.

8. A plant genetic transformation selection vector comprising the nucleic acid molecule of claim 3 or 4, or comprising the expression cassette of claim 6 or 7.

9. Use of a plant ALS mutein according to claim 1 or 2 or a nucleic acid molecule according to claim 3 or 4 or a biological material according to claim 5 or a plant transgenic screen expression cassette according to claim 6 or 7 or any of the following plant genetic transformation screen vectors according to claim 8:

(1) Use in conferring resistance to ALS inhibitor herbicides to plants;

(2) Use in increasing resistance of a plant to ALS inhibitor herbicides;

(3) Use in reducing phytotoxicity of ALS inhibitor herbicides to plants;

(4) The application in weed control;

(5) Application in genetic breeding or seed production of plants;

(6) Use as a plant transgene screening marker.

10. A method of making an ALS inhibitor herbicide-like plant, the method comprising: comprising the nucleic acid molecule of claim 3 or 4 or expressing the plant ALS mutein of claim 1 or 2 in a plant.