CN117982625A - Use of TRIM72 in the prevention or treatment of ALS - Google Patents

Abstract

Pharmaceutical compositions comprising a scavenger are provided, wherein the scavenger is used to scavenge FUS mutants. Methods for treating or preventing or alleviating ALS are also provided.

Description

Use of TRIM72 in the prevention or treatment of ALS

The application is a divisional application of Chinese patent application with the application date of 2017, 03 and 22, the application number of 201780091092.0 and the name of TRIM72 which takes a ubiquitinated FUS protein mutant as a potential therapeutic target of ALS.

Technical Field

Embodiments of the present disclosure relate generally to biomedical science, and more particularly to pharmaceutical compositions, use of scavengers for scavenging FUS mutants in the manufacture of a medicament, and methods for treating or preventing or alleviating ALS.

Background

Amyotrophic Lateral Sclerosis (ALS), also known as geriatric disease (Lou Gehrig's disease) and Motor Neuron Disease (MND), is a special disease that results in neuronal death controlling voluntary muscles. Some people also use the term "motor neuron disease" to represent a group of disorders in which ALS is most common. ALS has the characteristics of muscle stiffness, muscle twitches, and progressive deterioration of weakness due to decreased muscle size. This results in difficulty speaking, swallowing, and eventually breathing. The etiology is not clear for 90% to 95% of cases. About 5-10% of cases are inherited from individual parents. About half of these genetic cases are due to the four specific genes SOD1, TDP-43, FUS and C9orf 72. Diagnosis is based on individual signs and symptoms and tests are performed to rule out other underlying causes. There is no cure for ALS. A drug named riluzole (riluzole) can extend the lifetime by about two to three months. Non-invasive ventilation can improve quality of life and extend life. The disease usually starts around 60 years of age and for hereditary cases around 50 years of age. The average survival from morbidity to mortality is two to four years. About 10% survived longer than 10 years. Most die from respiratory failure. In many parts of the world, the incidence of ALS is unknown. In europe and the united states, about two out of every 100,000 people are affected by the disease each year.

Physical therapy plays an important role in the rehabilitation of ALS patients. In particular, physical and professional therapists can target and benefit ALS patients by delaying strength loss, maintaining endurance, limiting pain, improving speech and swallowing, preventing complications, and promoting functional independence. Occupational therapy and specialized equipment (e.g., auxiliary technology) may also enhance individual independence and safety throughout the ALS. Low-impact mild aerobic exercises such as daily life, walking, swimming and spinning can strengthen unaffected muscles, improve cardiovascular health and help people fight fatigue and depression. The range of motion and extension motion can help prevent painful spasms and muscle shortening (contraction). Physical therapists and professional therapists may recommend exercises that provide these benefits without overstrain muscles. They would suggest devices such as ramps, supports, walkers, bathroom equipment (shower chairs, toilet lifts, etc.), and wheelchairs that help people keep them mobile. Professional therapists may offer or recommend equipment and retrofit products that keep ALS people as safe and independent as possible in daily life.

In addition, scientists have been studying ALS pathogenic genes to provide increasingly effective therapeutic ALS targets.

There is growing evidence that abnormal RNA metabolism, including RBP gain-of-function, loss of RNA helicase function, and misprocessing of pre-mRNA splicing, can lead to neurodegenerative diseases. Among them, mutations encoding two structurally similar RBP (TDP-43 and FUS) genes are associated with ALS of neurodegenerative diseases with genetic and pathological overlap. Even more surprisingly, ubiquitin-positive, mislocalized TDP-43 and FUS were found in most ALS populations, although some of them did not carry both RBP mutations, highlighting the key role of RBP dysfunction in pathogenesis. However, the disease mechanism of the underlying neurodegenerative disease caused by these RBP dysfunctions is still unknown.

Recently, TDP-43 and FUS, as well as many other RBPs, have been identified in the untranslated cytoplasmic mRNA complex (also known as stress particles (SG), a structure that typically occurs under stress conditions to temporarily stop cytoplasmic mRNA translation initiation), which contain Low Complexity Domains (LCDs), also known as Intrinsic Disorder Regions (IDRs). Like TDP-43 and FUS, mutations in those RBP genes have also been associated with neurodegenerative diseases including ALS and FTD. In ALS and FTD patient specimens, the mislocalized TDP-43 was co-localized with the SG markers, whereas in cultured cells, overexpressed mutant TDP-43 and FUS were found in stress-induced SG. Mutants in VCP, a gene encoding a protein involved in SG autophagy clearance, are also closely related to ALS and FTD. Taken together, these data suggest that incorrect processing of SG may cause disease etiology. However, it is not clear how endogenous levels of wild-type and mutant RBPs behave and function in SG formation and phase change, especially in disease target neurons that face pressure challenges, in part due to the urgent need for rational cell and animal models.

Thus, there is a need to further explore and improve methods for treating ALS.

Disclosure of Invention

Embodiments of the present disclosure seek to at least partially solve at least one problem existing in the prior art or to provide consumers with a useful commercial choice.

Embodiments of the first broad aspect of the present disclosure provide pharmaceutical compositions. According to this embodiment, wherein the pharmaceutical composition comprises a scavenger, wherein the scavenger is used to scavenge the FUS mutant. The inventors of this patent surprisingly found that scavengers used to eliminate FUS mutants can enhance motor capacity, the number of motor neurons, and motor learning capacity of the ALS mouse model. The pharmaceutical compositions disclosed herein may be effective in treating or preventing or alleviating ALS.

According to an embodiment of the present invention, the pharmaceutical composition may further comprise at least one of the following additional technical features.

According to some embodiments, the scavengers are used to eliminate FUS mutants by ubiquitination and proteasome mediated degradation. The pharmaceutical compositions disclosed herein may be more effective and safer in treating or preventing or alleviating ALS.

According to some embodiments, the scavenger is Trim72 or a nucleic acid encoding Trim 72. The inventors of the present patent surprisingly found that Trim72 can target FUS mutants for ubiquitination and proteasome-mediated degradation. Pharmaceutical compositions comprising Trim72 or a nucleic acid encoding Trim72 may be more effective and safer in treating or preventing or alleviating ALS.

According to some embodiments, wherein the FUS mutant is a FUS mutant of human ALS. The pharmaceutical compositions disclosed herein are more suitable for use in humans.

According to some embodiments, wherein the FUS mutant has a mutation in the FUS nuclear localization signal. Alternatively, the amino acid position of the nuclear localization signal of FUS is 513-526 (NP-004951.1). Alternatively, wherein the FUS mutant is prone to localization in the cytoplasm. The FUS mutants disclosed herein are closely related to ALS and are critical pathogenic mutants. Pharmaceutical compositions comprising scavengers for clearing the FUS mutants described above will be used for more effective treatment or prevention or alleviation of ALS.

According to some embodiments, the pharmaceutical compositions disclosed herein are for use in the treatment or prevention or alleviation of ALS. As described above, the inventors of the present patent have surprisingly found that a scavenger for scavenging FUS mutants can effectively enhance the motor ability, the number of motor neurons, and the motor learning ability of an ALS mouse model. The pharmaceutical compositions disclosed herein may be effective in treating or preventing or alleviating ALS.

According to some embodiments, the scavenger has at least one of the following forms: (a) a protein or functional fragment; (b) a nucleic acid molecule encoding (a); (c) a construct having (b). As described above, scavengers can be used to eliminate FUS mutants, such as Trim72, by ubiquitination and proteasome-mediated degradation. Trim72 or a functional fragment of Trim72 or a nucleic acid molecule encoding Trim72 or a functional fragment or a construct with a nucleic acid molecule for ubiquitination and proteasome mediated degradation of FUS mutants can be used as a scavenger for efficient scavenging of FUS mutants.

According to some embodiments, wherein the nucleic acid molecule comprises at least one of DNA and RNA. The form of the nucleic acid molecule is not particularly limited. According to some embodiments, the DNA or RNA has a double strand or single strand encoding a protein such as Trim72 or a functional fragment thereof, which may be effective as a scavenger of FUS mutants.

According to some embodiments, wherein the construct comprises at least one of a plasmid and a virus. The form of the construct is not particularly limited. So long as the construct can carry a nucleic acid molecule encoding a protein (e.g., trim72 or a functional fragment thereof) and the protein (e.g., trim72 or a functional fragment thereof) can be expressed in a suitable environment. According to some embodiments, the construct may be at least one of a plasmid and a virus.

According to some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier can alter the manner in which the drug enters and is distributed in the body, control the release rate of the drug, and deliver the drug to the target organ. The pharmaceutical compositions disclosed herein may then be more effective in treating ALS.

According to some embodiments, the acceptable carrier is a drug, toxin, cytokine, radioactive element, carrier protein, enzyme, lectin, fluorescent quantum dot, or high absorption coefficient chromophore. The acceptable carriers disclosed above can alter the manner in which and distribution of the drug into the body, control the release rate of the drug, and more effectively deliver the drug to the target organ.

Embodiments of the second broad aspect of the present disclosure provide the use of a scavenger for scavenging FUS mutants in the manufacture of a medicament for treating or preventing or alleviating ALS. As described above, the inventors of the present patent surprisingly found that a scavenger for scavenging FUS mutants can enhance the motor capacity, the number of motor neurons, and the motor learning capacity of an ALS mouse model. The scavenger is used for preparing a medicament, and the medicament can effectively treat or prevent or alleviate ALS.

According to an embodiment of the invention, the use may further comprise at least one of the following additional technical features.

According to some embodiments, the scavengers are used to eliminate FUS mutants by ubiquitination and proteasome mediated degradation. The medicaments disclosed herein may be more effective and safer in treating or preventing or alleviating ALS.

According to some embodiments, the scavenger is Trim72 or a nucleic acid encoding Trim 72. The inventors of the present patent surprisingly found that Trim72 can target FUS mutants for ubiquitination and proteasome-mediated degradation. Medicaments prepared with Trim72 or a nucleic acid encoding Trim72 may be more effective and safer in treating or preventing or alleviating ALS.

According to some embodiments, wherein the FUS mutant is a FUS mutant of human ALS. The medicaments disclosed herein are more suitable for use in humans.

According to some embodiments, wherein the FUS mutant has a mutation in the FUS nuclear localization signal. Alternatively, the amino acid position of the nuclear localization signal of FUS is 513-526 (NP-004951.1). Alternatively, wherein the FUS mutant is prone to localization in the cytoplasm. The FUS mutants disclosed herein are closely related to ALS and are critical pathogenic mutants. Medicaments prepared with scavengers for the clearance of the FUS mutants described above will be more effective for the treatment or prevention or alleviation of ALS.

According to some embodiments, the scavenger has at least one of the following forms: (a) a protein or functional fragment; (b) a nucleic acid molecule encoding (a); (c) a construct having (b). As described above, scavengers can be used to eliminate FUS mutants, such as Trim72, by ubiquitination and proteasome-mediated degradation. Trim72 or Trim72 functional fragments or nucleic acid molecules encoding Trim72 or functional fragments or constructs with the nucleic acid molecules for ubiquitination and proteasome mediated degradation of FUS mutants can be used as scavengers to effectively eliminate FUS mutants.

According to some embodiments, wherein the nucleic acid molecule comprises at least one of DNA and RNA. The form of the nucleic acid molecule is not particularly limited. According to some embodiments, the DNA or RNA has a double strand or single strand encoding a protein such as Trim72 or a functional fragment thereof, which may be effective as a scavenger of FUS mutants.

According to some embodiments, wherein the construct comprises at least one of a plasmid and a virus. The form of the construct is not particularly limited. So long as the construct can carry a nucleic acid molecule encoding a protein, such as Trim72, or a functional fragment thereof, and the protein, such as Trim72, or a functional fragment thereof, can be expressed in a suitable environment. According to some embodiments, the construct may be at least one of a plasmid and a virus.

According to some embodiments, the medicament further comprises a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier can alter the manner in which the drug enters and is distributed in the body, control the release rate of the drug, and deliver the drug to the target organ. The drugs disclosed herein may then be more effective in treating ALS.

According to some embodiments, the acceptable carrier is a drug, toxin, cytokine, radioactive element, carrier protein, enzyme, lectin, fluorescent quantum dot, or high absorption coefficient chromophore. The acceptable carriers disclosed above can alter the manner in which and distribution of the drug into the body, control the release rate of the drug, and more effectively deliver the drug to the target organ.

Embodiments of the third broad aspect of the present disclosure provide a method for treating or preventing or alleviating ALS, wherein the method comprises administering to a patient in need thereof a clearing agent for clearing FUS protein mutants. The inventors of this patent have surprisingly found that scavengers for the clearance of FUS mutants can increase strong motor capacity, the number of motor neurons and motor learning capacity. The clearance agent for clearance of FUS protein mutants is administered to a patient in need thereof, such as an ALS patient, and is effective in treating or ameliorating a disease or preventing recurrence.

According to an embodiment of the invention, the method may further comprise at least one of the following additional technical features.

According to some embodiments, the scavengers are used to eliminate FUS mutants by ubiquitination and proteasome mediated degradation. The method disclosed herein is safer and more effective.

According to some embodiments, the scavenger is Trim72 or a nucleic acid encoding Trim 72. The inventors of the present patent surprisingly found that Trim72 can target FUS mutants for ubiquitination and proteasome-mediated degradation. The methods disclosed herein are safer and more effective.

According to some embodiments, wherein the FUS mutant is a FUS mutant of human ALS. The methods disclosed herein are more suitable for use in humans.

According to some embodiments, wherein the FUS mutant has a mutation in the FUS nuclear localization signal. Alternatively, the amino acid position of the nuclear localization signal of FUS is 513-526 (NP-004951.1). Alternatively, wherein the FUS mutant is prone to localization in the cytoplasm. The FUS mutants disclosed herein are closely related to ALS and are key pathogenic mutants. Administration of a scavenger for scavenging the above-described FUS protein mutants to a patient in need thereof will be more effective in treating or preventing or alleviating ALS.

According to some embodiments, the scavenger has at least one of the following forms: (a) a protein or functional fragment; (b) a nucleic acid molecule encoding (a); (c) a construct having (b). As described above, scavengers can be used to eliminate FUS mutants, such as Trim72, by ubiquitination and proteasome-mediated degradation. Trim72 or Trim72 functional fragments or nucleic acid molecules encoding Trim72 or functional fragments or constructs with the nucleic acid molecules for ubiquitination and proteasome mediated degradation of FUS mutants can be used as scavengers to effectively eliminate FUS mutants.

According to some embodiments, wherein the nucleic acid molecule comprises at least one of DNA and RNA. The form of the nucleic acid molecule is not particularly limited. According to some embodiments, the DNA or RNA has a double strand or single strand encoding a protein such as Trim72 or a functional fragment thereof, which may be effective as a scavenger of FUS mutants.

According to some embodiments, wherein the construct comprises at least one of a plasmid and a virus. The structural form is not particularly limited. So long as the construct can carry a nucleic acid molecule encoding a protein, such as Trim72, or a functional fragment thereof, and the protein, such as Trim72, or a functional fragment thereof, can be expressed in a suitable environment. According to some embodiments, the construct may be at least one of a plasmid and a virus.

According to some embodiments, wherein the scavenger is provided in the form of a pharmaceutical composition, and the pharmaceutical composition further comprises a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier can alter the manner in which the drug enters and is distributed in the body, control the release rate of the drug, and deliver the drug to the target organ. The pharmaceutical compositions disclosed herein may then be more effective in treating ALS.

According to some embodiments, the acceptable carrier is a drug, toxin, cytokine, radioactive element, carrier protein, enzyme, lectin, fluorescent quantum dot, or high absorption coefficient chromophore. The acceptable carriers disclosed above can alter the manner in which and distribution of the drug into the body, control the release rate of the drug, and more effectively deliver the drug to the target organ.

The above summary of the present disclosure is not intended to describe each disclosed embodiment or every implementation of the present disclosure. The figures and the detailed description that follow more particularly exemplify illustrative embodiments.

Additional aspects and advantages of embodiments of the disclosure will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of embodiments of the disclosure.

Drawings

These and other aspects and advantages of the disclosed embodiments will become apparent and more readily appreciated from the following description of the embodiments with reference to the accompanying drawings, in which:

FIG. 1 shows that mFUS-R513C KI mutant mice for ALS were generated using CRISPR/Cas9,

Wherein,

A shows an alignment of the last 12 amino acids of FUS in different mammalian species. These amino acids are highly conserved from rodents to humans. NCBI accession number: homo sapiens (h.sapiens) (np_ 004951.1), bovine (b.taurus) (xp_ 005224884.1), norvegicus (np_ 001012137), and mice (m.musculus) (np_ 631888.1). The human FUS sequence was used as a reference for amino acid localization. R521 is marked with an asterisk.

B shows the mouse genome structure of the FUS gene. Mouse FUS R513 corresponds to human R521. Two nucleotide mutations marked in red were introduced into the FUS locus 2bp upstream of the mouse PAM site (dark 3 capital letters). The underlined genomic DNA sequence corresponds to the gRNA sequence. Placing a new PstI cleavage site in the locus for future genotyping;

C shows a DNA chromatogram;

D shows gel electrophoresis. The PCR product containing the insert was treated with PstI. +/+ represents wild type C57BL/6J mice, C/+ and C/C represent heterozygous and homozygous mFUS-R513 CKI mice; and

E shows the expression of FUS in various tissues of mice. Tissues from 8 month old wild-type (+/+) mice and mFUS-R513C KI mutant (C/C) mice were blotted with home-made FUS antibodies. GAPDH was used as a loading control. Hippocampus; s.c., spinal cord.

FIG. 2 shows that senescent mFUS-R513C mutant KI mice exhibit hypokinesia and reduced numbers of motor fibers,

Wherein,

A shows the distance travelled measured by open field (clever sys. Topscan behavioural analysis system in the united states) and demonstrates a significant decrease in distance travelled in aged heterozygous (C/+) and homozygous (C/C) KI mutant animals (6.5 months) but no decrease in young mutant animals (4 months of age). At 4 months of age, n=9 (+/- + and C/+) respectively, male. 6.5 months of age, n=25 (+/+), n=16 (C/+), n=12 (C/C), male. In the open field test, the standing time (seconds in 10 minute intervals) of the hind limbs of the aging mice (6.5 months of age) was calculated. This value is expressed as mean ± SEM. * p <0.05, < p <0.01 (single party differential analysis or t-test, SPSS). NS, no statistical significance;

B shows a significant reduction in standing time for heterozygous (C/+) and homozygous (C/C) KI mutant groups compared to the wild-type (+/+) group. Values are expressed as mean ± SEM. * p <0.05, < p <0.01 (single party differential analysis or t-test, SPSS). NS, no statistical significance;

C and D show the performance of wild-type (+/+) heterozygous (C/+) and/or homozygous (C/C) KI mutant mice at 4 months of age (C) and 6.5 months of age (D) in a turn bar experiment (4 day interval, us, med Associates inc.). In aged KI mutant (C/+ and C/C,6.5 month old) mice, the residence time on the rotating rod was significantly reduced, whereas in younger (4 month old) mutant animals was not. At 4 months of age, n=8 (+/- + and C/+) respectively, male. 6.5 months of age, n=25 (+/+), n=14 (C/+), n=15 (C/C), male. Values are expressed as mean ± SEM. * p <0.05, < p <0.01 (single party differential analysis or t-test, SPSS). NS, no statistical significance;

E shows toluidine blue stained cross sections of stock motor branches of 8 month old wild type (+/+) and KI mutant (C/C) animals. Axon degeneration (arrow) is shown in the high magnification image. The scale bar, the low magnification image was 50 μm and the high magnification image was 100 μm. The diameter of the red dot in the low magnification image was 5 μm, which was used to measure the fiber size. Values are expressed as mean ± SEM (n=3). * P <0.01 (t-test, SPSS);

And

F shows that the number of nerve fibers of the greater size (diameter. Gtoreq.5 μm) (rather than the smaller size (< 5 μm)) of the femoral ramuscule in KI mutant (C/C, 8 month old) animals was significantly reduced compared to wild type (+/+) littermate control animals. In (A, B, C and D), the values are expressed as mean ± SEM. * p <0.05, < p <0.01 (single-party differential analysis, SPSS). NS, no statistical significance; and

FIG. 3 shows Trim72 up-regulation of the E3 ligase encoding in mFUS-R513C KI spinal cord and degradation of the E3 ligase targeting FUS mutant.

Wherein,

A shows the identification of genes differentially expressed in spinal cord at 1.5 and 7 months of age by RNA-seq for wild-type and KI mutant (C/C) genotypes. Of the limited number of differentially expressed genes (7 genes for 1.5 months of age and 13 genes for 7 months of age), trim72 is the only differentially expressed gene at two time points;

b shows RPKM values (mean ± SEM) of the indicator gene at two age points between the plotted genotypes. N=3, male;

C shows the experimental strategy for detecting the interaction of Trim72 with the FUS mutant (hFUS-R521C). The upper layer is the Myc-BirA-Trim 72 inducible expression system. BirA, a previously reported biotin ligase (doi/10.1073/pnas.1406459111). Lower layer, experimental procedure;

D shows infection of HEK293 cells with Myc-BirA-Trim 72 expressing lentivirus. After administration of doxycycline (Dox), myc-BirA x-Trim 72 expression was induced and biotinylation of hFUS-R521C was detected by streptavidin M-280 beads. However, when MG132 was removed from the medium, the interaction was greatly diminished, indicating that Trim72 ubiquitinates ALS-related hFUS-R521C and leads to its degradation;

E and F show weaker interactions with Trim72 for the wild-type hFUS and hFUS truncations (. DELTA.513-526) than hFUS-R521C. Interactions were quantified by relative Flag intensities (band density ratio between biotinylated input and total input) from at least three independent experiments. Values are expressed as mean ± SEM. * P <0.01 (t-test, SPSS).

Detailed Description

Reference will be made in detail to embodiments of the present disclosure. The embodiments described herein with reference to the drawings are illustrative, exemplary, and are used for general understanding of the present disclosure. These embodiments should not be construed as limiting the present disclosure. Throughout the specification, identical or similar elements and elements having identical or similar functions are denoted by identical reference numerals.

In addition, terms such as "first" and "second" are used herein for descriptive purposes and are not intended to indicate or imply relative importance or importance.

Pharmaceutical composition

The present invention provides pharmaceutical compositions comprising a scavenger, wherein the scavenger is used to scavenge FUS mutants. According to particular embodiments of the present invention, the pharmaceutical composition may further comprise pharmaceutically acceptable excipients, carriers, adjuvants, solvents, and combinations thereof.

The present invention provides a method of treating, preventing or ameliorating a disease or disorder comprising administering a safe and effective amount of a pharmaceutical combination comprising a scavenger and one or more therapeutically active agents. Wherein the pharmaceutical combination comprises one or more other drugs for the treatment of ALS. Other drugs for the treatment of ALS are not limited to: riluzole or antisense oligonucleotide against FUS mutant RNA.

According to some embodiments, the scavenger has at least one of the following forms: (a) a protein or functional fragment; (b) a nucleic acid molecule encoding (a); (c) a construct having (b). AAV-mediated gene therapy is also included herein. Recently, AAV-mediated gene therapy has been used to deliver genes of interest for therapy. The following reasons make AAV-mediated gene therapy promising for delivery of the scavenger gene to patients: 1) AAV is markedly devoid of pathogenicity and also shows very low immunogenicity; 2) Unlike retroviruses, random integration of AAV DNA into the host genome occurs very infrequently; 3) For non-dividing cells such as neurons, AAV-based gene therapy vectors form episomal concatamers in the host cell nucleus, and these concatamers remain intact throughout the life of the host cell; 4) One limitation of AAV delivery is the clonality, which is limited to about 4.8kb for viral vectors. However, the human Trim72 recombinant protein is about 477a.a. (ENST 00000322122.7), and the DNA size for expressing the scavenger is suitable for AAV-mediated gene delivery. Thus, in view of these advantages, AAV-mediated gene therapy would be a viable method of delivering human Trim72 targets to patients. Single-stranded (ss) and self-complementary (sc) AAV9 are used to deliver DNA encoding SMN proteins to SMA patients. Thus, similar means would be used for scavengers. Furthermore, the amount of scavenger in the pharmaceutical compositions disclosed herein refers to an amount that is effective to scavenge the FUS mutant. The dosage of the active ingredient in the compositions of the present invention may vary, but the amount of active ingredient is required so that a suitable dosage form is obtained. The active ingredient may be administered to a patient (animal or human) in need of such treatment in a dosage that provides optimal pharmaceutical efficacy. The dosage selected will depend on the desired therapeutic effect, the route of administration and the duration of treatment. Dosages will vary from patient to patient depending on the nature and severity of the disease, the patient's weight, the patient's subsequent special diet, concomitant medication, and other factors that will be recognized by those skilled in the art. The dosage range for each patient per day is typically about 0.5mg to 1.0g, and can be administered in single or multiple doses. In one embodiment, the dosage range will be about 0.5mg to 500mg per patient per day; in another embodiment 0.5mg to 200mg per patient per day; and in yet another embodiment about 5mg to 50mg per patient per day.

The pharmaceutical compositions of the present invention may be prepared and packaged in bulk form, wherein a safe and effective amount of a compound of formula (I) disclosed herein may be extracted and then administered to a patient, for example, as a powder or syrup. Typically, a dosage level of 0.0001 to 10mg/kg body weight is administered to the patient daily to achieve effective clearance of the FUS mutant. The pharmaceutical compositions of the present invention may be prepared and packaged in unit dosage form, wherein each physically discrete unit contains a safe and effective amount of the scavenger disclosed herein. When prepared in unit dosage form, the pharmaceutical compositions of the present invention generally comprise from about 0.5mg to 1g, or 1mg to 700mg, or 5mg to 100mg of the compound.

When the pharmaceutical composition of the present invention further comprises one or more other active ingredients, the weight ratio of the compound of the present invention to the second active ingredient may vary in addition to the compound of the present invention and depends on the effective dose of each ingredient. Typically, an effective dose of each ingredient will be used. Thus, for example, when a compound of the present invention is combined with another agent, the weight ratio of the compound of the present invention to the other agent is typically in the range of about 1000:1 to about 1:1000, such as about 200:1 to 1:200. Combinations of the compounds of the invention and other active ingredients will also generally be within the above-mentioned ranges, but in each case an effective dose of each active ingredient should be used.

As used herein, "pharmaceutically acceptable excipients" refers to pharmaceutically acceptable materials, compositions, or vehicles that are relevant to imparting a form or consistency to a pharmaceutical composition. Each adjuvant, when mixed, needs to be compatible with the other ingredients of the pharmaceutical composition, thereby avoiding interactions that would greatly reduce the efficacy of the compounds of the invention and would result in a pharmaceutically unacceptable composition when administered to a patient. In addition, each excipient is of course required to be of sufficiently high purity to render it pharmaceutically acceptable.

Suitable pharmaceutically acceptable excipients will vary depending upon the particular dosage form selected. In addition, suitable pharmaceutically acceptable excipients may be selected for the particular function they may serve in the composition. For example, certain pharmaceutically acceptable excipients may be selected based on their ability to promote the production of a uniform dosage form. Certain pharmaceutically acceptable excipients may be selected based on their ability to promote the production of stable dosage forms. Certain pharmaceutically acceptable excipients may be selected based on their ability to facilitate the carrying or transporting of the compounds of the invention from one organ or body part to another once administered to a patient. Certain pharmaceutically acceptable excipients may be selected based on their ability to enhance patient compliance.

Suitable pharmaceutically acceptable excipients include the following types of excipients: diluents, fillers, binders, disintegrants, lubricants, glidants, granulating aids, coating agents, wetting aids, solvents, co-solvents, suspending aids, emulsifiers, sweeteners, flavoring agents, odor masking agents, colorants, anti-caking agents, humectants, chelating agents, plasticizers, tackifiers, antioxidants, preservatives, stabilizers, surfactants, and buffering aids. The skilled artisan will appreciate that certain pharmaceutically acceptable excipients may perform more than one function and may perform alternative functions, depending on how much of the excipient is present in the formulation and what other ingredients are present in the formulation.

The skilled artisan will have knowledge and skill in the art to enable them to select the appropriate amount of suitable pharmaceutically acceptable excipients for use in the present invention. In addition, a large number of resources describing pharmaceutically acceptable excipients and useful for selecting appropriate pharmaceutically acceptable excipients are available to those skilled in the art. Examples include the pharmaceutical science of ramington (Mack publishing company), the handbook of pharmaceutical additives (Gower publishing company) and the handbook of pharmaceutical excipients (american society of medicine and pharmaceutical publishing company).

In "leimington: pharmaceutical sciences and practices (21 st edition, 2005, d.b. troll edition, litscott, willi, wilkins publishing company, philadelphia) and pharmaceutical encyclopedia of pharmaceutical technology (j.swarbrick and j.c. boylan edition, 1988-1999, marzier, dekk, new york), each of which is incorporated herein by reference, disclose various carriers for formulating pharmaceutically acceptable compositions and known techniques for their preparation. Unless any conventional vehicle carrier is incompatible with the compounds of the present invention, such as by producing any undesirable biological effect or interacting in a deleterious manner with any of the other components of the pharmaceutically acceptable composition, its use is contemplated as being within the scope of the present invention.

The pharmaceutical compositions of the present invention are prepared using techniques and methods known to those skilled in the art. Some methods commonly used in the art are described in the pharmaceutical sciences of ramington (Mack publishing company).

Thus, another aspect of the invention relates to a method for preparing a pharmaceutical composition. The pharmaceutical composition comprises a compound disclosed herein and a pharmaceutically acceptable adjuvant, carrier, adjuvant, vehicle, or combination thereof, which method comprises mixing the various ingredients. Pharmaceutical compositions comprising the compounds disclosed herein may be prepared, for example, at ambient temperature and atmospheric pressure.

The compounds of the present invention are typically formulated into dosage forms suitable for administration to a patient by the desired route of administration. For example, dosage forms include those suitable for: (1) Oral administration, such as tablets, capsules, caplets, pills, troches, powders, syrups, elixirs, suspensions, solutions, emulsions, sachets and cachets; (2) Parenteral administration, such as sterile solutions, suspensions, and powders to be redissolved; (3) transdermal administration, such as transdermal patches; (4) rectal administration, such as suppositories; (5) inhalations, such as aerosols, solutions and dry powders; and (6) topical administration, such as creams, ointments, lotions, solutions, pastes, sprays, foams and gels.

In one embodiment, the compounds disclosed herein may be prepared for oral administration. In another embodiment, the compounds disclosed herein may be prepared for inhalation. In yet another embodiment, the compounds disclosed herein may be prepared for nasal administration. In yet another embodiment, the compounds disclosed herein may be prepared for transdermal administration. In yet another embodiment, the compounds disclosed herein may be prepared for topical administration.

The pharmaceutical compositions provided herein may be provided as compressed tablets, ground tablets, chewable lozenges, fast-dissolving tablets, multi-compressed tablets or enteric-coated tablets, sugar-coated tablets or film-coated tablets. Enteric coated tablets are compressed tablets coated with a substance that resists the action of gastric acid but dissolves or disintegrates in the intestinal tract, thereby protecting the active ingredient from the acidic environment of the stomach. Enteric coatings include, but are not limited to, fatty acids, fats, phenyl salicylate, waxes, shellac, ammoniated shellac, and cellulose acetate phthalate. Sugar coated tablets are compressed tablets surrounded by a sugar coating, which can be beneficial in masking unpleasant tastes or odors and protecting the tablet from oxidation. Film coated tablets are compressed tablets covered with a thin layer or film of water-soluble material. Film coatings include, but are not limited to, hydroxyethyl cellulose, sodium carboxymethyl cellulose, polyethylene glycol 4000, and cellulose acetate phthalate. Film coatings impart the same general characteristics as sugar coatings. Multiple compressed tablets are compressed tablets made by more than one compression cycle, including layered tablets, press coated tablets, or dry coated tablets.

Tablet dosage forms may be prepared from the active ingredient alone or in combination with one or more carriers or excipients described herein, including binders, disintegrants, controlled release polymers, lubricants, diluents and/or colorants, in powdered, crystalline or granular form. Flavoring agents and sweeteners are particularly useful for the formation of chewable tablets and lozenges.

The pharmaceutical compositions provided herein may be provided as soft or hard capsules, which may be prepared from gelatin, methylcellulose, starch, or calcium alginate. Hard gelatin capsules, also known as Dry Filled Capsules (DFCs), are composed of two parts, one sliding over the other, thereby completely enclosing the active ingredient. Soft Elastic Capsules (SEC) have a soft spherical shell, such as a gelatin shell, plasticized by the addition of glycerol, sorbitol or similar polyols. The gelatin soft shell may contain a preservative to prevent the growth of microorganisms. Suitable preservatives are those as described herein, including methyl and propyl parahydroxybenzoates and sorbic acid. Liquid, semi-solid and solid dosage forms provided herein may be encapsulated in capsules. Suitable liquid and semi-solid dosage forms include solutions and suspensions in propylene carbonate, vegetable oils or triglycerides. Capsules containing such solutions may be prepared as described in U.S. patent No. 4,328,245;4,409,239; and 4,410,545. As known to those skilled in the art, capsules may also be coated in order to alter or maintain dissolution of the active ingredient.

The pharmaceutical compositions provided herein may be provided in liquid and semi-solid dosage forms, including emulsions, solutions, suspensions, elixirs and syrups. Emulsions are two-phase systems in which one liquid is dispersed in the form of pellets in another liquid, which may be oil-in-water or water-in-oil. The emulsion may comprise a pharmaceutically acceptable non-aqueous liquid or solvent, an emulsifier and a preservative. The suspension may comprise pharmaceutically acceptable suspension aids and preservatives. The hydroalcoholic solution may comprise a pharmaceutically acceptable acetal, such as a di (lower alkyl) acetal of a lower alkyl aldehyde, for example acetaldehyde diethyl acetal; and water miscible solvents having one or more hydroxyl groups (e.g., propylene glycol and ethanol). Elixirs are clear, sweet aqueous alcoholic solutions. Syrups are concentrated aqueous solutions of a sugar, for example sucrose, and may also contain a preservative. For liquid dosage forms, for example, solutions in polyethylene glycol may be diluted with a sufficient amount of a pharmaceutically acceptable liquid carrier such as water to facilitate measurement for administration.

Other useful liquid and semi-solid dosage forms include, but are not limited to, those containing one or more of the active ingredients provided herein and dialkylated mono-or polyalkylene glycols, including 1, 2-dimethoxymethane, diglyme, triglyme, tetraglyme, polyethylene glycol-350-dimethyl ether, polyethylene glycol-550-dimethyl ether, polyethylene glycol-750-dimethyl ether, wherein 350, 550 and 750 refer to the approximate average molecular weight of polyethylene glycol. These formulations may further comprise one or more antioxidants such as Butylated Hydroxytoluene (BHT), butylated Hydroxyanisole (BHA), propyl gallate, vitamin E, hydroquinone, hydroxycoumarins, ethanolamine, lecithin, cephalin, ascorbic acid, malic acid, sorbitol, phosphoric acid, bisulphite, sodium metabisulphite, thiodipropionic acid and esters thereof, and dithiocarbamates.

Dosage unit formulations for oral administration may be microencapsulated, as appropriate. The formulation may also be prepared to prolong or sustain release, for example, by coating or embedding the particulate material in a polymer, wax, or the like.

The pharmaceutical compositions provided herein for oral administration may also be provided in the form of liposomes, micelles, microspheres or nanosystems. Micelle dosage forms may be prepared as described in U.S. Pat. No. 6,350,458.

The pharmaceutical compositions provided herein may be provided as non-effervescent or effervescent granules and powders to be redissolved in a liquid dosage form. Pharmaceutically acceptable carriers and excipients used in non-effervescent granules or powders may include diluents, sweeteners and wetting aids. Pharmaceutically acceptable carriers and excipients used in effervescent granules or powders may include organic acids and carbon dioxide sources.

Colorants and flavoring agents may be used in all of the above dosage forms.

The scavengers disclosed herein can also be coupled to soluble polymers as drug targeting carriers. Such polymers may include polyvinylpyrrolidone substituted with palmitoyl groups, pyran copolymers, polyhydroxypropyl methacrylamidophenol, polyhydroxyethyl asparagimidophenol or polyethylene oxide polylysine. The compounds may also be coupled to a class of biodegradable polymers suitable for achieving controlled release of the drug, such as polylactic acid, poly-epsilon-caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydroxypyrans, polycyanoacrylates and cross-linked or amphiphilic block copolymers of hydrogels.

The pharmaceutical compositions provided herein can be formulated in immediate or modified release dosage forms including delayed release forms, sustained release forms, pulsatile release forms, controlled release forms, targeted release forms and programmed release forms.

The pharmaceutical compositions provided herein may be formulated with other active ingredients that do not impair the desired therapeutic effect or with substances that supplement the desired effect.

The pharmaceutical compositions provided herein may be administered parenterally for local or systemic administration by injection, infusion or implantation. Parenteral administration, as used herein, includes intravenous, intra-arterial, intraperitoneal, intrathecal, intraventricular, intraurethral, intrasternal, intracranial, intramuscular, intrasynovial, and subcutaneous administration.

The pharmaceutical compositions provided herein may be formulated in any dosage form suitable for parenteral administration, including solutions, suspensions, emulsions, micelles, liposomes, microspheres, nanosystems, and solid forms suitable for liquid solutions or suspensions prior to injection. Such dosage forms may be prepared according to conventional methods known to those skilled in the art of pharmacy (see, e.g., lemmington, pharmaceutical sciences and practice, supra).

Pharmaceutical compositions intended for parenteral administration may comprise one or more pharmaceutically acceptable carriers and excipients including, but not limited to, aqueous vehicles, water miscible vehicles, non-aqueous vehicles, antimicrobial agents or preservatives that prevent microbial growth, stabilizers, solubility enhancers, isotonic agents, buffering aids, antioxidants, local anesthetics, suspending and dispersing aids, wetting aids or emulsifiers, complexing agents, sequestering or chelating agents, cryoprotectants, lyoprotectants, thickening agents, pH adjusting agents, and inert gases.

Suitable aqueous vehicles include, but are not limited to, water, saline, physiological saline or Phosphate Buffered Saline (PBS), sodium chloride injection, ringer's injection, isotonic dextrose injection, sterile water injection, dextrose and lactate ringer's injection. Non-aqueous vehicles include, but are not limited to, fixed oils of vegetable origin, castor oil, corn oil, cottonseed oil, olive oil, peanut oil, peppermint oil, safflower oil, sesame oil, soybean oil, hydrogenated vegetable oil, hydrogenated soybean oil, medium chain triglycerides of coconut oil and palm seed oil. Water miscible vehicles include, but are not limited to, ethanol, 1, 3-butanediol, liquid polyethylene glycols (e.g., polyethylene glycol 300 and polyethylene glycol 400), propylene glycol, glycerol, N-methyl-2-pyrrolidone, N-dimethylacetamide, and dimethylsulfoxide.

Suitable antimicrobial agents or preservatives include, but are not limited to, phenol, cresol, mercuric agents, benzyl alcohol, chlorobutanol, methyl and propyl parahydroxybenzoates (METHYL AND propyl p-hydroxybenzoates), thimerosal, benzalkonium chloride (e.g., benzethonium chloride), methyl and propyl parahydroxybenzoates (methyl-and propyl-parambens), and sorbic acid. Suitable isotonic agents include, but are not limited to, sodium chloride, glycerol, and dextrose. Suitable buffering aids include, but are not limited to, phosphates and citrates. Suitable antioxidants are those described herein, including bisulfites and sodium metabisulfites. Suitable local anesthetics include, but are not limited to procaine hydrochloride. Suitable suspending and dispersing aids are those described herein, including sodium carboxymethyl cellulose, hydroxypropyl methylcellulose, and polyvinylpyrrolidone. Suitable emulsifiers include those described herein, including polyoxyethylene sorbitol monolaurate, polyoxyethylene sorbitol monooleate 80, and triethanolamine oleate. Suitable sequestering or chelating agents include, but are not limited to, EDTA. Suitable pH adjusting agents include, but are not limited to, sodium hydroxide, hydrochloric acid, citric acid, and lactic acid. Suitable complexing agents include, but are not limited to, cyclodextrins including alpha-cyclodextrin, beta-cyclodextrin, hydroxypropyl-beta-cyclodextrin, sulfobutyl ether-beta-cyclodextrin, and sulfobutyl ether 7-beta-cyclodextrinCyDex，Lenexa，Kans)。

The pharmaceutical compositions provided herein may be formulated for single or multi-dose administration. The single dose formulation is packaged in an ampoule, vial or syringe. Multiple doses of parenteral formulations are required to contain antimicrobial agents at concentrations that inhibit bacteria or inhibit fungi. As known and practiced in the art, all parenteral formulations need to be sterile.

In one embodiment, the pharmaceutical composition is provided as a ready-to-use sterile solution. In another embodiment, the pharmaceutical composition is provided as a sterile, dry soluble product, including lyophilized powders and subcutaneous injection tablets that are reconstituted with a vehicle prior to use. In yet another embodiment, the pharmaceutical composition is provided as a ready-to-use sterile suspension. In another embodiment, the pharmaceutical composition is provided as a sterile dry insoluble product that is reconstituted with a vehicle prior to use. In another embodiment, the pharmaceutical composition is provided as a sterile ready-to-use emulsion.

The pharmaceutical compositions may be formulated as suspensions, solids, semi-solids, or thixotropic liquids for administration as an implanted reservoir. In one embodiment, the pharmaceutical compositions provided herein are dispersed in a solid inner matrix surrounded by an outer polymeric film that is insoluble in body fluids but allows the active ingredient in the pharmaceutical composition to diffuse through.

Suitable internal matrices include polymethyl methacrylate, polybutyl methacrylate, plasticized or unplasticized polyvinyl chloride, plasticized nylon, plasticized polyethylene terephthalate, natural rubber, polyisoprene, polyisobutylene, polybutadiene, polyethylene, ethylene-vinyl acetate copolymers, silicone rubber, polydimethylsiloxane, silicone carbonate copolymers, hydrophilic polymers (such as esters of acrylic and methacrylic acid, collagen, crosslinked polyvinyl alcohol, and crosslinked hydrogels of partially hydrolyzed polyvinyl acetate).

Suitable outer polymeric films include polyethylene, polypropylene, ethylene/propylene copolymers, ethylene/ethyl acrylate copolymers, ethylene/vinyl acetate copolymers, silicone rubbers, polydimethylsiloxanes, neoprene, chlorinated polyethylene, polyvinyl chloride, copolymers of vinyl chloride and vinyl acetate, vinylidene chloride, ethylene and propylene, ionomeric polyethylene terephthalate, butyl rubber epichlorohydrin rubber, ethylene/vinyl alcohol copolymers, ethylene/vinyl acetate/vinyl alcohol terpolymers, and ethylene/ethyleneoxy ethanol copolymers.

In another aspect, the pharmaceutical compositions of the invention are prepared in a dosage form suitable for administration to a patient by inhalation, for example as a dry powder, aerosol, suspension or solution composition. In one embodiment, the present invention relates to a dosage form suitable for administration to a patient by inhalation as a dry powder. In one embodiment, the present invention relates to a dosage form suitable for administration to a patient by inhalation as a dry powder. Dry powder compositions for delivery to the lungs by inhalation typically comprise a compound disclosed herein or a pharmaceutically acceptable salt thereof as a finely divided powder and one or more pharmaceutically acceptable excipients as a finely divided powder. Pharmaceutically acceptable excipients particularly suitable for use as dry powders are known to those skilled in the art and include lactose, starch, mannitol, and monosaccharides, disaccharides, and polysaccharides. Finely divided powders can be prepared, for example, by micronization and grinding. In general, reduced-size (e.g., micronized) compounds may be defined by a D50 value of about 1 micron to about 10 microns (e.g., as measured using laser diffraction).

Aerosols may be formed by suspending or dissolving a compound disclosed herein, or a pharmaceutically acceptable salt thereof, in a liquefied propellant. Suitable propellants include halogenated hydrocarbons, hydrocarbons and other liquefied gases. Representative propellants include: trichlorofluoromethane (propellant 11), dichlorofluoromethane (propellant 12), dichlorotetrafluoroethane (propellant 114), tetrafluoroethane (HFA-134 a), 1-difluoroethane (HFA-152 a), difluoromethane (HFA-32), pentafluoroethane (HFA-12), heptafluoropropane (HFA-227 a), perfluoropropane, perfluorobutane, perfluoropentane, butane, isobutane and pentane. An aerosol formulation comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof will typically be administered to a patient via a Metered Dose Inhaler (MDI). Such devices are known to those skilled in the art.

The aerosol formulation may contain additional pharmaceutically acceptable excipients (such as surfactants, lubricants, co-solvents and other excipients) commonly used with MDI to improve the physical stability of the formulation, improve valve performance, improve solubility or improve taste.

Pharmaceutical compositions suitable for transdermal administration may be presented as discrete patches intended to remain in intimate contact with the patient's epidermis for an extended period of time. For example, the active ingredient may be delivered from the patch by iontophoresis as generally described in Pharmaceutical Research,3 (6), 318 (1986).

Pharmaceutical compositions suitable for topical administration may be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols or oils. Ointments, creams and gels may, for example, be formulated with an aqueous or oily base with the addition of appropriate thickening and/or gelling agents and/or solvents. Thus, such a matrix may for example comprise water and/or an oil, such as liquid paraffin or a vegetable oil (e.g. peanut oil or castor oil) or a solvent (e.g. polyethylene glycol). Thickening and gelling agents that may be used depending on the nature of the matrix include soft paraffin, aluminum stearate, stearyl alcohol, polyethylene glycol, lanolin, beeswax, carboxypolymethylene and cellulose derivatives, and/or glyceryl monostearate and/or nonionic emulsifiers.

Lotions may be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents, stabilizing agents, dispersing aids, suspending agents, or thickening agents.

The powder for external application may be formed by means of any suitable powder matrix, such as talc, lactose or starch. Drops may be formulated with an aqueous or non-aqueous base further comprising one or more dispersing aids, solubilizers, suspending agents or preservatives.

The topical formulation may be applied to the affected area by one or more administrations per day; on the skin area, occlusive dressings may be advantageously used. Continuous or prolonged delivery may be achieved by an adhesive reservoir system.

In one embodiment, the therapies disclosed herein comprise administering to a patient in need thereof a safe and effective amount of a compound or pharmaceutical composition comprising a scavenger for scavenging FUS mutants. Each example disclosed herein includes a method of treating the above-described diseases comprising administering to a patient in need thereof a safe and effective amount of an inhibitor compound or a pharmaceutical composition comprising the inhibitor compound.

In one embodiment, the pharmaceutical compositions thereof may be administered by any suitable route of administration, including both systemic and topical administration. Systemic administration includes oral, parenteral, transdermal and rectal administration. Parenteral administration refers to routes of administration other than enteral or transdermal, and is typically performed by injection or infusion. Parenteral administration includes intravenous, intramuscular, and subcutaneous injections or infusions. Topical administration includes application to the skin, intraocular, otic, intravaginal, inhalation, and intranasal administration. In one embodiment, the compounds of the present invention or pharmaceutical compositions thereof may be administered orally. In another embodiment, the compounds of the present invention or pharmaceutical compositions thereof may be administered by inhalation. In another embodiment, the compounds of the present invention or pharmaceutical compositions thereof may be administered intranasally.

In one embodiment, the pharmaceutical composition thereof may be administered once or according to a dosage regimen, wherein some dosages are administered at different time intervals over a given period of time. For example, the dose may be administered once, twice, three times or four times per day. In one embodiment, the dose is administered once a day. In another embodiment, the dose is administered twice daily. The dose may be administered until the desired therapeutic effect is achieved or indefinitely to maintain the desired therapeutic effect. Suitable dosage regimens for the compounds of the invention or pharmaceutical compositions thereof depend on the pharmacokinetic properties of the compound, such as absorption, distribution and half-life, which can be determined by the skilled artisan. In addition, for a compound of the invention or a pharmaceutical composition thereof, the appropriate dosage regimen (including the duration of administration of the regimen) will depend on the condition being treated, the severity of the condition being treated, the age and physical condition of the patient being treated, the medical history of the patient being treated, the nature of concurrent therapy, the desired therapeutic effect, and like factors within the knowledge and expertise of the skilled artisan. These skilled artisans will further appreciate that appropriate dosage regimens may need to be adjusted in view of the individual patient's response to a dosage regimen or over time due to changes in the individual patient's needs.

The pharmaceutical compositions of the present invention may be administered simultaneously with or before or after one or more other therapeutic agents. The compounds of the invention may be administered separately by the same or different route of administration as the other therapeutic agent, or in the same pharmaceutical composition as the other therapeutic agent.

The pharmaceutical compositions or combinations of the invention may be administered to a subject of about 50-70kg, preferably about 1-500mg or about 1-250mg or about 1-150mg or about 0.5-100mg or about 1-50mg of the active ingredient in unit doses of about 1-1000mg of the active ingredient. The therapeutically effective dose of a compound, pharmaceutical composition, or combination thereof depends on the type of subject, the weight, age, and individual condition, the condition or disease being treated, or the severity thereof. A physician, clinician or veterinarian of ordinary skill can readily determine the effective amount of each of the active ingredients required to prevent, treat or inhibit the progress of the condition or disorder.

The above dose characteristics can be advantageously demonstrated in vitro and in vivo tests using mammals (e.g., mice, rats, dogs, monkeys) or isolated organs, tissues and preparations thereof. The compounds of the invention may be applied in the form of solutions (e.g. preferably as aqueous solutions) in vitro and enterally or parenterally (advantageously intravenously, e.g. in the form of suspensions or aqueous solutions) in vivo.

In one embodiment, a therapeutically effective dose of the pharmaceutical composition disclosed herein is from about 0.1mg to about 2,000mg per day. The pharmaceutical composition should provide a dose of the compound of about 0.1mg to about 2000 mg. In a particular embodiment, the dosage unit form of the medicament is prepared to provide from about 1mg to about 2,000mg, from about 10mg to about 1,000mg, from about 20mg to about 500mg, or from about 25mg to about 250mg of the active ingredient or combination of essential ingredients per dosage unit form. In a particular embodiment, the dosage unit form of the medicament is prepared to provide about 10mg, 20mg, 25mg, 50mg, 100mg, 250mg, 500mg, 1000mg or 2000mg of the active ingredient.

Use of scavengers for the clearance of FUS mutants

Embodiments of the second broad aspect of the present disclosure provide the use of a scavenger for scavenging FUS mutants in the manufacture of a medicament for treating or preventing or alleviating ALS. The inventors of this patent surprisingly found that scavengers used to eliminate FUS mutants can enhance motor capacity, the number of motor neurons, and motor learning capacity of the ALS mouse model. The scavenger is used for preparing a medicament, and the medicament can effectively treat or prevent or alleviate ALS.

Methods for treating or preventing or alleviating ALS

Embodiments of the third broad aspect of the present disclosure provide methods for treating or preventing or alleviating ALS, wherein the methods comprise administering to a patient in need thereof a clearing agent for clearing FUS protein mutants. The inventors of the present patent have surprisingly found that scavengers for the clearance of FUS mutants can enhance motor capacity, the number of motor neurons and motor learning capacity. A scavenger for scavenging FUS protein mutants is administered to a patient in need thereof (e.g., an ALS patient) and is effective in treating or ameliorating a disease or preventing relapse.

As used herein, the terms "administering (administration of)" and "administering (ADMINISTERING A)" a scavenger should be understood to mean providing the scavenger to an individual in need thereof. It is recognized that one of skill in the art may treat a patient currently suffering from ALS disease with an effective amount of a scavenger for scavenging FUS mutants.

The following examples are provided so that the invention may be more fully understood. However, it should be understood that these embodiments merely provide a method of practicing the invention and that the invention is not limited to these embodiments.

The related method is described as follows:

materials and methods:

Mouse and mouse behavior test

To generate FUS-R513C KI mouse strains, we PCR amplified the target sequence in the C57BL/6J (JAX, stock number 000664) mouse genomic DNA. The donor DNA fragment contains the R513C mutation (tcg to ctg) and the left and right homology arms (about 1 kb) on either side thereof. Donor DNA, gRNA (position GCGAGCACAGACAGGATCGCAGG, PAM shown in uppercase) and Cas9 mRNA were injected into C57BL/6J embryos. The injected embryos were transferred to the ampulla of a pseudopregnant ICR (JAX, stock No. 009122) female recipient. The correct genotype offspring were backcrossed with C57BL/6J for at least five generations to establish the line.

For open field behavioral testing, a single animal was placed in the center of an open field area (60 cm x 60 cm) and tracked by TopScan behavioral analysis system (clever sys., usa) at 10 minute intervals using a number of parameters including total distance, average speed and distance traveled in the center area. The turnbar performance was measured by an automated system (Med Associates, inc). Briefly, animals were placed on an accelerating spindle (4-40 rpm) for 5 minutes per test and 3 consecutive tests per day. A rest time of 20 minutes was set between each trial. The test was repeated for four days. When the mice were dropped from the spindle within 5 minute intervals, the system automatically calculated the time of drop from the spindle. The residence time was calculated by subtracting the drop time from 5 minutes and the average of the residence times of 3 consecutive trials per day was used for statistical analysis.

Since 2014, animal facilities at the university of bloom have obtained comprehensive certification by the international laboratory animal protection assessment and authentication association (AAALAC). All animal protocols were approved by the university of sublimating animal protection and use committee (IACUC) according to the guidelines for laboratory animal protection and use (eighth edition, NHR). C57BL/6J and ICR mice were purchased from Charles river Laboratories (CHARLES RIVER Laboratories) in Beijing, china.

Stock nerve anatomy and axon count

Stock dissection was performed as described previously. Prior to dissection, the femoral nerves in the sacrificed mice were exposed and transiently fixed (0.1M arsonate buffer containing 2% glutaraldehyde/2% paraformaldehyde). The isolated nerves were fixed overnight in the same fixative. The dissected nerves were plastic embedded and observed by transmission electron microscopy by standard procedures. Nerve sections were stained with toluidine blue and examined by light microscopy.

RNA sequencing and differential expression Gene identification

Total RNA from spinal cord was extracted using TRIzol (Invitrogen) and cDNA library preparations for high throughput sequencing (Illumina HiSeq 2500) were prepared as described in the handbook (NEBNEXt Ultra). Reads were aligned with the mouse reference genome mm10 using HISAT2 and known splice sites from the Ensembl database were used as parameters. The differentially expressed gene was designated DESeq2.

Protein-protein interactions

For protein-protein interactions, the previous lentivirus-based induction system (Addgene, # 50661) was modified for the induction of Myc-BirA x-mTrim expression via doxycycline in HEK293 cells. Following blasticidin (Sigma) selection, infected cells were transiently transfected with plasmids expressing human wild-type FUS, FUS-R521C and truncated FUS 513-526 (pCMV-3 Tag, stratagene). Doxycycline (1 μg/ml, sigma) was added to the cells 8 hours after transfection to induce Myc-BirA x-mTrim expression. To prevent protein degradation we added MG132 (20 μm, selleck) to the cells 24 hours after transfection and harvested the cells after 8 hours for purification of biotinylated protein (streptavidin Dynabead M-280, invitrogen). After washing, the IP or immobilized product was probed with anti-Flag antibodies (mouse abmart, china) or anti-Myc antibodies (mouse abmart, china).

Examples

In the past, great efforts have been made to generate animal models for ALS by over-expressing recombinant DNA carrying mutants found in the ALS family. While these transgenic animal models greatly increase our understanding of the disease mechanism, one might argue for potential artifacts caused by ectopic overexpression of muteins in disease models, such as 40-fold overexpression of human SOD1-G93a in mice (a popular ALS mouse model). Similar transgenic strategies were applied to generate the TDP-43 model and the FUS ALS model. However, overexpression of wild-type TDP-43 and FUS also produced a motor phenotype similar to the mutant transgenes in many animal species (including drosophila, mice and rats), suggesting a potential artifact for pathogenesis in these models. In addition, other warnings exist for transgene strategies including indeterminate genomic insertion sites, unstable copy numbers, potential disruption of genomic integrity, ectopic expression patterns driven by exogenous promoters, and lack of endogenous splice regulation.

To avoid these warnings, the inventors employed CRISPR-Cas9 based knock-in (KI) methods. There are three reasons why we selected FUS-R521C to generate the KI ALS mouse model. First, the R521C mutation is located at the C-terminus of FUS, a non-classical Nuclear Localization Signal (NLS) of PY, in which more than half of the ALS-related FUS mutations are accumulated. Among these mutants, R521C is the most common mutation and accounts for 30% of the total. Second, the R521C mutation has been found in both familial and sporadic ALS patients with high disease penetration. Third, the FUS R521C transgenic mice and rat models exhibited strong ALS-like pathology.

To generate KI mouse strains, the inventors first analyzed the conservation of FUS protein among species (fig. 1A). The last exon of mouse FUS encodes the same C-terminal NLS as human (515 GEHRQDRRERPY 526). For human R521, the mouse corresponding position is R513. Downstream of the mouse R513 triplet codon, a PAM site recognizing Cas9 appears (fig. 1B). Correct genomic insertion and germ line transmission was confirmed by breeding with C57BL/6J wild-type mice and KI-created mice (fig. 1C and 1D). Meanwhile, the inventors backcrossed KI mutant mice with C57BL/6J for at least 5 generations in order to reduce the potential off-target effects caused by CRISPR/Cas9 introduction. Using the FUS antibody, the inventors observed that the expression level of mutant FUS was slightly up-regulated in the spinal cord (fig. 1E), although the mRNA level of mutant FUS was comparable to wild-type (data not shown), suggesting that the R513C mutation may increase protein stability and/or decrease turnover rate in target tissue.

Unlike the early onset dyskinesia and death found in wild-type and mutant FUS transgenic mice previously reported, the inventors failed to observe degenerative paralysis and shortened longevity in our aging KI animals (data not shown). However, in the 4 month old fuski heterozygous population, a slight decrease in spontaneous locomotor ability was detected by open field test, and a marked decrease in locomotor activity was recorded in both 6.5 month old heterozygous and homozygous mutant mice (fig. 2A). The reduced exercise capacity was further confirmed by the performance of the mutant group on the rotating bars. Although the residence time on the rotating rod was slightly reduced by the 4 month old fuski heterozygote group (fig. 2B), by 6.5 months old both heterozygous and homozygous mutant mice showed a further reduction in residence time on the rotating rod, particularly at days 2 and 3 (fig. 2C) compared to wild type littermates.

Reduced motor axons further reflect decreased motor ability in aging KI mice. At 8 months of age, degenerative motor axons of the femoral nerve were observed in homozygous KI mutant animals (fig. 2D). By counting the number of axons, the inventors found that the number of large diameter fibers (. Gtoreq.5 μm) and the number of small diameter fibers (. Gtoreq.5 μm) were significantly reduced in homozygous KI mutant mice (FIGS. 2D and 2E), indicating that fibers with high conduction rates were affected to a large extent by mutant FUS expression.

To further elucidate the disease mechanism, the inventors isolated mRNA from the spinal cord of wild-type mice and FUS-R513C KI mice at two different age points (1.5 month old and 7 month old) and applied to RNA sequencing. Surprisingly, of some of the differentially expressed genes of both genotypes, only Trim72 encoding E3 ligase was greatly up-regulated in the mutant spinal cord at both age points (fig. 3A and 3B). To investigate the function of Trim72 up-regulation in mutant FUS spinal cord, the inventors expressed Trim72 in heterologous systems as well as human wild-type and mutant FUS (fig. 3C). Surprisingly, trim72 preferentially interacted with FUS-R521C compared to wild-type FUS, but interacted very little with the FUS truncated form (Δ513-526) lacking the Nuclear Localization Signal (NLS), indicating that FUS's NLS are required for interaction (fig. 3C and 3D). Considering the localization of expressed Trim72 in the cytoplasm (fig. 3E), it is possible that Trim72 targets mislocalized FUS for ubiquitination and proteasome-mediated degradation. Indeed, the interaction between Trim72 and FUS-R521C was sensitive to the proteasome inhibitor MG132 (fig. 3F).

Throughout this specification, references to "one embodiment," "an embodiment," "some embodiments," "some embodiments," one embodiment, "another example," "one example," "an example," "a particular example," "A SPECIFIC example," "some examples," "some examples,", are intended to mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or examples is included in at least one implementation or example of the present disclosure. Thus, appearances of the phrases such as "in some embodiments (in some embodiments,)", "in one embodiment (in one embodiment)", "in one embodiment (in an embodiment)", "in another embodiment (in another example,)" "in one embodiment (in an example,)", "in a particular embodiment (IN A SPECIFIC example,)" or "in some embodiments (in some examples,)" in various places throughout this specification are not necessarily all referring to the same implementations or embodiments of the present disclosure. Furthermore, the particular features, structures, materials, or characteristics may be combined in any suitable manner in one or more implementations or embodiments.

Although illustrative embodiments have been shown and described, it will be understood by those skilled in the art that the above embodiments are not to be construed as limiting the present disclosure and that changes, substitutions and modifications may be made to the embodiments without departing from the spirit, principles and scope of the disclosure.

Claims (9)

1. Use of trim72 in the manufacture of a medicament for treating or preventing or alleviating ALS.
2. 2. The use of claim 1, wherein the TRIM72 has at least one of the following forms:

   (a) A protein or functionally active fragment thereof;

   (b) A nucleic acid molecule encoding (a); and

   (C) A construct having (b).
3. 3. The use of claim 2, wherein the nucleic acid molecule comprises at least one of DNA and RNA.
4. 4. The use of claim 2, wherein the construct comprises at least one of a plasmid and a virus.
5. 5. Use of a pharmaceutical composition in the manufacture of a medicament for treating or preventing or alleviating ALS, wherein the pharmaceutical composition comprises one or more selected from the group consisting of:

   (1) TRIM72 protein or a functionally active fragment thereof;

   (2) A nucleic acid molecule encoding a TRIM72 protein or a functionally active fragment thereof; and

   (3) A construct having the formula (2).
6. 6. The use of claim 5, wherein the nucleic acid molecule comprises at least one of DNA and RNA.
7. 7. The use of claim 5, wherein the construct comprises at least one of a plasmid and a virus.
8. 8. The use of claim 5, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
9. 9. The use of claim 8, wherein the pharmaceutically acceptable carrier is a drug, toxin, cytokine, radioactive element, carrier protein, enzyme, lectin, fluorescent quantum dot, or high absorption coefficient chromophore.