CN117965617A - Application of soybean S-adenosine-L-homocysteine hydrolase GmSAHH coding gene - Google Patents

Abstract

The invention discloses an application of a soybean S-adenosine-L-homocysteine hydrolase GmSAHH coding gene. The application of the soybean S-adenosine-L-homocysteine hydrolase GmSAHH coding gene shown in SEQ ID NO.1 in the genetic engineering of soybean amino acid content. In soybeans, knockout GmSAHH1 can significantly reduce the amino acid content of the soybeans. The amino acid content of soybean can be obviously improved by over-expressing the gene.

Description

Application of soybean S-adenosine-L-homocysteine hydrolase GmSAHH coding gene

Technical Field

The invention relates to an application of soybean S-adenosine-L-homocysteine hydrolase GmSAHH coding gene, belonging to the field of genetic engineering.

Background

Soybean is an important component of the human dietary structure and provides a large amount of substances such as protein and oil in daily life. During development, free amino acids accumulated in seeds are preserved in the form of seed storage proteins (seed storage protein, SSP), the nutritional quality of which is affected by the type and content of amino acids. However, most amino acids have complex metabolic pathways, and the amino acid content of different species and tissues varies greatly, so that it is not easy to maintain a stable and balanced amino acid content level in seeds. In legume crops, the content of amino acids such as Cysteine (Cys), methionine (Methionine, met), lysine (Lys), threonine (Threonine, thr) and the like is significantly lower than that of other types of amino acids, and is an important factor for limiting the nutritional value of soybeans. The amino acid belongs to essential amino acid, plays an important role in plant physiological reaction and balanced nutrition supply of animal feed, so that the improvement of the content of the limiting amino acid in the soybean seeds has important research value for high-quality soybean breeding.

S-adenosin-L-homocysteine hydrolase (S-adenosine-L-homocysteine hydrolase, SAHH) is involved in methionine downstream metabolism and is reported to be more in methylation reactions in humans and animals. Methionine is an important methylation donor in organisms, after methylation reaction, is decomposed into S-adenosylmethionine (S-adenosylmethionine, SAM), S-adenosin-L-homocysteine (S-adenosine-L-homocysteine, SAH) is generated when SAM is transferred to a target molecule through a methyl loop, SAH and SAM compete with each other for a methyltransferase binding site in plants, plant methylation is hindered, and SAHH serves as the only known eukaryotic enzyme capable of hydrolyzing SAH and plays a key role in maintaining the methylation potential of cells. In addition, the gene is reported to be related to plant growth, embryo development, virus resistance and other processes, and mutant with SAHH1 protein subtype deletion in Arabidopsis thaliana can lead to embryo death, and mutant with SAHH1 function impaired can survive but shows delayed germination, slow growth and short primary root. SAHH can regulate interactions with other proteins by controlling complex formation and post-translational modifications. No report on the influence of the gene on the amino acid content has been found in soybeans at present.

Disclosure of Invention

The invention aims to disclose application of soybean S-adenosine-L-homocysteine hydrolase GmSAHH.

The aim of the invention can be achieved by the following technical scheme:

the nucleotide sequence of the soybean GmSAHH coding gene is as follows: SEQ ID NO.1.

The amino acid sequence of soybean GmSAHH protein is: SEQ ID NO.2.

Constructing an over-expression vector by using a homologous recombination method; four sgrnas were designed using the website (http:// cbi.hzau.edu.cn/cgi-bin/CRISPR 2/CRISPR) to target the first exon region of the GmSAHH gene simultaneously.

And constructing GmSAHH a gene over-expression vector, and transferring the gene over-expression vector by taking Jack as a receptor material. The obtained hairy root is identified positive through PCR detection. The qRT-PCR method detects the expression level of GmSAHH gene in soybean hairy root. The amino acid content in the overexpressed and control hairy roots was determined by an amino acid analyzer L-8900.

And constructing a CRISPR-cas9 vector, and carrying out soybean genetic transformation by taking Tianlong No. I as a receptor material to obtain a T ₀ generation soybean plant from which the gene is knocked out. The integration of GmSAHH and cas9 genes on the genome was examined by PCR. The GmSAHH gene editing sites and editing modes were determined by genome sequencing. And detecting the expression quantity of GmSAHH genes in the soybean transgenic material by using a qRT-PCR method. And (3) combining the detection results, and carrying out quality trait measurement on the screened T ₁ -generation knockout transgenic soybean. The amino acid content of GmSAHH knockout plants and control plants was determined using an amino acid analyzer L-8900.

By using the application of the invention, the amino acid content in transgenic hairy roots can be improved by over-expressing the gene, and the amino acid content of transgenic soybeans can be obviously reduced by utilizing CRISPR-cas9 technology to edit the gene at fixed points.

Advantageous effects

According to the invention, the GmSAHH gene is overexpressed to obtain a plurality of soybean positive hairy roots, and qRT-PCR results show that the transcription level of the gene in the overexpressed hairy roots is obviously improved, and the amino acid content is obviously improved compared with a control. After the CRISPR-cas9 technology is utilized to edit the gene at fixed points, two GmSAHH gene edited strains are obtained, and qRT-PCR results show that the expression quantity of the GmSAHH gene in the knocked-out strain is obviously reduced compared with the contrast, and the amino acid content of the transgenic strain is obviously reduced compared with the contrast; subcellular localization results indicate GmSAHH that 1 is localized on the cell membrane. GmSAHH1 over-expression hairy roots and phenotype change results in knockout transgenic soybean materials show that the gene positively regulates and controls the soybean amino acid content, and can be used for improving soybean quality traits.

Drawings

FIG. 1. PCR amplification results of GmSAHHH1 gene clone. M is Marker (DL 5000); 1-13 is GmSAHH bp in size, about 2300bp, and contains a CDS fragment 1458bp in length.

FIG. 2.GmSAHH1 is aligned with GmSAHH, gmSAHH amino acid sequences.

FIG. 3.GmSAHH1 tissue expression level analysis. Root: root tissue, stem: stem tissue, leave: leaf tissue, flow: floral tissue, pod25d: pod tissue 25 days after flowers, pod45d: pod tissue 45 days after flowers, seed25d: seed is planted 25 days after flowers, seed is planted 45 days after flowers, and Seed is planted 45 days after flowers.

FIG. 4. Subcellular localization results of GmSAHHH 1 protein. The left to right of the first row of empty vector contrast is respectively a fluorescence channel, a chloroplast fluorescence channel, a bright field and a superposition graph, and the left to right of the second row is respectively a target protein fluorescence channel, a chloroplast fluorescence channel, a bright field and a superposition graph.

FIG. 5. Schematic representation of GmSAHHH 1 overexpression vector. The CDS sequence of the gene GmSAHH of interest is located between the restriction enzymes M1uI and SacI.

FIG. 6. PCR assay of GmSAHHH1 overexpressing hairy roots. M: DL2000; (a) detection of a gene of interest in the overexpressed hairy roots. 1-9, gmsahh1 overexpresses hairy roots. (b) hairy root phenotype map.

FIG. 7. GmSAHHH1 overexpressing hairy root qRT-PCR assay.

FIG. 8.GmSAHH1 overexpressing hairy root free amino acid content assay.

FIG. 9 shows a schematic diagram of the vector of pCBS-4-GmSAHH 1. SG1, SG2, SG3, SG4 represent four targets, respectively.

FIG. 10. Acquisition of GmSAHHH 1 knockout transgenic material. (a) GmSAHH A genetic map and the location of the target. SgRNA-1, sgRNA-2, sgRNA-3, sgRNA-4 are four targets. Blue boxes are CDS sequences, yellow and pink boxes are UTR regions, and gray lines are intron regions. (b) The T ₁ generation GmSAHH1 knockdown the editing type of transgenic material. The blue label is NGG sequence, the green frame is 20bp target sequence, and the red line is missing base sequence. (c) Tianlong number one and GmSAHH1 knockdown seed phenotype of transgenic material.

FIG. 11.expression level of GmSAHHH1 gene in control Tianlong No. one and two T ₁ -generation knockout materials. Error bars represent mean ± SD. Statistical analysis used a two-tailed T test. * P <0.05; * P <0.01; * P <0.001.

FIG. 12. Amino acid content determination of T ₁ generation GmSAHH1 knockout transgenic soybean lines. Statistical analysis used a two-tailed T test. * P <0.05; * P <0.01; * P <0.001.

Detailed Description

The invention will be further described with reference to the accompanying drawings and examples.

The methods used in the examples described below are conventional methods unless otherwise specified.

Example 1

1) Cloning of Gene encoding soybean S-adenosyl-L-homocysteine hydrolase GmSAHH1

Taking soybean variety nan nong 1138-2 as a material taking object, taking leaf tissues, grinding the leaf tissues with liquid nitrogen, loading the powder into a 1.5ml EP tube, adding 1ml of lysate, vortex shaking to uniformly mix the two, and then extracting according to a Kit (Total RNA Kit, tiangen, beijing, china). And (3) identifying the total RNA quality by formaldehyde denatured gel electrophoresis, and measuring the RNA content by a spectrophotometer. The obtained total RNA was used as a template, and was subjected to reverse transcription according to the instructions of reverse transcription kit (Vazyme HiScript 1st Strand cDNA Synthesis Kit, nanj) provided by Nuo zan Vazyme, to obtain a first strand of cDNA, and then subjected to PCR amplification, and the PCR procedure was as follows: pre-denaturation at 95℃for 3 min, denaturation at 95℃for 15 sec, annealing at 58℃for 15 sec, extension at 72℃for 60 sec for 35 cycles, final incubation at 72℃for 5 min, followed by incubation at 4℃for half an hour, the cDNA of Nannong 1138-2 material was obtained.

From NCBI database and Phytozome v soybean database, the Gene corresponding to GmSAHH (Glyma.08G108800, gene ID: 100786939) was found, and based on the nucleotide sequences provided in the databases, specific amplification primers were designed at UTR end, and the cloned primer sequences were: p1: CTCTAGTCCTGTTATTTCTCAGC, P2: AGATAGTATACCTCGGTTACACC cloning a gene by taking cDNA of a soybean variety Nannong 1138-2 as a template, cutting gel, then carrying out PCR product purification, connecting a T-carried plasmid and transforming, picking positive monoclonal sequencing, and obtaining an mRNA sequence of a soybean GmSAHH1 gene with an intact coding region after sequencing, wherein the mRNA sequence length is 2300bp, the CDS coding region sequence size is 1458bp (figure 1), the sequence is shown as SEQ ID NO.1, and the plasmid is named as T-GmSAHH1.

2) GmSAHH1 Gene homology analysis

By aligning the GmSAHH1 coding Gene sequences in the NCBI database (https:// www.ncbi.nlm.nih.gov), it was found that two homologous genes GmSAHH2 (Glyma.05G152000, gene ID: 100815953), gmSAHH3 (Glyma.11G254700, gene ID: 100787210) were also present in soybean, and that the degrees of homology of GmSAHH1 to the other two genes were 99.6% and 97.3%, respectively (FIG. 2).

3) GmSAHH1 Gene tissue expression analysis

To identify GmSAHH expression levels of 1 in different tissues, roots, stems, leaves, flowers, pods and seeds of soybean variety kefeng No. 1 material at different developmental stages were taken: root, stem and leaf are stage V4; flowers are R2 phase; seeds and pods were 25 and 45 days post flowering. The samples were stored at-80℃after flash freezing in liquid nitrogen. Total RNA extraction is the same as in step 1). The total RNA obtained by sampling each tissue was used as a template and was inverted into cDNA. GmSAHH1 fluorescent quantitative primer sequences are P3: GACCATCCAGACCGCCGTT and P4: TTGACGCCTTCGTGGATGA. The results of the tissue expression level detection showed GmSAHH that 1 was expressed in the highest amount in the pod 45 days after flowers (fig. 3).

4) GmSAHH1 Gene subcellular localization

Designing a primer (without a stop codon) containing GmSAHH gene complete CDS, wherein the primer sequence is shown in P5: ACAAATCTATCTCTCTCGAGATGGCTTTGTTGGTGGAGAA and P6: GCTCACCATGGATCCGTACCTGTAGTGAGCAGGCT the specific PCR procedure is the same as in step 1). And (3) performing PCR amplification by using high-fidelity enzyme, performing gel recovery and cleaning on the obtained product, performing double enzyme digestion on the product and a carrier by using restriction enzymes SmaI and XhoI, connecting the product and the carrier with a carrier pAN580 by using T ₄ DNA ligase, then transforming, plating, sequencing a correct bacterial liquid extract plasmid, and naming the bacterial liquid extract plasmid as pAN 58-GmSAHH. And respectively transferring the bacterial strain and the empty load into EHA105 competence, injecting the agrobacterium tumefaciens bacterial solution into tobacco for 48 hours, and verifying subcellular localization by utilizing a Leica laser confocal microscope. The results indicated that the empty plasmid vector had green fluorescence in each tissue, while GmSAHH a was mainly localized in the cytoplasmic membrane (fig. 4).

Example 2 genetic engineering application of Gene GmSAHH1

1) Construction of plant overexpression vectors

The method of enzyme digestion recombination is utilized to construct an over-expression vector, firstly, restriction enzymes MluI and SacI are used to cut the pBA002 vector, and the concentration is measured after gel cutting, recovery and purification.

PCR amplification is carried out by taking the T-GmSAHH plasmid as a template, and the amplification primer sequence with the pBA002 carrier enzyme digestion joint is shown in P7: SEQ ID NO.3 and P8: SEQ ID NO.4, PCR procedure is as follows: pre-denaturation at 95℃for 3 min, denaturation at 95℃for 15 sec, annealing at 58℃for 15 sec, extension at 72℃for 60 sec, total of 35 cycles, final incubation at 72℃for 5 min, subsequent incubation at 4 ℃,

And (3) recovering the gel after gel running to obtain the GmSAHH gene complete CDS sequence with MluI and SacI enzyme cutting joints.

The target gene fragment with enzyme digestion joint amplified by the P7 and P8 primers and the cut pBA002 vector are utilized by Vazyme companyEntry One Step Cloning Kit (C115) for connection, transformation, plating, monoclonal selection and bacterial liquid PCR sequencing verification. The sequencing primer is a pBA002 vector primer, and the sequences are respectively P9: GCTCCTACAAATGCCATCATTGC, P10: GTATAATTGCGGGACTCTAA the specific PCR procedure is the same as in step 1). Finally, the pBA002-GmSAHH1 plant over-expression plasmid (figure 5) is obtained and stored in a refrigerator at-20 ℃ for standby.

2) Agrobacterium-mediated transformation of soybean hairy roots

1. Preparing bacterial liquid: the over-expression pBA002-GmSAHH1 plasmid and the pBA002 empty plasmid obtained in the step 1) are respectively transformed into agrobacterium EHA105, and bacterial solutions are respectively named pBA002-GmSAHH1 and pBA002-KZ. The pBA002-GmSAHH1 and pBA002-KZ bacterial liquid are streaked on a YEB plate containing spectinomycin, inverted by a shaking table at 28 ℃, and after the monoclonal is grown, the monoclonal is picked up into a 2ml centrifuge tube containing 1ml liquid culture medium. Shaking overnight at 28℃and transferred to 150ml Erlenmeyer flasks containing 120ml of liquid medium containing antibiotics. At 28℃and 100rpm overnight, the OD ₆₀₀ was measured to be between 0.85 and 0.9. The bacterial liquid in the conical flask is split into two 50ml centrifuge tubes, centrifuged at 5000rpm for 10min, and the supernatant is discarded. The bottom sediment was suspended with 45ml of 10mM MgCl ₂ (containing As), the suspension was poured into a collection tank, and the above steps were repeated once, and the bacterial liquid OD ₆₀₀ in the collection tank was measured to be 0.5-0.6, and was placed in a refrigerator for use.

2. Cotyledon infestation: selecting germinated green soybean cotyledons, digging holes on the back of the cotyledons, ensuring the wound area as large as possible, and spreading the treated soybean cotyledons on White solid medium containing cephalosporin and carbenicillin. 1-2 drops of MgCl ₂ suspended infectious microbe liquid are dropped in cotyledon holes, and the culture is carried out under the constant temperature and light-shielding environment at 25 ℃, and the culture medium is replaced every 14 days.

3) Identification of transgenic hairy roots

PCR detection: after 3 weeks of hairy root culture, samples were rapidly placed in liquid nitrogen to extract DNA, PCR amplification was performed with pBA002 vector primer sequences P9 and P10, the size of the amplified band of the plasmid positive hairy root of PBA002-GmSAHH1 was about 1700bp, and the size of the amplified band of the plasmid positive hairy root of PBA002 empty was about 500bp (FIG. 6).

QRT-PCR detection: the qRT-PCR detects the change of the transcription level of the target gene in the transgenic material, the primers are P3 and P4, and the result is shown in figure 7, and compared with the hairy root of the no-load control, the expression quantity of the target gene in the overexpressed hairy root is obviously improved.

3. Determination of free amino acid content: the hairy roots identified as positive are ground into powder by liquid nitrogen, and are dried for moisture in an oven at 60 ℃ for 18 hours. 5 replicates of pBA002-GmSAHH1 treatment and PBA002 empty control were each weighed 50mg of powder into a 5ml centrifuge tube, 2.5mL of 10mM HCl was added, the extract was leached at 40Hz for 1.5h under ultrasound, the leachate was filtered through a filter paper funnel into a 5ml volumetric flask, and the volume was finally fixed. Mu.l of the supernatant was aspirated, an equal volume of sulfosalicylic acid was added, mixed well, and centrifuged at 15000rpm for 15min. Centrifuging to obtain supernatant, filtering with 0.22 μm water filter membrane, and bottling to sample amino acid analyzer L-8900. As a result, it was found that the content of all amino acids in the overexpressed hairy roots was increased, in which the content of amino acids such as aspartic acid (Asp), glycine (Gly), cysteine (Cys), valine (Val), methionine (Met), lysine (Lys), arginine (Arg) was significantly increased (FIG. 8).

4) Construction of plant knockout vector

The target design adopts a high-flux CRISPR-cas9 target design program developed by the non-rice company, and the vectors GM-U6 and pCBS used in the test are provided by the non-rice company. Soybean GmSAHH gene sequences were downloaded from phytozome (https:// phytozome. Jgi. Doe. Gov /), and SgRNA target sequences were designed by the website CRISPR-P (http:// cbi. Hzau. Edu. Cn/CRISPR), with the four target sequences SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, respectively. Constructing a knockout carrier according to a design target, firstly carrying out annealing connection, running an Anneal program by a PCR instrument, adding 180 mu l H ₂ O after the program is finished, and uniformly mixing. And mixing the SG primer and the GM-U6 carrier on ice, connecting the SG primer sequence with SEQ ID NO.9、SEQ ID NO.10,SEQ ID NO.11、SEQ ID NO.12,SEQ IDNO.13、SEQ ID NO.14,SEQ ID NO.15、SEQ ID NO.16,T4 Ligase, running a Ligase program by a PCR instrument at 22 ℃ for 1h, and placing the mixture into a refrigerator for standby. The PCR product was ligated with pCBS vector using T4 Ligase, and the PCR instrument was run at 22℃for 1h and then placed in a refrigerator for 3h or overnight. The ligation product is transformed into escherichia coli DH5 alpha, after overnight culture, monoclonal is selected and subjected to bacterial detection, positive bacterial liquid is selected for sequencing detection, and the sequencing primer is P11: TCCCAGTCACGACGTTGTAA and P12: GCCATTTGTCTGCAGAATTG. The plasmid with the correct sequence was designated pCBS-4-GmSAHH1 (FIG. 9), and the plasmid was extracted and stored using the plasmid extraction kit.

5) Agrobacterium-mediated transformation of soybean cotyledonary node

Transforming the plasmid obtained in the step 4) into agrobacterium EHA105, and culturing plant tissues, wherein the specific experimental operation flow is as follows:

1. Preparing bacterial liquid: pCBS-4-GmSAHH1 bacterial liquid is streaked on a YEB plate containing kanamycin, inverted by a shaking table at 28 ℃, and after the bacterial liquid grows out of the monoclonal liquid, the monoclonal liquid is picked up into a 2ml centrifuge tube containing 1ml of liquid culture medium. Shaking overnight at 28℃and transferred to 150ml Erlenmeyer flasks containing 120ml of liquid medium containing antibiotics. At 28℃and 100rpm overnight, the OD ₆₀₀ was measured to be between 0.85 and 0.9.

2. And (3) bacterial liquid collection: the bacterial liquid in the conical flask is split into two 50ml centrifuge tubes, centrifuged at 5000rpm for 10min, and the supernatant is discarded. The bottom sediment is suspended by 45ml CCM-liquid, the suspension is poured into a collecting tank, and then the steps are repeated once, and the bacterial liquid OD ₆₀₀ in the collecting tank is measured to be 0.5-0.6, and the bacterial liquid can be placed in a refrigerator for standby.

3. Cotyledonary node genetic transformation: and (3) selecting a Tianlong first wild type soybean seed with uniform color and luster and plump and no cracks, and sterilizing. The disinfection is carried out by using chlorine generated by chemical reaction HCl (concentrated) +NaClO→Cl ₂ ++NaOH (the volume ratio of concentrated hydrochloric acid to sodium hypochlorite is about 1:10), and the disinfection is carried out in a fume hood for 6-7 hours. After sterilization was completed, the seeds were placed on an ultra clean bench to sufficiently blow off the residual chlorine gas, and then the seeds were inserted into SG4 solid medium with forceps overnight. The imbibed seeds were first bisected along the middle of the cotyledons with a scalpel, the true leaves were removed, and then several wounds were gently streaked with a scalpel along the hypocotyl at the cotyledonary node. The treated explant was poured into a sterilized jar together with the bacterial suspension from step 2) and co-cultured at 28℃for 30min at 120 rpm. Finally, the explants are taken out, one side of the cotyledonary node faces downwards, and the explants are placed on a solid co-culture medium CCM paved with a layer of filter paper, 14 explants are placed in each culture dish, and the explants are cultivated in the dark at 25 ℃ for 5 days. After 5 days of co-culture, the explants are sterilized by using sterilized water and Wash-Liquid, the overlong hypocotyls are cut off, about 5-10mm is reserved, the growing points are obliquely inserted into a SIM solid culture medium at an angle of 45 degrees upwards, at the moment, herbicide-resistant screening is not carried out, 8 explants with cluster buds growing out are replaced into the SIM solid culture medium added with 6mg/L glufosinate for screening after 15 days of illumination culture at 26 ℃ per dish, cotyledons, dead leaves and partial hypocotyls of the explants which are not completely dead are cut off after half a month of continuous culture, and the explants are replaced into the SEM solid culture medium added with 4mg/L glufosinate for culture. The above operations were performed for half a month and one cycle until there was bud elongation. When the buds of the explants were elongated to about 6cm, the bottoms were cut off, a cross wound was cut at the stem bottom, and the roots were transferred to rooting medium RM for cultivation, and the induced roots were visible after about 10 days. The bottles were filled with an appropriate amount of sterile water and incubated at 26℃for about 5 days with light. When the number and length of the roots are moderate, the tissue culture seedlings are separated from the culture medium and transferred into sterilized soil to be placed in an artificial incubator for growth (16 h light/8 h dark, 25 ℃).

4. The knocked-out tissue culture seedlings transplanted into the soil are firstly detected by a Bar test strip, and then DNA extracted from leaves is taken for PCR identification after detection, wherein the primers used for detection are P13: GCCTGTCGGACCGAGTTC and P14: CACCAATGGCACAAAACCCA, PCR amplified and sequenced, and compared with wild type to confirm whether targeting is performed.

6) Identification of T ₁ -generation knockout transgenic plants

PCR detection: sampling leaves of T ₁ knockout plants in V4 period, and extracting DNA. PCR amplification by using P13 and P14 as primers, sequencing, and confirming P15 for target plants: GTGGCCTATTCTGTGCTGGT and P16: ATCCCGGTGCTTGTTGTAGG were tested for Cas 9-free. The sequencing results were compared with the wild type of the control material Tianlong one, the editing type is shown in FIG. 10.

QRT-PCR detection: the results of detecting the change in the transcription level of the target gene in the transgenic material using P3 and P4 as primers are shown in fig. 7, and the expression level of the target gene in the knocked-out material is significantly reduced compared with that of the control material Tianlong No. (fig. 11).

3. Mixing upper, middle and lower leaves of plants, oven drying, grinding into powder, and repeating three biological steps for each plant for measuring hydrolyzed amino acid and free amino acid content. Free amino acid content determination referring to step 3), the results are shown in fig. 12 as a significant decrease in amino acid content in the knockout line.

Claims (4)

1. The application of the soybean S-adenosine-L-homocysteine hydrolase GmSAHH gene shown in SEQ ID NO.1 in the genetic engineering of soybean amino acid content.
2. 2. Use according to claim 1, characterized in that the knockout of the gene enables a significant reduction of the soybean amino acid content.
3. 3. The use according to claim 1, characterized in that overexpression of the gene is capable of significantly increasing the amino acid content of soybean.
4. 4. Use according to claim 1, characterized in that the amino acids comprise aspartic acid, glycine, cysteine, valine, methionine, lysine and arginine.