CN117965417A - Application of pentagalloylglucose in preparation of reagent for culturing enterococcus faecalis - Google Patents

Abstract

The invention provides application of pentagalloylglucose in preparation of a reagent for culturing enterococcus faecalis, and belongs to the technical field of probiotic culture. The pentagalloylglucose provided by the invention can effectively increase the abundance of Enterococcus in the faeces of the DSS-induced colonitis mice and the DNA content of the main strain E.faecalis in the genus. Meanwhile, in-vitro fermentation experiments also show that PGG supplementation can obviously improve the biomass of the strain, and the PGG intervention in-vivo and in-vitro experiments can obviously promote the growth of probiotics E.faecalis. In addition, the supernatant after the co-fermentation of PGG and E.faecalis not only effectively reduces the occurrence of nematode intestinal leakage and the generation of ROS, but also protects the normal form of mitochondria and promotes the expression of outer membrane proteins, thereby maintaining the steady-state of mitochondrial function and helping to maintain the integrity of intestinal barriers.

Description

Application of pentagalloylglucose in preparation of reagent for culturing enterococcus faecalis

Technical Field

The invention relates to the technical field of probiotics culture, in particular to application of pentagalloylglucose in preparation of a reagent for culturing enterococcus faecalis.

Background

Impaired intestinal barrier function and increased intestinal permeability can cause the occurrence of various chronic diseases such as metabolic diseases, schizophrenia, coronary heart disease, chronic kidney disease, chronic pancreatitis, aging, etc. Therefore, maintaining intestinal health is beneficial to establishing positive communication and connection with other organs, thereby maintaining the health state of the body. Mitochondrial function homeostasis is beneficial for promoting the expression of intestinal claudin and providing the intestinal tract with the necessary capacity for digestive metabolism etc. to enhance the intestinal barrier. While intestinal health depends on the protective mechanisms involved in the intestinal barrier, including mucus layer, constantly updated epithelial boundaries, tight junctions and even intestinal microbiota. Wherein probiotics in the intestinal flora are defined as live microbial food supplements having beneficial effects on human and animal health, intestinal flora regulation, pathogen inhibition and immunomodulation. But also the metabolites secreted by the intestinal flora may have beneficial effects, such as SCFAs, bile acids, etc. SCFAs have profound effects on human health, not only are energy sources for colonic cells, but also can inhibit pathogen growth, reduce intestinal inflammation, regulate epithelial cell growth and differentiation, etc. to maintain intestinal homeostasis. Thus, the intestinal flora plays an important role in intestinal homeostasis, and targeting the intestinal flora may be an effective means for preventing and treating intestinal diseases.

Prebiotic and probiotic intervention helps to enhance the commensal gut microbiota and/or its function, and natural products and the like can act as prebiotic substrates for gut microbes, beneficial to host health. Therefore, the prebiotic effect of plant polyphenols is of increasing interest to researchers. Pentagalloylglucose (PGG) is a hydrolyzable tannin, which exerts important biological activities in terms of antioxidation, anti-inflammatory, etc., however, it is still unclear whether it has a positive promoting effect on the growth of probiotics, and whether it promotes the metabolism of probiotics to exert its probiotic effect.

Disclosure of Invention

The invention aims to provide application of pentagalloylglucose in preparation of a reagent for culturing enterococcus faecalis, and the application of Pentagalloylglucose (PGG) in preparation of the reagent is clear that the pentagalloylglucose can promote growth of probiotic enterococcus faecalis (E.faecalis), and supernatant obtained after co-fermentation of the pentagalloylglucose and the PGG can obviously improve the integrity of damaged intestinal tracts, and plays an important role in regulating and controlling intestinal probiotics and probiotic activity thereof.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides an application of pentagalloylglucose PGG in preparing a reagent for culturing enterococcus faecalis.

Preferably, the pentagalloylglucose PGG promotes the growth and reproduction of enterococcus faecalis and improves the abundance of enterococcus faecalis in intestinal tracts.

Preferably, the final concentration of the pentagalloylglucose PGG in the culture medium is 1-2 mg/mL when the enterococcus faecalis is cultured.

The pentagalloylglucose PGG provided by the invention can effectively increase the abundance of Enterococcus in the DSS-induced colonitis mouse feces and the DNA content of a main strain E.faecalis in the genus. Meanwhile, in-vitro fermentation experiments also show that PGG supplementation can obviously improve the biomass of the strain, and the PGG intervention in-vivo and in-vitro experiments can obviously promote the growth of probiotics E.faecalis. In addition, the supernatant after the co-fermentation of PGG and E.faecalis not only effectively reduces the occurrence of nematode intestinal leakage and the generation of ROS, but also protects the normal form of mitochondria and promotes the expression of outer membrane proteins, thereby maintaining the steady-state of mitochondrial function and helping to maintain the integrity of intestinal barriers.

Drawings

FIG. 1 is a graph showing the analysis of the results of 16S rDNA of the abundance of Enterococcus in the feces of mice from different treatment groups in example 2;

FIG. 2 shows the DNA content of E.faecalis in the intestinal tract of mice from different treatment groups in example 2;

FIG. 3 is a representative picture of the isolation and purification of fecal bacteria from mice of different treatment groups in example 2.

FIG. 4 is a photograph of fermentation broth after fermentation in example 3, E.faecalis (FEF) group, E.faecalis+DMSO group (FDMSO), E.faecalis+PGG (FPGG) group;

FIG. 5 shows the growth curves of bacteria during fermentation in the E.faecalis+DMSO group, E.faecalis+PGG group, and E.faecalis group of example 3;

FIG. 6 is a schematic diagram showing normal intestinal tract and injury status of the nematode in example 4;

FIG. 7 is a graph showing the analysis of intestinal damage after treatment of nematodes with fermentation broth.

FIG. 8 is a schematic representation of normal and damaged morphology of mitochondria after treatment of nematodes with fermentation broth.

FIG. 9 is a graph showing statistical analysis of mitochondrial health and injury after treatment of nematodes with fermentation broth.

FIG. 10 shows the fluorescence expression of mitochondrial outer membrane proteins after treatment of nematodes with fermentation broth.

FIG. 11 is a graph of fluorescent quantitative analysis of mitochondrial outer membrane proteins after treatment of nematodes with fermentation broth.

FIG. 12 is a graph showing the effect of fermentation broth treatment of nematodes on their in vivo reactive oxygen species.

Detailed Description

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

1.1 Experimental materials and methods

PGG (supplied by functional food active material emphasis laboratory, guangdong province, > 96.5%), edible blue dye (Enoglaucine disodium salt, sigma, USA), anhydrous glucose (Shanghai source leaf, china), ET fermentation medium (Qingdao high technology Industrial garden, haibo Biotechnology Co., china).

1.2 Nematode strains and cultures

Nematode model: n2, PD4251, DLM14.

1.3NGM preparation

Preparation of glucose-containing NGM: glucose was first prepared as a 2M stock solution. The stock solution is diluted and mixed with E.coli OP50 bacterial liquid to obtain 200mM working solution, and then the working solution is coated on an NGM plate, and the working solution is air-dried and then sealed and stored at 4 ℃ for standby.

The bacterial liquid of E.coli OP50 without glucose is used as a blank control. Air-drying, sealing, and storing at 4deg.C.

Preparation of fermentation broth NGM: and E.faecalis is subjected to in-vitro fermentation, 2mL of centrifugation is taken, the supernatants are respectively collected in an enzyme-free centrifuge tube, 2mL of E.coli OP50 bacterial liquid is centrifuged, the supernatant is removed to obtain bacterial precipitate, the obtained fermentation liquid supernatant and E.coli OP50 bacterial liquid are uniformly mixed, glucose stock solution is added to ensure that the final concentration of glucose is 200mM, the glucose stock solution is uniformly mixed and then coated on an NGM plate, and the membrane is sealed after air drying and is preserved at 4 ℃ for standby.

Example 2

2.1 Abundance of Enterococcus in mouse faeces

The invention selects SPF grade C56BL/6J male mice with 6 weeks of age, and the weight range is 18-21g (purchased from Beijing velarihua laboratory animal technology Co., ltd., production license number SCXK (Zhe) 2019-0001). Mice were randomly divided into 3 groups after 1 week of adaptive rearing. The blank and DSS model groups were perfused daily with 0.5% sodium carboxymethylcellulose (0.5% CMC-Na), designated CK and DSS groups, respectively, and the PGG-treated group was perfused daily with 150mg/kg body weight, designated PGG group. Colonitis modeling is started after 4 weeks of gastric lavage, the CK group normally drinks water, the DSS and PGG groups of mice freely ingest drinking water containing 2% DSS, and each group of mice is subjected to gastric lavage for 1 time per day, and the modeling period is 10 days.

After the molding was completed, the stool samples (fresh stool from the mice was collected directly) were immediately stored at-80 ℃ after collection from the colon until analysis. DNA from different stool samples was extracted using MagPure Soil DNALQ kit according to the manufacturer's instructions. Samples were sequenced by IlluminaNovaSeq (Illumina, shanghai, china) sequencing using primers 343F-5'-TACGGRAGCAGG-3' and 798R-5'-AAGGTATCTAATCCT-3' for the V3-V4 hypervariable region of 16S rDNA for PCR amplification.

The invention discovers the composition and abundance of intestinal flora in mice of each group through 16s rDNA analysis, and discovers that the abundance of Enterococcus is not different between CK group and DSS group, but PGG treatment remarkably increases the community abundance of the genus (figure 1).

2.2 DNA content of E.faecalis in mouse faeces

As an important strain in the genus Enterococcus, the content of E.faecalis in the intestinal tract of mice was further determined in this example, bacterial DNA was isolated from the feces of mice, and the bacterial DNA was quantified by q-PCR. Bacterial DNA was isolated using a Mag-MK soil and fecal genomic DNA extraction kit according to the manufacturer's instructions. Wherein the total bacterial primer sequences are ACTCCTACGGGAGGCAGCAGT (UniF 340) and ATTACCGCGGCTGCTGGC (UniR) and the target strain E.faecalis primer sequences are GGGAGGCAGCAGTAGGGA (F) and GCCGTGGCTTTCTGGTTAG (R). qRT-PCR was performed using 2X SG Fast qPCR MasterMix (High Rox, B639273, BBI) and a fluorescent quantitative PCR instrument (ABI 7500software, USA). Bacterial total DNA was used as an internal reference. The relative DNA content was calculated using the 2 ^(-ΔΔCt) algorithm. The results show that the PGG treatment can significantly improve the DNA content of the probiotics E.faecalis in the mouse feces (figure 2), and the PGG can significantly promote the growth of the E.faecalis in the group and improve the community abundance of the E.faecalis.

2.3 Isolation and screening of intestinal probiotic E.faecalis

After determining the positive effect of PGG-regulated intestinal flora on the intestinal integrity of the body, the present invention used collected mouse faeces for isolation and purification of intestinal bacterial strains (fig. 3). The genetic information of the selected strains was determined by separation and purification and analysis by 16S rDNA technology, and the genetic information was compared using NCBI database (table 1), thereby determining information of each strain. The results show that in the intestinal flora of PGG-interfered mice, probiotic strains Enterococcusfaecalis strainNBRC 100481 were isolated and determined.

TABLE 1 sequencing information of isolated and purified strains for each treatment group

Example 3

To further illustrate the positive effect of PGG on growth, the present invention further explored the effect of supplemental PGG on e.faecalis using Enterococcusfaecalis strain NBRC 100481 (e.faecalis) isolated by team and in vitro fermentation techniques. The Enterococcusfaecalis strainNBRC 100481 strain exists in normal intestinal tract of human or animal, is beneficial to the stabilization of intestinal flora, can relieve intestinal injury, and can promote the secretion of Short Chain Fatty Acids (SCFAs).

Preparing ET fermentation medium and high-pressure sterilizing. Since PGG samples are not water-soluble, PGG is dissolved in DMSO and then added to the medium to obtain a PGG-containing medium. The E.faecalis strain was inoculated into a medium containing 0.0125% DMSO and PGG at a final concentration of 1.53mg/mL in an inoculum size of 5%, and the mixture was mixed uniformly and sub-packaged, and cultured under anaerobic conditions at 37 ℃. And solvent control and blank groups were set, i.e., E.faecalis (control group) and ET medium (blank group) were inoculated after adding DMSO (final concentration 0.0125%) to the ET fermentation medium, so that the fermentation experiments were set up in total of 3 groups, i.e., E.faecalis+DMSO group, E.faecalis+PGG group, E.faecalis group, and FDMSO, FPGG and FEF groups, respectively (FIG. 4). Meanwhile, in the in vitro fermentation process, sampling is carried out at time points of 0h,4h,8h,12h,16h,20h and 24h respectively, and absorbance of the fermentation liquid at 600nm is measured by using an enzyme-labeled instrument to determine a growth curve of E.faecalis.

The results are shown in FIG. 5, which shows that FEF and FDMSO groups of bacteria grow substantially in agreement, indicating that the DMSO concentrations involved in the experiment do not affect E.faecalis growth. The OD value of the fermentation liquor is obviously increased under the treatment of PGG, which shows that PGG can indeed regulate and control the biomass of E.faecalis, the biomass increases most rapidly in the first four hours, and the curve basically becomes flat after 8 hours. The PGG supplementation was shown to increase the biomass of the probiotic E.faecalis in vivo and in vitro experiments.

Example 4

Intestinal barrier integrity test

It was found from examples 2 to 3 that supplementation of PGG increased the abundance of enterococcus faecalis in colitis mice, and therefore, in order to verify whether PGG promoted the growth metabolism of probiotics and thus exerted the probiotic effect, the invention evaluated the effect of fermentation broth on the integrity of the intestinal tract of insects by means of food blue staining.

Preparing an edible blue stock solution with the final concentration of 5% by M9 buffer, sucking 2ml of E.coli OP50 bacterial solution, centrifuging for 1min in a 2ml EP tube, removing supernatant, uniformly mixing an edible blue dye (5% w/v) with bacterial cells, randomly selecting 15 nematodes in a blank control group (CK group), a model group (Glc group), a fermentation liquor treatment group (E.faecalis group, E.faecalis+DMSO group and E.faecalis+PGG group), dyeing for 7h in the prepared edible blue dye solution, and washing the nematodes by using M9 buffer until no blue residues exist in the eluate. And finally, taking a picture after the nematodes are anesthetized and fixed. Judgment standard: nematodes with blue food dyes in the gut are not considered to be blue-troops unless such dyes are also observed in the body cavity.

According to the condition of dye transfer to the body cavity in nematode intestinal canal in the experimental process, the influence of fermentation supernatant on intestinal canal barrier is judged (figure 6), wherein in figure 6, "non-Smurf" is that the dye is not transferred in the intestinal canal, and "Smurf-transition" is that partial transfer (intestinal leakage) occurs, and "Smurf" is that the intestinal canal damage is more serious, and the whole body cavity is blue dye.

The ratio of the three E.faecalis in vitro fermentation broths was found to increase the integrity of the nematode gut, and the integrity of the nematode gut was increased by 24.44%,28.88% and 42.22% compared to the Glc group, FEF, FDMSO and FPGG groups, respectively (FIG. 7). The prebiotic effect of FPGG treatment groups was significantly higher than that of E.faecalis when fermented alone, indicating that the metabolites after co-fermentation of PGG and E.faecalis play an important role in protecting intestinal integrity.

Example 5

Nematode mitochondrial morphometry

As a functional organelle, mitochondria provide the energy required for cell survival and operation. The intestinal tract, as the largest digestive organ in the body, requires a great deal of capacity to sustain intestinal motility. To further determine whether fermentation broths are also dependent on promoting mitochondrial function homeostasis to protect intestinal barrier integrity, the present invention utilizes nematode mutants to evaluate the effects of fermentation broths on mitochondrial function. In the nematode mutant strain PD4251, mitochondria were co-expressed with Green Fluorescent Protein (GFP) in all body wall muscle cells. Thus, changes in mitochondrial morphology can be observed using GFP-tagged fluorescent visualizations of transgenic nematode PD 4251.

After completion of drug treatment (Glc was added to OP50 bacteria and each group of fermentation broths mixed with OP50 bacteria, respectively, and after application to NGM medium for nematode feeding), at least 15 nematodes were anesthetized (1% nan ₃) and fixed on glass slides, photographed using a fluorescence microscope at 40 x magnification with objective lenses, and different forms of mitochondria were observed and statistically analyzed.

In mutant PD4251 in which mitochondria were co-localized with GFP, whether the mitochondria were morphologically changed was observed by fluorescence microscopy. Fig. 8 shows that the proportion of mitochondrial "tubulor" phenotype was increased in all three groups of broth treatments compared to the model group, however the effect on reduction of mitochondrial damage was significant under FPGG intervention (fig. 9).

Example 6

The invention also determines the expression condition of the outer mitochondrial membrane protein, and detects the expression of the outer mitochondrial membrane channel protein TOM-7 by using the transgenic nematode DLM 14. After the DLM14 mutant (Glc was added to the OP50 bacteria solution and the mixed bacteria solution of each group of fermentation solutions and OP50 bacteria, respectively, and after being spread on the NGM medium for feeding by nematodes), the nematodes were anesthetized with 1% NaN ₃ and fixed on a slide, and photographed with a confocal laser fluorescence microscope 10× (LSM 800, carl Zeiss, jena, germany) or a fluorescence microscope 10× magnification of an objective lens. And its fluorescence intensity was quantitatively analyzed using Image J software to determine the expression level of TOM-7. At least 15 nematodes per experiment were counted and three biological replicates were performed.

As shown in FIGS. 10-11, fermentation broth treatment of PGG and E.faecalis promoted expression of the critical gene TOM-7 of the mitochondrial outer membrane TOM complex. In the fermentation liquor treatment process, the intestinal integrity of the nematodes and the steady-state of the mitochondrial function are synchronously improved, which indicates that mitochondria can play an important role in maintaining the intestinal barrier integrity, and can depend on stable functions to meet the energy required by the intestinal activities of the nematodes.

Example 7

The accumulation of excessive ROS is also one of the important causes of intestinal damage, and the invention further determines the effect of fermentation broth on ROS levels in insects.

N2 nematodes (Glc is added to the OP50 bacterial liquid and the bacterial liquid mixed by each group of fermentation liquid and OP50 bacterial liquid respectively, and the bacterial liquid is coated on an NGM culture medium for feeding by the nematodes) are repeatedly washed for a plurality of times by using an M9 buffer solution, so that bacteria on the body surface are removed, and the influence on a measurement result is avoided. 100 clean nematodes were transferred to 96-well plates containing M9 buffer, H2-DCF-DA (reduced fluorescent probe with membrane permeability) solution (final concentration 50. Mu.M) was added to each well containing the worms before detection, after incubation at 37℃one fluorescence measurement was performed at 1H intervals at 37℃using a EnSpire multifunctional microplate reader for 6H (excitation: 485nm; emission: 535 nm), the results were expressed as the mean area integral of the curve (FIG. 12), and wells without nematode-containing H2-DCF-DA solution were used as blank wells.

The results indicate that FPGG treatment can significantly reduce ROS levels in nematodes, suggesting that PGG or its metabolites may play an important role in protecting intestinal integrity.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (3)

1. Application of pentagalloylglucose in preparing a reagent for culturing enterococcus faecalis.

2. The use of claim 1, wherein said pentagalloylglucose promotes the growth and reproduction of enterococcus faecalis and increases the abundance of enterococcus faecalis in the gut.

3. The use according to claim 2, wherein the final concentration of pentagalloylglucose in the culture medium is 1-2 mg/mL when culturing enterococcus faecalis.