CN117980480A

CN117980480A - Engineered guide RNAs and polynucleotides

Info

Publication number: CN117980480A
Application number: CN202280058179.9A
Authority: CN
Inventors: 理查德·托马斯·沙利文; 布赖恩·约翰·布斯; 阿德里安·布里格斯; 扬尼斯·萨瓦
Original assignee: Shape Therapy Co
Current assignee: Shape Therapy Co
Priority date: 2021-06-29
Filing date: 2022-06-28
Publication date: 2024-05-03

Abstract

Disclosed herein are engineered guide RNAs for use in treating a disease or disorder in a subject, and compositions comprising the same. Also disclosed herein are methods of treating a disease or disorder in a subject by administering the engineered guide RNAs or pharmaceutical compositions described herein.

Description

Engineered guide RNAs and polynucleotides

Cross reference

The present application claims priority from 35U.S. C. ≡119 to provisional application serial number 63/216,178 filed on month 29 of 2021, provisional application serial number 63/277 filed on month 11 of 2021, 701, provisional application serial number 63/303,680 filed on month 27 of 2022, and provisional application serial number 63/345,059 filed on month 24 of 2022, the disclosures of which are incorporated herein by reference in their entireties.

Background

Compositions that mediate RNA editing may be viable therapies for genetic diseases. However, there is a need for efficient compositions that maximize editing of target RNA while minimizing editing of off-target RNA. In addition, there is a need for compositions that promote RNA editing.

Disclosure of Invention

Disclosed herein are engineered guide RNAs and compositions comprising the engineered guide RNAs, wherein: (a) The engineered guide RNA forms a guide-target RNA scaffold with the sequence of the target SNCA RNA after hybridization with the sequence of the target SNCA RNA; (b) The formation of the guide-target RNA scaffold essentially forms one or more structural features selected from the group consisting of: a bulge, an inner ring and a hairpin; (c) The structural feature is not present in the engineered guide RNA prior to hybridization of the engineered guide RNA to SNCA target RNA; and (d) after hybridization of the engineered guide RNAs to the sequences of the target SNCA RNAs, the engineered guide RNAs facilitate RNA editing of one or more target adenosines in the sequences of the target SNCA RNAs by an RNA editing entity. In some embodiments, the sequence of the target SNCA RNA is within the 3' untranslated region (UTR). In some embodiments, the sequence of the target SNCA RNA is within the 5' untranslated region (UTR). In some embodiments, the sequence of the target SNCA RNA in the 5' utr is a Kozak sequence. In some embodiments, the sequence of the target SNCA RNA in the 5' utr is an Internal Ribosome Entry Site (IRES). In some embodiments, the sequence of the target SNCA RNA in the 5' utr is an Iron Response Element (IRE). In some embodiments, the sequence of the target SNCA RNA comprises a translation initiation site. In some embodiments, the translation initiation site is the SNCA codon 1 translation initiation site of exon 2. In some embodiments, the translation initiation site is the SNCA codon 1 translation initiation site of exon 2 corresponding to position 226 of SNCA transcript variant 1 of accession No. nm_ 000345.4. In some embodiments, the one or more structural features comprise: a first 6/6 symmetric inner ring at a position selected from the group consisting of 32, 30, 28, 26 and 24, relative to the target adenosine at position 0. In some embodiments, the first 6/6 symmetric inner loop is at position 32 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 13 relative to position 0, an a/C mismatch at position 15 relative to position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 13 relative to position 0, and an a/C mismatch at position 15 relative to position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO. 350. In some embodiments, the engineered guide RNA comprises SEQ ID NO:350. In some embodiments, the first 6/6 symmetric inner loop is at position 30 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-18 relative to position 0, a 3/3 symmetrical bulge at position-6 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, a U/C mismatch at position 10 relative to position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6/6 symmetrical inner ring at position-18 relative to position 0, a 3/3 symmetrical protrusion at position-6 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, and a U/C mismatch at position 10 relative to position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO. 303. In some embodiments, the engineered guide RNA comprises SEQ ID NO. 303. In some embodiments, the first 6/6 symmetric inner loop is at position 28 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-8 relative to position 0, an a/C mismatch at position 0, a G/U wobble at position 2 relative to position 0, and any combination thereof. In some embodiments, the one or more structural features further include a 6/6 symmetrical inner ring at position-8 relative to position 0, an a/C mismatch at position 0, and a G/U wobble at position 2 relative to position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO. 318. In some embodiments, the engineered guide RNA comprises SEQ ID NO. 318. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/2 symmetrical protrusion at position-6 relative to position 0, an a/C mismatch at position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/2 symmetrical protrusion at position-6 relative to position 0, and an a/C mismatch at position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO. 353. In some embodiments, the engineered guide RNA comprises SEQ ID NO. 353. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 0/1 asymmetrical lobe at position-6 relative to position 0, an a/C mismatch at position 0, an a/a mismatch at position 4 relative to position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6/6 symmetrical inner ring at position-10 relative to position 0, a 0/1 asymmetrical lobe at position-6 relative to position 0, an a/C mismatch at position 0, and an a/a mismatch at position 4 relative to position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO 361. In some embodiments, the engineered guide RNA comprises SEQ ID NO 361. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/0 asymmetrical lobe at position-4 relative to position 0, an a/C mismatch at position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/0 asymmetrical lobe at position-4 relative to position 0, and an a/C mismatch at position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO 365. In some embodiments, the engineered guide RNA comprises SEQ ID NO 365. In some embodiments, the first 6/6 symmetric inner loop is at position 26 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical protrusion at position 5 relative to position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, and a 2/2 symmetrical protrusion at position 5 relative to position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO. 356. In some embodiments, the engineered guide RNA comprises SEQ ID NO 356. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a 3/3 symmetrical protrusion at position-4 relative to position 0, an a/C mismatch at position 0, and any combination thereof. In some embodiments, the one or more structural features further comprise a 6/6 symmetrical inner ring at position-14 relative to position 0, a 3/3 symmetrical protrusion at position-4 relative to position 0, and an a/C mismatch at position 0. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO 367. In some embodiments, the engineered guide RNA comprises SEQ ID NO. 367. In some embodiments, the first 6/6 symmetric inner loop is at position 24 relative to the target adenosine at position 0. In some embodiments, the one or more structural features include at least a first 6/6 symmetrical inner ring and at least a second 6/6 symmetrical ring. In some embodiments, the one or more structural features comprise a protrusion, and wherein the protrusion is a symmetrical protrusion. In some embodiments, the one or more structural features comprise a protrusion, and wherein the protrusion is an asymmetric protrusion. In some embodiments, the one or more structural features comprise an inner ring, and wherein the inner ring is a symmetrical inner ring. In some embodiments, the one or more structural features comprise an inner ring, and wherein the inner ring is an asymmetric inner ring. In some embodiments, the guide-target RNA scaffold comprises wobble base pairs. In some embodiments, the one or more structural features comprise a hairpin, and wherein the hairpin is a recruited hairpin or a non-recruited hairpin. In some embodiments, the engineered guide RNA facilitates RNA editing of one or more adenosines in the target SNCA RNA sequence by the RNA editing entity after hybridization of the engineered guide RNA to the target SNCA RNA sequence. In some embodiments, the RNA editing entity comprises ADAR1, ADAR2, ADAR3, or any combination thereof. In some embodiments, the engineered guide RNA comprises at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs 2 to 11. In some embodiments, the engineered guide RNA is encoded by an engineered polynucleotide. In some embodiments, the engineered polynucleotide is contained in or on a vector. In some embodiments, the vector is a viral vector, and wherein the engineered polynucleotide is encapsulated in a viral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector, derivatives thereof. In some embodiments, the viral vector is an adeno-associated virus (AAV), and wherein the AAV vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or a derivative, chimeric, or variant of any of these. In some embodiments, the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, or any combination thereof. In some embodiments, the engineered guide RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any one of SEQ ID NOs 12 to 384. In some embodiments, the engineered guide RNA has the sequence of any one of SEQ ID NOs 12 to 384.

Also disclosed herein are pharmaceutical compositions comprising: (a) An engineered guide RNA as described herein or a composition comprising an engineered guide RNA as described herein; and (b) pharmaceutically acceptable: excipients, carriers or diluents.

Also disclosed herein are methods of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an engineered guide RNA as described herein, a composition comprising an engineered guide RNA as described herein, or a pharmaceutical composition comprising an engineered guide RNA as described herein. In some embodiments, the disease or condition comprises synucleinopathy. In some embodiments, the synucleinopathy comprises Parkinson's disease (Parkinson's disease). In some embodiments, the subject is a human or non-human animal. In some embodiments, the pharmaceutical composition or composition is in unit dosage form. In some embodiments, the administration is sufficient to treat one or more symptoms of the disease or disorder. In some embodiments, the disease or disorder is synucleinopathy. In some embodiments, the one or more symptoms treated include muscle tone stiffness, bradykinesia, resting tremor, or any combination thereof. In some embodiments, the administration is sufficient to reduce aggregation of the α -synuclein protein relative to: (a) aggregation level prior to administration; (b) In the absence of administration, the cumulative aggregation level in the subject; or (c) both.

Also disclosed herein are methods of treating parkinson's disease in a subject in need thereof, the methods comprising administering to the subject an engineered guide RNA as described herein or a composition comprising an engineered guide RNA as described herein in an amount sufficient to treat parkinson's disease in the subject. In some embodiments, the administration is sufficient to treat one or more symptoms of parkinson's disease in the subject relative to prior to the administration. In some embodiments, the one or more symptoms treated include muscle tone stiffness, bradykinesia, resting tremor, or any combination thereof. In some embodiments, the subject exhibits an increased UPDRS score after the administration relative to a Unified Parkinson's Disease Rating Scale (UPDRS) score prior to administration.

Also disclosed herein are methods of editing SNCA RNA comprising contacting SNCA RNA with an engineered guide RNA as described herein or a composition comprising an engineered guide RNA as described herein and an RNA editing entity, thereby editing SNCA RNA. In some embodiments, the editing comprises editing one or more adenosines within the 3' untranslated region (UTR) of the SNCA RNA. In some embodiments, the editing comprises editing one or more adenosines within the 5' untranslated region (UTR) of the SNCA RNA. In some embodiments, the editing comprises editing one or more adenosines of a transcription start site (TIS) of the SNCA RNA. In some embodiments, the translation initiation site is the SNCA codon 1 translation initiation site of exon 2, the codon 5 translation initiation site of exon 2, or both. In some embodiments, the SNCA RNA comprises a pre-mRNA transcript of SNCA. In some embodiments, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the pre-mRNA transcripts of SNCA have at least one edit. In some embodiments, editing of SNCA RNA promotes protein knockdown. In some embodiments, the protein knockdown comprises a reduction of at least 10% relative to the amount of protein present prior to the contacting. In some embodiments, the protein knockdown comprises a reduction of about 10% to about 25% relative to the amount of protein present prior to the contacting. In some embodiments, the protein knockdown comprises a reduction of at least 50% relative to the amount of protein present prior to the contacting. In some embodiments, the protein knockdown comprises a knockdown of alpha-synuclein. In some embodiments, knockdown is measured in an in vitro assay. In some embodiments, knockdown is measured in an in vivo assay. In some embodiments, knockdown is measured in a human subject.

Incorporated by reference

All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

Drawings

The novel features believed characteristic of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the exemplary principles of the disclosure are utilized, and in which:

FIG. 1 shows a graph of SNCA expression as a percentage of wild type after introduction of hard-wired (hardwired) A to G mutations into cells at codon 1TIS and at codon 5 TIS.

Fig. 2 shows a graphical illustration of various exemplary structural features present in a guide-target RNA scaffold formed after hybridization of a latent guide RNA of the present disclosure with a target RNA. Exemplary structural features shown include 8/7 asymmetric loops (8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), 2/2 symmetric projections (2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), 1/1 mismatches (1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), 5/5 symmetric inner loops (5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), 24bp regions (24 nucleotides on the base of the target RNA side that base pairs with 24 nucleotides on the guide RNA side), and 2/3 asymmetric projections (2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side)

Fig. 3 is a graph showing sequence similarity of SNCA TIS targeting engineered guide RNAs of the present disclosure to canonical guide RNA designs on the x-axis and edit scores of ADAR2 enzymes on the y-axis. These data highlight the diverse sequence space represented by the SNCA TIS-targeted engineered guide RNAs of the present disclosure, which have a range of different structural features that drive sequence diversity and exhibit high on-target editing efficiency.

FIG. 4 shows a schematic representation of the Transcription Initiation Site (TIS) in SNCA. The top schematic shows an overall view of the 5' region + TIS and the bottom schematic shows a more detailed view of the different TIS.

FIG. 5 shows ELISA assessment of alpha-synuclein protein levels in SH-SY5Y A > G hard-wired mutant cell lines. ^*p<0.05,^*** p <0.001, n=3-4 biological replicates (except primary neurons, n=1). Data are expressed as mean ± SD. And (3) statistical inspection: one-way ANOVA with Tukey multiple comparison test.

FIGS. 6A-6B show immunoblot assessment of alpha-synuclein protein levels in SH-SY5Y A > G hard-connected mutant cell lines. Figure 6A shows a representative immunoblot using an alpha-synuclein specific antibody and a beta-actin antibody as a protein loading control. Figure 6B shows quantitative densitometric analysis of immunoblotted α -synuclein protein levels normalized to protein loading control. ^**p<0.01,^*** p <0.001, n=3-4 biological replicates. Data are expressed as mean ± SD. And (3) statistical inspection: one-way ANOVA with Tukey multiple comparison test.

FIGS. 7A-7B show quantitative PCR assessment of SNCA mRNA transcript levels in SH-SY5Y A > G hard-wired mutant cell lines. SNCA mRNA transcript levels were measured by quantitative PCR using TaqMan assays specific for either the SNCA exon 2-3 junction (FIG. 7A) or the SNCA exon 3-4 junction (FIG. 7B). ^** p <0.01, n=2-6 biological replicates. Data are expressed as mean ± SD. And (3) statistical inspection: one-way ANOVA with Tukey multiple comparison test.

Figure 8 shows biological replicates of intracellular testing of 48 grnas selected by high throughput screening.

FIG. 9 shows intracellular editing of target SNCA exon 1TIS by ADAR1 (left) or ADAR1+ADAR2 (right) from control guide (top) and guide RNA of the present disclosure (SEQ ID NO: 382-bottom).

FIG. 10 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 338-top; SEQ ID NO: 329-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 11 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 336-top; SEQ ID NO: 380-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 12 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 309-top; SEQ ID NO: 359-middle; SEQ ID NO: 357-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 13 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 320-top; SEQ ID NO: 373-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 14 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 315-top; SEQ ID NO: 321-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 15 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 378-top; SEQ ID NO: 320-middle; SEQ ID NO: 351-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 16 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 312-top; SEQ ID NO: 393-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 17 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 323-top; SEQ ID NO: 332-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 18 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 374-top; SEQ ID NO: 363-middle; SEQ ID NO: 366-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 19 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 369-top; SEQ ID NO: 355-middle; SEQ ID NO: 349-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 20 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 295-top; SEQ ID NO: 371-middle; SEQ ID NO: 319-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 21 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 325-top; SEQ ID NO: 219-middle; SEQ ID NO: 330-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 22 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 340-top; SEQ ID NO: 384-middle; SEQ ID NO: 343-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 23 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 376-top; SEQ ID NO: 242-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 24 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 345-top; SEQ ID NO: 306-middle; SEQ ID NO: 334-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 25 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 347-top; SEQ ID NO: 327-bottom) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 26 shows intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 341) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 27 shows two biological replicates of intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 365) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 28 shows two biological replicates of intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 303) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 29 shows two biological replicates of intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 318) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 30 shows two biological replicates of intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 350) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 31 shows two biological replicates of intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 361) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 32 shows two biological replicates of intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 367) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 33 shows two biological replicates of intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 356) via ADAR1 (left) or ADAR1+ADAR2 (right).

FIG. 34 shows two biological replicates of intracellular editing of target SNCA exon 1TIS by guide RNA of the present disclosure (SEQ ID NO: 353) via ADAR1 (left) or ADAR1+ADAR2 (right).

Detailed Description

RNA editing

RNA editing may refer to the process by which RNA is enzymatically modified at specific nucleosides after synthesis. RNA editing may include any of insertion, deletion, or substitution of nucleotides. Examples of RNA editing include chemical modifications such as pseudouridylation (isomerization of uridine residues) and deamination (removal of amine groups from cytidine to produce uridine, or C-to-U editing, or adenosine-to-inosine, or A-to-I editing). RNA editing can be used to correct mutations (e.g., correct missense mutations) to restore protein expression, and introduce mutations or edit coding or non-coding regions of RNA to inhibit RNA translation and achieve protein knockdown.

Described herein are engineered guide RNAs that facilitate RNA editing by RNA editing entities (e.g., adenosine Deaminase (ADAR) acting on the RNA) or biologically active fragments thereof. For example, the engineered guide RNAs of the present disclosure can facilitate editing of a transcription start site (e.g., a codon 1 transcription start site) of a target SNCA mRNA (e.g., an engineered guide RNA of any of SEQ ID NOs: 12-384). In some cases, ADAR can be an enzyme that catalyzes the chemical conversion of adenosine to inosine in RNA. Because the properties of inosine are similar to those of guanosine (e.g., inosine will form two hydrogen bonds with cytosine), inosine can be recognized as guanosine by the translational cellular mechanism. Thus, "adenosine to inosine (a to I) RNA editing" effectively alters the primary sequence of the RNA target. Typically, ADAR enzymes share a common domain structure, including a variable number of amino-terminal dsRNA binding domains (dsRBD) and one carboxy-terminal catalytic deaminase domain. Human ADAR possesses two or three dsRBD. There is evidence that ADAR can form homodimers as well as heterodimers with other ADARs when bound to double stranded RNA, but it is currently not possible to determine whether dimerization is necessary for editing to occur. The engineered guide RNAs disclosed herein can facilitate RNA editing of any one or any combination of three human ADAR genes (ADAR 1-3) that have been identified. ADAR has a typical modular domain organization comprising at least two copies of dsRNA binding domains in its N-terminal region (dsRBD; ADAR1 with three dsRBD; ADAR2 and ADAR3 with two dsRBD each), followed by a C-terminal deaminase domain.

The engineered guide RNAs of the present disclosure (e.g., the engineered guide RNAs of any one of SEQ ID NOs: 12-384 as listed in table 2) facilitate RNA editing (e.g., editing of SNCA codon 1 transcription initiation site) by endogenous ADAR enzymes. In some embodiments, exogenous ADAR can be delivered with the engineered guide RNAs disclosed herein to facilitate RNA editing. In some embodiments, the ADAR is human ADAR1. In some embodiments, the ADAR is human ADAR2. In some embodiments, the ADAR is human ADAR3. In some embodiments, the ADAR is human ADAR1, human ADAR2, or any combination thereof.

In some embodiments, the present disclosure provides engineered guide RNAs that facilitate editing at specific regions of a target RNA (e.g., mRNA or pre-mRNA). For example, the engineered guide RNAs disclosed herein can target coding or non-coding sequences of RNAs. For example, the target region in the RNA coding sequence may be a Translation Initiation Site (TIS). In some embodiments, the target region in the non-coding sequence of the RNA may be a polyadenylation (polyA) signal sequence.

TIS. In some embodiments, the engineered guide RNAs of the present disclosure target adenosine at the Translation Initiation Site (TIS). In some embodiments, the engineered guide RNAs of the present disclosure (e.g., the engineered guide RNAs of any one of SEQ ID NOs: 12-384 as listed in table 2) can target codon 1TIS of exon 2, which corresponds to the canonical TIS at nucleotide position 226 of SNCA transcript variant 1 (NCBI reference sequence: nm_ 000345.4). Engineering guide RNAs facilitates ADAR-mediated RNA editing of TIS (AUG) to GUG. This results in inhibition of RNA translation, resulting in protein knockdown. Protein knockdown may also refer to a decrease in expression of wild-type protein. In some embodiments, the engineered guide RNAs of the present disclosure that target canonical TIS at codon 1 of exon 2 of SNCA (NCBI reference sequence: nucleotide position 226 of nm_ 000345.4) may be multiplexed with one or more additional engineered guide RNAs that target a different TIS of SNCA, such as the codon 5 translation initiation site of exon 2. Alternatively or additionally, one or more engineered guide RNAs of the present disclosure that target a canonical TIS at codon 1 of exon 2 of SNCA (NCBI reference sequence: nucleotide position 226 of nm_ 000345.4) may be multiplexed with one or more engineered guide RNAs that target a different sequence of SNCA, such as the 5'utr region of SNCA (e.g., kozak sequence, internal Ribosome Entry Site (IRES), or Iron Response Element (IRE) of the 5' utr). In each of these cases, the multiple engineered guide RNAs may be delivered together in the same viral vector, or each of the different engineered guide RNAs may be delivered together in separate vectors.

3' UTR. In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the 3 'untranslated region (3' utr). In some embodiments, the engineered guide RNAs promote ADAR-mediated RNA editing of one or more adenosines in the 3' utr, thereby reducing mRNA export from the nucleus and inhibiting translation, thereby resulting in protein knockdown.

5' UTR. In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the 5 'untranslated region (5' utr). Figure 4 provides a schematic illustration of the 5'utr and structures within the 5' utr that can be targeted by guide RNAs of the present disclosure. In some embodiments, the engineered guide RNAs of the present disclosure can target the Kozak sequence of the 5' utr. In some embodiments, the engineered guide RNAs of the present disclosure can target Internal Ribosome Entry Sites (IRES) of the 5' utr. In some embodiments, the engineered guide RNAs of the present disclosure may target the Iron Response Element (IRE) of the 5' utr. In some embodiments, the engineered guide RNAs facilitate ADAR-mediated RNA editing of one or more adenosines of the 5'utr (including one or more adenosines present in one or more structures of the 5' utr). In some cases, extensive or excessive editing of multiple adenosines can be facilitated by the engineered guide RNAs of the present disclosure, which can lead to ribosome arrest of mRNA transcripts, resulting in protein knockdown.

Poly a signal sequence. In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the polyA signal sequence. In some embodiments, the engineered guide RNAs promote ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence, resulting in disruption of RNA processing and degradation of target mRNA, and thus protein knockdown. In some embodiments, the target may have one or more polyA signal sequences. In these cases, one or more engineered guide RNAs of the present disclosure that differ in their respective sequences can be multiplexed to target adenosine in one or more polyA signal sequences. In both cases, the engineered guide RNAs of the present disclosure promote ADAR-mediated RNA editing of adenosine to inosine (interpreted by cellular mechanisms as guanosine) in the polyA signal sequence, resulting in protein knockdown.

Engineered guide RNAs

Disclosed herein are engineered guide RNAs (e.g., an engineered guide RNA of any one of SEQ ID NOs: 12-384 as listed in table 2) and engineered polynucleotides encoding the same for site-specific selective editing of a target RNA (e.g., SNCA codon 1TIS of exon 2, which corresponds to the canonical TIS at nucleotide position 226 of SNCA transcript variant 1 (NCBI reference sequence: nm_ 000345.4) by an RNA editing entity or a biologically active fragment thereof. The engineered guide RNAs of the present disclosure may comprise a latent structure such that when the engineered guide RNAs hybridize to a target RNA to form a guide-target RNA scaffold, at least a portion of the latent structure exhibits at least a portion of the structural features described herein.

The engineered guide RNAs described herein comprise a targeting domain that is complementary to a target RNA described herein. In this way, the guide RNAs can be engineered to site-specifically/selectively target and hybridize to a particular target RNA, thereby facilitating editing of a particular nucleotide in the target RNA by the RNA editing entity or biologically active fragment thereof. The targeting domain may include nucleotides positioned such that when the guide RNA hybridizes to the target RNA, the nucleotides are opposite the base to be edited by the RNA editing entity or biologically active fragment thereof, and do not base pair or incompletely base pair with the base to be edited. This mismatching helps to localize the editing of the RNA editing entity to the desired base of the target RNA. However, in some cases, there may be some off-target editing in addition to the desired editing, and in some cases, significant off-target editing.

Hybridization of the targeting domains of the target RNA and the guide RNA produces a specific secondary structure in the primer-target RNA scaffold, which emerges after hybridization, referred to herein as a "latent structure". Latent structures, when expressed, become structural features described herein, including mismatches, bulges, inner loops, and hairpins. Without wishing to be bound by theory, the presence of the structural features described herein that result after hybridization of the guide RNA to the target RNA configures the guide RNA to facilitate specific or selective targeted editing of the target RNA by the RNA editing entity or biologically active fragment thereof. Furthermore, the structural features combined with the mismatches described above generally promote increased amounts of target adenosine editing, less off-target editing, or both, as compared to constructs containing only mismatches or constructs with perfect complementarity to the target RNA. Thus, rationally designing the latent structures in the engineered guide RNAs of the present disclosure to create specific structural features in the guide-target RNA scaffold can be a powerful tool to facilitate editing of target RNAs with high specificity, selectivity, and robust activity.

Provided herein are engineered guides and polynucleotides encoding the same; and compositions comprising the engineered guide RNAs or the polynucleotides. As used herein, the term "engineered" with respect to a guide RNA or polynucleotide encoding the same refers to a non-naturally occurring guide RNA or polynucleotide encoding the same. For example, the present disclosure provides engineered polynucleotides encoding engineered guide RNAs. In some embodiments, the engineered guide comprises RNA. In some embodiments, the engineered guide comprises DNA. In some examples, the engineered primer comprises a modified RNA base or an unmodified RNA base. In some embodiments, the engineered primer comprises a modified DNA base or an unmodified DNA base. In some examples, the engineered primer comprises DNA and RNA bases.

In some examples, the engineered guide provided herein includes an engineered guide that can be configured to at least partially form a guide-target RNA scaffold with at least a portion of a target RNA molecule upon hybridization to the target RNA molecule, wherein the guide-target RNA scaffold includes at least one structural feature, and wherein the guide-target RNA scaffold recruits an RNA editing entity and facilitates chemical modification of nucleotide bases in the target RNA molecule by the RNA editing entity.

In some examples, the target RNA of the engineered guide RNAs of the present disclosure can be a pre-mRNA or an mRNA. In some embodiments, the engineered guide RNAs of the present disclosure hybridize to a sequence of a target RNA. In some embodiments, a portion of the engineered guide RNA (e.g., the targeting domain) hybridizes to a sequence of the target RNA. The portion of the engineered guide RNA that hybridizes to the target RNA has sufficient complementarity to the sequence of the target RNA so that hybridization occurs.

A. Targeting domain

The engineered guide RNAs disclosed herein can be engineered in any manner suitable for RNA editing. In some examples, the engineered guide RNA generally comprises at least one targeting sequence that allows it to hybridize to a region of the target RNA molecule (e.g., SNCA codon 1TIS of exon 2, which corresponds to the canonical TIS at nucleotide position 226 of SNCA transcript variant 1 (NCBI reference sequence: nm_ 000345.4). The targeting sequence may also be referred to as a "targeting domain" or "targeting region".

In some cases, the targeting domain of the engineered primer allows the engineered primer to target the RNA sequence by base pairing (e.g., watson-crick base pairing (Watson Crick base pairing)). In some examples, the targeting sequence may be located at the N-terminus or the C-terminus of the engineered guide. In some cases, the targeting sequence may be located at both ends. The targeting sequence may be of any length. The length of the targeting sequence can be at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 77, 76, or more 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150 or up to about 200 nucleotides. In some of the cases where the number of the cases, the length of the targeting sequence can be no greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 77, and the like 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150 or 200 nucleotides. In some examples, the engineered guide comprises a targeting sequence that may be about 60 to about 500, about 60 to about 200, about 75 to about 100, about 80 to about 200, about 90 to about 120, or about 95 to about 115 nucleotides in length. In some examples, the engineered guide RNA comprises a targeting sequence that may be about 100 nucleotides in length.

In some cases, the targeting domain comprises 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity to the target RNA. In some cases, the targeting sequence comprises less than 100% complementarity to the target RNA sequence. For example, the targeting sequence and the region of the target RNA to which the targeting sequence can bind can have a single base mismatch.

The targeting sequence may have sufficient complementarity to the target RNA to allow hybridization of the targeting sequence to the target RNA. In some embodiments, the targeting sequence has minimal antisense complementarity of about 50 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has minimal antisense complementarity of about 60 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has minimal antisense complementarity of about 70 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has minimal antisense complementarity of about 80 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has minimal antisense complementarity of about 90 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has minimal antisense complementarity of about 100 nucleotides or more to the target RNA. In some embodiments, antisense complementarity refers to a non-contiguous segment of a sequence. In some embodiments, antisense complementarity refers to a contiguous fragment of a sequence.

In some cases, the engineered guide RNAs targeting SNCA may comprise multiple targeting sequences. In some cases, one or more target sequence domains in the engineered guide RNAs can bind to one or more regions of the target SNCA RNA. For example, a first targeting sequence can be configured to be at least partially complementary to a first region of a target RNA (e.g., a first exon of a pre-mRNA), and a second targeting sequence can be configured to be at least partially complementary to a second region of the target RNA (e.g., a second exon of a pre-mRNA). In some cases, multiple target sequences may be operably linked to provide for sequential hybridization of multiple regions of the target RNA. In some cases, multiple target sequences may provide for non-continuous hybridization of multiple regions of the target RNA. "discontinuous" overlapping or hybridization refers to hybridization of a first region of a target SNCA RNA to a first targeting sequence and hybridization of a second region of the target SNCA RNA to a second targeting sequence, wherein the first and second regions of the target SNCA RNA are discontinuous (e.g., an intervening sequence is present between the first and second regions of the target RNA). For example, the targeting sequence may be configured to bind a portion of a first exon, and may comprise an internal asymmetric loop (e.g., an oligomeric tether) configured to bind a portion of a second exon, while the intervening sequence between a portion of exon 1 and a portion of exon 2 is not hybridized by the targeting sequence or the oligomeric tether. The use of engineered guide RNAs configured for discontinuous hybridization as described herein may provide a number of benefits. For example, such a guide may target the pre-mRNA during (or shortly after) transcription, and may then facilitate chemical modification using deaminase (e.g., ADAR) co-transcription, thereby increasing the overall efficiency of the chemical modification. Furthermore, the use of oligomeric tethers to provide non-continuous hybridization while skipping the insertion sequence can result in shorter, more specific guide RNAs with less off-target editing.

In some cases, an engineered guide RNA configured for discontinuous hybridization with a target SNCA RNA (e.g., an engineered guide RNA comprising a targeting sequence with an oligomeric tether) may be configured to bind to a different region or target SNCA RNA separated by an intervening sequence. In some of the cases where the number of the cases, the insertion sequence may be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 78, 82, 84, 82, and 80, 84, or the like 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 670, 690, 720, 730, 750, 760, and the like, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4500, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 5100, 5200, 5300, 5400, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, 6600, 6700, 6800, 6900, 7000, 7100, 7200, 7300, 7400, 7500, 7600, 7700, 7800, 7900, 8000, 8100, 8200, 8300, 8400, 8500, 8600, 8700, 8800, 8900, 9000, 9100, 9200, 9300, 9400, 9500, 9600, 9700, 9800, 9900, or 10000 nucleotides. In some cases, the targeting sequence and the oligomeric tether may target different non-contiguous regions of the same intron or exon. In some cases, the targeting sequence and the oligomeric tether can target different non-contiguous regions of adjacent exons or introns. In some cases, the targeting sequence and the oligomeric tether may target different non-contiguous regions of the distal exon or intron.

B. engineered guide RNAs with recruitment domains

In some examples, the subject engineered guide RNAs comprise a recruitment domain that recruits an RNA editing entity (e.g., ADAR), wherein in some examples the recruitment domain is formed and present without binding to the target RNA. The "recruitment domain" may be referred to herein as a "recruitment sequence" or "recruitment region. In some examples, the subject engineered primers can facilitate editing the bases of nucleotides in the target sequence of the target RNA, which results in modification of expression of the polypeptide encoded by the target RNA. The modification may be an increase in polypeptide expression or a decrease in polypeptide expression. In some cases, the engineered primer can be configured to facilitate editing of a nucleotide or a base of a polynucleotide of the RNA region by an RNA editing entity (e.g., ADAR). To facilitate editing, the engineered guide RNAs of the present disclosure can recruit RNA editing entities (e.g., ADARs). The domain may be recruited by various RNA editing entities. In some examples, the recruitment domain comprises: glutamate ion receptor AMPA type subunit 2 (GluR 2), alu sequence, or, in the case of recruitment of apodec, apodec recruitment domain.

In some examples, more than one recruitment domain may be included in the engineered guide of the disclosure. In examples where a recruitment domain may be present, the recruitment domain may be used to locate an RNA editing entity to effectively react with a subject target RNA after hybridization of the targeting sequence to the target sequence of the target RNA. In some cases, the recruitment domain may allow for temporary binding of the RNA editing entity to the engineered guide. In some examples, the recruitment domain allows for permanent binding of the RNA editing entity to the engineered leader. The recruitment domain may be of any length. In some cases, the recruitment domains may be about 1,2, 3, 4, 5, 6,7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 74, 75, up to about 80 nucleotides in length. In some cases, the recruitment domains may be no more than about 1,2, 3, 4, 5, 6,7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 74, 75, or 80 nucleotides in length. In some cases, the recruitment domain may be about 45 nucleotides in length. In some cases, at least a portion of the recruitment domain comprises at least 1 to about 75 nucleotides. In some cases, at least a portion of the recruitment domain comprises from about 45 nucleotides to about 60 nucleotides.

In some embodiments, the recruitment domain comprises a GluR2 sequence or a functional fragment thereof. In some cases, the GluR2 sequence may be recognized by an RNA editing entity (such as ADAR or biologically active fragment thereof). In some embodiments, the GluR2 sequence may be a non-naturally occurring sequence. In some cases, gluR2 sequences may be modified, for example, to enhance recruitment. In some embodiments, the GluR2 sequence may comprise a portion of a naturally occurring GluR2 sequence and a synthetic sequence.

In some examples, the recruitment domain comprises a GluR2 sequence, or a sequence having at least about 70%, 80%, 85%, 90%, 95%, 98%, 99% or 100% identity and/or length to GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUC CCAC (SEQ ID NO: 1). In some cases, the recruitment domain may comprise at least about 80% sequence homology to at least about 10, 15, 20, 25, or 30 nucleotides of SEQ ID NO. 1. In some examples, the recruitment domain may comprise at least about 90%, 95%, 96%, 97%, 98%, or 99% sequence homology and/or length to SEQ ID No. 1.

In addition, RNA editing entity recruitment domains are also contemplated. In one embodiment, the recruitment domain comprises an apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (apodec) domain. In some cases, the apopec domain can comprise a non-naturally occurring sequence or a naturally occurring sequence. In some embodiments, the apodec domain coding sequence may comprise a modification. In some cases, the apodec domain coding sequence may comprise a portion of a naturally occurring apodec domain coding sequence. In another embodiment, the recruitment domain may be from an Alu domain.

Any number of recruitment domains may be present in the engineered guides of the present disclosure. In some examples, at least about 1,2, 3, 4, 5, 6, 7, 8, 9, or up to about 10 recruitment domains may be included in the engineered guide. The recruitment domain may be located anywhere in the engineered guide RNA. In some cases, the recruitment domain may be located at the N-terminus, middle, or C-terminus of the engineered guide RNA. The recruitment domain may be upstream or downstream of the targeting sequence. In some cases, the recruitment domain flanks the targeting sequence of the subject guide. The recruitment sequence may comprise all ribonucleotides or deoxyribonucleotides, although in some cases a recruitment domain comprising ribonucleotides and deoxyribonucleotides cannot be excluded.

C. engineered guide RNAs with latent structures

In some examples, the engineered guide disclosed herein for facilitating editing of a target RNA by an RNA editing entity may be an engineered latent guide RNA. "engineered latent guide RNA" refers to an engineered guide RNA that comprises a latent structure. "latent structure" refers to a structural feature that is substantially formed upon hybridization of a guide RNA to a target RNA. For example, the sequence of the guide RNA provides one or more structural features, but these structural features are formed substantially only after hybridization to the target RNA, and thus one or more latent structural features appear as structural features after hybridization to the target RNA. Upon hybridization of the guide RNA to the target RNA, structural features are formed and thus the latent structure provided in the guide RNA is uncovered.

Double-stranded RNA (dsRNA) substrates are formed after hybridization of the engineered guide RNAs of the present disclosure to a target RNA (e.g., SNCA codon 1 TIS). The resulting dsRNA substrate is also referred to herein as a "primer-target RNA scaffold".

Fig. 2 shows a graphical illustration of various exemplary structural features present in a guide-target RNA scaffold formed after hybridization of a latent guide RNA of the present disclosure with a target RNA. Exemplary structural features shown include 8/7 asymmetric loops (8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), 2/2 symmetric projections (2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), 1/1 mismatches (1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), 5/5 symmetric inner loops (5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), 24bp regions (24 nucleotides on the target RNA side base paired with 24 nucleotides on the guide RNA side), and 2/3 asymmetric projections (2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side). Unless otherwise indicated, the number of participating nucleotides in a given structural feature is indicated as the nucleotide on the target RNA side relative to the nucleotide on the guide RNA side. The location annotation of each figure is also shown in this legend. For example, the target nucleotide to be edited is designated as the 0 position. Downstream (3') of the target nucleotide to be edited, each nucleotide is counted in +1 increments. Upstream (5') of the target nucleotide to be edited, each nucleotide is counted in increments of-1. Thus, the exemplary 2/2 symmetrical projections in this illustration are located at positions +12 to +13 in the guide-target RNA scaffold. Similarly, the 2/3 asymmetric projections in this illustration are located at positions-36 to-37 in the guide-target RNA scaffold. As used herein, positional annotation is provided relative to the target nucleotide to be edited and on the target RNA side of the guide-target RNA scaffold. As used herein, if a single position is annotated, then the structural feature extends from that position away from position 0 (the target nucleotide to be edited). For example, if the latent guide RNA is annotated herein as forming a 2/3 asymmetric bulge at position-36, then the 2/3 asymmetric bulge is formed on the target RNA side of the guide-target RNA scaffold from position-36 to position-37 relative to the target nucleotide to be edited (position 0). As another example, if the latent guide RNA is annotated herein as forming a 2/2 symmetrical bulge at position +12, then the 2/2 symmetrical bulge is formed from +12 to +13 positions on the target RNA side of the guide-target RNA scaffold relative to the target nucleotide to be edited (position 0).

In some examples, the engineered guide disclosed herein lacks a recruitment region, and recruitment of RNA editing entities can be achieved by engineering structural features of the guide-target RNA scaffold formed by hybridization of guide RNA and target RNA. In some examples, the engineered guide does not comprise structural features that recruit an RNA editing entity (e.g., ADAR) when present in an aqueous solution and not bound to a target RNA molecule. The engineered guide RNAs, upon hybridization to the target RNAs, form together with the target RNA molecules one or more structural features that recruit an RNA editing entity (e.g., ADAR).

In the event that a recruitment sequence may not be present, the engineered guide RNA is still able to associate with a subject RNA editing entity (e.g., ADAR) to facilitate editing of the target RNA and/or to modulate expression of a polypeptide encoded by the subject target RNA. This can be achieved by structural features formed in the primer-target RNA scaffold formed after hybridization of the engineered guide RNA to the target RNA. The structural features may include any of the following: mismatches, symmetrical projections, asymmetrical projections, symmetrical inner loops, asymmetrical inner loops, hairpins, wobble base pairs, or any combination thereof.

Described herein are structural features that may be present in a guide-target RNA scaffold of the present disclosure. Examples of features include mismatches, bulges (symmetrical bulges or asymmetrical bulges), inner loops (symmetrical inner loops or asymmetrical inner loops), or hairpins (recruited hairpins or non-recruited hairpins). The engineered guide RNAs of the present disclosure can have 1 to 50 features. The engineered guide RNAs of the present disclosure can have 1 to 5,5 to 10, 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40, 40 to 45, 45 to 50, 5 to 20, 1 to 3, 4 to 5, 2 to 10, 20 to 40, 10 to 40, 20 to 50, 30 to 50, 4 to 7, or 8 to 10 features. In some embodiments, structural features (e.g., mismatches, bulges, internal loops) can be formed from the latent structure in the engineered latent guide RNA after the engineered latent guide RNA hybridizes to the target RNA, and thus the guide-target RNA scaffold is formed. In some embodiments, the structural features are not formed by latent structures, but rather preformed structures (e.g., gluR2 recruitment hairpins or hairpins from U7 snrnas).

The primer-target RNA scaffold is formed after hybridization of the engineered guide RNA of the present disclosure to the target RNA. As disclosed herein, mismatch refers to the unpaired single nucleotide in the guide RNA with the relative single nucleotide in the target RNA within the guide-target RNA scaffold. Mismatches may comprise any two non-base pairing single nucleotides. When the number of participating nucleotides on the guide RNA side and on the target RNA side exceeds 1, the resulting structure is no longer considered a mismatch, but rather a bulge or inner loop, depending on the size of the structural features. In some embodiments, the mismatch is an A/C mismatch. The a/C mismatch may comprise C in the engineered guide RNAs of the present disclosure, as opposed to a in the target RNA. The a/C mismatch may comprise a in the engineered guide RNAs of the present disclosure as opposed to C in the target RNA. The G/G mismatch may comprise G in the engineered guide RNAs of the present disclosure, as opposed to G in the target RNA.

In some embodiments, a mismatch 5' to the editing site may facilitate base inversion of target a to be edited. Mismatches also help to confer sequence specificity. Thus, mismatches may be structural features formed by the latent structure provided by the engineered latent guide RNA.

In another aspect, the structural feature comprises a wobble base. Wobble base pairing refers to the pairing of two bases with a weak base. For example, wobble base pairs of the present disclosure may refer to G paired with U. Thus, wobble base pairs may be structural features formed by the latent structure provided by the engineered latent guide RNA.

In some cases, the structural feature may be a hairpin. As disclosed herein, a hairpin includes an RNA duplex in which a portion of a single RNA strand folds upon itself to form the RNA duplex. By having nucleotide sequences that base pair with each other, portions of a single RNA strand fold upon themselves, wherein the nucleotide sequences are separated by an intervening sequence that does not base pair with itself, thereby forming a base-paired portion and a non-base-paired intervening loop portion. The hairpin may have 10 to 500 nucleotides in length throughout the duplex structure. The loop portion of the hairpin may be 3 to 15 nucleotides in length. The hairpin may be present in any of the engineered guide RNAs disclosed herein. The engineered guide RNAs disclosed herein can have 1 to 10 hairpins. In some embodiments, the engineered guide RNAs disclosed herein have 1 hairpin. In some embodiments, the engineered guide RNAs disclosed herein have 2 hairpins. As disclosed herein, a hairpin may include a recruited hairpin or a non-recruited hairpin. The hairpin may be located anywhere within the engineered guide RNAs of the disclosure. In some embodiments, one or more hairpins are proximal to or present at the 3 'end of the engineered guide RNAs of the present disclosure, proximal to or present at the 5' end of the engineered guide RNAs of the present disclosure, proximal to or within the targeting domain of the engineered guide RNAs of the present disclosure, or any combination thereof.

In some aspects, the structural feature comprises a non-recruiting hairpin. As disclosed herein, the non-recruiting hairpins do not have the primary function of recruiting RNA editing entities. In some cases, the non-recruiting hairpin does not recruit an RNA editing entity. In some cases, the non-recruited hairpin has a dissociation constant that binds the RNA editing entity under physiological conditions that is insufficient for binding. For example, the non-recruited hairpin binds to the RNA editing entity with a dissociation constant greater than about 1mM, 10mM, 100mM, or 1M at 25 ℃, as determined in an in vitro assay. The non-recruiting hairpin may exhibit a function to enhance localization of the engineered guide RNA to the target RNA. In some embodiments, the non-recruiting hairpin improves nuclear retention. In some embodiments, the non-recruiting hairpin comprises a hairpin from U7 snRNA. Thus, a non-recruiting hairpin (such as a hairpin from U7 snRNA) is a preformed structural feature that may be present in a construct comprising an engineered guide RNA construct, rather than a structural feature formed by the latent structure provided in the engineered latent guide RNA.

The hair clips of the present disclosure may have any length. In one aspect, the hairpin may be about 10-500 nucleotides or more. In some of the cases where the number of the cases, the hairpin may comprise about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 86, 89, 88, 92, 95, 93, or the like; 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 174, 175, 176, etc, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, and 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 396, 397, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 418, 419, 420, 422, 424, 423, 425, etc.; 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 492, 493, 494, 495, 496, 497, 499, 500 or more nucleotides. In other cases, the hairpin may further comprise 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 10 to 110, 10 to 120, 10 to 130, 10 to 140, 10 to 150, 10 to 160, 10 to 170, 10 to 180, 10 to 190, 10 to 200, 10 to 210, 10 to 220, 10 to 230, 10 to 240, 10 to 250, 10 to 260, 10 to 270, 10 to 280, 10 to 290, 10 to 300, 10 to 310, 10 to 320, 10 to 330, 10 to 340, 10 to 350, 10 to 360, 10 to 370, 10 to 460, 10 to 380, 10 to 400, 10 to 440, 10 to 500, or 10 to 400 to 440 nucleotides.

The primer-target RNA scaffold is formed after hybridization of the engineered guide RNA of the present disclosure to the target RNA. As disclosed herein, a bulge refers to a structure that is formed substantially only upon formation of a guide-target RNA scaffold, wherein consecutive nucleotides in the engineered guide RNA or target RNA are not complementary to their positional counterparts on the opposite strand. The projections may alter the secondary or tertiary structure of the guide-target RNA scaffold. The projections may independently have 0 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the target RNA side of the guide-target RNA scaffold, or the projections may independently have 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold. However, a bulge as used herein does not refer to a structure in which a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA do not base pair, which are referred to herein as mismatches. Furthermore, when the number of participating nucleotides on the guide RNA side or on the target RNA side exceeds 4, the resulting structure is no longer considered as a bulge, but rather as an inner loop. In some embodiments, the guide-target RNA scaffold of the present disclosure has 2 projections. In some embodiments, the guide-target RNA scaffold of the present disclosure has 3 projections. In some embodiments, the guide-target RNA scaffold of the present disclosure has 4 projections. Thus, the bulge may be a structural feature formed by the latent structure provided by the engineered latent guide RNA.

In some embodiments, the presence of a bulge in the guide-target RNA scaffold can locate or can help locate ADAR to selectively edit target a in the target RNA and reduce off-target editing of non-target a in the target RNA. In some embodiments, the presence of a bulge in the guide-target RNA scaffold can recruit or help recruit additional amounts of ADAR. The projections in the guide-target RNA scaffold disclosed herein can recruit other proteins, such as other RNA editing entities. In some embodiments, a bulge 5' of the editing site may facilitate base inversion of target a to be edited. The bulge may also help to confer a sequence specificity to the target RNA to be edited relative to other a present in the target RNA. For example, the bump may help guide ADAR editing by constraining it in a direction that produces selective editing of target a.

The primer-target RNA scaffold is formed after hybridization of the engineered guide RNA of the present disclosure to the target RNA. The protrusions may be symmetrical protrusions or asymmetrical protrusions. Symmetrical projections are formed when the same number of nucleotides are present on each side of the projection. For example, symmetrical projections in a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. The symmetrical projections of the present disclosure may be formed from 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetrical projections of the present disclosure may be formed from 3 nucleotides on the engineered guide RNA side of the guide-target RNA stent target and 3 nucleotides on the target RNA side of the guide-target RNA stent. The symmetrical projections of the present disclosure may be formed from 4 nucleotides on the engineered guide RNA side of the guide-target RNA stent target and 4 nucleotides on the target RNA side of the guide-target RNA stent. Thus, symmetrical projections may be structural features formed by the latent structures provided by the engineered latent guide RNAs.

The primer-target RNA scaffold is formed after hybridization of the engineered guide RNA of the present disclosure to the target RNA. The protrusions may be symmetrical protrusions or asymmetrical protrusions. An asymmetric bulge is formed when there are different numbers of nucleotides on each side of the bulge. For example, asymmetric projections in a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1 nucleotide on the target RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 2 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 2 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric projections of the present disclosure may be formed from 3 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, asymmetric projections may be structural features formed by the latent structures provided by the engineered latent guide RNAs.

In some embodiments, the asymmetric protrusion may be a 1/0 asymmetric protrusion. In some embodiments, the 1/0 asymmetric protuberance may be a U-miss. "U-deletion" refers to a 1/0 asymmetric bulge in which the U nucleotides of the engineered guide RNA located opposite the non-target A of the target RNA in the guide-target RNA scaffold are deleted from the engineered guide RNA. In some cases, the 1/0 asymmetric bulge comprising a U deletion can reduce editing of non-target a relative to a comparable guide RNA lacking a U deletion.

In some cases, the structural feature may be an inner ring. As disclosed herein, an inner loop refers to a structure that is formed substantially only when a guide-target RNA scaffold is formed, wherein the nucleotides in the engineered guide RNA or target RNA are not complementary to their positional counterparts on the opposite strand, and wherein one side of the inner loop (on the target RNA side or on the engineered guide RNA side of the guide-target RNA scaffold) has 5 or more nucleotides. When the number of participating nucleotides on both the guide RNA side and the target RNA side is below 5, the resulting structure is no longer considered an inner loop, but rather a bulge or mismatch, depending on the size of the structural features. The inner ring may be a symmetrical inner ring or an asymmetrical inner ring. The inner loop present near the editing site can help the base inversion of target a in the target RNA to be edited.

One side of the inner loop (on the target RNA side or on the engineered guide RNA side of the guide-target RNA scaffold) may be formed of 5-150 nucleotides. One side of the inner loop may be formed from 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 120, 135, 140, 145, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900 or 1000 nucleotides, or any number therebetween. One side of the inner loop may be formed of 5 nucleotides. One side of the inner loop may be formed of 10 nucleotides. One side of the inner loop may be formed of 15 nucleotides. One side of the inner loop may be formed of 20 nucleotides. One side of the inner loop may be formed of 25 nucleotides. One side of the inner loop may be formed of 30 nucleotides. One side of the inner loop may be formed of 35 nucleotides. One side of the inner loop may be formed of 40 nucleotides. One side of the inner loop may be formed of 45 nucleotides. One side of the inner loop may be formed of 50 nucleotides. One side of the inner loop may be formed of 55 nucleotides. One side of the inner loop may be formed of 60 nucleotides. One side of the inner loop may be formed of 65 nucleotides. One side of the inner loop may be formed of 70 nucleotides. One side of the inner loop may be formed of 75 nucleotides. One side of the inner loop may be formed of 80 nucleotides. One side of the inner loop may be formed of 85 nucleotides. One side of the inner loop may be formed of 90 nucleotides. One side of the inner loop may be formed of 95 nucleotides. One side of the inner loop may be formed of 100 nucleotides. One side of the inner loop may be formed of 110 nucleotides. One side of the inner loop may be formed of 120 nucleotides. One side of the inner loop may be formed of 130 nucleotides. One side of the inner loop may be formed of 140 nucleotides. One side of the inner loop may be formed of 150 nucleotides. One side of the inner loop may be formed of 200 nucleotides. One side of the inner loop may be formed of 250 nucleotides. One side of the inner loop may be formed of 300 nucleotides. One side of the inner loop may be formed of 350 nucleotides. One side of the inner loop may be formed of 400 nucleotides. One side of the inner loop may be formed of 450 nucleotides. One side of the inner loop may be formed of 500 nucleotides. One side of the inner loop may be formed of 600 nucleotides. One side of the inner loop may be formed of 700 nucleotides. One side of the inner loop may be formed of 800 nucleotides. One side of the inner loop may be formed of 900 nucleotides. One side of the inner loop may be formed of 1000 nucleotides. Thus, the inner loop may be a structural feature formed by the latent structure provided by the engineered latent guide RNA.

The inner ring may be a symmetrical inner ring or an asymmetrical inner ring. A symmetrical inner loop is formed when the same number of nucleotides are present on each side of the inner loop. For example, the symmetrical inner loop in the guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. The symmetric inner loops of the present disclosure may be formed from 5 nucleotides on the engineered guide RNA side of the guide-target RNA stent target and 5 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA stent target and 6 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loop of the present disclosure may be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA stent target and 7 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loop of the present disclosure may be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA stent target and 8 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loop of the present disclosure may be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA stent target and 9 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 10 nucleotides on the engineered guide RNA side of the guide-target RNA stent target and 10 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 15 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 15 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 20 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 20 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 30 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 30 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 40 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 40 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loop of the present disclosure may be formed by 50 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 50 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 60 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 60 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 70 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 70 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 80 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 80 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 90 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 90 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 100 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 100 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 110 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 110 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 120 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 120 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 130 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 130 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 140 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 140 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loop of the present disclosure may be formed by 150 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 150 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 200 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 200 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 250 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 250 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 300 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 300 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 350 nucleotides on the engineered polynucleotide side of the primer-target RNA stent target and 350 nucleotides on the target RNA side of the primer-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 400 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 400 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 450 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 450 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 500 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 500 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 600 nucleotides on the engineered polynucleotide side of the primer-target RNA stent target and 600 nucleotides on the target RNA side of the primer-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 700 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 700 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 800 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 800 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 900 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 900 nucleotides on the target RNA side of the guide-target RNA stent. The symmetric inner loops of the present disclosure may be formed from 1000 nucleotides on the engineered polynucleotide side of the guide-target RNA stent target and 1000 nucleotides on the target RNA side of the guide-target RNA stent. Thus, a symmetrical inner loop may be a structural feature formed by the latent structure provided by the engineered latent guide RNA.

An asymmetric inner loop is formed when there are a different number of nucleotides on each side of the inner loop. For example, asymmetric inner loops in a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold.

The asymmetric inner loop of the present disclosure may be formed from 5 to 150 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 5 to 150 nucleotides on the target RNA side of the guide-target RNA scaffold, wherein the number of nucleotides on the engineered side of the guide-target RNA scaffold target is different from the number of nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 5 to 1000 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 5 to 1000 nucleotides on the target RNA side of the guide-target RNA scaffold, wherein the number of nucleotides on the engineered side of the guide-target RNA scaffold target is different from the number of nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by a 5 nucleotide inner loop on the engineered guide RNA side of the guide-target RNA scaffold and an 8 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by a 5 nucleotide inner loop on the engineered guide RNA side of the guide-target RNA scaffold and a9 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by a 5 nucleotide inner loop on the engineered guide RNA side of the guide-target RNA scaffold and a 10 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by a 6 nucleotide inner loop on the engineered guide RNA side of the guide-target RNA scaffold and a 7 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by a 6 nucleotide inner loop on the engineered guide RNA side of the guide-target RNA scaffold and an 8 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by a 6 nucleotide inner loop on the engineered guide RNA side of the guide-target RNA scaffold and a9 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by a 6 nucleotide inner loop on the engineered guide RNA side of the guide-target RNA scaffold and a 10 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and an 8 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a9 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 10 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by an 8 nucleotide inner loop on the engineered guide RNA side of the guide-target RNA scaffold and a9 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by an 8 nucleotide inner loop on the engineered guide RNA side of the guide-target RNA scaffold and a 10 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by a9 nucleotide inner loop on the engineered guide RNA side of the guide-target RNA scaffold and a 10 nucleotide inner loop on the target RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 9 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed from 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric inner loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, the asymmetric inner loop may be a structural feature formed by the latent structure provided by the engineered latent guide RNA.

As disclosed herein, a "base pairing (bp) region" refers to a region of a guide-target RNA scaffold in which the bases in the guide RNA are paired with the opposite bases in the target RNA. The base pairing region can extend from or near one end of the guide-target RNA scaffold to or near the other end of the guide-target RNA scaffold. The base pairing region can extend between two structural features. The base pairing region can extend from or near one end of the primer-target RNA scaffold to or near the structural feature. The base pairing region can extend from the structural feature to the other end of the guide-target RNA scaffold. In some embodiments, the base pairing region has a base-pairing region of 1bp to 100bp, 1bp to 90bp, 1bp to 80bp, 1bp to 70bp, 1bp to 60bp, 1bp to 50bp, 1bp to 45bp, 1bp to 40bp, 1bp to 35bp, 1bp to 30bp, 1bp to 25bp, 1bp to 20bp, 1bp to 15bp, 1bp to 10bp, 1bp to 5bp, 5bp to 10bp, 5bp to 20bp, 10bp to 50bp, 5bp to 50bp, at least 1bp, at least 2bp, at least 3bp, at least 4bp, at least 5bp, at least 6bp, at least 7bp, at least 8bp, at least 9bp, at least 10bp, at least 12bp, at least 14bp, at least 16bp, at least 18bp, at least 20bp, at least 25bp, at least 30bp, at least 35bp, at least 40bp, at least 45bp, at least 50bp, at least 60bp, at least 70bp, at least 80bp, at least 90bp, at least 100bp.

The present disclosure provides engineered guide RNAs (e.g., an engineered guide RNA of any one of SEQ ID NOs: 12-384 as listed in table 2) that target the sequence of a SNCA target RNA (e.g., codon 1TIS of exon 2, which corresponds to the canonical TIS at nucleotide position 226 of SNCA transcript variant 1 (NCBI reference sequence: nm_ 000345.4).

In some cases, the engineered guide RNAs comprise one or more structural features that appear as latent structures resulting in editing of a target adenosine (defined as position 0) in a target sequence (e.g., codon 1 TIS) of the SNCA RNA. In some embodiments, the one or more structural features include a first 6/6 symmetrical inner ring and a second symmetrical 6/6 inner ring. In some embodiments, the one or more structural features comprise: a first 6/6 symmetric inner ring at a position selected from the group consisting of 32, 30, 28, 26 and 24, relative to the target adenosine at position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 32 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 32 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to the guide RNA comprising SEQ ID No. 336, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 32 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:336 and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 32 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 32 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 13 relative to position 0, an a/C mismatch at position 15 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 15 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 32 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNA comprising SEQ ID No. 350, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 15 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 32 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:350 and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 15 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 32 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 30 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-8 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNA comprising SEQ ID No. 293, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 293 against the target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA with the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, and a so-called inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 30 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-18 relative to position 0, a 3/3 symmetrical bulge at position-6 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, a U/C mismatch at position 10 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-18 relative to position 0, a symmetrical bulge of 3 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 10 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure for target SNCA RNAs have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID NOs 303, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to target SNCA RNAs comprises a symmetrical inner loop of 6 nucleotides at position-18 relative to position 0, a symmetrical protuberance of 3 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 10 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:303, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-18 relative to position 0, a symmetrical bulge of 3 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 10 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 30 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical protrusion at position 4 relative to position 0, a C/C mismatch at position 11 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 4 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID No. 306, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to the target SNCA RNAs comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 4 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:306, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 4 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 30 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a 4/4 symmetrical bulge at position-5 relative to position 0, an a/C mismatch at position 0, an a/a mismatch at position 4 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a symmetrical bulge of 4 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 4 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure for target SNCA RNAs have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID NOs 309, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to target SNCA RNAs comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a symmetrical bulge of 4 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 4 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 309 for a target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA with the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a symmetrical bulge of 4 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 4 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 30 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical protrusion at position 5 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 5 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNA comprising SEQ ID No. 315, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 5 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 315 and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 5 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 30 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner loop at position-6 relative to position 0, an a/C mismatch at position 0, a C/U mismatch at position 11 relative to position 0, a G/a mismatch at position 19 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, a mismatch of 1 nucleotide at position 19 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID No. 320, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to the target SNCA RNAs comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, a mismatch of 1 nucleotide at position 19 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:320 for a target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, a mismatch of 1 nucleotide at position 19 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 30 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-16 relative to position 0, a 1/0 asymmetrical lobe at position-4 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical lobe at position 5 relative to position 0, a U/G wobble at position 7 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, an asymmetric bulge of 1/0 nucleotide at position-4 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 5 relative to position 0, a wobble base pair at position 7 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to the guide RNA comprising SEQ ID No. 321 for the target SNCA RNA, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, an asymmetrical bulge of 1/0 nucleotide at position-4 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 5 relative to position 0, a wobble base pair at position 7 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:321 for a target SNCA RNA, and a guide-target RNA scaffold formed after hybridization of the engineered guide RNA with a target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, an asymmetric bulge of 1/0 nucleotide at position-4 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 5 relative to position 0, a wobble base pair at position 7 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 30 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 2/0 asymmetric protuberance at position-6 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 5 relative to position 0, an a/G mismatch at position 12 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise an asymmetric bulge of 2 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 5 relative to position 0, a mismatch of 1 nucleotide at position 12 relative to position 0, and a symmetric inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to the guide RNA comprising SEQ ID No. 325, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises an asymmetric protuberance of 2 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 5 relative to position 0, a mismatch of 1 nucleotide at position 12 relative to position 0, and a symmetric inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 325 and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises an asymmetric protuberance of 2 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 5 relative to position 0, a mismatch of 1 nucleotide at position 12 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 30 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a 2/0 asymmetrical lobe at position-5 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, an asymmetric bulge of 2/0 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNA comprising SEQ ID No. 338, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, an asymmetric bulge of 2/0 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 338 and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, an asymmetric bulge of 2/0 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 30 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a U/G wobble at position-6 relative to position 0, a 2/0 asymmetrical lobe at position-3 relative to position 0, an A/C mismatch at position 0, a G/A mismatch at position 19 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a wobble base pair at position-6 relative to position 0, an asymmetric bulge of 2/0 nucleotides at position-3 relative to position 0, a mismatch of 1 nucleotide at position 19 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO 349, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to a target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a wobble base pair at position-6 relative to position 0, an asymmetric bulge of 2/0 nucleotides at position-3 relative to position 0, a mismatch of 1 nucleotide at position 19 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO 349 to target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a wobble base pair at position-6 relative to position 0, an asymmetric bulge of 2/0 nucleotides at position-3 relative to position 0, a mismatch of 1 nucleotide at position 19 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 30 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-8 relative to position 0, an a/C mismatch at position 0, a G/U wobble at position 2 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 2 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNA comprising SEQ ID No. 318, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 2 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 318 for a target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 2 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-16 relative to position 0, a 4/1 asymmetrical lobe at position-5 relative to position 0, an a/C mismatch at position 0, a G/U wobble at position 6 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, a 4/1 asymmetric bulge at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure for target SNCA RNAs have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID NOs 319, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to target SNCA RNAs comprises a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, a 4/1 asymmetric bulge at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:319 and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, a 4/1 asymmetric bulge at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical protrusion at position 5 relative to position 0, a C/U mismatch at position 11 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 5 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID No. 329, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to the target SNCA RNAs comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 5 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 329 and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 5 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-16 relative to position 0, a 2/0 asymmetrical lobe at position-4 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 7 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, an asymmetric bulge of 2/0 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 7 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO:334, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to a target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, an asymmetric bulge of 2/0 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 7 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:334 for a target SNCA RNA, and a guide-target RNA scaffold formed after hybridization of the engineered guide RNA with a target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, an asymmetric bulge of 2/0 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 7 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 10 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a mismatch of 1 nucleotide at position 10 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID No. 347, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to the target SNCA RNAs comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a mismatch of 1 nucleotide at position 10 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 347 against a target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a mismatch of 1 nucleotide at position 10 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: an A/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a mismatch of 1 nucleotide at position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to a guide RNA comprising SEQ ID NO 351, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a mismatch of 1 nucleotide at position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure directed against a target SNCA RNA have the sequence of SEQ ID NO:351, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a1 nucleotide mismatch at position 0, a1 nucleotide mismatch at position 6 relative to position 0, and a 6 nucleotide symmetrical inner loop at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/2 symmetrical protrusion at position-6 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a symmetrical bulge of 2 nucleotides at position 6 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID No. 353, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a symmetrical bulge of 2 nucleotides at position 6 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 353 for a target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a symmetrical bulge of 2 nucleotides at position 6 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-18 relative to position 0, a 2/0 asymmetrical lobe at position-3 relative to position 0, an a/C mismatch at position 0, a 0/2 asymmetrical lobe at position 18 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-18 relative to position 0, a 2/0 asymmetric bulge at position-3 relative to position 0, a mismatch of 1 nucleotide at position 0, an asymmetric bulge of 0/2 nucleotides at position 18 relative to position 0, and a symmetrical inner bulge of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure for target SNCA RNAs have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID NO:355, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to target SNCA RNAs comprises a symmetrical inner loop of 6 nucleotides at position-18 relative to position 0, a 2/0 asymmetric bulge at position-3 relative to position 0, a mismatch of 1 nucleotide at position 0, an asymmetric bulge of 0/2 nucleotides at position 18 relative to position 0, and a symmetrical inner bulge of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:355 and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-18 relative to position 0, a 2/0 asymmetrical bulge at position-3 relative to position 0, a 1 nucleotide mismatch at position 0, an asymmetrical bulge of 0/2 nucleotides at position 18 relative to position 0, and a symmetrical inner bulge of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-8 relative to position 0, a 2/1 asymmetrical lobe at position-2 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, an asymmetric bulge of 2/1 nucleotides at position-2 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID No. 357, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, an asymmetric bulge of 2/1 nucleotides at position-2 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:357, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNAs to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, an asymmetric bulge of 2/1 nucleotides at position-2 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/1 asymmetrical lobe at position-6 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 13 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, an asymmetric bulge of 2/1 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 13 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO:359, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, an asymmetric bulge of 2/1 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 13 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 359, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, an asymmetric bulge of 2/1 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 13 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 0/1 asymmetrical lobe at position-6 relative to position 0, an a/C mismatch at position 0, an a/a mismatch at position 4 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, an asymmetric bulge of 0/1 nucleotide at position-6 relative to position 0, a mismatch of 1 nucleotide at position 4 relative to position 0, and a symmetrical inner loop of 28 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure for target SNCA RNAs have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID NOs 361, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to target SNCA RNAs comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, an asymmetric bulge of 0/1 nucleotide at position-6 relative to position 0, a mismatch of 1 nucleotide at position 4 relative to position 0, and a symmetrical inner loop of 28 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:361 for a target SNCA RNA, and a guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, an asymmetric bulge of 0/1 nucleotide at position-6 relative to position 0, a mismatch of 1 nucleotide at position 4 relative to position 0, and a symmetrical inner loop of 28 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: G/G mismatch at position-3 relative to position 0, A/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a mismatch of 1 nucleotide at position-3 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to a guide RNA comprising SEQ ID NO 363, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a1 nucleotide mismatch at position-3 relative to position 0, a1 nucleotide mismatch at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure directed against a target SNCA RNA have the sequence of SEQ ID No. 363, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a1 nucleotide mismatch at position-3 relative to position 0, a1 nucleotide mismatch at position 0, and a 6 nucleotide symmetrical inner loop at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/0 asymmetrical lobe at position-4 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, an asymmetric bulge of 2/0 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure for a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO 365, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to a target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, an asymmetric bulge of 2/0 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 365 for a target SNCA RNA, and a guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, an asymmetric bulge of 2/0 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-16 relative to position 0, a 4/3 asymmetrical lobe at position-3 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, an asymmetric bulge of 4/3 nucleotides at position-3 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to a guide RNA comprising SEQ ID No. 366, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to a target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, an asymmetric bulge of 4/3 nucleotides at position-3 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 366 for a target SNCA RNA, and a guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, an asymmetric bulge of 4/3 nucleotides at position-3 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-4 relative to position 0, an a/C mismatch at position 0, a 2/1 asymmetrical lobe at position 4 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 0, an asymmetric bulge of 2/1 nucleotide at position 4 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to a guide RNA comprising SEQ ID No. 369, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to a target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 0, an asymmetric bulge of 2/1 nucleotides at position 4 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:369 for a target SNCA RNA, and a guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 0, an asymmetrical bulge of 2/1 nucleotide at position 4 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-4 relative to position 0, an a/C mismatch at position 0, an a/a mismatch at position 12 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 12 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID No. 374, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 12 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 374 for a target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 12 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-4 relative to position 0, an A/C mismatch at position 0, a C/C mismatch at position 11 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID No. 376, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 376 for the target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a G/U wobble at position 3 relative to position 0, a U/C mismatch at position 13 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 3 relative to position 0, a mismatch of 1 nucleotide at position 13 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID No. 378, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to the target SNCA RNAs comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 3 relative to position 0, a mismatch of 1 nucleotide at position 13 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:378 for a target SNCA RNA, and a guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 3 relative to position 0, a mismatch of 1 nucleotide at position 13 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner loop at position-8 relative to position 0, an A/C mismatch at position 0, a C/U mismatch at position 11 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure for a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to a guide RNA comprising SEQ ID NO:380, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure directed against a target SNCA RNA have the sequence of SEQ ID NO:380, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a 3/3 symmetrical protrusion at position-5 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a symmetrical bulge of 3 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical inner loop of 6 nucleotides at a position 28 nucleotides downstream of target a.

In some cases, the engineered guide RNAs of the present disclosure for a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNA comprising SEQ ID NO:382, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a symmetrical bulge of 3 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical inner loop of 6 nucleotides at a position 28 nucleotides downstream of target a.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:382 and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a symmetrical bulge of 3 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical inner loop of 6 nucleotides at a position 28 nucleotides downstream of target a.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 28 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 3/3 symmetrical protrusion at position-5 relative to position 0, an a/C mismatch at position 0, a U/G wobble at position 10 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a symmetrical bulge of 3 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 10 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure for a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNA comprising SEQ ID No. 384, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a symmetrical bulge of 3 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 10 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:384, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a symmetrical bulge of 3 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 10 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 28 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 26 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-12 relative to position 0, a 3/2 asymmetrical lobe at position-4 relative to position 0, an a/C mismatch at position 0, a U/G wobble at position 13 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-12 relative to position 0, an asymmetric bulge of 3/2 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 13 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure for target SNCA RNAs have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID NOs 299, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to target SNCA RNAs comprises a symmetrical inner loop of 6 nucleotides at position-12 relative to position 0, an asymmetric bulge of 3/2 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 13 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:299, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-12 relative to position 0, an asymmetric bulge of 3/2 nucleotides at position-4 relative to position 0, a mismatch of 1 nucleotide at position 0, a wobble base pair at position 13 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 26 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, an a/a mismatch at position-7 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a mismatch of 1 nucleotide at position-7 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure for a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO:312, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to a target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a mismatch of 1 nucleotide at position-7 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:312 for a target SNCA RNA, and a guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a mismatch of 1 nucleotide at position-7 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 26 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-12 relative to position 0, a 2/1 asymmetrical lobe at position-2 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-12 relative to position 0, an asymmetric bulge of 2/1 nucleotides at position-2 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNA comprising SEQ ID No. 323, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-12 relative to position 0, an asymmetric bulge of 2/1 nucleotides at position-2 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 323 and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-12 relative to position 0, an asymmetric bulge of 2/1 nucleotides at position-2 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 26 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-8 relative to position 0, a U/G wobble at position-6 relative to position 0, an A/C mismatch at position 0, a U/U mismatch at position 9 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a wobble base pair at position-6 relative to position 0, a mismatch of 1 nucleotide at position 9 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID No. 327, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a wobble base pair at position-6 relative to position 0, a mismatch of 1 nucleotide at position 9 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:327 for a target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a wobble base pair at position-6 relative to position 0, a mismatch of 1 nucleotide at position 9 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 26 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-16 relative to position 0, a 0/1 asymmetrical lobe at position-7 relative to position 0, an a/C mismatch at position 0, a C/U mismatch at position 11 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, an asymmetric bulge of 0/1 nucleotide at position-7 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to the guide RNAs comprising SEQ ID No. 341, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, an asymmetric bulge of 0/1 nucleotide at position-7 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:341 and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-16 relative to position 0, an asymmetric protuberance of 0/1 nucleotide at position-7 relative to position 0, a mismatch of 1 nucleotide at position 11 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 26 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a U/C mismatch at position-5 relative to position 0, an A/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a mismatch of 1 nucleotide at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to a guide RNA comprising SEQ ID No. 343, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a mismatch of 1 nucleotide at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 343 and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a mismatch of 1 nucleotide at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 26 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical protrusion at position 5 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 5 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID No. 356, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a 1 nucleotide mismatch at position 0, a symmetrical bulge of 2 nucleotides at position 5 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 356 for a target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 0, a symmetrical bulge of 2 nucleotides at position 5 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 26 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a 3/3 symmetrical protrusion at position-4 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a symmetrical bulge of 3 nucleotides at position 4 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID No. 367 for a target SNCA RNA, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to a target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a symmetrical bulge of 3 nucleotides at position 4 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 367 for a target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a symmetrical bulge of 3 nucleotides at position 4 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 26 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/2 symmetrical protrusion at position-5 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a symmetrical bulge of 2 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure for a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNA comprising SEQ ID No. 371, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a symmetrical bulge of 2 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID No. 371 for a target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-10 relative to position 0, a symmetrical bulge of 2 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 26 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-20 relative to position 0, a 4/4 symmetrical bulge at position-5 relative to position 0, an a/C mismatch at position 0, a 0/1 asymmetrical bulge at position 5 relative to position 0, an a/C mismatch at position 17 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-20 relative to position 0, a symmetrical bulge of 4 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, an asymmetrical bulge of 0/1 nucleotide at position 5 relative to position 0, a mismatch of 1 nucleotide at position 17 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID No. 373, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to a target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-20 relative to position 0, a symmetrical bulge of 4 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, an asymmetrical bulge of 0/1 nucleotide at position 5 relative to position 0, a mismatch of 1 nucleotide at position 17 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:373 for a target SNCA RNA, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-20 relative to position 0, a symmetrical bulge of 4 nucleotides at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, an asymmetrical bulge of 0/1 nucleotide at position 5 relative to position 0, a mismatch of 1 nucleotide at position 17 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 26 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 24 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to a guide RNA comprising SEQ ID NO:295, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to a target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:295, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 24 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-18 relative to position 0, a U/C mismatch at position-5 relative to position 0, an A/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-18 relative to position 0, a mismatch of 1 nucleotide at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNA comprising SEQ ID No. 330, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-18 relative to position 0, a mismatch of 1 nucleotide at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure directed against a target SNCA RNA have the sequence of SEQ ID No. 330, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA with the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-18 relative to position 0, a mismatch of 1 nucleotide at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 24 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a U/C mismatch at position-5 relative to position 0, an A/C mismatch at position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a mismatch of 1 nucleotide at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity with a guide RNA comprising SEQ ID NO:332, and a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA with the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a mismatch of 1 nucleotide at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure directed against a target SNCA RNA have the sequence of SEQ ID No. 332, and the guide-target RNA scaffold formed after hybridization of the engineered guide RNA with the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-14 relative to position 0, a mismatch of 1 nucleotide at position-5 relative to position 0, a mismatch of 1 nucleotide at position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 24 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-8 relative to position 0, an a/C mismatch at position 4 relative to position 0, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a mismatch of 1 nucleotide at position 4 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNA comprising SEQ ID No. 340 for the target SNCA RNA, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a mismatch of 1 nucleotide at position 4 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:340 for a target SNCA RNA, and a guide-target RNA scaffold formed after hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 6 nucleotides at position-8 relative to position 0, a mismatch of 1 nucleotide at position 4 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, one or more structural features comprising the first 6/6 symmetric inner ring are at position 24 relative to the target adenosine at position 0. In some cases, the one or more structural features further comprise at least one structural feature selected from the group consisting of: an 8/8 symmetrical inner ring at position-6 relative to position 0, an A/C mismatch at position 0, a G/A mismatch at position 6 relative to position 0, a U/G wobble at position 7 relative to position 1, and any combination thereof.

In some cases, the structural features formed after hybridization of the engineered guide RNAs of the present disclosure with the target SNCA RNA comprise a symmetrical inner loop of 8 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, a wobble base pair at position 7 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure for target SNCA RNAs have at least 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to the guide RNAs comprising SEQ ID NOs 345, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNAs to target SNCA RNAs comprises a symmetrical inner loop of 8 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, a wobble base pair at position 7 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, the engineered guide RNAs of the present disclosure have the sequence of SEQ ID NO:345, and the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA to the target SNCA RNA comprises a symmetrical inner loop of 8 nucleotides at position-6 relative to position 0, a mismatch of 1 nucleotide at position 6 relative to position 0, a wobble base pair at position 7 relative to position 0, and a symmetrical inner loop of 6 nucleotides at position 24 relative to position 0.

In some cases, the engineered guide RNAs of the disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO 365; or the engineered guide RNA comprises the sequence of SEQ ID NO: 365. In some cases, the engineered guide RNAs of the disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to the guide RNA comprising SEQ ID No. 303; or the engineered guide RNA comprises the sequence of SEQ ID NO. 303. In some cases, the engineered guide RNAs of the disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID No. 318; or the engineered guide RNA comprises the sequence of SEQ ID NO. 318. In some cases, the engineered guide RNAs of the disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID No. 350; or the engineered guide RNA comprises the sequence of SEQ ID NO: 350. In some cases, the engineered guide RNAs of the present disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO 361; or the engineered guide RNA comprises the sequence of SEQ ID NO: 361. In some cases, the engineered guide RNAs of the disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID No. 367; or the engineered guide RNA comprises the sequence of SEQ ID NO. 367. In some cases, the engineered guide RNAs of the disclosure directed against a target SNCA RNA have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO 353; or the engineered guide RNA comprises the sequence of SEQ ID NO. 353.

Additional engineered guide RNA components

The present disclosure provides engineered guide RNAs with additional structural features and components. For example, the engineered guide RNAs described herein may be circular. In another example, the engineered guide RNAs described herein can comprise a U7, smOPT sequence, or a combination of both sequences.

In some cases, the engineered guide RNAs can be circularized. In some cases, the engineered guide RNAs provided herein can be circular or in a circular configuration. In some aspects, the at least partially circular guide RNA lacks a 5 'hydroxyl group or a 3' hydroxyl group. In some embodiments, the circular engineered guide RNA may comprise guide RNA from any of SEQ ID NOS.12-384 listed in Table 2, which targets SNCA codon 1TIS of exon 2.

In some examples, the engineered guide RNA can comprise a backbone comprising a plurality of sugar and phosphate moieties covalently linked together. In some examples, the backbone of the engineered guide RNA can comprise a phosphodiester linkage located between a first hydroxyl group in a phosphate group on the 5 'carbon of deoxyribose in DNA or ribose in RNA and a second hydroxyl group on the 3' carbon of deoxyribose in DNA or ribose in RNA.

In some embodiments, the backbone of the engineered guide RNA may lack 5 'reduced hydroxyl groups, 3' reduced hydroxyl groups, or both that are capable of being exposed to a solvent. In some embodiments, the backbone of the engineered primer may lack a 5 'reduced hydroxyl group, a 3' reduced hydroxyl group, or both that are capable of being exposed to a nuclease. In some embodiments, the backbone of the engineered guide may lack a 5 'reduced hydroxyl group, a 3' reduced hydroxyl group, or both that are capable of being exposed to a hydrolase. In some cases, the backbone of the engineered guide may be represented as a polynucleotide sequence in circular 2-dimensional format, nucleotide by nucleotide. In some cases, the backbone of the engineered guide may be represented as a polynucleotide sequence in a circular 2-dimensional format, nucleotide by nucleotide. In some cases, the 5 'hydroxyl group, the 3' hydroxyl group, or both may be linked by a phosphorus-oxygen bond. In some cases, the 5 'hydroxyl group, the 3' hydroxyl group, or both may be modified with a phosphorus-containing moiety to a phosphate ester.

As described herein, the engineered guide may comprise a cyclic structure. The engineered polynucleotide may be circularized from the precursor engineered polynucleotide. Such a precursor engineered polynucleotide may be a precursor engineered linear polynucleotide. In some cases, the precursor engineered linear polynucleotide may be a precursor to a circular engineered guide RNA. For example, a precursor engineered linear polynucleotide may be a linear mRNA transcribed from a plasmid, which may be configured to be circularized in a cell using the techniques described herein. The precursor engineered linear polynucleotide may be constructed with domains that allow cyclization when inserted into a cell, such as ribozyme domains and ligation domains. The ribozyme domain may include a domain (e.g., a proximal attachment domain) capable of cleaving a linear precursor RNA at a specific site. The precursor engineered linear polynucleotide may comprise from 5 'to 3': a 5 'ribozyme domain, a 5' linker domain, a circularization region, a3 'linker domain, and a 3' ribozyme domain. In some cases, the circularized region can comprise a guide RNA as described herein. In some cases, the precursor polynucleotide may be specifically processed by 5 'and 3' ribozymes at two positions, respectively, to release the exposed ends on the 5 'and 3' ligation domains. The free exposed ends may be ligatable such that the ends may be joined to form a mature cyclic structure. For example, the free end may include 5' -OH and 2',3' -cyclic phosphate, which are linked in the cell by RNA ligation. Linear polynucleotides having a ligation and ribozyme domain can be transfected into a cell where they can be circularized by endogenous cellular enzymes. In some cases, the polynucleotide may encode an engineered guide RNA comprising a ribozyme and a linking domain as described herein, which may be circularized in a cell. Circular guide RNAs are described in PCT/US2021/034301, which is incorporated herein by reference in its entirety.

The engineered polynucleotides described herein (e.g., circularized guide RNAs) can include a spacer domain. As described herein, a spacer domain may refer to a domain that provides space between other domains. Spacer domains can be used between the region to be circularized and flanking linking sequences to increase the overall size of the mature circularized guide RNA. When the region to be circularized comprises a targeting domain configured to associate with a target sequence as described herein, the addition of a spacer can provide an engineered polynucleotide with improvements (e.g., increased specificity, increased editing efficiency, etc.) to the target polynucleotide relative to a comparable engineered polynucleotide lacking the spacer domain. In some cases, the spacer domain is configured not to hybridize to the target RNA. In some embodiments, the precursor engineered polynucleotide or the circular engineered guide may comprise in 5 'to 3' order: a first ribozyme domain; a first connection domain; a first spacer domain; a targeting domain that can be at least partially complementary to a target RNA, a second spacer domain, a second linking domain, and a second ribozyme domain. In some cases, when the targeting domain binds to the target RNA, the first spacer domain, the second spacer domain, or both are configured to not bind to the target RNA.

Compositions and methods of the present disclosure provide engineered polynucleotides encoding guide RNAs operably linked to a portion of a microribonucleic acid (snRNA) sequence. The engineered polynucleotide may include at least a portion of a small ribonucleic acid (snRNA) sequence. U7 and U1 micrornas (whose natural role is to splice body processing pre-mRNA) have been redesigned for decades to alter splicing at the desired disease target. The first 18 nucleotides of U7 snRNA (which naturally hybridizes to spacer elements of the histone pre-mRNA) are replaced with short targeting (or antisense) sequences of disease genes, redirecting the splicing machinery to alter splicing around the target site. In addition, conversion of the wild-type U7 Sm domain binding site to an optimized consensus Sm binding sequence (SmOPT) can increase the expression level, activity, and subcellular localization of the artificial anti-engineered U7 snrnas. Many later groups have adapted this modified U7 SmOPT snRNA chassis with antisense sequences of other genes to recruit spliceosome elements and modify RNA splicing to additional disease targets.

SnRNA is a class of small RNA molecules found in the nucleus of eukaryotic cells. They are involved in a variety of important processes such as RNA splicing (removal of introns from pre-mRNA), regulation of transcription factors (7 SK RNA) or RNA polymerase II (B2 RNA), and maintenance of telomeres. They are always associated with a specific protein, and the resulting RNA-protein complex is known as microribonucleoprotein (snRNP) or sometimes as snurps. There are many snRNAs named U1, U2, U3, U4, U5, U6, U7, U8, U9 and U10.

The snRNA of U7 type is usually involved in the maturation of histone mRNA. Such snrnas have been identified in a large number of eukaryotic species (56 so far) and the U7 snrnas of each of these species should be considered as equally convenient for the present disclosure.

Wild-type U7 snrnas include stem-loop structures, U7-specific Sm sequences, and sequences antisense to the 3' end of histone pre-mRNA.

In addition to the SmOPT domain, U7 contains a sequence antisense to the 3' end of histone pre-mRNA. When this sequence is replaced with a targeting sequence that is antisense to another target pre-mRNA, U7 is redirected to the new target pre-mRNA. Thus, stable expression of modified U7 snrnas containing SmOPT domains and targeting antisense sequences resulted in specific changes in mRNA splicing. While AAV-2/1-based vectors expressing the appropriately modified murine U7 gene and its native promoter and 3' elements allow efficient gene transfer into skeletal muscle and completion of dystrophin rescue by overlaying and skipping mouse Dmd exon 23, the engineered polynucleotides described herein (whether administered directly or via, for example, an AAV vector) can facilitate editing of the target RNA by deaminase.

The engineered polynucleotide may comprise, at least in part, a snRNA sequence. The snRNA sequence may be a U1, U2, U3, U4, U5, U6, U7, U8, U9 or U10 snRNA sequence.

In some cases, engineered polynucleotides comprising at least a portion of a snRNA sequence (e.g., a snRNA promoter, a snRNA hairpin, etc.) can have superior properties for treating or preventing a disease or disorder relative to comparable polynucleotides lacking these features. For example, as described herein, an engineered polynucleotide comprising at least a portion of a snRNA sequence can promote exon skipping of an exon more effectively than a comparable polynucleotide lacking these features. Furthermore, as described herein, engineered polynucleotides comprising at least a portion of a snRNA sequence can facilitate editing of nucleotide bases in a target RNA (e.g., pre-mRNA or mature RNA) more effectively than comparable polynucleotides lacking these features. The promoter and snRNA components are described in PCT/US2021/028618, which is incorporated herein by reference in its entirety.

Disclosed herein are engineered RNAs comprising (a) an engineered guide RNA as described herein, and (b) a U7 snRNA hairpin sequence, smOPT sequence, or a combination thereof. In some embodiments, the U7 hairpin comprises a human U7 hairpin sequence or a mouse U7 hairpin sequence. In some cases, the human U7 hairpin sequence comprises TAGGCTTTCTGGCTTTTT ACCGGAAAGCCCCT (SEQ ID NO:385 or RNA: UAGGCUUUCU GGCUUUUUACCGGAAAGCCCCU (SEQ ID NO: 386) & in some cases, the mouse U7 hairpin sequence comprises CAGGTTTTCTGACTTCGGTCGGAAAA CCCCT (SEQ ID NO:387 or RNA: CAGGUUUUCUGACUUCGGUC GGAAAACCCCU SEQ ID NO: 1593) & in some embodiments, the SmOPT sequence has the sequence of AATTTTTGGAG (SEQ ID NO:388 or RNA: AAUUUUUGGAG SEQ ID NO: 389.) in some embodiments, the guide RNA from SNCA codon 1TIS of any one of SEQ ID NO:12-384 listed in Table 2 may comprise a guide RNA comprising a U7 hairpin sequence (e.g., human or mouse U7 hairpin sequence), smOPT sequence, or a combination thereof, in some cases, the combination of U7 hairpin sequence and SmOPT sequence may comprise a SmOPT U hairpin sequence, wherein the SmOPT sequence is linked to the U7 sequence.

Also disclosed herein are promoters for driving expression of the guide RNAs disclosed herein. In some cases, the promoter used to drive expression may be 5' to the guide RNA sequences disclosed herein. In some cases, the promoter may comprise a U1 promoter, a U7 promoter, a U6 promoter, or any combination thereof. In some cases, the promoter may comprise a CMV promoter. In some cases, the U7 promoter or the U6 promoter may be a mouse U7 promoter or a mouse U6 promoter. In some cases, the U1 promoter, U7 promoter, or U6 promoter may be a human U1 promoter, a human U7 promoter, or a human U6 promoter. In some cases, the human U6 promoter may comprise sequence ：GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC(SEQ ID NO:390). having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the following sequence, in some cases, the mouse U6 promoter may comprise sequence ：GTACTGAGTCGCCCAGTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCT GTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTTG(SEQ ID NO:391). having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the following sequence, in some cases, the human U7 promoter may comprise sequence ：TTAACAACAACGAAGGGGCTGTGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGGGCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTAAGTTCCTTAGAATATTATTTTTCCTACTGAAAGTTACCACATGCGTCGTTGTTTATACAGTAATAGGAACAAGAAAAAAGTCACCTAAGCTCACCCTCATCAATTGTGGAGTTCCTTTATATCCCATCTTCTCTCCAAACACATACGCA(SEQ ID NO:392). having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the following sequence, in some cases, the mouse U7 promoter may comprise sequence ：TTAACAACATAGGAGCTGTGATTGGCTGTTTT CAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTGGAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGC(SEQ ID NO:393). having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the following sequence, in some cases, the human U1 promoter may comprise sequence ：TAAGGACCAGCTTCTTTGGGAGAGAAC AGACGCAGGGGCGGGAGGGAAAAAGGGAGAGGCAGACGTCACTTCCTCTTGGCGACTCTGGCAGCAGATTGGTCGGTTGAGTGGCAGAAAGGCAGACGGGGACTGGGCAAGGCACTGTCGGTGACATCACGGACAGGGCGACTTCTATGTAGATGAGGCAGCGCAGAGGCTGCTGCTTCGCCACTTGCTGCTTCGCCACGAAGGGAGTTCCCGTGCCCTGGGAGCGGGTTCAGGACCGCTGATCGGAAGTGAGAATCCCAGCTGTGTGTCAGGGCTGGAAAGGGCTCGGGAGTGCGC GGGGCAAGTGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGAGCCCGAAGATCTC(SEQ ID NO:394). having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the following sequence, in some cases, the CMV promoter may comprise sequence having at least about 70%, 75%, 80%, 85%, 95%, or 99% sequence identity to the following sequence ：ATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGAGGATCGAACC(SEQ ID NO:395).

Targets and methods of treatment

The present disclosure provides compositions of engineered guide RNAs or engineered polynucleotides encoding guide RNAs and methods of use thereof, such as methods of treatment. In some embodiments, the engineered polynucleotides of the present disclosure encode guide RNAs that target the coding sequence of the RNA (e.g., TIS). In some embodiments, the engineered polynucleotides of the disclosure encode guide RNAs that target non-coding sequences of RNAs (e.g., polyA sequences). In some embodiments, the present disclosure provides compositions of one or more than one engineered polynucleotide encoding more than one engineered guide RNA targeting TIS, polyA sequences, or any other portion of a coding sequence or non-coding sequence. The engineered guide RNAs disclosed herein facilitate ADAR-mediated RNA editing of adenosine in TIS, polyA sequences, any portion of the coding sequence of the RNA, any portion of the non-coding sequence of the RNA, or any combination thereof.

The present disclosure provides engineered guide RNAs that facilitate SNCA RNA editing upon contact with SNCA RNA to knock down expression of alpha-synuclein proteins. The knockdown achieved by the engineered guide RNAs of the present disclosure results in at least a 10%, at least a 15%, at least a 20%, at least a 25%, at least a 30%, at least a 35%, at least a 40%, at least a 45%, at least a 50%, at least a 55%, at least a 60%, at least a 65%, at least a 70%, at least a 75%, at least a 80%, at least a 85%, at least a 90% or at least a 95% reduction in the α -synuclein protein relative to the amount prior to contacting the engineered guide RNAs with the SNCA RNAs. Alpha-synucleinopathies are characterized by alpha-synuclein dysfunction, overexpression and/or aggregation, and are associated with neurodegenerative diseases by genetic and neuropathological evidence. The gene encoding the alpha-synuclein protein is called SNCA. In Parkinson's Disease (PD), SNCA gene repeats and variations (e.g., a 53T) that promote aggregation of α -synuclein lead to early onset and severe forms of the disease. Thus, the engineered guide RNAs of the present disclosure can target SNCA for RNA editing, driving a reduction in α -synuclein synthesis and facilitating clearance of aggregation. In some embodiments, the present disclosure provides compositions of engineered guide RNAs that target and facilitate ADAR-mediated RNA editing of SNCA to reduce the pathogenic level of a-synuclein by targeting key adenosines present in the Translation Initiation Site (TIS) or 3' utr for deamination. In some embodiments, the engineered guide RNAs of the present disclosure target coding sequences in SNCA. For example, the coding sequence may be the translational start site (TIS) of SNCA (AUG), and the engineered guide RNA may facilitate ADAR-mediated RNA editing of AUG to GUG. For example, as shown in FIG. 1, the hard-linked A to G mutation of the TIS in codon 1 resulted in an approximately 90% decrease in the α -synuclein protein level, and translation was almost completely absent in the hard-linked A to G mutation of the TIS in codons 1 and 5 (ATG to GTG). Thus, the engineered guide RNAs of the present disclosure that target these sites in SNCA are able to facilitate editing, which results in inhibition of translation and a reduction in α -synuclein protein expression. In some embodiments, the engineered guide RNA targeted TIS of the present disclosure is in codon 1 of SNCA. In some embodiments, the engineered guide RNA targeted TIS of the present disclosure is in codon 5 of SNCA. In some embodiments, one or more than one engineered guide RNAs can target TIS in codons 1 and 5. In some embodiments, the engineered guide RNAs of the present disclosure target any key adenosines in SNCA natural TIS. For example, in some embodiments, the engineered guide RNA targets AUG at position 265 in exon 2 of SNCA to facilitate ADAR-mediated editing of GUG, thereby blocking translation and reducing expression of a-synuclein. In some embodiments, the engineered guide RNAs target key adenosines in the 3' utrs of SNCA to facilitate ADAR-mediated editing of a to G, thereby blocking translation and reducing expression of alpha-synuclein. Engineering guide RNAs targeting the 3' utr of SNCA for a-to-G editing can result in inhibition of mRNA export from the nucleus, thereby preventing accessibility of protein translation and resulting in reduced α -synuclein expression. In some embodiments, engineering the guide RNA targets the 3'utr and facilitates ADAR-mediated RNA editing of the 3' utr, resulting in mRNA knockdown and reduced α -synuclein expression. Assays to determine successful RNA editing may include NGS, sanger sequencing (Sanger sequencing), qPCR, ddPCR, fluorescent western blotting, and a-synuclein specific sandwich ELISA. In some embodiments, any of the engineered guide RNAs disclosed herein are packaged in an AAV vector and delivered by a virus.

Editing the target sequence of SNCA RNA from engineered guide RNAs by ADAR, as disclosed herein, can be used to reduce expression of alpha-synuclein proteins. The reduction of alpha-synuclein is useful in the treatment of diseases or conditions associated with alpha-synuclein. In some embodiments, the disease or disorder is synucleinopathy. Editing of target SNCA RNAs described herein with a decrease in α -synuclein levels can be used to reduce or prevent aggregation of α -synuclein proteins. Thus, one or more symptoms associated with α -synuclein aggregation (e.g., synucleinopathies) can be treated by administering the engineered guide RNAs described herein.

As disclosed herein, administration of the engineered guide RNAs described herein that target SNCA RNAs to a subject can be used to treat a disease or disorder associated with α -synuclein, including treatment of one or more symptoms associated with the disease or disorder. In some embodiments, the disease or condition may be parkinson's disease. In some embodiments, one or more symptoms of parkinson's disease can be treated by administering an engineered guide RNA that targets SNCA RNA as described herein. For example, administration of the engineered guide RNA may be sufficient to reduce resting tremor (resting tremor), muscle stiffness, difficulty standing, difficulty walking, difficulty body movement, involuntary movement, muscle rigidity, coordination problems, rhythmic muscle contractions, slow body movement, bradykinesia, slow moving gait, or any combination thereof. In some embodiments, the treatment of parkinson's disease comprises an improvement in cognitive function. For example, a subject administered an SNCA-targeted engineered guide RNA of the present disclosure may show an increase in cognitive ability propensity or motor skill testing relative to performance prior to administration. In some embodiments, the subject may exhibit improvement in a unified parkinson's disease score scale (UPDRS) test, such as an MDS-UPDRS test. In some embodiments, the subject may be assessed by imaging techniques (such as MRI or CAT scan) to monitor the progression of the disease or disorder. For example, MRI imaging may be used to visualize neurons of a subject during treatment to monitor the progress of the treatment. In some embodiments, degeneration of neuronal cells in substantia nigra may be monitored throughout the treatment period.

As disclosed herein, administration of the engineered guide RNAs of the present disclosure can be used to reduce α -synuclein protein levels by knockdown to treat diseases or conditions associated with α -synuclein. Despite the reduction obtained by administration, residual α -synuclein may still be present after administration. In some cases, the presence of reduced α -synuclein protein levels treats a disease or disorder without reducing the α -synuclein protein levels to zero. Such levels may be determined in an in vitro assay using a sample obtained from the subject. In some cases, the level may be determined in vivo using, for example, imaging techniques (such as MRI described above). Treatment may result in improvement of certain biomarkers in a subject. For example, the treatment may result in a decrease in SNCA in CSF, a decrease in SNCA in blood, a decrease in neurofilament a levels in CSF, or any combination thereof.

In some embodiments, the engineered guide RNA targets a non-coding sequence in SNCA. The non-coding sequence may be a polyA signal sequence, and the engineered guide RNA may promote ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence of SNCA. In some embodiments, the engineered guide RNAs of the present disclosure may be multiplexed to target more than one polyA signal sequence in SNCA. In some embodiments, the engineered guide RNAs of the present disclosure can be multiplexed to target TIS and one or more polyA signal sequences in SNCA. In some embodiments, the engineered guide RNAs of the present disclosure that target canonical TIS at codon 1 of exon 2 of SNCA (NCBI reference sequence: nucleotide position 226 of nm_ 000345.4) may be multiplexed with one or more additional engineered guide RNAs that target a different TIS of SNCA, such as the codon 5 translation initiation site of exon 2. Alternatively or additionally, one or more engineered guide RNAs of the present disclosure that target a canonical TIS at codon 1 of exon 2 of SNCA (NCBI reference sequence: nucleotide position 226 of nm_ 000345.4) may be multiplexed with one or more engineered guide RNAs that target a different sequence of SNCA, such as the 5'utr region of SNCA (e.g., kozak sequence, internal Ribosome Entry Site (IRES), or Iron Response Element (IRE) of the 5' utr). In some embodiments, the engineered guide RNAs can be multiplexed to target non-coding and coding sequences in SNCA. The engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of SNCA, thereby achieving protein knockdown. In each of these cases, the multiple engineered guide RNAs may be delivered together in the same viral vector, or each of the different engineered guide RNAs may be delivered together in separate vectors.

In some embodiments, the present disclosure provides engineered guide RNAs that facilitate editing at multiple adenosines. Hydrolytic deamination of multiple adenosines in RNA can be referred to as over-editing (hyper-editing). In some cases, over editing can occur in cis (e.g., in Alu elements) or trans (e.g., in the target RNA by engineering the guide RNA). In some cases, over-editing may include editing the polyA signal sequence of the SNCA target RNA. In some cases, over-editing can introduce editing in at least 2 or more nucleotides of the subject target RNA. In some cases, the over-editing may introduce at least or at most about 2、4、6、8、10、12、14、16、18、20、22、24、26、28、30、32、34、36、38、40、42、44、46、48、50、52、54、56、58、60、62、64、66、68、70、72、74、76、78、80、82、84、86、88、90、92、94、96、98 edits, or at least or at most about 100 edits, in the region of the target RNA. In one embodiment, the over-editing may occur in an untranslated region, a translated region, a 3'utr, a 5' utr, or any combination thereof.

In some embodiments, the engineered guide RNAs of the present disclosure promote ADAR-mediated RNA editing of 1% to 100% of target adenosines. The engineered guide RNAs of the present disclosure can promote 40% to 90% targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing by at least 5%. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing by at least 10%. 15% of target adenosine was edited. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing by at least 20%. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing by at least 25%. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing by at least 30%. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing of at least 35%. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing by at least 40%. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing of at least 45%. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing by at least 50%. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 55% target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 60% target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing of at least 65%. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing by at least 70%. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing of at least 75%. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 80% target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing by at least 85%. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 90% editing of target adenosine. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 95% target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote 100% target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote 5% to 20% target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing by 20% to 40%. In some embodiments, the engineered guide RNAs of the present disclosure can promote 40% to 60% target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote 60% to 80% target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote 80% to 100% target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote 60% to 80% target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote 70% to 90% target adenosine editing.

In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing of at least 70% or more. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing of at least 80% or more. In some embodiments, the engineered guide RNAs of the present disclosure can promote target adenosine editing up to 90% or more. Optionally, in addition, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of off-target RNA editing while maintaining less than 30% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 25% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of off-target RNA editing while maintaining less than 20% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of off-target RNA editing while maintaining less than 15% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of off-target RNA editing while maintaining less than 10% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining off-target adenosine editing of less than 9%. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 8% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of off-target RNA editing while maintaining less than 7% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 6% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining off-target adenosine editing of less than 5%. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of off-target RNA editing while maintaining less than 4% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 3% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 2% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 1% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining 0% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 30% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 29% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 28% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 27% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 26% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 25% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 24% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 23% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 22% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 21% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 20% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 19% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 18% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 17% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 16% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 15% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 14% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 13% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 12% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 11% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 10% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 9% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 8% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 7% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 6% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 5% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 4% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 3% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 2% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining less than 1% off-targeted adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can promote at least 70% targeted adenosine editing while maintaining 0% off-targeted adenosine editing.

In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of SNCA, which results in knockdown at the protein level. Knock-down of protein levels is quantified as a decrease in alpha-synuclein protein expression. The engineered guide RNAs of the present disclosure can promote 1% to 100% α -synuclein knockdown. The engineered guide RNAs of the present disclosure may promote α -synuclein knockdown by 1% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%, 90% to 100%, 20% to 40%, 30% to 50%, 40% to 60%, 50% to 70%, 60% to 80%, 20% to 50%, 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or at least 90%. In some embodiments, the engineered guide RNAs of the present disclosure promote 30% to 60% α -synuclein knockdown. Alpha-synuclein knockdown can be measured by an assay that compares a sample or subject treated with an engineered guide RNA to a control sample or subject not treated with an engineered guide RNA.

The engineered guide RNAs of the present disclosure are useful in methods of treating a disorder in a subject in need thereof. The condition may be a disease, disorder, genotype, phenotype, or any state associated with a side effect. In some embodiments, treating a disorder may include preventing the disorder, slowing the progression of the disorder, reversing or alleviating the symptoms of the disorder. Methods of treating a disorder can include delivering an engineered polynucleotide encoding an engineered guide RNA to a cell of a subject in need thereof, and expressing the engineered guide RNA in the cell. In some embodiments, the engineered guide RNAs of the present disclosure are useful for treating genetic disorders (e.g., synucleinopathies, such as parkinson's disease). In some embodiments, the engineered guide RNAs of the present disclosure can be used to treat disorders associated with one or more mutations.

Pharmaceutical composition

The compositions described herein (e.g., compositions comprising an engineered guide RNA or an engineered polynucleotide) can be formulated with a pharmaceutically acceptable carrier for administration to a subject (e.g., a human or non-human animal). Pharmaceutically acceptable carriers can include, but are not limited to, phosphate buffered saline solutions, water, emulsions (e.g., oil/water emulsions or water/oil emulsions), glycerin, liquid polyethylene glycols, aprotic solvents (e.g., dimethylsulfoxide, N-methylpyrrolidone, or mixtures thereof), various types of wetting agents, solubilizing agents, antioxidants, fillers, protein carriers (such as albumin), any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintegrants (e.g., potato starch or sodium starch glycolate), and the like. The composition may further comprise a stabilizer and a preservative. Other examples of carriers, stabilizers, and adjuvants consistent with the compositions of the present disclosure can be found, for example, in Remington's Pharmaceutical Sciences, 21 st edition, mack publication co., easton, pa. (2005), the entire contents of which are incorporated herein by reference.

In some examples, the pharmaceutical composition may be formulated in unit dosage form or in multi-dosage form. In some examples, the unit dosage form may be a physically discrete unit suitable for administration to a human or non-human subject (e.g., an animal). In some examples, the unit dosage forms may be packaged separately. In some examples, each unit dose contains a predetermined amount of active ingredient sufficient to produce the desired therapeutic effect associated with the pharmaceutical carrier, diluent, excipient, or any combination thereof. In some examples, the unit dosage form comprises an ampoule, a syringe, or individually packaged tablets and capsules, or any combination thereof. In some cases, the unit dosage form may be contained in a single use syringe. In some cases, the unit dosage form may be administered in fractions or multiples thereof. In some examples, the multiple dosage form comprises multiple identical unit dosage forms packaged in a single container, which may be administered in separate unit dosage forms. In some examples, the multi-dose form comprises a vial, tablet or capsule bottle or pint or gallon bottle. In some cases, the multiple dosage forms comprise the same pharmaceutically active agent. In some cases, the multiple dosage forms comprise different pharmaceutically active agents.

In some examples, the pharmaceutical composition comprises a pharmaceutically acceptable excipient. In some examples, the excipient comprises a buffer, a cryopreservative, a preservative, a stabilizer, a binder, a compacting agent, a lubricant, a chelating agent, a dispersion enhancing agent, a disintegrant, a flavoring agent, a sweetener, or a coloring agent, or any combination thereof.

In some examples, the excipient comprises a buffer. In some examples, the buffer includes sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, calcium bicarbonate, or any combination thereof. In some examples, the buffer includes sodium bicarbonate, potassium bicarbonate, magnesium hydroxide, magnesium lactate, magnesium gluconate, aluminum hydroxide, sodium citrate, sodium tartrate, sodium acetate, sodium carbonate, sodium polyphosphate, potassium polyphosphate, sodium pyrophosphate, potassium pyrophosphate, disodium hydrogen phosphate, dipotassium hydrogen phosphate, trisodium phosphate, tripotassium phosphate, potassium metaphosphate, magnesium oxide, magnesium hydroxide, magnesium carbonate, magnesium silicate, calcium acetate, calcium glycerophosphate, calcium chloride or calcium hydroxide, and other calcium salts, or any combination thereof.

In some examples, the excipient comprises a cryopreservative. In some examples, the cryopreservative comprises DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof. In some examples, the cryopreservative comprises sucrose, trehalose, starch, salts of any of these, derivatives of any of these, or any combination thereof. In some examples, the excipients include pH agents (to minimize oxidation or degradation of the composition components), stabilizers (to prevent modification or degradation of the composition components), buffers (to enhance temperature stability), solubilizing agents (to increase protein solubility), or any combination thereof. In some examples, the excipient comprises a surfactant, sugar, amino acid, antioxidant, salt, nonionic surfactant, solubilizing agent, triglyceride, alcohol, or any combination thereof. In some examples, the excipient comprises sodium carbonate, acetate, citrate, phosphate, polyethylene glycol (PEG), human Serum Albumin (HSA), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, HCl, disodium edetate, lecithin, glycerol, xanthan gum rubber, soy isoflavone, polysorbate 80, ethanol, water, teprenone (teprenone), or any combination thereof. In some examples, the excipient may be an excipient described in Handbook of Pharmaceutical Excipients, american Pharmaceutical Association (1986).

In some examples, the excipient comprises a preservative. In some examples, the preservative includes antioxidants, such as alpha-tocopherol and ascorbate; antibacterial agents such as parahydroxybenzoate, chlorobutanol and phenol; or any combination thereof. In some examples, the antioxidant includes EDTA, citric acid, ascorbic acid, butylated Hydroxytoluene (BHT), butylated Hydroxyanisole (BHA), sodium sulfite, para-aminobenzoic acid, glutathione, propyl gallate, cysteine, methionine, ethanol, or N-acetylcysteine, or any combination thereof. In some examples, the preservative includes validamycin (validamycin) A, TL-3, sodium orthovanadate, sodium fluoride, N-a-tosyl-Phe-chloromethyl ketone, N-a-tosyl-Lys-chloromethyl ketone, aprotinin, phenylmethylsulfonyl fluoride, diisopropylfluorophosphate, kinase inhibitor, phosphatase inhibitor, caspase inhibitor, granzyme inhibitor, cell adhesion inhibitor, cell division inhibitor, cell cycle inhibitor, lipid signaling inhibitor, protease inhibitor, reducing agent, alkylating agent, antibacterial agent, oxidase inhibitor, or other inhibitor, or any combination thereof.

In some examples, the excipient comprises a binder. In some examples, the binder includes starch, pregelatinized starch, gelatin, polyvinylpyrrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamide, polyvinyl oxazolidone (polyvinyloxoazolidone), polyvinyl alcohol, C12-C18 fatty acid alcohols, polyethylene glycol, polyols, saccharides, oligosaccharides, or any combinations thereof.

In some examples, the binder may be a starch, such as potato starch, corn starch, or wheat starch; sugars such as sucrose, glucose, dextrose, lactose or maltodextrin; natural and/or synthetic gums; gelatin; cellulose derivatives such as microcrystalline cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methylcellulose, carboxymethyl cellulose, methyl cellulose or ethyl cellulose; polyvinylpyrrolidone (povidone); polyethylene glycol (PEG); a wax; calcium carbonate; a calcium phosphate; alcohols such as sorbitol, xylitol, mannitol, or water, or any combination thereof.

In some examples, the excipient comprises a lubricant. In some examples, the lubricant includes magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oil (sterotex), polyoxyethylene monostearate, talc, polyethylene glycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, or light mineral oil, or any combination thereof. In some examples, the lubricant includes a metal stearate (such as magnesium stearate, calcium stearate, aluminum stearate), a fatty acid ester (such as sodium stearyl fumarate), a fatty acid (such as stearic acid), a fatty alcohol, glyceryl behenate, a mineral oil, a paraffin wax, a hydrogenated vegetable oil, leucine, polyethylene glycol (PEG), a metal lauryl sulfate (such as sodium lauryl sulfate, magnesium lauryl sulfate), sodium chloride, sodium benzoate, sodium acetate, or talc, or a combination thereof.

In some examples, the excipient includes a dispersion enhancer. In some examples, the dispersion enhancing agent includes starch, alginic acid, polyvinylpyrrolidone, guar gum, kaolin, bentonite, purified lignocellulose, sodium starch glycolate, isosilicate or microcrystalline cellulose, or any combination thereof, as the high HLB emulsifier surfactant.

In some examples, the excipient comprises a disintegrant. In some examples, the disintegrant comprises a non-effervescent disintegrant. In some examples, the non-effervescent disintegrants include starches such as corn starch, potato starch, pregelatinized and modified starches thereof; a sweetener; clays such as bentonite, microcrystalline cellulose, alginate, sodium starch glycolate; or gums such as agar, guar gum, locust bean gum, karaya gum, pectin, and tragacanth gum; or any combination thereof. In some examples, the disintegrant comprises an effervescent disintegrant. In some examples, suitable effervescent disintegrants include a combination of bicarbonate and citric acid, and a combination of sodium bicarbonate and tartaric acid.

In some examples, the excipient comprises a sweetener, a flavoring agent, or both. In some examples, sweeteners include glucose (corn syrup), dextrose, invert sugar, fructose, and mixtures thereof (when not used as a carrier); saccharin and its various salts, such as sodium salts; dipeptide sweeteners such as aspartame (aspartame); dihydrochalcone compounds, glycyrrhizin; stevia rebaudiana (Stevia Rebaudiana) (stevioside (Stevioside)); chloro derivatives of sucrose, such as sucralose; and sugar alcohols such as sorbitol, mannitol, sugar alcohols, and the like, or any combination thereof. In some cases, flavoring agents incorporated into the compositions include synthetic flavoring oils and flavoring fragrances; natural oil; extracts from plants, leaves, flowers and fruits; or any combination thereof. In some examples, the flavoring agent comprises cinnamon oil; wintergreen oil; peppermint oil; clover oil; a hay oil; fennel oil; eucalyptus; herb of vanilla; citrus oils such as lemon oil, orange oil, grape oil, and grapefruit oil; and fruit flavors including apples, peaches, pears, strawberries, raspberries, cherries, plums, pineapples and apricots, or any combination thereof.

In some examples, the excipient comprises a pH agent (e.g., to minimize oxidation or degradation of the composition components), a stabilizer (e.g., to prevent modification or degradation of the composition components), a buffer (e.g., to enhance temperature stability), a solubilizing agent (e.g., to increase protein solubility), or any combination thereof. In some examples, the excipient comprises a surfactant, sugar, amino acid, antioxidant, salt, nonionic surfactant, solubilizing agent, triglyceride, alcohol, or any combination thereof. In some examples, the excipient comprises sodium carbonate, acetate, citrate, phosphate, polyethylene glycol (PEG), human Serum Albumin (HSA), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, HCl, disodium edetate, lecithin, glycerol, xanthan gum rubber, soy isoflavone, polysorbate 80, ethanol, water, teprenone, or any combination thereof. In some examples, the excipient comprises a cryopreservative. In some examples, the excipient comprises DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof. In some examples, the excipient comprises sucrose, trehalose, starch, salts of any of these, derivatives of any of these, or any combination thereof.

In some examples, the pharmaceutical composition comprises a diluent. In some examples, the diluent comprises water, glycerol, methanol, ethanol, or other similar biocompatible diluents, or any combination thereof. In some examples, the diluent includes an aqueous acid, such as acetic acid, citric acid, maleic acid, hydrochloric acid, phosphoric acid, nitric acid, sulfuric acid, or any combination thereof. In some examples, the diluent includes an alkali metal carbonate, such as calcium carbonate; alkali metal phosphates such as calcium phosphate; alkali metal sulfates such as calcium sulfate; cellulose derivatives such as cellulose, microcrystalline cellulose, cellulose acetate; magnesium oxide, dextrin, fructose, dextrose, glyceryl palmitate, lactitol, choline, lactose, maltose, mannitol, simethicone, sorbitol, starch, pregelatinized starch, talc, xylitol and/or dehydrates, hydrates and/or pharmaceutically acceptable derivatives thereof or combinations thereof.

In some examples, the pharmaceutical composition comprises a carrier. In some examples, the carrier includes a liquid or solid filler, solvent, or encapsulating material. In some examples, the carrier includes additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides; derivatized sugars, such as sugar alcohols, aldonic acids, esterified sugars, etc., and polysaccharides or sugar polymers), used alone or in combination.

Delivery of

An engineered guide RNA of the present disclosure (such as an engineered guide RNA having a polynucleotide sequence of any one of SEQ ID NOs: 12-384 listed in table 2, which targets SNCA codon 1 TIS) or an engineered polynucleotide of the present disclosure (e.g., an engineered polynucleotide encoding an engineered guide RNA) can be delivered by a delivery vehicle. In some embodiments, the delivery vehicle is a carrier. The vector may facilitate delivery of the engineered guide RNA into the cell to genetically modify the cell. In some examples, the vector comprises DNA, such as double-stranded or single-stranded DNA. In some examples, the delivery vector may be a eukaryotic vector, a prokaryotic vector (e.g., bacterial vector or plasmid), a viral vector, or any combination thereof. In some embodiments, the vector is an expression cassette. In some embodiments, the viral vector comprises a viral capsid, an inverted terminal repeat, and the engineered polynucleotide can be used to deliver the engineered guide RNA to a cell.

In some embodiments, the viral vector may be a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, an alphaviral vector, a lentiviral vector (e.g., human or porcine), a herpes viral vector, an Epstein-barr viral vector (Epstein-Barr virus vector), an SV40 viral vector, a poxviral vector, or a combination thereof. In some embodiments, the viral vector may be a recombinant vector, a hybrid vector, a chimeric vector, a self-complementing vector, a single stranded vector, or any combination thereof.

In some embodiments, the viral vector may be an adeno-associated virus (AAV). In some embodiments, the AAV may be any AAV known in the art. In some embodiments, the viral vector may be of a particular serotype. In some embodiments, the viral vector can be an AAV1 serotype, an AAV2 serotype, an AAV3 serotype, an AAV4 serotype, an AAV5 serotype, an AAV6 serotype, an AAV7 serotype, an AAV8 serotype, an AAV9 serotype, an AAV10 serotype, an AAV11 serotype, an AAV 12 serotype, an AAV3B serotype, an AAV14 serotype, an AAV15 serotype, an AAV16 serotype, an AAV8 serotype, an AAV10 serotype, an AAV 20 serotype, an rh39 serotype, an AAV 74 serotype, an aav.rhm4-1 serotype, an aav.hu37 serotype, an aav.ank80 serotype, an aav.ank80l65 serotype, an aav.7m8 serotype, an aav.php.b serotype, an AAV2.5 serotype, an AAV2. tYF serotype, an AAV3B serotype, an aav.lk03 serotype, an aav.hsc1 serotype, an aav.hsc2 serotype, an aav.3 serotype, an aav.4, an aav.5, an aav.539, an aav.hsc serotype, an aav.5, an aav.539, an aav.hsc.hsc-3 serotype, an aav.539, an aav.hsc-5 serotype, an aav.hsc-5, an aav.h-5 serotype, an aav.h-5, an aav.h-a.h-3 serotype, an-a.h-3 serotype, derivatives of any of these serotypes, or any combination thereof.

In some embodiments, the AAV vector may be a recombinant vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single stranded AAV, or any combination thereof.

In some embodiments, the AAV vector may be a recombinant AAV (rAAV) vector. Methods of producing recombinant AAV vectors are known in the art and, in some cases, generally involve introducing into a producer cell line: (1) DNA necessary for AAV replication and AAV capsid synthesis, (b) one or more helper constructs containing viral functions deleted in the AAV vector, (c) helper viruses, and (d) plasmid constructs containing the AAV vector genome, e.g., ITRs, promoters, and engineered guide RNA sequences, etc. In some embodiments, the viral vectors described herein may be engineered by synthetic or other suitable means, with reference to published sequences, such as those available in the literature. For example, the genomic and protein sequences of the various serotypes of AAV, as well as the sequences of the natural Terminal Repeats (TR), rep proteins, and capsid subunits, are known in the art and can be found in the literature or in public databases such as the gene bank (GenBank) or Protein Database (PDB).

In some examples, methods of producing a delivery vector herein comprise packaging an engineered polynucleotide of the disclosure (e.g., an engineered polynucleotide encoding an engineered guide RNA) in an AAV vector. In some examples, methods of producing a delivery vehicle described herein comprise (a) introducing into a cell: (i) A polynucleotide comprising a promoter and an engineered guide RNA as disclosed herein; and (ii) a viral genome comprising a replication (Rep) gene and a capsid (Cap) gene encoding a wild-type AAV capsid protein or modified version thereof; (b) Expressing a wild-type AAV capsid protein or modified version thereof in a cell; (c) assembling AAV particles; and (d) packaging the engineered guide RNAs disclosed herein in an AAV particle, thereby producing an AAV delivery vector. In some examples, the recombinant vector comprises one or more inverted terminal repeats, and the inverted terminal repeat comprises a 5 'inverted terminal repeat, a 3' inverted terminal repeat, and a mutated inverted terminal repeat. In some examples, the mutated terminal repeat sequence lacks a terminal resolution site, thereby being capable of forming a self-complementary AAV.

In some examples, a hybrid AAV vector may be produced by transcapsular action, e.g., packaging Inverted Terminal Repeats (ITRs) from a first serotype into a capsid of a second serotype, where the first and second serotypes may be different. In some examples, the Rep genes and ITRs from a first AAV serotype (e.g., AAV 2) can be used in a capsid from a second AAV serotype (e.g., AAV5 or AAV 9), wherein the first and second AAV serotypes can be different. As a non-limiting example, a hybrid AAV serotype comprising AAV2 ITRs and AAV9 capsid proteins may be denoted AAV2/9. In some examples, the hybrid AAV delivery vector comprises an AAV2/1, AAV2/2, AAV 2/4, AAV2/5, AAV2/6, AAV2/8, or AAV2/9 vector.

In some examples, the AAV vector may be a chimeric AAV vector. In some examples, the chimeric AAV vector comprises exogenous amino acids or amino acid substitutions, or capsid proteins from two or more serotypes. In some examples, the chimeric AAV vector can be genetically engineered to increase transduction efficiency, selectivity, or a combination thereof.

In some examples, the AAV vector comprises a self-complementary AAV genome. Self-complementary AAV genomes are generally known in the art and contain two DNA strands that can anneal together to form double stranded DNA.

In some examples, the delivery vector may be a retroviral vector. In some examples, the retroviral vector may be a moloney murine (Moloney Murine) leukemia virus vector, a spleen necrosis virus vector, or a vector derived from rous sarcoma virus (Rous Sarcoma Virus), hawy sarcoma virus (Harvey Sarcoma Virus), avian leukemia virus, human immunodeficiency virus, myeloproliferative sarcoma virus, or breast tumor virus, or a combination thereof. In some examples, retroviral vectors may be transfected such that most of the sequences encoding the structural genes of the virus (e.g., gag, pol, and env) may be deleted and replaced by the genes of interest.

In some examples, the delivery vehicle may be a non-viral vector. In some examples, the delivery vehicle may be a plasmid. In some examples, the plasmid comprises DNA. In some examples, the plasmid comprises circular double stranded DNA. In some examples, the plasmid may be linear. In some examples, the plasmid comprises one or more genes of interest and one or more regulatory elements. In some examples, the plasmid comprises a bacterial backbone that contains an origin of replication and an antibiotic resistance gene or other selectable marker for plasmid amplification in bacteria. In some examples, the plasmid may be a small circular plasmid. In some examples, the plasmid comprises one or more genes that provide selectable markers to induce the target cell to retain the plasmid. In some examples, the plasmid may be formulated for delivery by injection through a syringe carrying a needle. In some examples, the plasmid may be formulated for delivery by electroporation. In some examples, the plasmid may be engineered by synthesis or other suitable methods known in the art. For example, in some examples, genetic elements can be assembled by restriction digestion of a desired genetic sequence from a donor plasmid or organism to produce a DNA end, which can then be readily ligated to another genetic sequence.

In some embodiments, the vector containing the engineered guide RNA or the engineered polynucleotide is a non-viral vector system. In some embodiments, the non-viral vector system comprises a cationic lipid or polymer. For example, the non-viral vector system may be a liposome or a polymeric nanoparticle. In some embodiments, the engineered polynucleotide or the non-viral vector comprising the engineered polynucleotide is delivered to the cell by hydraulic injection or ultrasound.

Application of

Administration can refer to methods that can be used to deliver the compositions described herein (e.g., comprising an engineered guide RNA or an engineered polynucleotide encoding the same) to a desired biological site of action. For example, an engineered guide RNA (such as an engineered guide RNA having the polynucleotide sequence of any one of SEQ ID NOS: 12-384 listed in Table 2, which targets SNCA codon 1 TIS) may be included in a DNA construct, a viral vector, or both, and administered by intravenous administration. Administration of the regions disclosed herein in need of treatment or therapy may be accomplished by, for example, but not limited to, oral administration, topical administration, intravenous administration, inhalation administration, or any combination thereof. In some embodiments of the present invention, in some embodiments, delivery may include inhalation, ear, cheek, conjunctiva, dentistry, endocervical, sinus, intratracheal, enteral, epidural, extraamniotic, extracorporeal, hemodialysis, invasive, interstitial, intraperitoneal, intra-amniotic, intraarterial, intra-articular, intrabiliary, intrabronchial, intracapsular, intracardiac, intracartilaginous, intracavitary, intraventricular, intracardiac, intracorporal, intraocular intracisternal, intracorneal, intracoronary, intracorporal, intracavernosal, intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intravaginal, intrahippocampal, intraileal, intralesional, intraluminal, intralymphatic, intramedullary, intramural, intramuscular, intraocular, intraovarian, intracardiac, intracorporeal, and intraspinal intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intracavitary, intraspinal, intrasynovial, intratendinous, intrathecal, intrathoracic, intratubular, intratumoral, intrathecal, intrauterine, intravascular, intravenous bolus, intravenous drip, intravesical, intravitreal, iontophoresis, irrigation, laryngeal, nasal, nasogastric, ocular, oral, oropharyngeal, parenteral, transdermal, periarticular, epidural, peri-nerve, peri-dental, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urinary tract, vaginal, infraorbital, intraparenchymal, intrathecal, intraventricular, stereotactical, or any combination thereof. Delivery may include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular or infusion), oral administration, inhalation administration, intraduodenal administration, rectal administration, or combinations thereof. Delivery may include direct application to affected tissue or areas of the body. In some cases, topical application may include applying a lotion, solution, emulsion, cream, sesame oil, paste, stick, aerosol, foam, jelly, foam, mask, pad, powder, solid, tincture, butter, patch, gel, spray, drops, liquid formulation, ointment to an external surface of a surface, such as skin. Delivery may include substantial injection, intrathecal injection, intraventricular injection, or intracisternal injection. The compositions provided herein may be applied by any method. The method of administration may be by intra-arterial injection, intracisternal injection, intramuscular injection, intraparenchymal injection, intraperitoneal injection, intrathecal injection, intravenous injection, intraventricular injection, stereotactic injection, subcutaneous injection, epidural injection, or any combination thereof. Delivery may include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular or infusion administration). In some embodiments, the delivery may include nanoparticles, liposomes, exosomes, extracellular vesicles, implants, or combinations thereof. In some cases, delivery may be by the device. In some cases, delivery may be by a pump, infusion pump, or a combination thereof. In some embodiments, delivery may be by enema, eye drops, nasal spray, or any combination thereof. In some cases, the subject may administer the composition without supervision. In some cases, the subject may administer the composition under the supervision of a medical professional (e.g., doctor, nurse, doctor assistant, caregiver, end care worker, etc.). In some embodiments, the medical professional may administer the composition.

In some examples, the pharmaceutical compositions disclosed herein may be administered at a dosage level sufficient to deliver from about 0.0001mg/kg to about 100mg/kg, from about 0.001mg/kg to about 0.05mg/kg, from about 0.005mg/kg to about 0.05mg/kg, from about 0.001mg/kg to about 0.005mg/kg, from about 0.05mg/kg to about 0.5mg/kg, from about 0.01mg/kg to about 50mg/kg, from about 0.1mg/kg to about 40mg/kg, from about 0.5mg/kg to about 30mg/kg, from about 0.01mg/kg to about 10mg/kg, from about 0.1mg/kg to about 10mg/kg, or from about 1mg/kg to about 25mg/kg of subject body weight once or multiple times per day to obtain the desired therapeutic, diagnostic, or prophylactic effect.

The appropriate dosage and treatment regimen of the treatment methods described herein will vary depending on the particular disease being treated, the gRNA and/or ADAR delivered (or vector encoding the gRNA and/or ADAR), and the particular disorder in the subject. In some examples, administration may be continued for a period of time until a desired effect is achieved (e.g., a reduction in symptoms may be achieved). In some examples, administration may be 1,2, 3,4, 5, 6, or 7 times per week. In some examples, administration or application of the compositions disclosed herein may be for a treatment duration of at least about 1 week, at least about 1 month, at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, at least about 10 years, at least about 15 years, at least about 20 years, or more. In some examples, administration may be for a period of 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, or 10 weeks. In some examples, administration may be for a period of 2 months, 3 months, 4 months, 5 months, 6 months, or longer. In some examples, administration may be repeated throughout the lifetime of the subject, such as once a month or once a year throughout the lifetime of the subject. In some examples, administration may be repeated for a substantial portion of the subject's lifetime, such as once a month or once a year, for at least about 1 year, 5 years, 10 years, 15 years, 20 years, 25 years, 30 years, or more. In some instances, treatment may resume after a period of remission.

In some cases, administration may be oral ingestion. In some cases, administration may be capsules or tablets. Oral intake delivery may include tea, elixir, food, drink, beverage, syrup, liquid, gel, capsule, tablet, oil, tincture, or any combination thereof. In some embodiments, the food product may be a medical food product. In some cases, the capsule may comprise hydroxymethyl cellulose. In some embodiments, the capsule may comprise gelatin, hydroxypropyl methylcellulose, pullulan (pullulan), or any combination thereof. In some cases, the capsule may comprise a coating, such as an enteric coating. In some embodiments, the capsule may comprise a vegetarian or pure product, such as hydroxypropyl methylcellulose capsule. In some embodiments, the delivery may include inhalation by an inhaler, a diffuser, a nebulizer, a vaporizer, or a combination thereof.

In some embodiments, disclosed herein may be a method comprising administering a composition disclosed herein to a subject (e.g., a human) in need thereof. In some cases, the methods can treat (including prevent) a disease in a subject.

Definition of the definition

Unless defined otherwise, all technical, scientific and technical terms or terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art to which claimed subject matter belongs. In some cases, terms with commonly understood meanings are defined herein for clarity and/or for ease of reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is commonly understood in the art.

Throughout the present application, various embodiments are presented in a range format. It should be understood that the description of the range format is merely for convenience and brevity and should not be interpreted as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all possible sub-ranges as well as individual values within the range. For example, descriptions of ranges such as 1 to 6 should be considered to have specifically disclosed sub-ranges such as 1 to 3,1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within the ranges, e.g., 1,2, 3, 4, 5, and 6. This applies to any range of widths.

As used herein, the term "about" a number may refer to the number plus or minus 10% of the number.

As disclosed herein, "bulge" refers to a structure that is formed substantially only upon formation of a guide-target RNA scaffold, wherein consecutive nucleotides in the engineered guide RNA or target RNA are not complementary to their positional counterparts on the opposite strand. The projections may independently have 0 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the target RNA side of the guide-target RNA scaffold, or the projections may independently have 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold. However, a bulge as used herein does not refer to a structure in which a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA do not base pair, which are referred to herein as "mismatches". Furthermore, when the number of participating nucleotides on the guide RNA side or on the target RNA side exceeds 4, the resulting structure is no longer considered as a bulge, but rather as an "inner loop". "symmetrical projections" means that the same number of nucleotides are present on each side of the projections. An "asymmetric bulge" refers to the presence of a different number of nucleotides on each side of the bulge.

The term "complementary" or "complementarity" refers to the ability of a nucleic acid to form one or more bonds with a corresponding nucleic acid sequence by, for example, hydrogen bonding (e.g., conventional Watson-Crick), covalent bonding, or other similar means. In Watson-Crick base pairing, double hydrogen bonds are formed between nucleobases T and A, while triple hydrogen bonds are formed between nucleobases C and G. For example, the sequence A-G-T may be complementary to the sequence T-C-A. Percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 of 10 are 50%, 60%, 70%, 80%, 90% and 100% complementary, respectively). "fully complementary" may mean that all consecutive residues of a nucleic acid sequence will form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used herein, "substantially complementary" may refer to a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% over a region of 10, 15, 20, 25, 30, 35, 40, 45, 50 or more nucleotides, or may refer to two nucleic acids that hybridize under stringent conditions (i.e., stringent hybridization conditions). The nucleic acid may include a non-specific sequence. As used herein, the term "non-specific sequence" or "non-specific" may refer to a nucleic acid sequence that contains a series of residues that may not be designed to be complementary or only partially complementary to any other nucleic acid sequence.

The terms "determining," "measuring," "evaluating," "assessing," "determining," and "analyzing" are used interchangeably herein to refer to the form of measurement. These terms include determining whether an element is present (e.g., detecting). These terms may include quantitative, qualitative, or both quantitative and qualitative determinations. Assessment may be relative or absolute. "detecting the presence of a thing" may include determining the amount of something present in addition to determining the presence or absence of something from the context.

The term "encoding" as used herein refers to the ability of a polynucleotide to provide sufficient information or sequences of instructions to produce the corresponding gene expression product. In one non-limiting example, mRNA may encode a polypeptide during translation, while DNA may encode an mRNA molecule during transcription.

By "engineered latent guide RNA" is meant an engineered guide RNA comprising a portion of the sequence that, upon hybridization or only upon hybridization to a target RNA, substantially forms at least a portion of the structural features, rather than a single a/C mismatch feature at the target adenosine to be edited.

As used herein, the term "facilitating RNA editing by engineering guide RNAs" refers to the ability of an engineered guide RNA to provide targeted editing of a target RNA by an RNA editing entity when associated with the RNA editing entity and the target RNA. In some cases, the engineered guide RNAs can directly recruit or position/orient RNA editing entities to the appropriate location for editing the target RNAs. In other cases, the engineered guide RNAs, upon hybridization to the target RNAs, form a guide-target RNA scaffold having one or more structural features as described herein, wherein the guide-target RNA scaffold having structural features recruits or positions/directs the RNA editing entity to the appropriate location to edit the target RNAs.

As disclosed herein, a "primer-target RNA scaffold" is a double-stranded RNA with a latent structure formed after hybridization of a guide RNA to a target RNA. The primer-target RNA scaffold has one or more structural features that form in the double-stranded RNA duplex after hybridization. For example, the guide-target RNA scaffold may have one or more structural features selected from the group consisting of a bulge, a mismatch, a loop, a hairpin, or a wobble base pair.

As disclosed herein, a "hairpin" includes an RNA duplex in which a portion of a single RNA strand folds upon itself to form the RNA duplex. By having nucleotide sequences that base pair with each other, portions of a single RNA strand fold upon themselves, wherein the nucleotide sequences are separated by an intervening sequence that does not base pair with itself, thereby forming a base-paired portion and a non-base-paired intervening loop portion.

As used herein, the term "percent identity" in the context of two or more nucleic acid or polypeptide sequences can refer to two or more sequences or subsequences that have a specified percentage of nucleotide or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to those of skill in the art) or by visual inspection. Depending on the application, the "percentage of identity" may be present over a region of the sequences being compared, e.g., over a functional domain, or alternatively, over the full length of the two sequences being compared.

For sequence comparison, typically one sequence is compared as a reference sequence to a test sequence. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the specified program parameters.

For purposes herein, percent identity and sequence similarity may be performed using the BLAST algorithm described in Altschul et al (J.mol. Biol.215:403-410 (1990)). Software for performing BLAST analysis is publicly available from national biotechnology information (National Center for Biotechnology Information).

As disclosed herein, "inner loop" refers to a structure that is formed substantially only when a guide-target RNA scaffold is formed, wherein the nucleotides in the engineered guide RNA or target RNA are not complementary to their positional counterparts on the opposite strand, and wherein one side of the inner loop (on the target RNA side or on the engineered guide RNA side of the guide-target RNA scaffold) has 5 or more nucleotides. When the number of participating nucleotides on both the guide RNA side and the target RNA side is below 5, the resulting structure is no longer considered an inner loop, but rather a "bulge" or "mismatch", depending on the size of the structural features. A "symmetrical inner loop" is formed when the same number of nucleotides are present on each side of the inner loop. An "asymmetric inner loop" is formed when there are a different number of nucleotides on each side of the inner loop.

"Latent structure" refers to a structural feature that is formed substantially only after hybridization of the guide RNA to the target RNA. For example, the sequence of the guide RNA provides one or more structural features, but these structural features are formed substantially only after hybridization to the target RNA, and thus one or more latent structural features appear as structural features after hybridization to the target RNA. Upon hybridization of the guide RNA to the target RNA, structural features are formed and thus the latent structure provided in the guide RNA is uncovered.

A "messenger RNA" or "mRNA" is an RNA molecule that comprises a sequence encoding a polypeptide or protein. In general, RNA can be transcribed from DNA. In some cases, a pre-mRNA containing non-protein coding regions in the sequence may be transcribed from DNA and then processed to remove all or part of the non-coding regions (introns) to produce mature mRNA. As used herein, the term "pre-mRNA" may refer to an RNA molecule transcribed from DNA prior to undergoing processing to remove non-protein coding regions.

As disclosed herein, "mismatch" refers to the unpaired single nucleotide in the guide RNA with the relative single nucleotide in the target RNA within the guide-target RNA scaffold. Mismatches may comprise any two non-base pairing single nucleotides. When the number of participating nucleotides on the guide RNA side and on the target RNA side exceeds 1, the resulting structure is no longer considered a mismatch, but rather a "bulge" or "inner loop", depending on the size of the structural feature.

As used herein, the term "polynucleotide" may refer to a single-or double-stranded polymer of Deoxyribonucleotide (DNA) or Ribonucleotide (RNA) bases read from the 5 'end to the 3' end. The term "RNA" includes dsRNA (double-stranded RNA), snRNA (microrna), lncRNA (long non-coding RNA), mRNA (messenger RNA), miRNA (microrna) RNAi (inhibitory RNA), siRNA (small interfering RNA), shRNA (short hairpin RNA), tRNA (transfer RNA), rRNA (ribosomal RNA), snoRNA (micronucleolar RNA) and cRNA (complementary RNA). The term DNA includes cDNA, genomic DNA and DNA-RNA hybrids.

The terms "protein," "peptide" and "polypeptide" are used interchangeably and may refer in their broadest sense to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics. These subunits may be linked by peptide bonds. In another embodiment, the subunits may be linked by other linkages, such as esters, ethers, and the like. The protein or peptide may comprise at least two amino acids and there is no limit to the maximum number of amino acids that may comprise the protein or peptide sequence. As used herein, the term "amino acid" may refer to natural, unnatural or synthetic amino acids, including glycine as well as D and L optical isomers, amino acid analogs and peptidomimetics. As used herein, the term "fusion protein" may refer to a protein that is composed of domains from more than one naturally occurring or recombinantly produced protein, where typically each domain performs a different function. In this regard, the term "linker" may refer to a fragment of a protein that may be used to join these domains together, optionally to preserve the conformation of the fusion protein domains, to prevent adverse interactions between the fusion protein domains (which may impair their respective functions), or both.

The term "structural motif" refers to a combination of two or more structural features in a primer-target RNA scaffold.

The terms "subject," "individual," or "patient" are used interchangeably herein. "subject" refers to a biological entity that contains expressed genetic material. The biological entity may be a plant, animal or microorganism, including, for example, bacteria, viruses, fungi, and protozoa. The subject may be a tissue, a cell, or a progeny of a biological entity obtained in vivo or cultured in vitro. The subject may be a mammal. The mammal may be a human. The subject may be diagnosed or suspected of being at high risk for developing a disease. In some cases, the subject is not necessarily diagnosed or suspected of being at high risk of developing a disease.

The term "in vivo" refers to an event that occurs within the body of a subject.

The term "ex vivo" refers to an event that occurs outside the body of a subject. No ex vivo measurement can be performed on the subject. Instead, it may be performed on a sample separate from the subject. An example of an ex vivo assay performed on a sample may be an "in vitro" assay.

The term "in vitro" refers to an event that occurs in a container for holding laboratory reagents such that it can be separated from the biological source from which the material can be obtained. In vitro assays may encompass cell-based assays, where living or dead cells may be used. In vitro assays may also encompass cell-free assays, where whole cells cannot be used.

The term "wobble base pair" refers to two bases that are weakly paired. For example, wobble base pairs may refer to G paired with U.

When referring to a particular secondary structure, the term "substantially formed" as described herein refers to the formation of at least 80% of the structure under physiological conditions (e.g., physiological pH, physiological temperature, physiological salt concentration, etc.).

As used herein, the term "treatment" or "treatment" may be used to refer to a drug or other intervention regimen that achieves a beneficial or desired result in a recipient. Beneficial or desired results include, but are not limited to, therapeutic benefits and/or prophylactic benefits. Therapeutic benefit may refer to the eradication or amelioration of one or more symptoms of the underlying disorder being treated. Furthermore, therapeutic benefits may be obtained by eradicating or ameliorating one or more of the physiological symptoms associated with the underlying disorder such that an improvement may be observed in the subject, although the subject may still have the underlying disorder. Preventive effects include delaying, preventing or eliminating the appearance of a disease or condition, delaying or eliminating the onset of one or more symptoms of a disease or condition, slowing, stopping or reversing the progression of a disease or condition, or any combination thereof. For prophylactic benefit, a subject at risk of developing a particular disease, or a subject reporting one or more of the physiological symptoms of a disease, may undergo treatment, even though a diagnosis of this disease may not have been made.

Numbered embodiments

Disclosed herein are various compositions and methods. Specific exemplary embodiments of these compositions and methods are disclosed below. The following embodiments enumerate non-limiting permutations of combinations of features disclosed herein. Other arrangements of combinations of features are also contemplated. In particular, each of these numbered embodiments is contemplated as belonging to or relating to each of the preceding or following numbered embodiments, regardless of the order in which they are listed.

Embodiment 1. A composition comprising an engineered guide RNA, wherein: a) The engineered guide RNA forms a guide-target RNA scaffold with the sequence of a target SNCA RNA after hybridization with the sequence of the target SNCA RNA; b) The formation of the guide-target RNA scaffold essentially forms one or more structural features selected from the group consisting of: a bulge, an inner ring and a hairpin; and c) the absence of the structural feature in the engineered guide RNA prior to hybridization of the engineered guide RNA to the SNCA target RNA; and d) after hybridization of the engineered guide RNAs to the sequences of the target SNCA RNAs, the engineered guide RNAs facilitate RNA editing of one or more target adenosines in the sequences of the target SNCA RNAs by an RNA editing entity. Embodiment 2. The composition of embodiment 1, wherein the sequence of the target SNCA RNA is within the 3' untranslated region (UTR). Embodiment 3. The composition of embodiment 1, wherein the sequence of the target SNCA RNA is within the 5' untranslated region (UTR). Embodiment 4. The composition of embodiment 3, wherein the sequence of the target SNCA RNA in the 5' utr is a Kozak sequence. Embodiment 5. The composition of embodiment 3, wherein the sequence of the target SNCA RNA in the 5' utr is an Internal Ribosome Entry Site (IRES). Embodiment 6. The composition of embodiment 3, wherein the sequence of the target SNCA RNA in the 5' utr is an Iron Response Element (IRE). Embodiment 7. The composition of embodiment 1, wherein the sequence of the target SNCA RNA comprises a translation initiation site. Embodiment 8. The composition of embodiment 7 wherein the translation initiation site is at position 265 of SNCA exon 2. Embodiment 9. The composition of embodiment 7 wherein the translation initiation site is the SNCA codon 1 translation initiation site of exon 2, the codon 5 translation initiation site of exon 2, or both. Embodiment 10. The composition of embodiment 7 wherein the translation initiation site is the SNCA codon 1 translation initiation site of exon 2. Embodiment 11. The composition of embodiment 7, wherein the translation initiation site is the SNCA codon 1 translation initiation site of exon 2 corresponding to position 226 of SNCA transcript variant 1 of accession No. nm_ 000345.4. Embodiment 12. The composition of embodiment 7 wherein the translation initiation site is the SNCA codon 5 translation initiation site of exon 2. Embodiment 13 the composition of any one of embodiments 9 to 11, wherein the one or more structural features comprise: a first 6/6 symmetric inner ring at a position selected from the group consisting of 32, 30, 28, 26 and 24, relative to the target adenosine at position 0. Embodiment 14. The composition of embodiment 13 wherein the first 6/6 symmetrical inner loop is at position 32 relative to the target adenosine at position 0. Embodiment 15 the composition of embodiment 14 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, and any combination thereof. Embodiment 16. The composition of embodiment 15, wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-6 relative to position 0, an a/C mismatch at position 0, and a G/G mismatch at position 6 relative to position 0. Embodiment 17. The composition of embodiment 15 or embodiment 16, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO. 336. Embodiment 18. The composition of embodiment 17, wherein the engineered guide RNA comprises SEQ ID NO 336. Embodiment 19 the composition of embodiment 14, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 13 relative to position 0, an a/C mismatch at position 15 relative to position 0, and any combination thereof. Embodiment 20 the composition of embodiment 19 wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-6 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 13 relative to position 0, and an a/C mismatch at position 15 relative to position 0. Embodiment 21. The composition of embodiment 19 or embodiment 20, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 350. Embodiment 22. The composition of embodiment 21, wherein the engineered guide RNA comprises SEQ ID NO. 350. Embodiment 23. The composition of embodiment 13, wherein the first 6/6 symmetrical inner loop is at position 30 relative to the target adenosine at position 0. Embodiment 24 the composition of embodiment 23, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-8 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, and any combination thereof. The composition of embodiment 25, wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-8 relative to position 0, an a/C mismatch at position 0, and a G/G mismatch at position 6 relative to position 0. Embodiment 26. The composition of embodiment 24 or embodiment 25, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO. 293. Embodiment 27. The composition of embodiment 26, wherein the engineered guide RNA comprises SEQ ID NO 293. Embodiment 28 the composition of embodiment 23, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-18 relative to position 0, a 3/3 symmetrical bulge at position-6 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, a U/C mismatch at position 10 relative to position 0, and any combination thereof. Embodiment 29 the composition of embodiment 28 wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-18 relative to position 0, a 3/3 symmetrical bulge at position-6 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, and a U/C mismatch at position 10 relative to position 0. Embodiment 30. The composition of embodiment 28 or embodiment 29, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 303. Embodiment 31 the composition of embodiment 30, wherein the engineered guide RNA comprises SEQ ID NO 303. Embodiment 32 the composition of embodiment 23, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical protrusion at position 4 relative to position 0, a C/C mismatch at position 11 relative to position 0, and any combination thereof. Embodiment 33 the composition of embodiment 32 wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-10 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical bulge at position 4 relative to position 0, and a C/C mismatch at position 11 relative to position 0. Embodiment 34 the composition of embodiment 32 or embodiment 33, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 306. Embodiment 35 the composition of embodiment 34, wherein the engineered guide RNA comprises SEQ ID NO 306. Embodiment 36 the composition of embodiment 23, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a 4/4 symmetrical bulge at position-5 relative to position 0, an a/C mismatch at position 0, an a/a mismatch at position 4 relative to position 0, and any combination thereof. The composition of embodiment 37, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-14 relative to position 0, a 4/4 symmetrical bulge at position-5 relative to position 0, an a/C mismatch at position 0, and an a/a mismatch at position 4 relative to position 0. Embodiment 38. The composition of embodiment 36 or embodiment 37, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 309. Embodiment 39. The composition of embodiment 38, wherein the engineered guide RNA comprises SEQ ID NO 309. Embodiment 40 the composition of embodiment 23, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical protrusion at position 5 relative to position 0, and any combination thereof. Embodiment 41 the composition of embodiment 40, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, and a 2/2 symmetrical protrusion at position 5 relative to position 0. Embodiment 42. The composition of embodiment 40 or embodiment 41, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO. 315. Embodiment 43 the composition of embodiment 42, wherein the engineered guide RNA comprises SEQ ID NO 315. Embodiment 44 the composition of embodiment 23, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner loop at position-6 relative to position 0, an a/C mismatch at position 0, a C/U mismatch at position 11 relative to position 0, a G/a mismatch at position 19 relative to position 0, and any combination thereof. Embodiment 45 the composition of embodiment 44, wherein the one or more structural features further comprises a 6/6 symmetrical inner loop at position-6 relative to position 0, an a/C mismatch at position 0, a C/U mismatch at position 11 relative to position 0, and a G/a mismatch at position 19 relative to position 0. Embodiment 46. The composition of embodiment 44 or embodiment 45, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO. 320. Embodiment 47. The composition of embodiment 46, wherein the engineered guide RNA comprises SEQ ID NO:320. Embodiment 48 the composition of embodiment 23, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-16 relative to position 0, a 1/0 asymmetrical lobe at position-4 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical lobe at position 5 relative to position 0, a U/G wobble at position 7 relative to position 0, and any combination thereof. Embodiment 49 the composition of embodiment 48 wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-16 relative to position 0, a 1/0 asymmetrical lobe at position-4 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical lobe at position 5 relative to position 0, and a U/G wobble at position 7 relative to position 0. Embodiment 50. The composition of embodiment 48 or embodiment 49, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO. 321. Embodiment 51. The composition of embodiment 50, wherein the engineered guide RNA comprises SEQ ID NO 321. Embodiment 52 the composition of embodiment 23 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 2/0 asymmetric protuberance at position-6 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 5 relative to position 0, an a/G mismatch at position 12 relative to position 0, and any combination thereof. Embodiment 53 the composition of embodiment 52 wherein the one or more structural features further comprise a 2/0 asymmetric protuberance at position-6 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 5 relative to position 0, and an a/G mismatch at position 12 relative to position 0. Embodiment 54. The composition of embodiment 52 or embodiment 53, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO. 325. Embodiment 55 the composition of embodiment 54, wherein the engineered guide RNA comprises SEQ ID No. 325. Embodiment 56 the composition of embodiment 23 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a 2/0 asymmetrical lobe at position-5 relative to position 0, an a/C mismatch at position 0, and any combination thereof. Embodiment 57 the composition of embodiment 56, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a 2/0 asymmetrical lobe at position-5 relative to position 0, and an a/C mismatch at position 0. Embodiment 58 the composition of embodiment 56 or embodiment 57, wherein said engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO. 338. Embodiment 59 the composition of embodiment 58, wherein the engineered guide RNA comprises SEQ ID NO 338. Embodiment 60 the composition of embodiment 23, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a U/G wobble at position-6 relative to position 0, a 2/0 asymmetrical lobe at position-3 relative to position 0, an A/C mismatch at position 0, a G/A mismatch at position 19 relative to position 0, and any combination thereof. Embodiment 61 the composition of embodiment 60 wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-14 relative to position 0, a U/G wobble at position-6 relative to position 0, a 2/0 asymmetrical lobe at position-3 relative to position 0, an a/C mismatch at position 0, and a G/a mismatch at position 19 relative to position 0. Embodiment 62. The composition of embodiment 60 or embodiment 61, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO 349. Embodiment 63 the composition of embodiment 62, wherein the engineered guide RNA comprises SEQ ID NO 349. Embodiment 64 the composition of embodiment 13 wherein the first 6/6 symmetrical inner loop is at position 28 relative to the target adenosine at position 0. Embodiment 65 the composition of embodiment 64, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-8 relative to position 0, an a/C mismatch at position 0, a G/U wobble at position 2 relative to position 0, and any combination thereof. The composition of embodiment 66, wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-8 relative to position 0, an a/C mismatch at position 0, and a G/U wobble at position 2 relative to position 0. Embodiment 67 the composition of embodiment 65 or embodiment 66, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 318. Embodiment 68. The composition of embodiment 67, wherein the engineered guide RNA comprises SEQ ID NO. 318. Embodiment 69 the composition of embodiment 64 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-16 relative to position 0, a 4/1 asymmetrical lobe at position-5 relative to position 0, an a/C mismatch at position 0, a G/U wobble at position 6 relative to position 0, and any combination thereof. Embodiment 70 the composition of embodiment 69 wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-16 relative to position 0, a 4/1 asymmetrical lobe at position-5 relative to position 0, an a/C mismatch at position 0, and a G/U wobble at position 6 relative to position 0. Embodiment 71 the composition of embodiment 69 or embodiment 70, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 319. Embodiment 72. The composition of embodiment 71, wherein the engineered guide RNA comprises SEQ ID NO 319. Embodiment 73 the composition of embodiment 64, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical protrusion at position 5 relative to position 0, a C/U mismatch at position 11 relative to position 0, and any combination thereof. Embodiment 74 the composition of embodiment 73 wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-10 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical bulge at position 5 relative to position 0, and a C/U mismatch at position 11 relative to position 0. Embodiment 75. The composition of embodiment 73 or embodiment 74, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO 329. Embodiment 76 the composition of embodiment 75 wherein said engineered guide RNA comprises SEQ ID NO 329. Embodiment 77 the composition of embodiment 64, wherein said one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-16 relative to position 0, a 2/0 asymmetrical lobe at position-4 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 7 relative to position 0, and any combination thereof. Embodiment 78 the composition of embodiment 77, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-16 relative to position 0, a 2/0 asymmetrical lobe at position-4 relative to position 0, an a/C mismatch at position 0, and a U/C mismatch at position 7 relative to position 0. Embodiment 79 the composition of embodiment 77 or embodiment 78 wherein said engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO. 334. Embodiment 80. The composition of embodiment 79, wherein the engineered guide RNA comprises SEQ ID NO 334. Embodiment 81 the composition of embodiment 64 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 10 relative to position 0, and any combination thereof. Embodiment 82 the composition of embodiment 81 wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-10 relative to position 0, an a/C mismatch at position 0, and a U/C mismatch at position 10 relative to position 0. Embodiment 83 the composition of embodiment 81 or embodiment 82 wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 347. Embodiment 84 the composition of embodiment 83, wherein the engineered guide RNA comprises SEQ ID NO 347. Embodiment 85 the composition of embodiment 64, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: an A/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, and any combination thereof. The composition of embodiment 86, wherein the one or more structural features further comprise an a/C mismatch at position 0 and a G/G mismatch at position 6 relative to position 0. Embodiment 87 the composition of embodiment 85 or embodiment 86, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 351. Embodiment 88 the composition of embodiment 87, wherein the engineered guide RNA comprises SEQ ID NO 351. Embodiment 89 the composition of embodiment 64 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/2 symmetrical protrusion at position-6 relative to position 0, an a/C mismatch at position 0, and any combination thereof. Embodiment 90 the composition of embodiment 89, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/2 symmetrical protrusion at position-6 relative to position 0, and an a/C mismatch at position 0. Embodiment 91 the composition of embodiment 89 or embodiment 90, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 353. Embodiment 92. The composition of embodiment 91, wherein the engineered guide RNA comprises SEQ ID NO 353. Embodiment 93 the composition of embodiment 64, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-18 relative to position 0, a 2/0 asymmetrical lobe at position-3 relative to position 0, an a/C mismatch at position 0, a 0/2 asymmetrical lobe at position 18 relative to position 0, and any combination thereof. Embodiment 94 the composition of embodiment 93 wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-18 relative to position 0, a 2/0 asymmetrical lobe at position-3 relative to position 0, and an a/C mismatch at position 0, a 0/2 asymmetrical lobe at position 18 relative to position 0. Embodiment 95 the composition of embodiment 93 or embodiment 94, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO 355. Embodiment 96 the composition of embodiment 95, wherein the engineered guide RNA comprises SEQ ID NO 355. Embodiment 97 the composition of embodiment 64, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-8 relative to position 0, a 2/1 asymmetrical lobe at position-2 relative to position 0, an a/C mismatch at position 0, and any combination thereof. The composition of embodiment 98, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-8 relative to position 0, a 2/1 asymmetrical bulge at position-2 relative to position 0, and an a/C mismatch at position 0. Embodiment 99 the composition of embodiment 97 or embodiment 98, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 357. Embodiment 100. The composition of embodiment 99, wherein the engineered guide RNA comprises SEQ ID NO. 357. Embodiment 101 the composition of embodiment 64, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/1 asymmetrical lobe at position-6 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 13 relative to position 0, and any combination thereof. Embodiment 102 the composition of embodiment 101 wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/1 asymmetrical lobe at position-6 relative to position 0, an a/C mismatch at position 0, and a U/C mismatch at position 13 relative to position 0. Embodiment 103. The composition of embodiment 101 or embodiment 102, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 359. Embodiment 104. The composition of embodiment 103, wherein the engineered guide RNA comprises SEQ ID NO:359. Embodiment 105 the composition of embodiment 64 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 0/1 asymmetrical lobe at position-6 relative to position 0, an a/C mismatch at position 4 relative to position 0, and any combination thereof. Embodiment 106 the composition of embodiment 105 wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-10 relative to position 0, a 0/1 asymmetrical lobe at position-6 relative to position 0, an a/C mismatch at position 0, and an a/a mismatch at position 4 relative to position 0. Embodiment 107 the composition of embodiment 105 or embodiment 106, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 361. Embodiment 108. The composition of embodiment 107, wherein the engineered guide RNA comprises SEQ ID NO 361. Embodiment 109 the composition of embodiment 64 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: G/G mismatch at position-3 relative to position 0, A/C mismatch at position 0, and any combination thereof. Embodiment 110 the composition of embodiment 109 wherein the one or more structural features further comprises a G/G mismatch at position-3 and an a/C mismatch at position 0 relative to position 0. Embodiment 111 the composition of embodiment 109 or embodiment 110, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 363. Embodiment 112 the composition of embodiment 111, wherein the engineered guide RNA comprises SEQ ID NO 363. Embodiment 113 the composition of embodiment 64 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/0 asymmetrical lobe at position-4 relative to position 0, an a/C mismatch at position 0, and any combination thereof. Embodiment 114 the composition of embodiment 113 wherein the one or more structural features further comprises a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/0 asymmetrical bulge at position-4 relative to position 0, and an a/C mismatch at position 0. Embodiment 115. The composition of embodiment 113 or embodiment 114, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 365. Embodiment 116. The composition of embodiment 115, wherein the engineered guide RNA comprises SEQ ID NO 365. Embodiment 117 the composition of embodiment 64, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-16 relative to position 0, a 4/3 asymmetrical lobe at position-3 relative to position 0, an a/C mismatch at position 0, and any combination thereof. The composition of embodiment 118, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-16 relative to position 0, a 4/3 asymmetrical bulge at position-3 relative to position 0, and an a/C mismatch at position 0. Embodiment 119 the composition of embodiment 117 or embodiment 118, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 366. Embodiment 120 the composition of embodiment 119, wherein the engineered guide RNA comprises SEQ ID NO 366. Embodiment 121 the composition of embodiment 64, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-4 relative to position 0, an a/C mismatch at position 0, a 2/1 asymmetrical lobe at position 4 relative to position 0, and any combination thereof. Embodiment 122 the composition of embodiment 121 wherein the one or more structures further comprise a 6/6 symmetrical inner ring at position-4 relative to position 0, an a/C mismatch at position 0, and a 2/1 asymmetrical bulge at position 4 relative to position 0. Embodiment 123 the composition of embodiment 121 or embodiment 122, wherein said engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 369. Embodiment 124 the composition of embodiment 123, wherein the engineered guide RNA comprises SEQ ID No. 369. Embodiment 125 the composition of embodiment 64, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-4 relative to position 0, an a/C mismatch at position 0, an a/a mismatch at position 12 relative to position 0, and any combination thereof. Embodiment 126 the composition of embodiment 125 wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-4 relative to position 0, an a/C mismatch at position 0, and an a/a mismatch at position 12 relative to position 0. Embodiment 127 the composition of embodiment 125 or embodiment 126, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO. 374. Embodiment 128 the composition of embodiment 127, wherein the engineered guide RNA comprises SEQ ID No. 374. Embodiment 129 the composition of embodiment 64, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-4 relative to position 0, an A/C mismatch at position 0, a C/C mismatch at position 11 relative to position 0, and any combination thereof. Embodiment 130 the composition of embodiment 129, wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-4 relative to position 0, an a/C mismatch at position 0, and a C/C mismatch at position 11 relative to position 0. Embodiment 131 the composition of embodiment 129 or embodiment 130, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 376. Embodiment 132 the composition of embodiment 131, wherein the engineered guide RNA comprises SEQ ID NO 376. Embodiment 133 the composition of embodiment 64, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a G/U wobble at position 3 relative to position 0, a U/C mismatch at position 13 relative to position 0, and any combination thereof. The composition of embodiment 134, wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-6 relative to position 0, an a/C mismatch at position 0, a G/U wobble at position 3 relative to position 0, and a U/C mismatch at position 13 relative to position 0. Embodiment 135 the composition of embodiment 133 or embodiment 134, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 378. Embodiment 136 the composition of embodiment 135 wherein the engineered guide RNA comprises SEQ ID NO 378. Embodiment 137 the composition of embodiment 64 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner loop at position-8 relative to position 0, an A/C mismatch at position 0, a C/U mismatch at position 11 relative to position 0, and any combination thereof. The composition of embodiment 138, wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-8 relative to position 0, an a/C mismatch at position 0, and a C/U mismatch at position 11 relative to position 0. The composition of embodiment 139, embodiment 137 or embodiment 138, wherein said engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 380. Embodiment 140 the composition of embodiment 139, wherein the engineered guide RNA comprises SEQ ID No. 380. Embodiment 141 the composition of embodiment 64 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a 3/3 symmetrical protrusion at position-5 relative to position 0, an a/C mismatch at position 0, and any combination thereof. The composition of embodiment 142, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-14 relative to position 0, a 3/3 symmetrical bulge at position-5 relative to position 0, and an a/C mismatch at position 0. Embodiment 143 the composition of embodiment 141 or embodiment 142, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 382. Embodiment 144 the composition of embodiment 143, wherein the engineered guide RNA comprises SEQ ID NO 382. Embodiment 145 the composition of embodiment 64, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 3/3 symmetrical protrusion at position-5 relative to position 0, an a/C mismatch at position 0, a U/G wobble at position 10 relative to position 0, and any combination thereof. The composition of embodiment 146, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-10 relative to position 0, a 3/3 symmetrical protrusion at position-5 relative to position 0, an a/C mismatch at position 0, and a U/G wobble at position 10 relative to position 0. Embodiment 147 the composition of embodiment 145 or embodiment 146, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 384. Embodiment 148 the composition of embodiment 147, wherein the engineered guide RNA comprises SEQ ID No. 384. Embodiment 149 the composition of embodiment 13, wherein the first 6/6 symmetrical inner loop is at position 26 relative to the target adenosine at position 0. Embodiment 150 the composition of embodiment 149, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-12 relative to position 0, a 3/2 asymmetrical lobe at position-4 relative to position 0, an a/C mismatch at position 0, a U/G wobble at position 13 relative to position 0, and any combination thereof. Embodiment 151 the composition of embodiment 150, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-12 relative to position 0, a 3/2 asymmetrical lobe at position-4 relative to position 0, an A/C mismatch at position 0, and a U/G wobble at position 13 relative to position 0. Embodiment 152 the composition of embodiment 150 or embodiment 151, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 299. Embodiment 153 the composition of embodiment 152, wherein said engineered guide RNA comprises SEQ ID NO 299. The composition of embodiment 149, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, an a/a mismatch at position-7 relative to position 0, an a/C mismatch at position 0, and any combination thereof. Embodiment 155 the composition of embodiment 154 wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-14 relative to position 0, an a/a mismatch at position-7 relative to position 0, and an a/C mismatch at position 0. Embodiment 156 the composition of embodiment 154 or embodiment 155, wherein said engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO. 312. Embodiment 157 the composition of embodiment 156, wherein the engineered guide RNA comprises SEQ ID No. 312. Embodiment 158 the composition of embodiment 149, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-12 relative to position 0, a 2/1 asymmetrical lobe at position-2 relative to position 0, an a/C mismatch at position 0, and any combination thereof. The composition of embodiment 159, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-12 relative to position 0, a 2/1 asymmetrical bulge at position-2 relative to position 0, and an a/C mismatch at position 0. The composition of embodiment 158 or embodiment 159, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 323. Embodiment 161 the composition of embodiment 160, wherein the engineered guide RNA comprises SEQ ID No. 323. Embodiment 162 the composition of embodiment 149, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-8 relative to position 0, a U/G wobble at position-6 relative to position 0, an A/C mismatch at position 0, a U/U mismatch at position 9 relative to position 0, and any combination thereof. The composition of embodiment 163, wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-8 relative to position 0, a U/G wobble at position-6 relative to position 0, an a/C mismatch at position 0, and a U/U mismatch at position 9 relative to position 0. Embodiment 164 the composition of embodiment 162 or embodiment 163, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 327. Embodiment 165 the composition of embodiment 164, wherein said engineered guide RNA comprises SEQ ID NO 327. The composition of embodiment 166, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-16 relative to position 0, a 0/1 asymmetrical lobe at position-7 relative to position 0, an a/C mismatch at position 0, a C/U mismatch at position 11 relative to position 0, and any combination thereof. Embodiment 167. The composition of embodiment 166, wherein the one or more structural features further comprises a 6/6 symmetrical inner ring at position-16 relative to position 0, a 0/1 asymmetrical lobe at position-7 relative to position 0, an a/C mismatch at position 0, and a C/U mismatch at position 11 relative to position 0. Embodiment 168 the composition of embodiment 166 or embodiment 167, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO 341. Embodiment 169 the composition of embodiment 168, wherein said engineered guide RNA comprises SEQ ID NO 341. Embodiment 170 the composition of embodiment 149, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a U/C mismatch at position-5 relative to position 0, an A/C mismatch at position 0, and any combination thereof. The composition of embodiment 171, wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-10 relative to position 0, a U/C mismatch at position-5 relative to position 0, and an a/C mismatch at position 0. Embodiment 172 the composition of embodiment 170 or embodiment 171, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 343. Embodiment 173 the composition of embodiment 172, wherein the engineered guide RNA comprises SEQ ID No. 343. Embodiment 174 the composition of embodiment 149, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical protrusion at position 5 relative to position 0, and any combination thereof. Embodiment 175 the composition of embodiment 174 wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, and a 2/2 symmetrical protrusion at position 5 relative to position 0. Embodiment 176 the composition of embodiment 174 or embodiment 175, wherein said engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 356. Embodiment 177 the composition of embodiment 176, wherein the engineered guide RNA comprises SEQ ID No. 356. The composition of embodiment 149, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a 3/3 symmetrical protrusion at position-4 relative to position 0, an a/C mismatch at position 0, and any combination thereof. The composition of embodiment 179, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-14 relative to position 0, a 3/3 symmetrical bulge at position-4 relative to position 0, and an a/C mismatch at position 0. Embodiment 180 the composition of embodiment 178 or embodiment 179, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 367. Embodiment 181 the composition of embodiment 180, wherein said engineered guide RNA comprises SEQ ID No. 367. Embodiment 182 the composition of embodiment 149, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/2 symmetrical protrusion at position-5 relative to position 0, an a/C mismatch at position 0, and any combination thereof. The composition of embodiment 183, wherein the one or more structural features further comprises a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/2 symmetrical protrusion at position-5 relative to position 0, and an a/C mismatch at position 0. Embodiment 184. The composition of embodiment 182 or embodiment 183, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO. 371. Embodiment 185 the composition of embodiment 184, wherein the engineered guide RNA comprises SEQ ID NO 371. Embodiment 186 the composition of embodiment 149 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-20 relative to position 0, a 4/4 symmetrical bulge at position-5 relative to position 0, an a/C mismatch at position 0, a 0/1 asymmetrical bulge at position 5 relative to position 0, an a/C mismatch at position 17 relative to position 0, and any combination thereof. Embodiment 187 the composition of embodiment 186 wherein the one or more structural features further comprises a 6/6 symmetrical inner ring at position-20 relative to position 0, a 4/4 symmetrical bulge at position-5 relative to position 0, an a/C mismatch at position 0, a 0/1 asymmetrical bulge at position 5 relative to position 0, and an a/C mismatch at position 17 relative to position 0. Embodiment 188 the composition of embodiment 186 or embodiment 187, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 373. Embodiment 189 the composition of embodiment 188, wherein said engineered guide RNA comprises SEQ ID No. 373. Embodiment 190 the composition of embodiment 13 wherein the first 6/6 symmetrical inner loop is at position 24 relative to the target adenosine at position 0. Embodiment 191 the composition of embodiment 190 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, and any combination thereof. The composition of embodiment 192, wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-6 relative to position 0, an a/C mismatch at position 0, and a G/G mismatch at position 6 relative to position 0. The composition of embodiment 193, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 295. Embodiment 194 the composition of embodiment 193, wherein said engineered guide RNA comprises SEQ ID NO 295. Embodiment 195 the composition of embodiment 190 wherein said one or more structural features further comprises at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-18 relative to position 0, a U/C mismatch at position-5 relative to position 0, an A/C mismatch at position 0, and any combination thereof. The composition of embodiment 196, wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-18 relative to position 0, a U/C mismatch at position-5 relative to position 0, and an a/C mismatch at position 0. The composition of embodiment 197 or embodiment 196, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 330. Embodiment 198 the composition of embodiment 197 wherein the engineered guide RNA comprises SEQ ID NO 330. Embodiment 199 the composition of embodiment 190 wherein said one or more structural features further comprises at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a U/C mismatch at position-5 relative to position 0, an A/C mismatch at position 0, and any combination thereof. Embodiment 200 the composition of embodiment 199 wherein the one or more structural features further comprises a 6/6 symmetrical inner loop at position-14 relative to position 0, a U/C mismatch at position-5 relative to position 0, and an a/C mismatch at position 0. Embodiment 201 the composition of embodiment 199 or embodiment 200, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 332. Embodiment 202 the composition of embodiment 201, wherein said engineered guide RNA comprises SEQ ID No. 332. Embodiment 203 the composition of embodiment 190 wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-8 relative to position 0, an a/C mismatch at position 4 relative to position 0, and any combination thereof. The composition of embodiment 204, wherein the one or more structural features further comprise a 6/6 symmetrical inner loop at position-8 relative to position 0, an a/C mismatch at position 0, and an a/C mismatch at position 4 relative to position 0. Embodiment 205 the composition of embodiment 203 or embodiment 204, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 340. Embodiment 206 the composition of embodiment 205, wherein the engineered guide RNA comprises SEQ ID No. 340. Embodiment 207 the composition of embodiment 190 wherein said one or more structural features further comprises at least one structural feature selected from the group consisting of: an 8/8 symmetrical inner ring at position-6 relative to position 0, an A/C mismatch at position 0, a G/A mismatch at position 6 relative to position 0, a U/G wobble at position 7 relative to position 1, and any combination thereof. Embodiment 208 the composition of embodiment 207 wherein the one or more structural features further comprise an 8/8 symmetrical inner loop at position-6 relative to position 0, an A/C mismatch at position 0, a G/A mismatch at position 6 relative to position 0, and a U/G wobble at position 7 relative to position 1. Embodiment 209 the composition of embodiment 207 or embodiment 208, wherein said engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID No. 345. Embodiment 210 the composition of embodiment 209, wherein said engineered guide RNA comprises SEQ ID NO 345. Embodiment 211 the composition of any one of embodiments 1 to 210, wherein said one or more structural features comprises at least a first 6/6 symmetrical inner ring and at least a second 6/6 symmetrical ring. Embodiment 212 the composition of any one of embodiments 1-210, wherein the one or more structural features comprise the protrusions, and wherein the protrusions are symmetrical protrusions. Embodiment 213 the composition of any one of embodiments 1 to 210 wherein the one or more structural features comprise the protrusions, and wherein the protrusions are asymmetric protrusions. The composition of any one of embodiments 1 to 213, wherein the one or more structural features comprise the inner ring, and wherein the inner ring is a symmetrical inner ring. Embodiment 215 the composition of any one of embodiments 1 to 213 wherein said one or more structural features comprises said inner ring, and wherein said inner ring is an asymmetric inner ring. Embodiment 216 the composition of any one of embodiments 1 to 215, wherein said guide-target RNA scaffold comprises wobble base pairs. Embodiment 217 the composition of any of embodiments 1 to 216, wherein said one or more structural features comprise said hairpin, and wherein said hairpin is a recruited hairpin or a non-recruited hairpin. Embodiment 218. The composition of any one of embodiments 1 to 217, wherein the engineered guide RNA facilitates RNA editing of one or more adenosines in the sequence of the target SNCA RNA by an RNA editing entity after hybridization of the engineered guide RNA to the sequence of the target SNCA RNA. The composition of embodiment 219, wherein the RNA editing entity comprises ADAR1, ADAR2, ADAR3, or any combination thereof. Embodiment 220 the composition of any one of embodiments 1 to 219, wherein the engineered guide RNA comprises at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to any one of SEQ ID NOs 2 to 11. Embodiment 221 the composition of any one of embodiments 1 to 220, wherein the engineered guide RNA is encoded by an engineered polynucleotide. Embodiment 222. The composition of embodiment 221 wherein the engineered polynucleotide is contained in or on a vector. Embodiment 223 the composition of embodiment 222, wherein said vector is a viral vector, and wherein said engineered polynucleotide is encapsulated in said viral vector. The composition of embodiment 224, wherein the viral vector is an adeno-associated virus (AAV) vector, derivatives thereof. The composition of embodiment 225, wherein the viral vector is an adeno-associated virus (AAV), and wherein the AAV vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or a derivative, chimeric or variant of any of these. The composition of any one of embodiments 224 to 225, wherein the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementing AAV (scAAV) vector, or any combination thereof. Embodiment 227 the composition of any one of embodiments 1 to 226, wherein said engineered guide RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any one of SEQ ID NOs 12 to 384. Embodiment 228 the composition of any one of embodiments 1 to 226, wherein said engineered guide RNA has the sequence of any one of SEQ ID NOs 12 to 384. Embodiment 229 a pharmaceutical composition comprising: a) The composition of any one of embodiments 1 to 228; and b) pharmaceutically acceptable: excipients, carriers or diluents. Embodiment 230 a method of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the composition of any one of embodiments 1 to 228 or the pharmaceutical composition of embodiment 229. Embodiment 231 the method of embodiment 230, wherein said disease or condition comprises synucleinopathy. Embodiment 232 the method of embodiment 231 wherein said synucleinopathy comprises parkinson's disease. Embodiment 233 the method of any one of embodiments 230 to 232, wherein the subject is a human or non-human animal. The method of any one of embodiments 230 to 233, wherein the pharmaceutical composition or the composition is in unit dosage form. The method of any one of embodiments 230 to 234, wherein the administering is sufficient to treat one or more symptoms of the disease or disorder. Embodiment 236 the method of embodiment 235, wherein said disease or disorder is synucleinopathy. The method of embodiment 237, wherein the one or more symptoms treated comprise muscle tone stiffness, bradykinesia, resting tremor, or any combination thereof. The method of embodiments 236-237, wherein the administering is sufficient to reduce aggregation of the alpha-synuclein protein relative to: (a) the aggregation level prior to said administration; (b) In the absence of said administration, a cumulative level of aggregation in said subject; or (c) both. Embodiment 239. A method of treating parkinson's disease in a subject in need thereof, said method comprising administering to said subject an amount of the composition of any of embodiments 1-228 sufficient to treat parkinson's disease in said subject. The method of embodiment 239, wherein said administering is sufficient to treat one or more symptoms of parkinson's disease in said subject relative to prior to said administering. Embodiment 241 the method of embodiment 240, wherein the one or more symptoms treated comprise muscle tone stiffness, bradykinesia, resting tremor, or any combination thereof. The method of any one of embodiments 239-241, wherein the subject exhibits an increased UPDRS score after the administration relative to a Unified Parkinson's Disease Rating Scale (UPDRS) score prior to the administration. Embodiment 243. A method of editing an SNCA RNA, comprising contacting the SNCA RNA with the composition of any one of embodiments 1 to 228 and an RNA editing entity, thereby editing the SNCA RNA. The method of embodiment 244, wherein said editing comprises editing one or more adenosines within the 3' untranslated region (UTR) of said SNCA RNA. The method of embodiment 245, wherein the editing comprises editing one or more adenosines within the 5' untranslated region (UTR) of the SNCA RNA. The method of embodiment 246, wherein said editing comprises editing one or more adenosines of the Transcription Initiation Site (TIS) of said SNCA RNA. Embodiment 247 the method of embodiment 246, wherein the translation initiation site is the SNCA codon 1 translation initiation site of exon 2, the codon 5 translation initiation site of exon 2, or both. The method of any one of embodiments 248 to 247, wherein the SNCA RNA comprises a pre-mRNA transcript of SNCA. Embodiment 249. The method of embodiment 248, wherein at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the pre-mRNA transcripts of SNCA have at least one edit. Embodiment 250. The method of embodiment 243, wherein the editing of SNCA RNA promotes protein knockdown. Embodiment 251. The method of embodiment 250, wherein the protein knockdown comprises a reduction of at least 10% relative to the amount of protein present prior to the contacting. The method of embodiment 252, wherein the protein knockdown comprises a reduction of about 10% to about 25% relative to the amount of protein present prior to the contacting. The method of embodiment 253, wherein the protein knockdown comprises at least a 50% reduction relative to the amount of protein present prior to the contacting. Embodiment 254 the method of embodiment 250, wherein said protein knockdown comprises a knockdown of alpha-synuclein. Embodiment 255 the method of any one of embodiments 250-254 wherein said knockdown is measured in an in vitro assay. Embodiment 256 the method of any one of embodiments 250-254, wherein said knockdown is measured in an in vivo assay. Embodiment 257 the method of any one of embodiments 250-254, wherein said knockdown is measured in a human subject.

Examples

The following illustrative examples represent embodiments of the stimuli, systems, and methods described herein, and are not meant to be limiting in any way.

Example 1

Engineered guide RNAs for editing SNCA TIS

This example describes engineered guide RNAs for editing SNCA RNAs to knock down the expression of alpha-synuclein proteins. The engineered guide RNAs of the present disclosure are designed to target the Translation Initiation Site (TIS) of SNCA RNA (e.g., in codon 1, codon 5, or both), and promote AUG (TIS) to GUG ADAR-mediated RNA editing, thus inhibiting SNCA translation. Editing resulted in the knockdown of the alpha-synuclein protein. The engineered guide RNAs are packaged and delivered in AAV viruses and administered to a subject in need thereof. After in vitro or in vivo administration of the engineered guide RNA, the engineered guide RNA edits SNCA TIS, thereby reducing expression of the α -synuclein protein. Upon administration to a subject having a synucleinopathy (e.g., parkinson's disease), the engineered guide RNAs are therapeutically effective, and alleviate symptoms and/or cure the synucleinopathy.

Example 2

Engineered guide RNAs for editing SNCA 3' utrs

This example describes engineered guide RNAs for editing SNCA RNAs to knock down the expression of alpha-synuclein proteins. The engineered guide RNAs of the present disclosure are designed to target the 3' utr of SNCA RNA and promote ADAR-mediated a-to-G RNA editing, thus resulting in suppressed mRNA output from the nucleus and reduced SNCA translation. After in vitro or in vivo administration of the engineered guide RNA, the engineered guide RNA edits the SNCA 3' utr region. Editing resulted in the knockdown of the alpha-synuclein protein. The engineered guide RNAs are packaged and delivered in AAV viruses and administered to a subject in need thereof. Upon administration to a subject having a synucleinopathy (e.g., parkinson's disease), the engineered guide RNAs are therapeutically effective, and alleviate symptoms and/or cure the synucleinopathy.

Example 3

Engineered guide RNAs targeting SNCA mRNA

This example describes engineered guide RNAs targeting SNCA mRNA. The self-annealing RNA structure comprising the engineered guide RNA sequences of table 1 and the sequences of the regions targeted by the engineered guide RNAs is contacted with an RNA editing entity (e.g., recombinant ADAR1 and/or ADAR 2) under conditions that allow editing of the regions targeted by the guide RNAs. The regions targeted by the engineered guide RNAs were then assessed for editing using Next Generation Sequencing (NGS). The engineered guide RNA of Table 1 shows specific editing of A nucleotides at the translation initiation site of SNCA mRNA (TIS; A in ATG is encoded starting with the genomic coordinates: hg38 chr4:89835667 strand-1). The percentage of editing at the target was calculated by the following formula: the number of reads containing "G" at the target/total number of reads. The specificity was calculated by the following formula: (percent target edit +100)/(percent off-target edit sum at selected off-target site +100).

TABLE 1 exemplary guide RNAs targeting SNCA mRNA

/>

Example 4

Engineered guide RNA compositions targeting SNCA codon 1TIS

This example describes the sequence of an engineered guide RNA targeting codon 1TIS of exon 2 of the canonical TIS at nucleotide position 226 corresponding to SNCA transcript variant 1 (NCBI reference sequence: NM-000345.4). Contacting a self-annealing RNA structure comprising (i) an engineered guide RNA as shown in table 2 and (ii) an RNA sequence of an SNCA region targeted by the engineered guide RNA with an RNA editing entity (e.g., recombinant ADAR1 and/or ADAR 2) for 30 minutes under conditions that allow editing. The regions targeted by the engineered guide RNAs were then assessed for editing by Next Generation Sequencing (NGS). The engineered guide RNAs at target editing that showed over 50% of SNCA TIS for ADAR1 and/or ADAR2, as quantified at read depths >200, are shown in table 2. Also encompassed herein are all polynucleotide sequences encoding the engineered guide RNAs of table 2, represented by each sequence shown in table 2, each U replaced with T. For each sequence, the structural features formed in the double stranded RNA substrate after hybridization of the guide RNA to the target SNCA RNA are shown in the second column of table 2. For reference, each structural feature formed within the guide-target RNA scaffold (target RNA sequence hybridized to the engineered guide RNA) is annotated as follows:

a. the position of the structural feature relative to target a (position 0) of the target RNA sequence, wherein a negative value indicates upstream (5 ') of target a and a positive value indicates downstream (3') of target a;

b. The number of bases in the target RNA sequence and the number of bases in the engineered guide RNA together form a structural feature, e.g., 6/6 indicates that six consecutive bases from the target RNA sequence and six consecutive bases from the engineered guide RNA form a structural feature;

c. Names of structural features (e.g., symmetrical projections, symmetrical inner rings, asymmetrical projections, asymmetrical inner rings, mismatches, or wobble base pairs), and

D. The base sequences on the side of the target RNA and on the side of the engineered guide RNA that are involved in the formation of structural features.

For example, in SEQ ID NO.2, "-33_4-4_bulge-symmetric_UUCG-ACAU" is understood as a structural feature formed in the guide-target RNA scaffold (target SNCA RNA sequence hybridized to the engineered guide RNA of SEQ ID NO. 2), wherein

A. The structural features start with 33 nucleotides upstream (5') (-33) of target A (position 0) of the target RNA sequence

B. four consecutive bases from the target RNA sequence and four consecutive bases from the engineered guide RNA form a structural feature

C. The structural characteristics are symmetrical bulges

D. the UUCG sequence from the target RNA side and ACAU sequence from the engineered guide RNA side participate in the formation of symmetrical projections.

For reference, fig. 2 may be used to aid in visualizing the structural features and terms disclosed herein. Fig. 3 is a graph showing sequence similarity of SNCA TIS-targeted engineered guide RNAs of the present disclosure to canonical guide RNA designs on the x-axis and edit scores of ADAR2 enzymes on the y-axis. Table 2 also includes on-target editing amounts achieved by ADAR1 or ADAR2 alone and by ADAR1 and ADAR 2. The specificity of each engineered guide was also calculated by ADAR1, ADAR2 and adar1+adar2. The specificity provided in table 2 was calculated using the following formula: specificity= (target edit score +1)/(sum (non-synonymous off-target edit)). These data highlight the diverse sequence space represented by the SNCA TIS-targeted engineered guide RNAs of the present disclosure, which have a range of different structural features that drive sequence diversity and exhibit high on-target editing efficiency.

/>

Example 5

Selected engineered guide RNA compositions targeting SNCA codon 1TIS

This example describes the first 48 engineered guide RNAs targeting the SNCA codon 1 transcription start site (TIS) of the target SNCA mRNA. Contacting a self-annealing RNA structure comprising (i) an engineered guide RNA as shown in table 3 and (ii) an RNA sequence of SNCA TIS targeted by the engineered guide RNA with ADAR1 for 30 minutes under conditions allowing editing. The regions targeted by the engineered guide RNAs were then assessed for editing using Next Generation Sequencing (NGS). All polynucleotide sequences encoding the engineered guide RNAs of table 3 are encompassed herein, represented by each SEQ ID NO shown in table 3, each U being substituted with T. For each sequence, the structural features formed in the double stranded RNA substrate after hybridization of the guide RNA to the target SNCARNA are shown in the second column of table 3. For reference, each structural feature formed within the guide-target RNA scaffold (target RNA sequence hybridized to the engineered guide RNA) is annotated as follows:

For example, reference to SEQ ID NO:336, "-6_6-6_internal_cyclo-symmetrical_ AUUCAU-CCGCCC" is understood to be a structural feature formed in a guide-target RNA scaffold (target SNCA RNA sequence hybridized to the engineered guide RNA of SEQ ID NO: 336), wherein

A. the structural features start with 6 nucleotides upstream (5') (-6) of target A (0 position) of the target RNA sequence

B. Six consecutive bases from the target RNA sequence and six consecutive bases from the engineered guide RNA form a structural feature

C. The structural feature is an internal symmetrical ring

D. the AUUCAU sequence from the target RNA side and the CCGCCC sequence from the engineered guide RNA side are involved in the formation of internal symmetry loops.

Table 3: the first 48 engineered guide RNAs targeted SNCA TIS.

/>

Example 6

Hard-junction mutations

To determine if editing the adenosine of the SNCA target RNA resulted in a decrease in protein levels, SH-SY5Y A > G hard-linked mutant cell lines were prepared that expressed hard-linked mutations in TIS at codon 1 and codon 5, as well as hard-linked mutations in the 3' utr.

SH-SY5Y cells were obtained and subcultured. Hard-wired SNCA a > G mutant cell lines were engineered using DNA editing. Briefly, by electroporation-based nuclear transfection, guide RNAs for each target locus and donor oligonucleotides containing a > G mutation of interest were designed and delivered to SH-SY5Y cells. After single cell clonal expansion and genotyping, clonal lines with a > G mutation of interest are selected for further expansion and downstream analysis.

Culture and maintenance of experimental cell lines

Multiple clone SH-SY5Y lines (three TIS codons 1a > G, three TIS codons 5a > G, four 3' utr a > G clone lines) for each SNCA a > G mutation were amplified and seeded in 6-well plates at 250,000 cells/well. Wild-type SH-SY5Y and primary cortical neurons from P1 humanized SNCA transgenic (hSNCA-Tg) or wild-type (WT) mice were cultured and included as controls. For undifferentiated experimental conditions, SH-SY5Y cell lines were maintained in proliferation medium (DMEM+10% FBS, 1% GlutaMax, 1% pen-Strep) until >80% confluence for collection of downstream transcripts or protein analysis. For the experimental conditions of differentiation, SH-SY5Y cell lines were inoculated in proliferation medium. After overnight incubation, the medium was changed to SH-SY5Y differentiation medium (Neurobasal plus+1% N2, 2% B27, 1% GlutaMax, 1% Pen-Strep, 500nM cAMP, 5uM retinoic acid, 20ng/uL GDNF). The differentiation medium was changed every 2 days until collected 7 days after differentiation.

Total human alpha-synuclein protein ELISA assay

Cells were lysed in total protein lysis buffer (150 mM NaCl, 20mM Tris pH7.5, 1mM EDTA, 1mM EGTA, 1% Triton X-100, 1x HaltTM protease/phosphatase inhibitor cocktail). After lysis, total protein concentration was measured using a protein assay kit. All protein samples were diluted to 200ug/mL in total protein lysis buffer prior to testing with human alpha-synuclein colorimetric ELISA kit. Samples were further diluted 1:20 in 2x ELISA reagent diluent, loaded in duplicate with human α -synuclein kit standards, and run according to the manufacturer's protocol. Based on the curves generated from the human alpha-synuclein standard of the kit, absolute total alpha-synuclein protein levels (ug) were calculated and normalized to total protein (mg).

FIG. 5 depicts ELISA assessment of alpha-synuclein protein levels in SH-SY5Y A > G hard-wired mutant cell lines. Total human alpha-synuclein protein levels were measured by ELISA in undifferentiated and differentiated SH-SY5Y wild-type (WT), TIS codon 1A > G mutant, TIS codon 5A > G mutant and 3' UTR A > G mutant cell lines. Primary neurons from humanized SNCA (hSNCA-Tg) or wild-type (WT) mice were included as positive and negative total human alpha-synuclein protein controls, respectively. The codon 1tis a > g hard-junction mutation results in almost complete knockdown (> 90%) of the total alpha-synuclein protein. The codon 5tis a > g hard-junction mutation results in a partial knockdown of the total α -synuclein protein. The 3' UTR A > G hard-junction mutation does not affect the total alpha-synuclein protein.

Alpha-synuclein western immunoblotting assay

Cells were lysed in total protein lysis buffer (150 mM NaCl, 20mM Tris pH7.5, 1mM EDTA, 1mM EGTA, 1% Triton X-100, 1 Xprotease/phosphatase inhibitor cocktail). After lysis, total protein concentration was measured using a protein assay kit. 20ug of total protein was incubated with sample buffer and reducing agent at 70℃for 10min and loaded onto 4% to 12% Bis-Tris gels. The gel was run at 200V for 45 minutes and transferred to nitrocellulose membrane blots using a transfer stack. The blots were blocked in blocking buffer for 10min at RT and incubated overnight at 4 ℃ at 1:2000 dilution in rabbit monoclonal α -synuclein primary antibody [ clone MJFR, ab138501 ]. After primary incubation, the blots were incubated at 1:10000 dilution in goat anti-rabbit IgG H & L HRP secondary antibody [ ab205718] for 1 hour at RT. The substrate is added to the blot for visual inspection and imaging on an imaging system. The blots were stripped in western blot stripping buffer, blocked for an additional 10 minutes in PIERCE FAST blocking buffer at RT, and re-probed with mouse monoclonal GAPDH primary antibody [ clone 6c5, ab8245] at 1:10000 dilution or mouse monoclonal β -actin primary antibody [ clone 2F1-1] at 1:500 dilution for 2 hours, and goat anti-mouse IgG H & L HRP secondary antibody [ ab205719] at 1:10000 dilution for 1 hour. The substrate was added to the blot for visual inspection and imaging on an imaging system (thermo fisher).

FIGS. 6A-6B show immunoblot assessment of alpha-synuclein protein levels in SH-SY5Y A > G hard-connected mutant cell lines. Total human alpha-synuclein protein levels were measured by immunoblotting in undifferentiated and differentiated SH-SY5Y wild-type (WT), TIS codon 1A > G mutant, TIS codon 5A > G mutant and 3' UTR A > G mutant cell lines. The codon 1tis a > g hard-junction mutation results in a complete knockdown of the total α -synuclein protein. Codon 5TIS A > G and 3' UTR A > G hard-junction mutations did not affect the total alpha-synuclein protein. Figure 6A shows a representative immunoblot using an alpha-synuclein specific antibody and a beta-actin antibody as a protein loading control. Figure 6B shows quantitative densitometric analysis of immunoblotted α -synuclein protein levels normalized to protein loading control.

SNCA mRNA transcript quantitative PCR

Cells were lysed in RLT buffer containing β -mercaptoethanol and total RNA extraction was performed according to the manufacturer's protocol. cDNA synthesis was performed from RNA samples using a cDNA reverse transcription kit with an RNase inhibitor. For TaqMan-based detection of SNCA mRNA transcript levels, 2uL of cDNA template was added to 10uL 2x TaqMan Fast Advanced Master Mix and 1uL 20x SNCA TaqMan assays (FAM; SNCA exons 2-3 or SNCA exons 3-4) and 1uL 20x HPRT1 TaqMan assays, in total volume of 20uL. All conditions were run in duplicate wells on a real-time PCR system. The qPCR thermocycler was set as follows: 50 ℃ for 2 minutes, 95 ℃ for 20 seconds, [40 cycles ]95 ℃ for 20 seconds >60 ℃ for 30 seconds. SNCA mRNA transcript levels were normalized to HPRT1 using the comparative CT method.

FIGS. 7A-7B show quantitative PCR assessment of SNCA mRNA transcript levels in SH-SY5Y A > G hard-wired mutant cell lines. SNCA mRNA transcript levels were measured by quantitative PCR using TaqMan assays specific for either the SNCA exon 2-3 junction (FIG. 7A) or the SNCA exon 3-4 junction (FIG. 7B). qPCR analysis demonstrated a non-statistical trend of reduced SNCA levels in the undifferentiated TIS codon 1 and codon 5a > g mutant SH-SY5Y line and differentiated codon 1TIS mutant SH-SY5Y line.

Example 7

Use of engineered grnas targeting SNCA codon 1TIS in cell editing

This example demonstrates the use of the first 48 engineered guide RNAs listed in table 3 in cell editing that target HEK293 cells expressing SNCA and ADAR1 and SNCA codon 1TIS of exon 2 in HEK293 cells where ADAR2 is stably integrated by Piggybac system.

Each of the 48 guide RNAs listed in table 3 was transfected into HEK293 and HEK293+ ADAR2 cells. Cells were collected 48 hours after transfection, and RNA was collected, converted to DNA by reverse transcriptase, and sequenced by sanger sequencing. Cells were harvested and RNA analyzed by Sanger sequencing at-48 hours post-gRNA transfection. FIG. 8 shows biological replicates of 48 gRNAs listed in Table 3. On-target and off-target editing of each guide RNA was determined and is listed in fig. 9-34.

FIGS. 27-34 show the most targeted editing variants that produced SNCA codon 1TIS, corresponding to SEQ ID NOS 365, 303, 318, 350, 361, 367, 356 and 353 of Table 3.

While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Many changes, modifications and substitutions will now occur to those skilled in the art without departing from the disclosure. It should be understood that various alternatives to the embodiments of the disclosure described herein may be employed in practicing the disclosure. The following claims are intended to define the scope of the present disclosure and thus cover methods and structures within the scope of these claims and their equivalents.

Claims

1. A composition comprising an engineered guide RNA, wherein:

a) The engineered guide RNA forms a guide-target RNA scaffold with the sequence of a target SNCA RNA after hybridization with the sequence of the target SNCA RNA;

b) The formation of the guide-target RNA scaffold essentially forms one or more structural features selected from the group consisting of: a bulge, an inner ring and a hairpin;

c) The structural feature is not present in the engineered guide RNA prior to hybridization of the engineered guide RNA to SNCA target RNA; and

D) After hybridization of the engineered guide RNAs with the sequences of the target SNCA RNAs, the engineered guide RNAs facilitate RNA editing of one or more target adenosines in the sequences of the target SNCA RNAs by an RNA editing entity.

2. The composition of claim 1, wherein the sequence of the target SNCA RNA is within the 3' untranslated region (UTR).

3. The composition of claim 1, wherein the sequence of the target SNCA RNA is within the 5' untranslated region (UTR).

4. The composition of claim 3, wherein the sequence of the target SNCA RNA in the 5' utr is a Kozak sequence.

5. The composition of claim 3, wherein the sequence of the target SNCA RNA in the 5' utr is an Internal Ribosome Entry Site (IRES).

6. The composition of claim 3, wherein the sequence of the target SNCA RNA in the 5' utr is an Iron Response Element (IRE).

7. The composition of claim 1, wherein the sequence of the target SNCA RNA comprises a translation initiation site.

8. The composition of claim 7, wherein the translation initiation site is the SNCA codon 1 translation initiation site of exon 2.

9. The composition of claim 7, wherein the translation initiation site is the SNCA codon 1 translation initiation site of exon 2 corresponding to position 226 of SNCA transcript variant 1 of accession No. nm_ 000345.4.

10. The composition of any one of claims 7 to 9, wherein the one or more structural features comprise: a first 6/6 symmetric inner ring at a position selected from the group consisting of 32, 30, 28, 26 and 24, relative to the target adenosine at position 0.

11. The composition of claim 10, wherein the first 6/6 symmetrical inner ring is at position 32 relative to the target adenosine at position 0.

12. The composition of claim 11, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 13 relative to position 0, an a/C mismatch at position 15 relative to position 0, and any combination thereof.

13. The composition of claim 12, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a U/C mismatch at position 13 relative to position 0, and an a/C mismatch at position 15 relative to position 0.

14. The composition of claim 12 or claim 13, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 350.

15. The composition of claim 14, wherein the engineered guide RNA comprises SEQ ID No. 350.

16. The composition of claim 10, wherein the first 6/6 symmetrical inner ring is at position 30 relative to the target adenosine at position 0.

17. The composition of claim 16, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-18 relative to position 0, a 3/3 symmetrical bulge at position-6 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, a U/C mismatch at position 10 relative to position 0, and any combination thereof.

18. The composition of claim 17, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-18 relative to position 0, a 3/3 symmetrical protrusion at position-6 relative to position 0, an a/C mismatch at position 0, a G/G mismatch at position 6 relative to position 0, and a U/C mismatch at position 10 relative to position 0.

19. The composition of claim 17 or claim 18, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 303.

20. The composition of claim 19, wherein the engineered guide RNA comprises SEQ ID No. 303.

21. The composition of claim 10, wherein the first 6/6 symmetrical inner ring is at position 28 relative to the target adenosine at position 0.

22. The composition of claim 21, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-8 relative to position 0, an a/C mismatch at position 0, a G/U wobble at position 2 relative to position 0, and any combination thereof.

23. The composition of claim 22, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-8 relative to position 0, an a/C mismatch at position 0, and a G/U wobble at position 2 relative to position 0.

24. The composition of claim 22 or claim 23, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 318.

25. The composition of claim 24, wherein the engineered guide RNA comprises SEQ ID No. 318.

26. The composition of claim 21, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/2 symmetrical protrusion at position-6 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

27. The composition of claim 26, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/2 symmetrical protrusion at position-6 relative to position 0, and an a/C mismatch at position 0.

28. The composition of claim 26 or claim 27, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 353.

29. The composition of claim 28, wherein the engineered guide RNA comprises SEQ ID NO 353.

30. The composition of claim 21, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 0/1 asymmetrical lobe at position-6 relative to position 0, an a/C mismatch at position 0, an a/a mismatch at position 4 relative to position 0, and any combination thereof.

31. The composition of claim 30, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-10 relative to position 0, a 0/1 asymmetrical lobe at position-6 relative to position 0, an a/C mismatch at position 0, and an a/a mismatch at position 4 relative to position 0.

32. The composition of claim 30 or claim 31, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 361.

33. The composition of claim 32, wherein the engineered guide RNA comprises SEQ ID NO 361.

34. The composition of claim 21, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/0 asymmetrical lobe at position-4 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

35. The composition of claim 34, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-10 relative to position 0, a 2/0 asymmetrical lobe at position-4 relative to position 0, and an a/C mismatch at position 0.

36. The composition of claim 34 or claim 35, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO 365.

37. The composition of claim 36, wherein the engineered guide RNA comprises SEQ ID NO 365.

38. The composition of claim 10, wherein the first 6/6 symmetrical inner ring is at position 26 relative to the target adenosine at position 0.

39. The composition of claim 38, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-6 relative to position 0, an a/C mismatch at position 0, a 2/2 symmetrical protrusion at position 5 relative to position 0, and any combination thereof.

40. The composition of claim 39, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-6 relative to position 0, an A/C mismatch at position 0, and a 2/2 symmetrical protrusion at position 5 relative to position 0.

41. The composition of claim 39 or claim 40, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 356.

42. The composition of claim 41, wherein the engineered guide RNA comprises SEQ ID NO 356.

43. The composition of claim 38, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6/6 symmetrical inner ring at position-14 relative to position 0, a 3/3 symmetrical protrusion at position-4 relative to position 0, an a/C mismatch at position 0, and any combination thereof.

44. The composition of claim 43, wherein the one or more structural features further comprise a 6/6 symmetrical inner ring at position-14 relative to position 0, a 3/3 symmetrical protrusion at position-4 relative to position 0, and an A/C mismatch at position 0.

45. The composition of claim 43 or claim 44, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID No. 367.

46. The composition of claim 45, wherein the engineered guide RNA comprises SEQ ID NO 367.

47. The composition of claim 10, wherein the first 6/6 symmetrical inner ring is at position 24 relative to the target adenosine at position 0.

48. The composition of any one of claims 1 to 47, wherein the one or more structural features comprise at least a first 6/6 symmetrical inner ring and at least a second 6/6 symmetrical ring.

49. The composition of any one of claims 1 to 47, wherein the one or more structural features comprise the protrusions, and wherein the protrusions are symmetrical protrusions.

50. The composition of any one of claims 1 to 47, wherein the one or more structural features comprise the protrusions, and wherein the protrusions are asymmetric protrusions.

51. The composition of any one of claims 1 to 50, wherein the one or more structural features comprise the inner ring, and wherein the inner ring is a symmetrical inner ring.

52. The composition of any one of claims 1 to 50, wherein the one or more structural features comprise the inner ring, and wherein the inner ring is an asymmetric inner ring.

53. The composition of any one of claims 1 to 52, wherein the guide-target RNA scaffold comprises wobble base pairs.

54. The composition of any one of claims 1 to 53, wherein the one or more structural features comprise the hairpin, and wherein the hairpin is a recruited hairpin or a non-recruited hairpin.

55. The composition of any one of claims 1 to 54, wherein the engineered guide RNA facilitates RNA editing of one or more adenosines in the sequence of the target SNCA RNA by an RNA editing entity after hybridization of the engineered guide RNA to the sequence of the target SNCA RNA.

56. The composition of claim 55, wherein the RNA editing entity comprises ADAR1, ADAR2, ADAR3, or any combination thereof.

57. The composition of any one of claims 1 to 56, wherein the engineered guide RNA comprises at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to any one of SEQ ID NOs 2 to 11.

58. The composition of any one of claims 1 to 57, wherein the engineered guide RNA is encoded by an engineered polynucleotide.

59. The composition of claim 58, wherein the engineered polynucleotide is contained in or on a vector.

60. The composition of claim 59, wherein the vector is a viral vector, and wherein the engineered polynucleotide is encapsulated in the viral vector.

61. The composition of claim 60, wherein the viral vector is an adeno-associated virus (AAV) vector, a derivative thereof.

62. The composition of claim 61, wherein the viral vector is an adeno-associated virus (AAV), and wherein the AAV vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or a derivative, chimeric, or variant of any of these.

63. The composition of any one of claims 61-62, wherein the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, or any combination thereof.

64. The composition of any one of claims 1 to 63, wherein the engineered guide RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any one of SEQ ID NOs 12 to 384.

65. The composition of any one of claims 1 to 63, wherein the engineered guide RNA has the sequence of any one of SEQ ID NOs 12 to 384.

66. A pharmaceutical composition comprising:

a) The composition of any one of claims 1 to 65; and

B) Pharmaceutically acceptable: excipients, carriers or diluents.

67. A method of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the composition of any one of claims 1 to 65 or the pharmaceutical composition of claim 66.

68. The method of claim 67, wherein the disease or condition comprises synucleinopathy.

69. The method of claim 68, wherein the synucleinopathy comprises parkinson's disease.

70. The method of any one of claims 67 to 69, wherein the subject is a human or non-human animal.

71. The method of any one of claims 67 to 70, wherein said pharmaceutical composition or said composition is in unit dosage form.

72. The method of any one of claims 67-71, wherein said administering is sufficient to treat one or more symptoms of said disease or disorder.

73. The method of claim 72, wherein the disease or disorder is synucleinopathy.

74. The method of claim 73, wherein the one or more symptoms treated comprise muscle tone stiffness, bradykinesia, resting tremor, or any combination thereof.

75. The method of claims 73-74, wherein the administering is sufficient to reduce aggregation of the alpha-synuclein protein relative to:

(a) Aggregation level prior to said administration;

(b) In the absence of said administration, a cumulative level of aggregation in said subject; or (b)

(C) Both of which are located in the same plane.

76. A method of treating parkinson's disease in a subject in need thereof, said method comprising administering to said subject the composition of any one of claims 1 to 65 in an amount sufficient to treat parkinson's disease in said subject.

77. The method of claim 76, wherein the administration is sufficient to treat one or more symptoms of parkinson's disease in the subject relative to prior to the administration.

78. The method of claim 77, wherein the one or more symptoms treated comprise muscle tone stiffness, bradykinesia, resting tremor, or any combination thereof.

79. The method of any one of claims 76-78, wherein the subject exhibits an increased UPDRS score after the administration relative to a Unified Parkinson's Disease Rating Scale (UPDRS) score prior to the administration.

80. A method of editing SNCA RNA, the method comprising contacting the SNCA RNA with the composition of any one of claims 1 to 65 and an RNA editing entity, thereby editing the SNCA RNA.

81. The method of claim 80, wherein the editing comprises editing one or more adenosines within the 3' untranslated region (UTR) of the SNCA RNA.

82. The method of claim 80, wherein the editing comprises editing one or more adenosines within the 5' untranslated region (UTR) of the SNCA RNA.

83. The method of claim 80, wherein the editing comprises editing one or more adenosines of a transcription start site (TIS) of the SNCA RNA.

84. The method of claim 83, wherein the translation initiation site is the SNCA codon 1 translation initiation site of exon 2, the codon 5 translation initiation site of exon 2, or both.

85. The method of any one of claims 80-84, wherein the SNCA RNA comprises a pre-mRNA transcript of SNCA.

86. The method of claim 85, wherein at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the pre-mRNA transcripts of SNCA have at least one edit.

87. The method of claim 80, wherein the editing of SNCA RNA promotes protein knockdown.

88. The method of claim 87, wherein the protein knockdown comprises a reduction of at least 10% relative to the amount of protein present prior to the contacting.

89. The method of claim 87, wherein the protein knockdown comprises a reduction of about 10% to about 25% relative to the amount of protein present prior to the contacting.

90. The method of claim 87, wherein the protein knockdown comprises a reduction of at least 50% relative to the amount of protein present prior to the contacting.

91. The method of claim 87, wherein the protein knockdown comprises a knockdown of alpha-synuclein.

92. The method of any one of claims 87-91, wherein the knockdown is measured in an in vitro assay.

93. The method of any one of claims 87-91, wherein the knockdown is measured in an in vivo assay.

94. The method of any one of claims 87-91, wherein the knockdown is measured in a human subject.