CN117964761A

CN117964761A - Anti-TREM 2 antibodies and uses thereof

Info

Publication number: CN117964761A
Application number: CN202311778506.0A
Authority: CN
Inventors: 周祥山; 张苗; 孙乐桥; 吴坤宝; 曹峰崎; 李娴; 白贵荣
Original assignee: China Resources Biomedical Co ltd
Current assignee: China Resources Biomedical Co ltd
Priority date: 2023-12-21
Filing date: 2023-12-21
Publication date: 2024-05-03

Abstract

The present disclosure provides an anti-TREM 2 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof specifically binds TREM2, TREM2 being a trending target with potential for the treatment of cancer and neurodegenerative diseases.

Description

Anti-TREM 2 antibodies and uses thereof

Reference to sequence Listing

The present application comprises a sequence listing in computer readable form, which is incorporated herein by reference.

Technical Field

The disclosure belongs to the technical field of antibodies, and more particularly relates to an anti-TREM 2 antibody or an antigen binding fragment thereof and application thereof.

Background

The international cancer research institute (International Agency for Research on Cancer, IARC) issued global latest cancer burden data of 457 cases of new cancer in China in 2020, 23.7% of the global new cases, 300 tens of thousands of cancer death cases, and 30% of the total number of cancer deaths in 2020. In cities and rural areas of our country, the mortality rates of malignant tumors are respectively ranked at the 1 st and the 2 nd positions. The data show that the total yield of the Chinese anti-tumor medicament in 2019 reaches 1156.2 hundred million yuan, and the same ratio is increased by 16 percent. According to the average compound growth rate of the past five years, the total yield of Chinese anti-tumor drugs reaches 1341.2 hundred million yuan in 2020, and the global tumor market reaches 1119 hundred million dollars.

According to the data statistics of the world-guard organization, the current global Alzheimer's Disease (AD) patients reach 5200 ten thousand people, and are explosively growing, and the estimated year 2050 is about to reach 1.5 hundred million people. In China, AD patients are about 1000 ten thousand, accounting for one fifth of the total cases in the world. Market scale (eliminating intelligence-promoting medicines) in 2019 is 15.39 hundred million yuan, compound annual average growth rate CAGR (Compound Annual Growth Rate) in 2014-2019 is 16%, and continuous increase of market scale also shows increase of anti-dementia medicine demand in China.

Recent studies have shown that the deletion of mouse myeloid cell trigger receptor 2 (TRIGGERING RECEPTOR EXPRESSED ON MYELOID CELLS-2, TREM 2) reduces tumor growth and most likely by enhancing T cell killing function, while the deletion of TREM2 gene results in a significant decrease in the number of regulatory myeloid cells, an increase in immune response to tumors, such as an increase in natural killer cells (natural KILLER CELL, NK cells) and cytotoxic T cells; both TREM2 depletion and anti-TREM 2 mab treatment resulted in significant changes in the tumor-infiltrating macrophage population: infiltration of mannose receptor 1 (Mannose receptor, MRC 1), chemokine receptor (chemokine receptors, CX3CR 1) and immunosuppressive macrophages in the tumor microenvironment is reduced, expansion of a subset of myeloid lineage expressing immunostimulatory factors (promoting improved T cell responses) is enhanced, while TREM2 deletion or combination with anti-TREM 2 mAbs enhances anti-PD-1 treatment. Clinical Tumor sample analysis showed that TREM2 was highly expressed (mediated immunosuppression) on Tumor-associated macrophages (Tumor-associated macrophage, TAMs) in the Tumor microenvironment (Tumor Microenvironment, TME) of more than 200 cases of primary and metastatic cancers in humans, with high expression being inversely correlated with overall survival and prognosis of gastric, colorectal and triple negative breast cancers. Therefore, TREM2 is an optional high-quality target for realizing solid tumor immunotherapy from the viewpoint of remodelling tumor microenvironment.

TREM2 is an emerging tumor immune target, and immune checkpoint therapy releases T cell control of the tumor but is destroyed by immunosuppressive myeloid cells. Anti-inflammatory and immunosuppressive activity of TREM2 promotes tumor growth and immune escape, blocks TREM2 signal transduction or depletes trem2+ myeloid cells in tumors to activate T cell mediated anti-tumor immune response is a new targeted drug therapy strategy that can be used in combination with pd-1 antibodies and enhance anti-pd-1 immunotherapy.

In Alzheimer's Disease (AD), an increase in the risk of AD is associated with a TREM2 mutation, a R47H missense mutation of TREM2, or the like, causing a microglial lipid recognition disorder. In the action model of preclinical AD, TREM2 is a lipid receptor expressed in microglia and other tissue macrophages, phospholipids, apolipoproteins (APOEs) and lipoproteins bind to TREM2, transmitting intracellular activation signals through adapter DAP12, promoting microglial activation, survival; the formation of a microglial barrier around the aβ plaques, forming neuroprotection; while aβ binding to APOE-containing or Clusterin (CLU) may aid in the delivery of these complexes to microglia, resulting in increased aβ clearance and reduced neuronal damage.

In AD, agonistic antibodies targeting TREM2 can delay the appearance and progression of alzheimer's disease by promoting TREM2 activation, activating microglial cells, and inducing their response to neurodegeneration (including proliferation, survival, aggregation, and phagocytosis).

TREM2 is therefore a hot target with potential for the treatment of cancer and neurodegenerative diseases. Because of the unmet clinical medical need for a large number of malignant tumors and neurodegenerative diseases, there is a need for other TREM2 antibodies with more desirable pharmaceutical characteristics.

Disclosure of Invention

In response to the above-described problems, the present disclosure provides antibodies, methods of making the same, compositions, and the like. The benefits provided by the present disclosure are broadly applicable to the fields of antibody therapy and diagnosis, and can be used in combination with antibodies reactive with various targets, and the present invention provides antibodies, preferably chimeric or humanized monoclonal antibodies, capable of specifically binding TREM 2.

In one aspect, the present disclosure provides an anti-TREM 2 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof specifically binds TREM2, wherein the isolated antibody or antigen-binding fragment thereof comprises a heavy chain variable region (HCDR) and a light chain variable region (LCDR), wherein the light chain variable region comprises LCDR1, LCDR2, and LCDR3:

The LCDR1 comprises the following sequence:

[K/R][S/A]S[Q/K/*][S/*][L/*][Q/L/V/E][D/H/N/S/Y][S/V/I][D/N/G][G/*][N/K/*]T[Y/N][L/V/I][N/H/S/Y]；

the LCDR2 comprises the following sequence:

[L/K/G/H/R][V/A/M]S[K/N/E][L/R/S][D/F/Y/I/A][S/T]；

the LCDR3 comprises the following sequence:

[W/S/G/Q/M]Q[G/S/H][T/Y/N/L][H/S/N/E][F/V/Y/W]P[Y/L/F]T；

the heavy chain variable region comprises HCDR1, HCDR2 and HCDR3:

the HCDR1 comprises the following sequence:

[D/S][G/*]Y[G/W/Y/N][M/W][H/N]；

The HCDR2 comprises the following sequence:

[A/R/Y/F]I[D/Y/S/N][P/*][E/G/Y/N][T/D/N/S]G[G/D/R/T][T/N/I][A/N/G/T][Y/F]N[Q/G/P][K/S/N][F/L]K[G/N];

the HCDR3 comprises the following sequence:

[E/K/S/P][L/G/P/S/*][W/H/T/F/Y/*][D/F/G/V/Y/*][G/Y/T/*][G/V/T/*][E/V/S/*][G/*][E/*][E/*][N/V/E/*][A/T/P/N/G/*][M/E/S/F/*][A/D]Y.

further, the above isolated antibody or antigen binding fragment thereof, wherein,

The LCDR1 comprises a sequence corresponding to SEQ ID NO: 35. 38, 41, 44, 47, and 50 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, or a sequence consisting of SEQ ID NO: 35. 38, 41, 44, 47 and 50; and/or the number of the groups of groups,

The LCDR2 comprises a nucleotide sequence corresponding to SEQ ID NO: 36. 39, 42, 45, 48, and 51, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to one another, or consisting of SEQ ID NO: 36. 39, 42, 45, 48 and 51; and/or the number of the groups of groups,

The LCDR3 comprises a nucleotide sequence corresponding to SEQ ID NO: 37. 40, 43, 46, 49 and 52 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, or a sequence consisting of SEQ ID NO: 37. 40, 43, 46, 49 and 52.

The HCDR1 comprises a sequence identical to SEQ ID NO: 56. 59, 62, 65, 68 and 71 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to one of SEQ ID NO: 56. 59, 62, 65, 68 and 71; and/or the number of the groups of groups,

The HCDR2 comprises a sequence identical to SEQ ID NO: 57. 60, 63, 66, 69, and 72 has a sequence of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, or a sequence of SEQ ID NO: 57. 60, 63, 66, 69 and 72; and/or the number of the groups of groups,

The HCDR3 comprises a sequence identical to SEQ ID NO: 58. 61, 64, 67, 70 and 73, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to one another, or consisting of SEQ ID NO: 58. 61, 64, 67, 70 and 73.

In some embodiments of the invention, the antibodies or fragments thereof include the following combinations:

(a) SEQ ID NO:56, HCDR1, SEQ ID NO:57, and HCDR2 as set forth in SEQ ID NO:58, HCDR3, SEQ ID NO:35, LCDR1, SEQ ID NO:36, and LCDR2 as set forth in SEQ ID NO: LCDR3 as indicated at 37; or (b)

(B) SEQ ID NO:59, HCDR1, SEQ ID NO:60, and HCDR2 as set forth in SEQ ID NO:61, HCDR3, SEQ ID NO:38, LCDR1, SEQ ID NO:39, and LCDR2 as set forth in SEQ ID NO: LCDR3 as shown at 40; or (b)

(C) SEQ ID NO:62, HCDR1, SEQ ID NO:63, and HCDR2 as set forth in SEQ ID NO:64, HCDR3, SEQ ID NO:41, LCDR1, SEQ ID NO:42, and LCDR2 as set forth in SEQ ID NO: LCDR3 as shown at 43; or (b)

(D) SEQ ID NO:65, HCDR1, SEQ ID NO:66, and HCDR2 as set forth in SEQ ID NO:67, HCDR3, SEQ ID NO:44, LCDR1, SEQ ID NO:45, and LCDR2 as set forth in SEQ ID NO: LCDR3 as shown at 46; or (b)

(E) SEQ ID NO:68, HCDR1, SEQ ID NO:69, and HCDR2 as set forth in SEQ ID NO:70, HCDR3 shown in SEQ ID NO:47, LCDR1, SEQ ID NO:48, and LCDR2 as set forth in SEQ ID NO: LCDR3 as shown in 49; or (b)

(F) SEQ ID NO:71, HCDR1, SEQ ID NO:72, and HCDR2 as shown in SEQ ID NO:73, HCDR3, SEQ ID NO:50, LCDR1, SEQ ID NO:51, and LCDR2 as set forth in SEQ ID NO: LCDR3 as shown at 52.

Further, the isolated antibody or antigen binding fragment thereof described above, wherein the heavy chain variable region comprises a sequence that hybridizes to SEQ ID NO: 20. 22, 24, 26, 28, and 30 has a sequence of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, or a sequence of SEQ ID NO: 20. 22, 24, 26, 28 and 30.

Further, the isolated antibody or antigen binding fragment thereof described above, wherein the light chain variable region comprises a sequence that hybridizes to SEQ ID NO: 19. 21, 23, 25, 27, and 29 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, or a sequence consisting of SEQ ID NO: 19. 21, 23, 25, 27 and 29.

Further, the antibody or fragment, wherein,

(A) The heavy chain variable region comprises a sequence identical to SEQ ID NO:20, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:20 parts;

Wherein the light chain variable region comprises a sequence identical to SEQ ID NO:19 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, or a sequence consisting of SEQ ID NO: 19;

(b) The heavy chain variable region comprises a sequence identical to SEQ ID NO:22 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, or a sequence consisting of SEQ ID NO: 22;

Wherein the light chain variable region comprises a sequence identical to SEQ ID NO:21 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, or a sequence consisting of SEQ ID NO: 21;

(c) The heavy chain variable region comprises a sequence identical to SEQ ID NO:24 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, or a sequence consisting of SEQ ID NO: 24;

Wherein the light chain variable region comprises a sequence identical to SEQ ID NO:23 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, or a sequence consisting of SEQ ID NO: 23;

(d) The heavy chain variable region comprises a sequence identical to SEQ ID NO:26 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, or a sequence consisting of SEQ ID NO: 26;

Wherein the light chain variable region comprises a sequence identical to SEQ ID NO:25, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 25;

(e) The heavy chain variable region comprises a sequence identical to SEQ ID NO:28 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, or a sequence consisting of SEQ ID NO: 28;

Wherein the light chain variable region comprises a sequence identical to SEQ ID NO:27, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 27;

(f) The heavy chain variable region comprises a sequence identical to SEQ ID NO:30 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, or a sequence consisting of SEQ ID NO: 30;

Wherein the light chain variable region comprises a sequence identical to SEQ ID NO:29 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, or a sequence consisting of SEQ ID NO: 29.

Further, the isolated antibody or antigen binding fragment thereof described above further comprises a heavy chain constant region, wherein the heavy chain constant region comprises a sequence that hybridizes to SEQ ID NO:34 or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 34.

Further, the isolated antibody or antigen binding fragment thereof described above further comprises a light chain constant region comprising a sequence identical to SEQ ID NO:33 or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 33.

Further, the isolated antibody or antigen binding fragment thereof comprises:

(a) A light chain comprising a sequence identical to SEQ ID NO: 5.7, 9, 11, 13 and 15 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity or consists of SEQ ID NO: 5.7, 9, 11, 13 and 15;

(b) A heavy chain comprising a sequence identical to SEQ ID NO: 6.8, 10, 12, 14, and 16, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to one another or consisting of SEQ ID NO: 6.8, 10, 12, 14 and 16.

Further, the isolated antibody or antigen binding fragment thereof comprises:

(a) And SEQ ID NO:5 or a light chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 5; and SEQ ID NO: 6. 8, 10, 12, 14, and 16, or a heavy chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence of SEQ ID NO: 6. 8, 10, 12, 14 and 16;

(b) And SEQ ID NO:7, or a light chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:7, a light chain; and SEQ ID NO: 6. 8, 10, 12, 14, and 16, or a heavy chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence of SEQ ID NO: 6. 8, 10, 12, 14 and 16;

(c) And SEQ ID NO:9 or a light chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 9; and SEQ ID NO: 6. 8, 10, 12, 14, and 16, or a heavy chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence of SEQ ID NO: 6. 8, 10, 12, 14 and 16;

(d) And SEQ ID NO:11 or a light chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity or consisting of SEQ ID NO: 11; and SEQ ID NO: 6. 8, 10, 12, 14, and 16, or a heavy chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence of SEQ ID NO: 6. 8, 10, 12, 14 and 16;

(e) And SEQ ID NO:13 or a light chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 13; and SEQ ID NO: 6. 8, 10, 12, 14, and 16, or a heavy chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence of SEQ ID NO: 6. 8, 10, 12, 14 and 16;

(f) And SEQ ID NO:15 or a light chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 15; and SEQ ID NO: 6. 8, 10, 12, 14, and 16, or a heavy chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence of SEQ ID NO: 6. 8, 10, 12, 14 and 16.

Further, the isolated antibody or antigen binding fragment thereof described above, wherein:

(a) And SEQ ID NO:5 or a light chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 5; and SEQ ID NO:6, or a heavy chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:6, a heavy chain;

(b) And SEQ ID NO:7, or a light chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:7, a light chain; and SEQ ID NO:8 or a heavy chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:8, a heavy chain consisting of;

(c) And SEQ ID NO:9 or a light chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 9; and SEQ ID NO:10 or a heavy chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity or consisting of SEQ ID NO: 10;

(d) And SEQ ID NO:11 or a light chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity or consisting of SEQ ID NO: 11; and SEQ ID NO:12 or a heavy chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:12, a heavy chain consisting of one of 12;

(e) And SEQ ID NO:13 or a light chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 13; and SEQ ID NO:14 or a heavy chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 14;

(f) And SEQ ID NO:15 or a light chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 15; and SEQ ID NO:16 or a heavy chain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:16, and a heavy chain consisting of 16.

Further, the antibody or antigen binding fragment thereof of any one of the preceding claims, wherein the antibody is a monoclonal antibody.

Further, the antibody or antigen binding fragment thereof of any one of the preceding claims, wherein the antibody is a chimeric or humanized antibody or an improved antibody, e.g. an improved chimeric antibody.

Further, an isolated nucleic acid molecule comprising a nucleic acid sequence encoding an antibody or antigen-binding fragment thereof as described above.

Further, a vector comprising the nucleic acid molecule described above.

Further, a host cell comprising the nucleic acid molecule or vector described above.

Further, a conjugate comprising an antibody or antigen-binding fragment thereof as described above coupled to at least one detectable label.

Further, an antibody drug conjugate comprising an antibody comprising one or more drug moieties covalently linked to the antibody or antigen binding fragment thereof directly or via a linker.

Further, a multispecific molecule comprising an antibody or antigen-binding fragment thereof described above; preferably, the multispecific molecule specifically binds TREM2, and additionally specifically binds one or more other targets; further preferred, the multispecific molecule further comprises at least one molecule having a second binding specificity for a second target.

Further, a pharmaceutical composition or kit comprising an antibody or antigen-binding fragment thereof, or a nucleic acid molecule, or a vector, or a host cell, or a conjugate, or an antibody drug conjugate, or a multispecific molecule, or a pharmaceutically acceptable carrier as described above.

Further, a method for preparing the antibody or the antigen binding fragment thereof comprises the following steps:

(i) Expressing the antibody or antigen binding fragment thereof in the host cell; and optionally

(Ii) Isolating the antibody or antigen binding fragment thereof from the host cell.

Further, the use of an antibody or antigen binding fragment thereof, or a nucleic acid molecule, or a vector, or a host cell, or a conjugate, or an antibody drug conjugate, or a multispecific molecule, or a pharmaceutical composition, or a kit as described above, in the preparation of a kit for diagnosing, detecting, or monitoring a disease associated with TREM2 expression.

Further, the use of an antibody or antigen binding fragment thereof, or a nucleic acid molecule, or a vector, or a host cell, or a conjugate, or an antibody drug conjugate, or a multispecific molecule, or a pharmaceutical composition, or a kit as described above, in the manufacture of a medicament for treating a disease associated with TREM2 expression or determining the prognosis thereof.

Further, as for the above use, it is combined with PD-1.

Further, the use as described above, wherein the disease associated with TREM2 expression is a cancer selected from the group consisting of: gastric cancer, colorectal cancer, breast cancer, liver cancer, pancreatic cancer, lung cancer, prostate cancer, glioma, ovarian cancer.

Further, the use as described above, wherein the disease associated with TREM2 expression is a neurodegenerative disease selected from the group consisting of: alzheimer's Disease (AD), parkinson's Disease (PD), autism (ASDs), multiple Sclerosis (MS), amyotrophic Lateral Sclerosis (ALS).

Further, the use as described above, wherein the disease associated with TREM2 expression is metabolic syndrome selected from the group consisting of: fat cell hypertrophy, systemic hypercholesterolemia, inflammation, and glucose intolerance.

Drawings

The accompanying drawings are included to provide a further understanding of the disclosure, and are incorporated in and constitute a part of this specification, illustrate embodiments of the disclosure and together with the description serve to explain the disclosure, without limitation to the disclosure. In the drawings:

FIG. 1A shows the results of detection of the binding activity of anti-TREM 2 antibodies C1 and G3 to cell surface huTREM;

FIG. 1B shows the results of detection of the binding activity of anti-TREM 2 antibodies 2A6 and 2A10 to cell surface huTREM;

FIG. 1C results of detection of binding activity of anti-TREM 2 antibodies mAb006C and mAb008C to cell surface huTREM 2;

FIG. 2A shows the results of detection of binding activity of anti-TREM 2 antibodies C1 and G3 to monkey TREM 2;

FIG. 2B shows the results of detection of binding activity of anti-TREM 2 antibodies 2A6 and 2A10 to monkey TREM 2;

FIG. 2C results of detection of binding activity of anti-TREM 2 antibodies mAb006C and mAb008C to monkey TREM 2;

FIG. 3A results of detection of binding activity of anti-TREM 2 antibodies C1 and G3 to murine TREM 2;

FIG. 3B results of detection of binding activity of anti-TREM 2 antibodies 2A6 and 2A10 to murine TREM 2;

FIG. 3C results of detection of binding activity of anti-TREM 2 antibodies mAb006C and mAb008C to murine TREM 2;

FIG. 4TREM2 reporter gene activity assay results, wherein the abscissa indicates antibody concentration and the ordinate RLU represents relative light units;

FIG. 5 is a graph of tumor growth in mice, wherein G represents group, ip represents intraperitoneal injection, and BIW represents twice weekly administration;

FIG. 6 shows survival curves for groups of mice wherein Group represents Group, ip represents intraperitoneal injection, and BIW represents twice weekly dosing.

Detailed Description

Hereinafter, only certain exemplary embodiments are briefly described. As will be recognized by those of skill in the pertinent art, the described embodiments may be modified in various different ways without departing from the spirit or scope of the present disclosure. Accordingly, the drawings and description are to be regarded as illustrative in nature and not as restrictive.

The preferred embodiments of the present disclosure are described below in conjunction with the accompanying drawings, it being understood that the preferred embodiments described herein are for purposes of illustration and explanation only and are not intended to limit the present disclosure.

Unless otherwise defined herein, scientific and technical terms used in connection with the present application will have the meanings commonly understood by one of ordinary skill in the art. Furthermore, unless the context requires otherwise, terms in the singular shall include the plural and terms in the plural shall include the singular. More specifically, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. In the present application, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "include" and other forms (such as "include" and "contain") is not limiting. Furthermore, the scope provided in the specification and the appended claims includes all values between the endpoints and between the endpoints.

Definition of the definition

The term "antibody" is used in its broadest sense and encompasses a variety of antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), full-length antibodies, and antigen-binding fragments thereof, so long as they exhibit the desired antigen-binding activity. The term "antibody moiety" refers to a full-length antibody or antigen-binding fragment thereof.

Full length antibodies comprise two heavy chains and two light chains. The variable regions of the light and heavy chains are responsible for antigen binding. The variable domains of the heavy and light chains may be referred to as "VH" and "VL", respectively. The variable region in both chains typically comprises three highly variable loops, known as Complementarity Determining Regions (CDRs) (light chain CDRs (LCDR), including LCDR1, LCDR2 and LCDR3, and heavy chain CDRs (HCDR), including HCDR1, HCDR2 and HCDR 3). CDR boundaries of antibodies and antigen binding fragments disclosed herein can be defined or identified by Kabat, chothia or by the convention of Al-Lazikani (Al-Lazikani 1997; chothia 1985; chothia 1987; chothia 1989; kabat 1987; kabat 1991). The three CDRs of the heavy or light chain are interposed between flanks called Framework Regions (FR), which are more highly conserved than the CDRs and form a scaffold to support the hypervariable loops. The constant regions of the heavy and light chains do not participate in antigen binding, but exhibit various effector functions. Antibodies are classified according to the amino acid sequence of their heavy chain constant region. The five main classes or isotypes of antibodies are IgA, igD, igE, igG and IgM, characterized by the presence of the alpha, delta, epsilon, gamma and mu heavy chains, respectively. Several major classes of antibodies are classified into subclasses, such as lgG1 (gamma 1 heavy chain), lgG2 (gamma 2 heavy chain), lgG3 (gamma 3 heavy chain), lgG4 (gamma 4 heavy chain), lgA1 (alpha 1 heavy chain) or lgA2 (alpha 2 heavy chain).

As used herein, the term "antigen-binding fragment" refers to an antibody fragment, including, for example, a diabody, fab ', F (ab ') ₂, fv fragment, disulfide stabilized Fv fragment (dsFv), (dsFv) ₂, bispecific dsFv (dsFv-dsFv '), disulfide stabilized diabody (dsdiabody), single chain Fv (scFv), scFv dimer (diabody), multispecific antibody formed from a portion of an antibody comprising one or more CDRs, camelid single domain antibody, nanobody, domain antibody, bivalent domain antibody, or any other antibody fragment that binds an antigen but does not comprise an intact antibody structure. The antigen-binding fragment is capable of binding to the same antigen to which the parent antibody or parent antibody fragment (e.g., parent scFv) binds. In some embodiments, an antigen binding fragment may comprise one or more CDRs from a particular human antibody grafted to a framework region from one or more different human antibodies.

As used herein, the term "CDR" or "complementarity determining region" means a discontinuous antigen binding site found within the variable regions of heavy and light chain polypeptides. These specific regions are described in Kabat et al, J.biol. Chem.252:6609-6616 (1977); kabat et al ,U.S.Dept.Of Health andHuman Services",Sequences of proteins of immunological interest"(1991);Chothia et al, J.mol. Biol.196:901-917 (1987); al-Lazikanib et Al, J.mol.biol.,. 273:927-948 (1997); mac Callum et al, J.mol.biol.262:732-745 (1996); abhinandan AND MARTIN, mol.immunol.,45:3832-3839 (2008); lefranc m.p. et al, dev. Comp. Immunol.,27:55-77 (2003); and honeygger and Pluckthun, J.mol.biol.,309:657-670 (2001), where the definition includes overlapping or subsets of amino acid residues when compared to each other. However, the application of either definition to refer to CDRs of an antibody or grafted antibody or variant thereof is intended to be within the scope of the terms defined and used herein. Amino acid residues encompassing CDRs as defined by each of the references cited above are listed in table 1 below for comparison. CDR prediction algorithms and interfaces are known in the art, including, for example, abhinandan AND MARTIN, mol.immunol.,45:3832-3839 (2008); EHRENMANN F, et al, nucleic Acids Res.,38:D301-D307 (2010); and Adolf-Bryfogle J. Et al, nucleic Acids Res.,43:D432-D438 (2015). The content of the references cited in this paragraph is incorporated by reference in its entirety for use in the present disclosure and possibly contained in one or more of the claims herein. In some embodiments, CDR sequences provided herein are based on IMGT definitions. For example, CDR sequences can be determined by VBASE2 tool (http:// www.vbase2.org/vbase2.Php, see also RetterI, althausHH, mu nchR, mu llerW: VBASE2an integrated Vgeenedatabase. Nucleic acids Res.2005Jan1;33 (database album Databaseissue): D671-4, which is incorporated herein by reference in its entirety). The expression "variable domain residue number as in Kabat" or "amino acid position number as in Kabat" and variants thereof, following the nomenclature of honeygger and pluckthun above, refers to the numbering system for the heavy chain variable domain or light chain variable domain of the antibody assembly in Kabat et al above. Using this numbering system, the actual linear amino acid sequence may comprise fewer or more amino acids, which corresponds to shortening or insertion of the FR or hypervariable region (HVR) of the variable domain. For example, the heavy chain variable domain may include a single amino acid insertion following the residue of H2 (residue 52a according to Kabat) and inserted residues following heavy chain FR residue 82 (e.g., residues 82a, 82b, 82c according to Kabat, etc.). The Kabat numbering of residues of a given antibody may be determined by alignment of the homologous regions of the antibody sequences with "standard" Kabat numbering sequences. Unless otherwise indicated herein, the numbering of residues in the heavy chain of an immunoglobulin is that of the EU index as in Kabat et al, supra. "EU index as in Kabat" refers to the residue number of the human IgG1EU antibody.

"Framework" or "FR" residues are those variable domain residues other than the CDR residues defined herein.

"Percent (%) amino acid sequence identity" or "homology" with respect to the polypeptide and antibody sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical to the amino acid residues in the polypeptide being compared, after aligning the sequences, taking into account any He Baoshou substitutions as part of the sequence identity. For example, alignment for the purpose of determining percent amino acid sequence identity can be accomplished in a variety of ways within the skill in the art using publicly available computer software, such as BLAST, BLAST-2, ALIGN, megalign (DNASTAR), or mulce software. One skilled in the art can determine appropriate parameters for measuring the alignment, including any algorithms needed to achieve maximum alignment over the entire length of the sequences being compared. However, for purposes herein,% amino acid sequence identity values are generated using the sequence comparison computer program MUSCLE (Edgar,R.C.,Nucleic Acids Research 32(5):1792-1797,2004;Edgar,R.C.,BMC Bioinformatics 5(1):113,2004).

"Homology" refers to sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When a position in both comparison sequences is occupied by the same base or amino acid monomer subunit, for example, if the respective position in both protein molecules is occupied by lysine, or if the respective position in both DNA molecules is occupied by adenine, the molecules are homologous at that position. The percent homology between two sequences is a function of the number of matched or homologous positions shared by the two sequences divided by the number of compared positions and multiplied by 100. For example, if 6 of the 10 positions in two sequences match or are homologous, then the two sequences have 60% homology. For example, protein sequences SGTSTD and TGTSDA have 50% homology. Typically, the comparison is performed when the two sequences are aligned to provide maximum homology. The term "constant domain" refers to the portion of an immunoglobulin molecule having a more conserved amino acid sequence relative to other portions of an immunoglobulin (variable domains) comprising an antigen binding site. The constant domain comprises the CH1, CH2 and CH3 domains of the heavy chain (collectively referred to as CH) and the CHL (or CL) domain of the light chain.

The "light chain" of an antibody (immunoglobulin) of any mammalian species can be assigned to one of two distinct types, called "kappa" and "lambda", depending on the amino acid sequence of its constant domain.

The "CH1 domain" (also referred to as "C1" of the "H1" domain) generally extends from about amino acid 118 to about amino acid 215 (EU numbering system).

The "hinge region" is generally defined as the region of IgG corresponding to Glu216 to Pro230 of human IgG1 (Burton, molecular immunol.22:161-206 (1985)). The hinge regions of other IgG isotypes can be aligned with the IgG1 sequence by placing the first and last cysteine residues that form the S-S bond between the heavy chains in the same position. The "CH2 domain" (also referred to as the "C2" domain) of the human IgGFc region generally extends from about amino acid 231 to about amino acid 340. The CH2 domain is unique in that it is not tightly paired with another domain. Instead, two N-linked branched carbohydrate chains are inserted between two CH2 domains of the intact native IgG molecule. It is speculated that carbohydrates may provide a surrogate for domain-domain pairing and help stabilize the CH2 domain. Burton, molecular immunol.22:161-206 (1985).

The "CH3 domain" (also referred to as the "C2" domain) comprises an extension of the Fc region from the C-terminus of the residues to the CH2 domain (i.e., from about amino acid residue 341 to the C-terminus of the antibody sequence, typically at amino acid residues 446 or 447 of IgG).

The term "Fc region" or "fragment crystallizable region" is used herein to define the C-terminal region of an immunoglobulin heavy chain, including native sequence Fc regions and variant Fc regions. Although the boundaries of the Fc region of an immunoglobulin heavy chain may vary, a human IgG heavy chain Fc region is generally defined as extending from amino acid residue position Cys226 or from position Pro230 to its carboxy terminus. For example, during production or purification of the antibody, or by recombinant engineering of nucleic acid encoding the heavy chain of the antibody, the C-terminal lysine (residue 447 according to the EU numbering system) of the Fc region may be removed. Thus, a composition of intact antibodies may comprise a population of antibodies that have all K447 residues removed, a population of antibodies that have no K447 residues removed, and a population of antibodies that comprise a mixture of antibodies with and without K447 residues. Native sequence Fc regions suitable for use in the antibodies described herein include human IgG1, igG2 (IgG 2A, igG B), igG3, and IgG4.

"Fc receptor" or "FcR" describes a receptor that binds to the Fc region of an antibody. The preferred FcR is a native sequence human FcR. Furthermore, preferred fcrs are those that bind IgG antibodies (gamma receptors) and include receptors of the fcyri, fcyrii, fcRN and fcyriii subclasses, including allelic and alternatively spliced forms of these receptors, fcyrii receptors including fcyriia ("activating receptor") and fcyriib ("inhibiting receptor"), which have similar amino acid sequences, differing primarily in their cytoplasmic domains. The activation receptor fcyriia comprises an immune receptor tyrosine based activation motif (ITAM) in its cytoplasmic domain. The inhibitory receptor fcyriib comprises an immunoreceptor tyrosine-based inhibitory motif (ITIM) in its cytoplasmic domain. (see M.Annu. Rev. Immunol.15:203-234 (1997)). FcRN is critical for the circulation of antibodies to the blood and can extend the serum half-life of antibodies. RAVETCHAND KINET, ANNU.REV.IMMUNOL.9:457-92 (1991); capel et al, immunomethods 4:25-34 (1994); and deHaas et al, J.Lab.Clin.Med.126:330-41 (1995) for an overview of FcR. Other fcrs, including those that will be identified in the future, are encompassed by the term "FcR" herein.

As used herein, the term "epitope" refers to a particular atom or amino acid group on an antigen to which an antibody or antibody portion binds. Two antibodies or antibody portions may bind to the same epitope within an antigen if they exhibit competitive binding to the antigen.

As used herein, a first antibody or fragment thereof "competes" with a second antibody or fragment thereof for binding to a target antigen when the first antibody or fragment thereof inhibits the second antibody or fragment thereof from binding to the target antigen by at least about 50% (e.g., at least about any one of 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%) in the presence of an equimolar concentration of the first antibody or fragment thereof, and vice versa. A high throughput process of "binning" antibodies based on their cross-competition is described in PCT publication number WO 03/48731.

As used herein, the terms "specifically bind," "specifically recognize," and "specific for," refer to measurable and reproducible interactions, such as binding between a target and an antibody or antibody moiety, that determine the presence of the target in the presence of a heterogeneous population of molecules (including biomolecules). For example, an antibody or antibody portion that specifically recognizes a target (which may be an epitope) is one that binds the target with higher affinity, avidity, ease, and/or longer duration than other targets. In some embodiments, the extent of binding of the antibody to an unrelated target is less than about 10% of the binding of the antibody to the target, e.g., as measured by Radioimmunoassay (RIA). In some embodiments, an antibody that specifically binds a target (or an antibody specific for an antigen) refers to an antibody that binds the target with a KD value of less than about 10 ^-5 M, such as less than about 10 ^-6M、10^-7M、10^-8M、10^-9 M or 10 ^-10 M or less. In some embodiments, the antibody specifically binds to an epitope on a protein that is conserved among proteins from different species. In some embodiments, specific binding may include, but is not required to, exclusive binding. The binding specificity of an antibody or antigen binding domain can be determined experimentally by methods known in the art. Such methods include, but are not limited to, western blotting, ELISA-, BLI, RIA-, ECL-, IRMA-, EIA-, BIACORETM-assays, and peptide scanning.

An "isolated" or "purified" antibody (or construct) is an antibody that has been identified, isolated, and/or recovered from components of its production environment (e.g., natural or recombinant). Preferably, the isolated polypeptide does not bind to all other components in its production environment.

An "isolated" nucleic acid molecule encoding a construct, antibody or antigen binding fragment thereof described herein is a nucleic acid molecule identified and isolated from at least one contaminated nucleic acid molecule with which it is ordinarily associated in the environment in which it is produced. Preferably, the isolated nucleic acid does not bind to all components associated with the production environment. The form of the isolated nucleic acid molecules encoding the polypeptides and antibodies described herein is different from the form or environment in which they are found in nature. Thus, an isolated nucleic acid molecule differs from a nucleic acid encoding a polypeptide and antibody described herein that naturally occurs in a cell. An isolated nucleic acid includes a nucleic acid molecule contained in a cell that normally contains the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location different from its natural chromosomal location.

The term "control sequences" refers to DNA sequences necessary for expression of an operably linked coding sequence in a particular host organism. Control sequences suitable for use in prokaryotes, for example, include a promoter, an optional operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers.

A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, if the DNA of a pre-sequence or secretion leader is expressed as a pre-protein involved in the secretion of a polypeptide, the DNA of the pre-sequence or secretion leader is operably linked to the DNA of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or if the ribosome binding site is positioned for translation, the ribosome binding site is operatively linked to a coding sequence. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and in the case of a secretory leader, and in reading frame. However, the enhancers do not have to be contiguous. Ligation is accomplished by ligation at convenient restriction sites. If such sites are not present, synthetic oligonucleotide aptamers or linkers are used as usual.

As used herein, the term "vector" refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes vectors that are self-replicating nucleic acid structures and that integrate into the genome of a host cell into which they have been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operably linked. Such vectors are referred to herein as "expression vectors".

As used herein, the term "transfected" or "transformed" or "transduced" refers to the process of transferring or introducing an exogenous nucleic acid into a host cell. A "transfected" or "transformed" or "transduced" cell is a cell that has been transfected, transformed or transduced with an exogenous nucleic acid. Cells include primary test cells and their progeny.

The terms "host cell", "host cell line", and "host cell culture" are used interchangeably to refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells" which include primary transformed cells and progeny derived therefrom, irrespective of the number of passages. The nucleic acid content of the offspring may not be exactly the same as the parent cell and may contain mutations. Included herein are mutant progeny that have the same function or biological activity as screened or selected in the originally transformed cell.

The term "immunoconjugate" includes reference to the covalent attachment of a therapeutic agent or detectable label to an antibody (e.g., an antibody moiety as described herein). The linkage may be direct or indirect through a linker (e.g., a peptide linker).

As used herein, "treatment" is a method of achieving a beneficial or desired result, including clinical results. For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, one or more of the following: reducing one or more symptoms caused by the disease, reducing the extent of the disease, stabilizing the disease (e.g., preventing or delaying the progression of the disease), preventing or delaying the spread of the disease (e.g., metastasis), preventing or delaying the recurrence of the disease, delaying or slowing the progression of the disease, ameliorating the disease state, providing relief (partial or complete) of the disease, reducing the dosage of one or more other drugs required to treat the disease, delaying the progression of the disease, increasing or ameliorating the quality of life, increasing weight, and/or prolonging survival. "treating" also includes reducing the pathological consequences of cancer (e.g., tumor volume). The methods of the present disclosure contemplate any one or more of these therapeutic aspects.

In the case of cancer, the term "treatment" includes any or all of the following: inhibit the growth of cancer cells, inhibit the replication of cancer cells, reduce overall tumor burden and ameliorate one or more symptoms associated with the disease.

The term "inhibit" refers to the reduction or cessation of any phenotypic feature or the reduction or cessation of the occurrence, extent, or likelihood of that feature. "reduce" or "inhibit" refers to reducing, decreasing, or preventing activity, function, and/or amount as compared to a reference. In certain embodiments, "reducing" or "inhibiting" refers to the ability to cause an overall reduction of 20% or more. In another embodiment, "reducing" or "inhibiting" refers to the ability to cause an overall reduction of 50% or more. In yet another embodiment, "reducing" or "inhibiting" refers to the ability to reduce 75%, 85%, 90%, 95% or more overall. As used herein, "reference" refers to any sample, standard, or level used for comparison purposes. The reference may be obtained from healthy and/or non-diseased samples. In some examples, the reference may be obtained from an untreated sample. In some examples, the reference is obtained from an individual's untreated or untreated sample. In some examples, the reference is obtained from one or more healthy individuals who are not the individual or patient.

As used herein, "delay of progression of a disease" refers to delaying, impeding, slowing, retarding, stabilizing, inhibiting, and/or delaying the progression of a disease (e.g., cancer). This delay may be of varying lengths of time, depending on the history of the disease and/or the individual receiving the treatment. As will be apparent to those skilled in the art, a sufficient or significant delay may actually include prophylaxis, i.e., the individual does not develop a disease. For example, the progression of advanced cancers, such as metastasis, may be delayed.

As used herein, "preventing" includes providing prophylaxis of the occurrence or recurrence of a disease in an individual who may be susceptible to the disease but who has not yet been diagnosed with the disease.

As used herein, "inhibiting" a function or activity refers to reducing the function or activity when compared to the same condition other than the target condition or parameter, or optionally, when compared to another condition. For example, an antibody that inhibits tumor growth reduces the growth rate of a tumor compared to the growth rate of a tumor in the absence of the antibody.

The terms "subject," "individual," and "patient" are used interchangeably herein to refer to a mammal, including but not limited to a human, cow, horse, feline, canine, rodent, or primate. In some embodiments, the individual is a human. An "effective amount" of an agent refers to an amount effective to achieve the desired therapeutic or prophylactic result over the necessary dosage and period of time. The specific dosage may vary depending on one or more of the following: the particular agent selected, the dosing regimen to be followed, whether to administer in combination with other compounds, the time of administration, the tissue to be imaged, and the physical delivery system carrying the agent.

The "therapeutically effective amount" of a substance/molecule, agonist or antagonist of the present disclosure may vary depending on factors such as the disease state, age, sex, and weight of the individual, as well as the ability of the substance/molecule, agonist or antagonist to elicit a desired response in the individual. A therapeutically effective amount is also an amount in which any toxic or detrimental effects of a substance/molecule, agonist or antagonist are offset by a therapeutically beneficial effect. A therapeutically effective amount may be delivered in one or more administrations.

"Prophylactically effective amount" means an amount effective to achieve the desired prophylactic result over the necessary dosage and period of time. Typically, but not necessarily, since the prophylactic dose is for the subject prior to or at an early stage of the disease, the prophylactically effective amount will be less than the therapeutically effective amount.

The terms "pharmaceutical formulation" and "pharmaceutical composition" refer to formulations which are in a form which allows the biological activity of the active ingredient to be effective and which are free of additional ingredients which have unacceptable toxicity to the individual to whom the formulation is administered. Such formulations may be sterile.

By "pharmaceutically acceptable carrier" is meant a nontoxic solid, semisolid or liquid filler, diluent, encapsulating material (encapsulatingmaterial), formulation aid or carrier conventional in the art for use with therapeutic agents, which together comprise the "pharmaceutical composition" for administration to an individual. The pharmaceutically acceptable carrier is non-toxic to the recipient at the dosage and concentration used and is compatible with the other ingredients of the formulation. Pharmaceutically acceptable carriers are suitable for the formulation used.

"Sterile" formulations are sterile or substantially free of viable microorganisms and spores thereof.

Administration "in combination" with one or more other therapeutic agents includes simultaneous (simultaneous) and sequential or sequential administration in any order.

The term "simultaneous" is used herein to refer to administration of two or more therapeutic agents, wherein at least portions of the administrations overlap in time, or wherein the administration of one therapeutic agent falls within a short period of time relative to the administration of the other therapeutic agent. For example, the two or more therapeutic agents are administered for a time interval of no more than about 60 minutes, such as no more than any one of about 30, 15, 10, 5, or 1 minutes.

The term "sequentially" is used herein to refer to the administration of two or more therapeutic agents, wherein the administration of one or more agents continues after the cessation of the administration of one or more other agents. For example, two or more therapeutic agents are administered at intervals of greater than about 15 minutes, such as any one of about 20, 30, 40, 50, or 60 minutes, 1 day, 2 days, 3 days, 1 week, 2 weeks, or 1 month or more.

As used herein, "combined" refers to administration of one therapeutic modality in addition to another therapeutic modality. Thus, "combined" refers to the administration of one therapeutic regimen prior to, during, or after the administration of another therapeutic regimen to an individual.

An "article of manufacture" is any article of manufacture (e.g., a package or container) or kit comprising at least one agent (e.g., a drug for treating a disease or disorder (e.g., cancer)), or a probe for specifically detecting a biomarker described herein. In certain embodiments, the article of manufacture or kit is promoted, distributed, or marketed as a unit for performing the methods described herein.

In the present disclosure, the amino acid at a position may be allowed to change, and the amino acid at the position represented by, for example, [ K/R ] may be K or R; for example, [ S/], indicates deletion, and the amino acid at the position may be S or may be deleted.

It should be understood that embodiments of the present disclosure described herein include embodiments that "consist of" and/or "consist essentially of … ….

The specific techniques or conditions are not noted in the examples and are carried out according to the techniques or conditions described in the literature in the art (for example, refer to J. Sam Brookfield et al, huang Peitang et al, molecular cloning Experimental guidelines, third edition, scientific Press) or according to the product specifications. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

Anti-TREM 2 antibodies

In some aspects, the invention includes an isolated antibody or antigen-binding fragment thereof.

In the context of the present application, "antibody" may include polyclonal antibodies, monoclonal antibodies, chimeric antibodies, humanized and primate antibodies, CDR-grafted antibodies, human antibodies, recombinantly produced antibodies, intracellular antibodies, bifunctional antibodies, multispecific antibodies, bispecific antibodies, monovalent antibodies, multivalent antibodies, anti-idiotypic antibodies, synthetic antibodies, including muteins and variants thereof, modified antibodies; and derivatives thereof (including Fc fusion proteins and other modifications), as well as any other immunoreactive molecules, so long as they exhibit preferential association or binding with TREM2 proteins. Furthermore, unless the context dictates otherwise, the term also includes all classes of antibodies (i.e., igA, igD, igE, igG and IgM) and all subclasses (i.e., igG1, igG2, igG3, igG4, igA1, and IgA 2). In a preferred embodiment, the antibody is a monoclonal antibody. In a more preferred embodiment, the antibody is a chimeric monoclonal antibody or a humanized monoclonal antibody or a modified chimeric monoclonal antibody.

The variable regions and CDRs in an antibody sequence can be identified according to general rules that have been developed in the art (as described above, e.g., the Kabat numbering system, or by aligning the sequences with a database of known variable regions).

In some embodiments, an isolated antibody or antigen-binding fragment thereof may comprise a conservative substitution or modification or substitution (e.g., a conservative substitution), a deletion or addition (e.g., a substitution, a deletion or addition of 1,2, 3,4, or 5 amino acids; or a conservative substitution of up to 20, up to 15, up to 10, or up to 5 amino acids), of an amino acid in the variable region of the heavy and/or light chain, or has at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100% sequence identity to the antibody or antigen fragment thereof from which it is derived. The amino acid deletion variants comprising deletions at the N-and/or C-terminus of the protein are also referred to as N-and/or C-terminal truncation variants (truncation variant). It is understood in the art that certain modifications of conserved sequences that do not eliminate antigen binding may be made. See, for example, brummel et al (1993) Biochem 32:1180-8; de Wildt et al (1997) Prot.Eng.10:835-41; komissarov et al (1997) J.biol. Chem.272:26864-26870; hall et al (1992) J.Immunol.149:1605-12; KELLEY AND O' Connell (1993) biochem.32:6862-35; adib-Conquy et al (1998) int.immunol.10:341-6and beer et al (2000) Clin.can.Res.6:2835-43.

As described above, the term "conservative substitution/conservative substitution" as used herein refers to an amino acid substitution/substitution that does not adversely affect or alter the basic properties of a protein/polypeptide comprising an amino acid sequence. For example, conservative substitutions/conservative substitutions may be introduced by standard techniques known in the art (e.g., site-directed mutagenesis and PCR-mediated mutagenesis). Conservative amino acid substitutions include substitutions in which an amino acid residue is substituted by another amino acid residue having a similar side chain, such as a substitution of a physically or functionally similar residue (e.g., of similar size, shape, charge, chemical nature including the ability to form covalent or hydrogen bonds, etc.) to the corresponding amino acid residue. Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, the corresponding amino acid residue is preferably substituted with another amino acid residue from the same side chain family. Methods for identifying amino acid conservative substitutions are well known in the art (see, e.g., brummell et al, biochem.32:1180-1187 (1993); kobayashi et al, protein Eng.12 (10): 879-884 (1999); and Burks et al, proc. Natl. Acad. Sci. USA 94:412-417 (1997), which are incorporated herein by reference).

According to the present invention, if reference is made to a specific antibody heavy chain and/or specific antibody light chain (e.g. a chain comprising specific CDR sequences), the two heavy chains and/or the two light chains of the antibody preferably consist of the specific antibody heavy chain and/or the specific antibody light chain, respectively.

Regardless of how the antibody is produced, methods of testing the ability of the antibody to bind to an antigen (e.g., TREM 2) are known in the art and include any antibody-antigen binding assay, such as Radioimmunoassays (RIA), ELISA, western blots, immunoprecipitation, SPR, and competitive inhibition assays (see, e.g., janeway et al, below and U.S. patent application publication No. 2002/0197266, and the above section on competition assays).

According to the present invention, in a standard assay (e.g., the assay described in the present invention), if an antibody has significant affinity to a predetermined target (e.g., a TREM2 protein or TREM 2-expressing cells), the antibody can bind to the predetermined target, and in order to test the binding of a monoclonal antibody to a live cell expressing TREM2, flow cytometry can be used. Preferably, in flow cytometry analysis (FACS) analysis, the binding of the antibody to a target expressed on the cell surface is determined, and the antibody is capable of binding to the target with an "affinity" if it binds detectably to the target (TREM 2 protein or TREM2 expressing cells). Preferably, an antibody in the present invention binds detectably to the target if it is present at a concentration of 10 μg/mL or less, 5 μg/mL or less, 3 μg/mL or less, 2 μg/mL or less, 1 μg/mL or less, 0.5 μg/mL or less.

In some embodiments, the antibody or fragment may have binding properties that are: binding human, murine or monkey TREM2 with a KD of 1 x 10 ^-7 M or less; binding human, murine or monkey TREM2 with a KD of 5 x 10 ^-8 M or less; binding human, murine or monkey TREM2 with a KD of 1 x 10 ^-8 M or less; binding human, murine or monkey TREM2 with a KD of 5 x 10 ^-9 M or less; binding human, murine or monkey TREM2 with a KD of 1 x 10 ^-9 M or less; or binding to human, murine or monkey TREM2 with a KD of 1 x 10 ^-9 M or less.

In some embodiments, the antibody or fragment may have EC50 binding properties that are: binding to human TREM2 or monkey TREM2 with an EC50 of 5 μg/mL or less; binding to human TREM2 or monkey TREM2 at an EC50 of 3 μg/mL or less; or binding to human TREM2 or monkey TREM2 with an EC50 of 2 μg/mL or less; or binding to human TREM2 or monkey TREM2 with an EC50 of 1 μg/mL or less; or binding to human TREM2 or monkey TREM2 with an EC50 of 0.5 μg/mL or less; binding to human TREM2 or monkey TREM2 with an EC50 of 0.3 μg/mL or less; or binding to human TREM2 or monkey TREM2 with an EC50 of 0.1 μg/mL or less.

The term TREM2 specific as used herein refers to TREM2 specific, in particular human TREM2, capable of binding to one or more TREM2 epitopes, in particular TREM2 epitopes in their native conformation.

In some embodiments, the antibody is a monoclonal antibody.

In some embodiments, the antibody is a chimeric antibody or a humanized antibody or an improved antibody, such as an improved chimeric antibody.

In some embodiments, the isolated antibody or antigen binding fragment thereof comprises a constant region of IgG. The constant region of the IgG is preferably selected from the group consisting of IgG1, igG2, igG3, or IgG4 constant regions. The constant region of IgG is more preferably selected from the constant region of IgG 1.

The engineering of desired properties of an antibody without altering the properties is varied in the art by various means, such as the manner in which the light and heavy chains of an antibody are recombined, amino acid substitutions made, etc., as employed in the present disclosure. For example, sequences of the invention, including chimeric or humanized antibody sequences, may be subjected to conservative amino acid substitutions.

Antibodies interact with target antigens primarily through amino acid residues located in the Complementarity Determining Regions (CDRs) of the six heavy and light chains. For this reason, the amino acid sequences of CDRs are more diverse between antibodies than other sequences. Since CDR sequences are responsible for most antibody-antigen interactions, it is possible to express recombinant antibodies that mimic the properties of a particular naturally occurring antibody by constructing expression vectors that contain CDR sequences from the particular naturally occurring antibody that are grafted onto framework sequences from different antibodies with different properties (see, e.g., riechmann, L. Et al (1998) Nature 332:323-327; jones, P. Et al (1986) Nature321:522-525; and Queen, C. Et al (1989) Proc. Natl. Acad. Sci. U.S.A.86:10029-10033). Such framework sequences may be obtained from public DNA databases including germline antibody gene sequences. These lines are sequences that differ from the mature antibody gene sequence in that they do not contain the fully assembled variable genes that are formed by V (D) J ligation during B cell maturation. Germline gene sequences will also have sequences that differ from the high affinity second antibody repertoire (secondary repertoire antibody) at individual points that are uniform across the variable region.

Mouse antibodies are highly immunogenic in humans, resulting in reduced therapeutic efficacy when repeatedly applied, with major immunogenicity mediated by the heavy chain constant region. If the individual antibodies are chimeric or humanized, the immunogenicity of the mouse antibodies in humans can be reduced or completely avoided.

Chimeric antibodies refer to antibodies in which different portions are derived from different animal species, e.g., antibodies having variable regions derived from mouse antibodies and human immunoglobulin constant regions. The variable regions of the heavy and light chains of the mouse antibodies are joined to the constant regions of the human heavy and light chains to obtain chimerism of the antibodies (e.g., as described in Kraus et al in Methods in MolecularBiology series, recombinant antibodies for CANCER THERAPY ISBN-0-89603-918-8). In a preferred embodiment, the chimeric antibody is produced by ligating a human kappa light chain constant region to a mouse light chain variable region. In another preferred embodiment, chimeric antibodies can be produced by linking a human lambda light chain constant region to a mouse light chain variable region.

By humanized antibody is meant an antibody in which CDR sequences/antigen binding portions or sites derived from the germline of another mammalian species, such as a mouse, are grafted onto a human framework sequence.

In order to reduce immunogenicity of antibodies to humans, humanized anti-TREM 2 antibodies are produced using the sequences of the TREM2 antibodies of the present disclosure, utilizing the CDR regions of murine anti-TREM 2 antibodies in combination with framework regions of human origin (e.g., human immunoglobulins) to form the humanized anti-TREM 2 antibodies of the present disclosure, the humanized antibodies are expected to retain the function of binding to human TREM2 as well as the function of binding to monkey TREM 2.

Preparation or production of antibodies

Antibodies of the invention can be produced by a variety of techniques, including conventional monoclonal antibody methods, such as KohlerandMilstein, nature256:495 The standard somatic hybridization technique of (1975). Although hybridoma technology is preferred, other techniques for producing monoclonal antibodies can in principle be employed, such as viral or oncogene transformation of B lymphocytes or phage display techniques using antibody gene libraries, somatic hybridization methods, and again obtained, for example, by genetic engineering recombinant techniques. For example, DNA molecules encoding the heavy and light chain genes of the antibodies of the invention are obtained by chemical synthesis or PCR amplification, the resulting DNA molecules are inserted into an expression vector, then the host cells are transfected, then the transfected host cells are cultured under specific conditions, and the antibodies of the invention are expressed.

Other preferred animal systems for the preparation of monoclonal antibody secreting hybridomas are the rat and rabbit systems (e.g., described in Spieker-Poletetal, proc. Natl. Acad. Sci. U.S. A.92:9348 (1995), see also Rossietal. Am. J. Clin. Pathol.124:295 (2005)). Hybridoma production in mice is a very well established method. Immunization protocols and techniques for isolating immunized splenocytes for fusion are known in the art. Fusion partners (e.g., murine myeloma cells) and fusion methods are also known.

Monoclonal antibodies may be prepared using a variety of techniques known in the art, including hybridoma techniques, recombinant techniques, phage display techniques, transgenic animals, or some combination thereof. For example, hybridomas and art-recognized biochemical and genetic engineering techniques can be used to produce monoclonal Antibodies, as described in detail in An,Zhigiang(ed.)Therapeutic Monoclonal Antibodies:From Bench to Clinic,JohnWiley and Sons,1st ed.2009;Shire et.al.(eds.)Current Trends in MonoclonalAntibody Development and Manufacturing,Springer Science+Business Media LLC,1sted.2010;Harlow et al, antibodies: A Laboratory Manual, cold Spring HarborLaboratory Press,2nd ed.1988; HAMMERLING, et al, in Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, n.y., 1981), each of which is incorporated herein by reference in its entirety.

It will be appreciated that the selected binding sequences may be further altered, e.g., to increase affinity for the target, to humanize the target binding sequence, to improve its production in cell culture, to reduce its immunogenicity in vivo, to produce multispecific antibodies, and the like, and antibodies comprising altered target binding sequences are also antibodies of the invention.

In some embodiments, the method of producing an antibody or fragment described in the present disclosure comprises the steps of:

(i) Expressing the antibody or fragment in a host cell; and optionally

In a preferred embodiment, the anti-TREM 2 monoclonal antibody is prepared by using a hybridoma.

To obtain hybridomas producing antibodies of the invention, e.g., human monoclonal antibodies of the invention, spleen cells and/or lymph node cells from immunized mice can be isolated and fused to a suitable immortalized cell line, e.g., a mouse myeloma cell line. The hybridomas produced are screened for the production of antigen-specific antibodies. The generation of hybridomas is well known in the art. See, e.g., harlow and Lane (1988) Antibodies, A Laboratory Manual, cold SpringHarbor Publications, new York.

Antibodies of the invention may also be produced in host cell transfectomas using, for example, a combination of recombinant DNA techniques and gene transfection methods well known in the art (e.g., morrison, s. (1985) Science 229:1202). In some embodiments, DNA encoding part or full length light and heavy chains obtained by standard molecular biology techniques is inserted into one or more expression vectors, such that the genes are operably linked to transcriptional and translational regulatory sequences. In this context, the term "operably linked" is intended to mean that the antibody genes are linked into a vector such that transcriptional and translational control sequences within the vector perform their intended functions of regulating the transcription and translation of the antibody genes.

The antibody light chain gene and the antibody heavy chain gene may be inserted into the same or different expression vectors. In some embodiments, the variable region is used to generate a full length antibody gene of any antibody isotype by inserting it into an expression vector that already encodes the heavy and light chain constant regions of the desired isotype, such that the VH segment is operably linked to the CH segment and the VL segment within the vector, and the CL segment within the vector. Additionally or alternatively, the recombinant expression vector may encode a signal peptide that facilitates secretion of the antibody chain from the host cell. The antibody chain gene may be cloned into a vector such that the signal peptide is linked to the amino terminus of the antibody chain gene. The signal peptide may be an immunoglobulin signal peptide or a heterologous signal peptide (i.e., a signal peptide from a non-immunoglobulin protein).

To express the light and heavy chains, expression vectors encoding the heavy and light chains are transfected into host cells by standard techniques. The various forms of the term "transfection" are intended to encompass the various techniques commonly used for introducing exogenous DNA into prokaryotic or eukaryotic host cells, such as electroporation, calcium phosphate precipitation, DEAE-dextran transfection, and the like. Antibodies of the invention can be expressed in prokaryotic or eukaryotic host cells, such as mammalian host cells, which can assemble and secrete properly folded and immunocompetent antibodies.

Mammalian host cells for expression of recombinant antibodies of the invention include chinese hamster ovary cells (CHO cells) (including DHFR CHO cells described in Urlaub and Chasin, (1980) proc.Natl.Acad.Sci.USA 77:4216-4220), NSO myeloma cells, COS cells and SP2 cells for use with a DHFR selection marker (e.g., as described in R.J. Kaufman and P.A. Sharp (1982) J.MoI.biol.159:601-621). In particular, for use with NSO myeloma, another expression system is the GS gene expression system disclosed in WO 87/04462, WO 89/01036 and EP 338,841. When a recombinant expression vector encoding an antibody gene is introduced into a mammalian host cell, the antibody is produced by culturing the host cell for a period of time sufficient to allow expression of the antibody in the host cell or by secreting the antibody into the medium in which the host cell is grown. Antibodies can be recovered from the culture medium using standard protein purification methods.

In another preferred embodiment, transgenic or transchromosomal mice with a partially human immune system (rather than a mouse system) may be used to generate human monoclonal antibodies against TREM 2.

Another strategy for generating monoclonal antibodies is to isolate the genes encoding the antibodies directly from the antibody-producing lymphocytes of the defined strategy, see for example Babcocketal.,1996;Anovel strategy for generating monoclonal antibodies from single,isolated lymphocytes producing antibodies of defined strategy. for details of recombinant antibody engineering and also see WelschofandKrau,Recombinant antibodes for cancer therapy ISBN-0-89603-918-8and Benny K.C.Lo Antibody Engineering ISBN 1-58829-092-1.

To prepare chimeric antibodies, the murine immunoglobulin variable region can be linked to a human immunoglobulin constant region using methods known in the art (see, e.g., U.S. Pat. No. 4,816,567 to Capilli et al). An isolated nucleic acid encoding a VH region can be converted to a full length heavy chain gene by operably linking the nucleic acid encoding the VH region to another DNA molecule encoding a heavy chain constant region (CH 1, CH2, and CH 3). The sequence of a human heavy chain constant region gene is known in the art (see, e.g., kabat et al (1991),Sequences Of Proteins of Immunological Interest,Fifth Edition,U.S.Department of Health and Human Services,NIH Publication No.91-3242). heavy chain constant region may be an IgG1, igG2, igG3, igG4, igA, igE, igM or IgD constant region, but more preferably an IgG1 or IgG4 constant region, the isolated nucleic acid encoding the VL region may be converted to a full-length light chain gene (and Fab light chain gene) by operably linking the DNA encoding the VL to another DNA molecule encoding the light chain constant region CL, the sequence of a human light chain constant region gene is known in the art (see, e.g., kabat et al supra), and DNA fragments comprising these regions may be obtained by standard PCR amplification.

To prepare humanized antibodies, murine CDR regions can be inserted into human framework sequences using methods known in the art (see Winter, U.S. Pat. nos. 5,225,539; U.S. Pat. No. 5,530,101 to Queen et al, U.S. Pat. No. 5,585,089, U.S. Pat. No. 5,693,762, and Lo,Benny,K.C.,editor,in Antibody Engineering:Methods and Protocols,volume 248,Humana Press,New Jersey,2004)., or alternatively transgenic animals that are capable of producing no endogenous immunoglobulins after immunization and that are capable of producing a complete human antibody repertoire have been reported, for example, to completely inhibit endogenous antibody production in chimeric and germ line mutant mice, and then transferring an array of human germ line immunoglobulin genes to the germ line mutant mice would result in the mice producing human antibodies upon antigen stimulation (see, e.g., jakobovits et al, 1993,Proc.Natl.Acad.Sci.USA 90:2551;Jakobovits et al, 1993, nature362:255-258; brugmann et al, 1993,Year in Immunology7:33; and Duchosal et al, 1992,Nature 355:258). Non-limiting examples of such transgenic animals include, humab mice (Medarex, inc.), which contain human immunoglobulin gene loci encoding unrearranged heavy (μ and γ) and kappa chain immunoglobulin sequences, and a gene locus (see also WO 35:3535:3535, and F.19935, et al, and a gene locus (see, e.g., moomu.19935:3535, 1997, F.1997) carrying a gene map (see, J.35:3593, F.1997, F.),3535, and F.),murine (see, J.1991, J.),35F.),35, F.),35, and F. (see also F.),1996, F.), nature Biotech 14: 309).

Nucleic acid molecules encoding antibodies of the invention

In some aspects, the invention relates to isolated nucleic acid molecules comprising a nucleic acid sequence encoding an isolated antibody or fragment thereof as described above in the present disclosure.

The nucleic acids of the invention may be obtained using standard molecular biology techniques. For hybridoma-expressed antibodies (e.g., hybridomas prepared from transgenic mice carrying human immunoglobulin genes as described further below), cdnas encoding the light and heavy chains of antibodies prepared by the hybridomas can be obtained by standard PCR amplification or cDNA cloning techniques. For antibodies obtained from immunoglobulin gene libraries (e.g., using phage display techniques), nucleic acids encoding such antibodies can be recovered from the gene library.

To prepare chimeric antibodies, the murine immunoglobulin variable region can be linked to a human immunoglobulin constant region using methods known in the art (see, e.g., U.S. Pat. No.4,816,567 to Capilli et al). By operably linking a nucleic acid encoding a VH to another DNA molecule encoding heavy chain constant regions (CH 1, CH2 and CH 3), the isolated nucleic acid encoding the VH region can be converted to a full length heavy chain gene, and DNA fragments comprising these regions can be obtained by standard PCR amplification. The isolated nucleic acid encoding the VL region can be converted to a full length light chain gene (as well as a Fab light chain gene) by operably linking the DNA encoding the VL to another DNA molecule encoding the light chain constant region CL. Once the DNA fragments encoding the VH and VL segments are obtained, these DNA fragments can be further manipulated by standard recombinant DNA techniques, such as converting the variable region genes into full-length antibody chain genes, fab fragment genes or scFv genes. In these operations, a DNA fragment encoding a VL or VH is operably linked to another DNA fragment encoding another protein, such as an antibody constant region or flexible linker.

In some embodiments, the invention relates to an isolated nucleic acid molecule comprising a nucleic acid sequence encoding an antibody or antigen-binding fragment thereof as described in the present disclosure.

In one aspect, the present disclosure provides a vector comprising the nucleic acid molecule described above.

In one aspect, the present disclosure provides a host cell comprising a nucleic acid molecule as described above or a vector as described above.

Conjugate(s)

In one aspect, the present disclosure provides a conjugate comprising an antibody or fragment thereof as described above coupled to at least one detectable label. Detectable labels include, but are not limited to: (i) providing a detectable signal; (ii) Interaction with a second label to modify a detectable signal provided by the first or second label, such as FRET (fluorescence resonance energy transfer ); (iii) The mobility (e.g., electrophoretic mobility) is affected by charge, hydrophobicity, shape, or other physical parameters, or (iv) a capture moiety is provided, such as affinity, antibody/antigen, or ion complexation.

Suitable structures for the label are e.g. fluorescent labels, luminescent labels, chromophore labels, radioisotope labels, isotopic labels, preferably stable isotopic labels, isobaric labels (isobaric label), enzymatic labels (e.g. horseradish peroxidase, alkaline phosphatase, beta-galactosidase, urease, glucose oxidase, etc.), particle labels (especially metal particle labels, magnetic particle labels, polymer particle labels), organic small molecules (e.g. biotin, ligands or binding molecules of receptors (e.g. cell adhesion proteins or lecithins), label sequences comprising nucleic acid and/or amino acid residues detectable by use of binding agents, etc. labels include, but are not limited to, barium sulfate, ioxitic acid, iodic acid, calcium amiodarone, sodium diatrizoate, meglumine, methoxamine, caseinate and radiodiagnostic agents (including positron emitters, (e.g. fluoro-18 and carbon-11), gamma emitters (e.g. iodo-123, iodo-125, iodo-99 m, iodo-111) and fluoro-131), fluorescent substances (e.g. g. fluoro-co-1, and co-channel-luminescent substances) and fluorescent substances (e.g. g. gold-shadow-emitting substances).

The detectable labels described above can be detected by methods known in the art. For example, fluorescent markers may be detected using a photodetector to detect the emitted light. Enzyme labels are typically detected by providing a substrate to an enzyme and detecting a reaction product produced by the action of the enzyme on the substrate. In certain embodiments, such labels can be suitable for immunological detection (e.g., enzyme-linked immunoassay, radioimmunoassay, fluorescent immunoassay, chemiluminescent immunoassay, etc.). In certain embodiments, a detectable label as described above may be attached to an antibody or antigen binding fragment thereof of the invention by linkers of different lengths to reduce potential steric hindrance.

Antibody drug conjugates/immunoconjugates

In one aspect, the present disclosure provides an antibody drug conjugate comprising an antibody comprising one or more drug moieties/therapeutic agents linked (e.g., covalently linked) directly or via a linker to an antibody or fragment thereof as described previously. In the antibody-drug conjugate of the present application, the linker structure for conjugating the anti-TREM 2 antibody to the drug is not particularly limited as long as the resulting antibody-drug conjugate can be used.

Because of the ability of the antibody-drug conjugates to selectively deliver one or more drugs to a target tissue (e.g., regulatory myeloid cells), the antibody-drug conjugates can increase the therapeutic efficacy of the antibodies or antigen binding fragments thereof of the invention in treating a disease (e.g., cancer).

Multispecific molecules

The antibodies or antigen binding fragments thereof of the invention can be used to form multispecific molecules (e.g., bispecific molecules). The antibodies or antigen binding fragments thereof of the invention may be part of a multispecific molecule (e.g., a bispecific molecule) that comprises a second functional moiety (e.g., a second antibody) or a third functional moiety (e.g., a third antibody) having a binding specificity different from the antibodies or antigen binding fragments thereof of the invention, thereby being capable of binding to at least two different binding sites and/or target molecules. For example, an antibody or antigen-binding fragment thereof of the invention may be linked to a second antibody or antigen-binding fragment thereof capable of specifically binding any protein that may be used as a potential target for combination therapy. To produce the bispecific or multispecific molecules, an antibody or antigen-binding fragment thereof of the invention may be linked (e.g., by chemical coupling, gene fusion, non-covalent association, or other means) to one or more other binding molecules (e.g., additional antibodies, antibody fragments, peptides, or binding mimics).

Thus, in some aspects, the invention provides a multispecific molecule comprising an antibody, or antigen-binding fragment thereof, of the invention.

In certain preferred embodiments, the multispecific molecule specifically binds TREM2 (e.g., human TREM2 or monkey TREM 2), and specifically binds one or more other targets.

In certain preferred embodiments, the multispecific molecule further comprises at least one molecule (e.g., a second antibody) having a second binding specificity for a second target.

In certain preferred embodiments, the multispecific molecule is a bispecific antibody.

Pharmaceutical composition

In some aspects, the present disclosure provides a pharmaceutical composition or kit comprising an antibody or fragment as described above, a nucleic acid molecule as described above, a vector as described above, a host cell as described above, a conjugate as described above, an antibody drug conjugate as described above, a multispecific molecule as described above; and a pharmaceutically acceptable carrier.

The pharmaceutical composition may optionally contain one or more additional pharmaceutically active ingredients, such as another antibody or drug. The pharmaceutical composition of the invention may also be administered in combination with, for example, another immunostimulant, anticancer agent, antiviral agent or vaccine, such that the anti-TREM 2 antibody enhances the immune response to the vaccine. Pharmaceutically acceptable carriers can include, for example, pharmaceutically acceptable liquid, gel or solid carriers, aqueous media, nonaqueous media, antimicrobial agents, isotonic agents, buffers, antioxidants, anesthetics, suspending/dispersing agents, chelating agents, diluents, adjuvants, excipients or non-toxic auxiliary substances, combinations of various components known in the art or more.

Suitable components may include, for example, antioxidants, fillers, binders, disintegrants, buffers, preservatives, lubricants, flavouring agents, thickening agents, colouring agents, emulsifying agents or stabilizing agents such as sugars and cyclodextrins. Suitable antioxidants may include, for example, methionine, ascorbic acid, EDTA, sodium thiosulfate, platinum, catalase, citric acid, cysteine, thioglycerol, thioglycolic acid, thiosorbitol, butylmethylanisole, butylated hydroxytoluene and/or propyl arsenate. As disclosed herein, the antibodies or antigen-binding fragments thereof of the disclosed compositions may be oxidized in a solvent containing one or more antioxidants, such as methionine, that reduce the antibodies or antigen-binding fragments thereof. Redox can prevent or reduce the decrease in binding affinity, thereby enhancing antibody stability and extending shelf life. Thus, in some embodiments, the invention provides compositions comprising one or more antibodies or antigen binding fragments thereof and one or more antioxidants, such as methionine. The invention further provides methods wherein the antibody or antigen-binding fragment thereof is admixed with one or more antioxidants, such as methionine, such that the antibody or antigen-binding fragment thereof may be protected from oxidation to extend its shelf life and/or increase activity.

For further illustration, pharmaceutically acceptable carriers may include, for example, aqueous vehicles such as sodium chloride injection, ringer's injection, isotonic dextrose injection, sterile water injection, or dextrose and lactate ringer's injection, non-aqueous vehicles such as fixed oils of vegetable origin, cottonseed oil, corn oil, sesame oil or peanut oil, antimicrobial agents of bacteriostatic or fungistatic concentration, isotonic agents such as sodium chloride or glucose, buffers such as phosphate or citrate buffers, antioxidants such as sodium bisulfate, local anesthetics such as procaine hydrochloride, suspending and dispersing agents such as sodium carboxymethyl cellulose, hydroxypropyl methylcellulose or polyvinylpyrrolidone, emulsifying agents such as polysorbate 80 (TWEEN-80), sequestering or chelating agents such as EDTA (ethylenediamine tetraacetic acid) or EGTA (ethylene glycol tetraacetic acid), ethanol, polyethylene glycol, propylene glycol, sodium hydroxide, hydrochloric acid, citric acid or lactic acid. The antimicrobial agent used as a carrier may be added to a pharmaceutical composition in a multi-dose container containing phenols or cresols, mercuric preparations, benzyl alcohol, chlorobutanol, methyl and propyl parahydroxybenzoates, thimerosal, benzalkonium chloride and benzethonium chloride. Suitable excipients may include, for example, water, saline, dextrose, glycerol, or ethanol. Suitable non-toxic auxiliary substances may include, for example, wetting or emulsifying agents, pH buffering agents, stabilizers, solubility enhancers, or agents such as sodium acetate, sorbitan monolaurate, triethanolamine oleate, or cyclodextrins.

Administration, formulation and dosage

The pharmaceutical compositions of the invention may be administered to a subject in need thereof in vivo by a variety of routes including, but not limited to, oral, intravenous, intra-arterial, subcutaneous, parenteral, intranasal, intramuscular, intracranial, intracardiac, intraventricular, intratracheal, buccal, rectal, intraperitoneal, intradermal, topical, transdermal and intrathecal, or by implantation or inhalation. The compositions of the present invention may be formulated as solid, semi-solid, liquid or gaseous forms of formulation; including but not limited to tablets, capsules, powders, granules, ointments, solutions, suppositories, enemas, injections, inhalants and aerosols. The appropriate formulation and route of administration may be selected depending upon the intended application and treatment regimen.

Suitable formulations for enteral administration include hard or soft gelatin capsules, pills, tablets (including coated tablets), elixirs, suspensions, syrups or inhalants and controlled release dosage forms thereof.

Formulations suitable for parenteral administration (e.g., by injection) include aqueous or nonaqueous, isotonic, pyrogen-free, sterile liquids (e.g., solutions, suspensions) in which the active ingredient is dissolved, suspended, or otherwise provided (e.g., in liposomes or other microparticles). These liquids may additionally contain other pharmaceutically acceptable ingredients such as antioxidants, buffers, preservatives, stabilizers, bacteriostats, suspending agents, thickening agents and solutes which render the formulation isotonic with the blood (or other relevant body fluids) of the intended recipient. Examples of excipients include, for example, water, alcohols, polyols, glycerol, vegetable oils, and the like. Examples of isotonic carriers suitable for use in such formulations include sodium chloride injection, ringer's solution or lactated ringer's injection. Similarly, the particular dosage regimen (including dosage, time and repetition) will depend on the particular individual and medical history of the individual, and empirical considerations such as pharmacokinetics (e.g., half-life, clearance rate, etc.).

The requirements for effective pharmaceutical carriers for injectable formulations/compositions are well known to those of ordinary skill in the art (see, e.g., pharmaceuticals AND PHARMACY PRACTICE, J.B.LIPPINCOTT Company, philadelphia, pa., banker and Chalmers editions, pages 238-250 (1982), and ASHP Handbook on Injectable Drugs, toissel, 4 th edition, pages 622-630 (1986)).

The frequency of administration can be determined and adjusted during treatment and based on reducing the number of proliferating or tumorigenic cells, maintaining such a reduction in tumor cells, reducing proliferation of tumor cells or delaying the development of metastasis. In some embodiments, the administered dose may be adjusted or reduced to control potential side effects and/or toxicity. Or a sustained continuous release formulation of the therapeutic composition of the present invention may be suitable.

Those skilled in the art will appreciate that the appropriate dosage may vary from patient to patient. Determining the optimal dose generally involves balancing the level of therapeutic benefit with any risk or adverse side effects. The dosage level selected will depend on a variety of factors including, but not limited to, the activity of the particular compound, the administration, the time of administration, the rate of clearance of the compound, the duration of treatment, other co-administered drugs, compounds and/or materials, the severity of the condition, as well as the species, sex, age, weight, condition, general health and previous medical history of the patient. The dosage is typically selected to achieve a local concentration at the site of action that achieves the desired effect without causing substantial deleterious or adverse side effects.

In general, the antibodies or antigen-binding fragments thereof of the invention may be administered in a variety of ranges. These include about 4 μg/kg body weight to about 100mg/kg body weight per dose; about 20 μg/kg body weight to about 50mg/kg body weight per dose; about 50 μg/kg body weight to about 10mg/kg body weight per dose. Other ranges include about 100 μg/kg body weight to about 20mg/kg body weight per dose and about 0.5mg/kg body weight to about 15mg/kg body weight per dose. In certain embodiments, the dosage is at least about 100 μg/kg body weight, at least about 250 μg/kg body weight, at least about 750 μg/kg body weight, at least about 3mg/kg body weight, at least about 5mg/kg body weight, at least about 10mg/kg body weight.

In certain preferred embodiments, the course of treatment involving an antibody or antigen-binding fragment thereof of the invention will comprise multiple doses of the selected pharmaceutical product administered over a period of weeks or months. More specifically, the antibodies or antigen binding fragments thereof of the invention may be administered daily, every two days, every four days, weekly, every ten days, every two weeks, every three weeks, monthly, every six weeks, every two months, every ten weeks, or every three months. In this regard, it is understood that the dosage or adjustment interval may be varied based on patient response and clinical practice.

A compatible formulation for parenteral administration (e.g., intravenous injection) will comprise an antibody or antigen-binding fragment thereof as disclosed herein at a concentration of about 5 μg/mL to about 100mg/mL. In certain selected embodiments, the concentration of the antibody or antigen-binding fragment thereof will comprise 10μg/mL,20μg/mL,50μg/mL,60μg/mL,80μg/mL,100μg/mL,200μg/μg/mL,300μg/mL,400μg/mL,500μg/mL,600μg/mL,800μg/mL,900μg/mL or 1mg/mL. In other preferred embodiments, the antibody-conjugated drug will comprise 2mg/mL,3mg/mL,4mg/mL,5mg/mL,6mg/mL,8mg/mL,10mg/mL,12mg/mL,14mg ml,16mg/mL,18mg/mL,20mg/mL,25mg/mL,30mg/mL,35mg/mL,40mg/mL,45mg/mL,50mg/mL,60mg/mL,70mg/mL,80mg/mL,90mg/mL or 100mg/mL.

The antibodies of the invention can be co-administered with one or more other therapeutic agents (e.g., cytotoxic agents, radiopharmaceuticals, antineoplastic agents, anti-angiogenic agents, or and immunosuppressants) to reduce induction of an immune response against the antibodies of the invention. The antibody may be linked to the therapeutic agent (as an immune complex) or may be administered separately from the therapeutic agent.

In the context of administration of a treatment, the term "combination" or "co-administration" as used herein refers to the use of more than one treatment or therapeutic agent. The use of the term "combination" does not limit the order of treatments or therapeutic agents administered to a subject. The treatment or therapeutic agent may be administered prior to, concurrently with, or after the administration of the second treatment or therapeutic agent to the patient. Preferably, the therapeutic or therapeutic agents are administered to the subject in a sequence, amount, and/or over a time interval such that the therapeutic or therapeutic agents may act together. In a particular embodiment, the therapeutic or therapeutic agents are administered to the subject in a sequence, amount, and/or over a time interval such that they provide increased benefits over if administered otherwise (particularly independently of each other). Preferably, the added benefit is a synergistic effect.

Medical application

The antibodies, antibody compositions and methods of the invention have a number of in vitro and in vivo uses, including, for example, detection of TREM2 or enhancement of immune responses. For example, these molecules may be administered to cultured cells in vitro or ex vivo, or to human subjects in vivo, for example.

Preferred subjects include mammals, such as humans/patients. Mammals in the context of the present invention are humans, non-human primates, domesticated animals such as dogs, cats, sheep, cattle, goats, pigs, horses, etc., laboratory animals such as mice, rats, rabbits, guinea pigs, etc., and farm animals such as zoo animals.

Treatment of disorders associated with TREM2 expression

In some aspects, the invention provides methods of treating a disorder in a mammal comprising administering to a subject (e.g., human) in need of treatment a therapeutically effective amount of an antibody or antigen-binding fragment thereof disclosed herein.

In some aspects, the disclosure provides a method for treating or determining prognosis of a disease associated with TREM2 expression in a subject, comprising administering an effective dose of the antibody or antigen-binding fragment thereof, the nucleic acid molecule, the vector, the host cell, the conjugate, the antibody drug conjugate, the multispecific molecule, or the pharmaceutical composition or kit to a subject in need thereof.

In some aspects, the disclosure provides the antibody or antigen-binding fragment thereof, the nucleic acid molecule, the vector, the host cell, the conjugate, the antibody drug conjugate, the multispecific molecule, or the pharmaceutical composition or kit for use in a method of treating a disease associated with TREM2 expression or determining the prognosis thereof in a subject.

In some aspects, the disclosure provides the use of the antibody or antigen binding fragment thereof, the nucleic acid molecule, the vector, the host cell, the conjugate, the antibody drug conjugate, the multispecific molecule, or the pharmaceutical composition or kit in the preparation of a reagent (or drug) for treating a disease associated with TREM2 expression or determining the prognosis thereof.

In one embodiment, the TREM2 related disease includes a neoplastic disease, such as cancer.

In some embodiments, the TREM 2-related disease is a cancer, preferably selected from the group consisting of: gastric cancer, colorectal cancer, breast cancer, liver cancer, pancreatic cancer, lung cancer, prostate cancer, glioma, ovarian cancer.

The antibody or antigen binding fragment thereof may be used alone as a monotherapy or may be used in combination with chemotherapy or radiation therapy.

The antibody or antigen binding fragment thereof may be used in combination with an anticancer agent, a cytotoxic agent, or a chemotherapeutic agent.

The term "anti-cancer agent" or "antiproliferative agent" means any agent that can be used to treat cell proliferative disorders such as cancer, and includes, but is not limited to, cytotoxic agents, cytostatic agents, anti-angiogenic agents, radiation therapy and radiation therapeutic agents, targeted anti-cancer agents, BRMs, therapeutic antibodies, cancer vaccines, cytokines, hormonal therapy, radiation therapy, anti-metastatic agents and immunotherapeutic agents. It will be appreciated that in selected embodiments as described above, such anti-cancer agents may comprise conjugates and may be conjugated to the disclosed site-specific antibodies prior to administration. More specifically, in certain embodiments, a selected anti-cancer agent is linked to a unpaired cysteine of an engineered antibody to provide an engineered conjugate as described herein. Thus, such engineered conjugates are expressly contemplated as being within the scope of the present invention. In other embodiments, the disclosed anti-cancer agents will be administered in combination with site-specific conjugates comprising different therapeutic agents as described above.

In some embodiments, the TREM 2-related disease is a neurodegenerative disease selected from the group consisting of: alzheimer's Disease (AD), parkinson's Disease (PD), autism (ASDs), multiple Sclerosis (MS), amyotrophic Lateral Sclerosis (ALS).

In some embodiments, the TREM 2-related disorder is metabolic syndrome selected from the group consisting of: fat cell hypertrophy, systemic hypercholesterolemia, inflammation, and glucose intolerance.

Diagnosis of

The present invention provides in vitro and in vivo methods for detecting, diagnosing or monitoring proliferative disorders and methods of screening cells from a patient to identify tumor cells, including tumorigenic cells. Such methods comprise identifying an individual having cancer for treatment or monitoring progression of cancer, comprising contacting a patient or a sample obtained from the patient (in vivo or in vitro) with an antibody described herein, and detecting the presence or absence or level of binding of the bound antibody to a bound or free target molecule in the sample. In some embodiments, the antibody will comprise a detectable label or a reported molecule as described herein.

In some aspects, the disclosure provides a method of diagnosing, detecting, or monitoring a disease associated with TREM2, comprising administering an effective dose of the antibody or antigen binding fragment thereof, the nucleic acid molecule, the vector, the host cell, the conjugate, the antibody drug conjugate, the multispecific molecule, or the pharmaceutical composition or kit to a subject in need thereof.

In some aspects, the disclosure provides the antibody or antigen-binding fragment thereof, the nucleic acid molecule, the vector, the host cell, the conjugate, the antibody drug conjugate, the multispecific molecule, or the pharmaceutical composition or kit for use in a method of diagnosing, detecting, or monitoring a TREM 2-associated disorder in a subject.

In yet another aspect, the present disclosure provides the use of the antibody or antigen binding fragment thereof, the nucleic acid molecule, the vector, the host cell, the conjugate, the antibody drug conjugate, the multispecific molecule, or the pharmaceutical composition or kit in the preparation of a reagent (or drug) for diagnosing, detecting, or monitoring a disease associated with TREM2 expression.

Samples may be analyzed by a variety of assays, such as radioimmunoassays, enzyme immunoassays (e.g., ELISA), competitive binding assays, fluorescent immunoassays, immunoblot assays, western blot analysis, and flow cytometry assays. Compatible in vivo diagnostic or diagnostic assays may include imaging or monitoring techniques known in the art, such as magnetic resonance imaging, computerized tomography (e.g., CAT scan), positron emission tomography (e.g., PET scan), radiography, ultrasound, and the like, as known to those skilled in the art.

The methods described herein for in vitro detection or monitoring of TREM2 expression or TREM2 expression cell levels can also be used for non-diagnostic purposes.

Preferred subjects include mammals, such as humans/patients in need thereof.

The sample from the subject is blood, fecal matter (urine or faeces), oral or nasal secretions, or alveolar lavage, interstitial fluid, sweat or extracts thereof from the subject.

Pharmaceutical package and kit

Pharmaceutical packages and kits comprising one or more containers of one or more doses of the antibodies or antigen binding fragments thereof are also provided. In certain embodiments, unit doses are provided, wherein the unit doses contain a predetermined amount of a composition comprising, for example, an antibody or antigen-binding fragment thereof, with or without one or more other agents. For other embodiments, such unit doses are supplied in single use, pre-filled syringes. In other embodiments, the compositions contained in the unit dose may comprise saline, sucrose, or the like; buffers such as phosphates and the like; and/or formulated in a stable and effective pH range. Or in certain embodiments, the conjugate composition may be provided as a lyophilized powder, which may be reconstituted upon addition of a suitable liquid (e.g., sterile water or saline solution). In certain preferred embodiments, the composition comprises one or more substances that inhibit protein aggregation, including, but not limited to, sucrose and arginine. Any label on or associated with the container indicates that the encapsulated conjugate composition is to be used to treat the selected neoplastic disease condition.

Such kits typically comprise a pharmaceutically acceptable formulation of the engineered conjugate in a suitable container, and optionally one or more anticancer agents or other agents in the same or different containers. The kit may also contain other pharmaceutically acceptable formulations for diagnostic or combination therapy.

More specifically, the kits may have a single container containing the antibodies or antigen binding fragments thereof of the disclosure, with or without additional components, or they may have different containers for each desired agent. Where a combination therapeutic agent is provided for conjugation, a single solution may be pre-mixed in molar equivalent combination or with more of one component than the other. Or the conjugate of the kit and any optional anticancer agent may be stored separately in separate containers prior to administration to the patient. The kit may further comprise a second/third container means for holding a sterile pharmaceutically acceptable buffer or other diluent, such as bacteriostatic water for injection (BWFI), phosphate Buffered Saline (PBS), ringer's solution and dextrose solution.

When the components of the kit are provided in one or more liquid solutions, the liquid solution is preferably an aqueous solution, particularly preferably a sterile aqueous solution or a saline solution. However, the components of the kit may be provided as a dry powder. When the reagents or components are provided in dry powder form, the powder may be reconstituted by the addition of a suitable solvent. It is contemplated that the solvent may also be provided in another container.

Examples

Example 1 antigen preparation, mouse immunization and screening

DNA antigen preparation

The preparation method of the human TREM2 DNA antigen for immunizing the Balb/c mice comprises the following steps: cDNA sequence (sequence shown as SEQ ID NO: 1) of human TREM2 (Uniprot ID Q9NZC 2) is synthesized, and the coding sequence of the gene is cloned into an expression vector by enzyme digestion.

SEQ ID NO. 1 sequence:

ATGGAGCCTCTCCGGCTGCTCATCTTACTCTTTGTCACAGAGCTGTCCGGAGCCCACAACACCACAGTGTTCCAGGGCGTGGCGGGCCAGTCCCTGCAGGTGTCTTGCCCCTATGACTCCATGAAGCACTGGGGGAGGCGCAAGGCCTGGTGCCGCCAGCTGGGAGAGAAGGGCCCATGCCAGCGTGTGGTCAGCACGCACAACTTGTGGCTGCTGTCCTTCCTGAGGAGGTGGAATGGGAGCACAGCCATCACAGACGATACCCTGGGTGGCACTCTCACCATTACGCTGCGGAATCTACAACCCCATGATGCGGGTCTCTACCAGTGCCAGAGCCTCCATGGCAGTGAGGCTGACACCCTCAGGAAGGTCCTGGTGGAGGTGCTGGCAGACCCCCTGGATCACCGGGATGCTGGAGATCTCTGGTTCCCCGGGGAGTCTGAGAGCTTCGAGGATGCCCATGTGGAGCACAGCATCTCCAGGAGCCTCTTGGAAGGAGAAATCCCCTTCCCACCCACTTCCATCCTTCTCCTCCTGGCCTGCATCTTTCTCATCAAGATTCTAGCAGCCAGCGCCCTCTGGGCTGCAGCCTGGCATGGACAGAAGCCAGGGACACATCCACCCAGTGAACTGGACTGTGGCCATGACCCAGGGTATCAGCTCCAAACTCTGCCAGGGCTGAGAGACACGTGA

B. Protein antigen preparation

The preparation method of the Human TREM2 ECD-hFc protein for immunizing Balb/c mice comprises the following steps: a nucleotide fragment (the sequence of which is shown as SEQ ID NO: 2) encoding human TREM2 (Uniprot ID Q9NZC 2) extracellular region Fc fusion protein was synthesized and loaded into an expression vector by a DNA ligase. The plasmid containing the Human TREM2 ECD-hFc was transferred into ExpiCHO (Gibco, cat: A29127) cells by PEI transfection. 9 days after transfection, the supernatant of the culture medium containing the target protein was harvested by centrifugation and filtration and purified by means of an affinity column (Cytiva, cat: 17549851). The purified proteins will be identified by SDS-PAGE, SEC-HPLC and the like.

SEQ ID NO. 2 sequence:

ATGGACATGAGGGTCCCTGCCCAGCTGCTGGGCCTGCTGCTCCTGTGGTTCCCCGGCAGCCGGTGCCACAATACAACCGTGTTCCAGGGCGTGGCCGGCCAGAGCCTGCAGGTTAGCTGTCCTTACGATTCCATGAAGCACTGGGGCAGGAGGAAGGCCTGGTGTAGACAGCTGGGCGAGAAGGGCCCTTGTCAGAGAGTGGTGAGCACACACAACCTGTGGCTGCTGTCCTTCCTGAGGAGATGGAACGGCTCCACAGCCATCACCGACGACACACTGGGCGGCACCCTGACAATCACACTGAGGAATCTGCAGCCCCACGATGCCGGCCTGTACCAGTGTCAGAGCCTGCACGGCAGCGAGGCCGACACCCTGAGAAAGGTGCTGGTGGAGGTGCTGGCCGACCCTCTGGACCACAGGGACGCCGGAGACCTGTGGTTTCCTGGCGAGAGCGAGAGCTTCGAGGACGCCCACGTGGAGCACAGCATCTCCAGGAGCCTGCTGGAGGGCGAGATCCCCTTCCCCCCTACATCCGGCGGAGGAGGTAGCGGCGGAGGAGGTAGCGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGAGGAGATGACCAAGAACCAGGTCAACCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCAACAGCACCCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTTGA

C. preparation of reference antibody PY314

The present study used Pionyr Immunotherapeutics developed anti-TREM 2 monoclonal antibody as reference, i.e., reference antibody, the amino acid sequence was derived from 37012 sequence in patent US2020/0140546A1, the DNA sequence of the variable region amino acid was synthesized (sequence shown as SEQ ID NO: 3), and the heavy chain and light chain variable region sequences were loaded onto pTT5 vector (HonorGene, cat: HG-VPW 0888) by DNA ligase, respectively, wherein the subtype of heavy chain constant region was hIgG1 and the subtype of light chain constant region was kappa. Plasmids containing the heavy and light chains of the tool antibodies were co-transferred into ExpiCHO cells using PEI transfection. The supernatant of the medium containing the antibody of interest was harvested 9 days after transfection by centrifugation and filtration and the antibody Protein was purified using a Protein A column (Cytiva, cat: 17549851). The purified antibodies will be identified by SDS-PAGE, SEC-HPLC and the like. The reference antibody PY314 amino acid sequence has the full-length light chain sequence shown in SEQ ID NO. 17, the full-length heavy chain sequence shown in SEQ ID NO. 18, the light chain variable region sequence shown in SEQ ID NO. 31, the heavy chain variable region sequence shown in SEQ ID NO. 32, the LCDR1-LCDR3 shown in SEQ ID NO. 53-55, and the HCDR1-HCDR3 shown in SEQ ID NO. 74-76.

SEQ ID NO. 3 sequence:

Heavy chain:

GAGGTGCAGCTGCTGGAAAGCGGAGGCGGACTGGTGCAACCCGGCGGCAGCCTGAGACTGAGCTGCGCTGCTTCTGGCTTTACATTCAGCAACTACTACATGGCCTGGGTGCGGCAGGCCCCTGGCAAAGGCCTGGAATGGGTGTCCAGCCTCACCAACAGCGGCGGATCTACCTACTACGCCGACAGCGTGAAGGGCAGATTCACCATCAGCAGAGATAATAGCAAGAACACCCTGTACCTGCAGATGAACTCCCTGCGGGCCGAGGACACCGCCGTGTACTATTGTACAAGAGAGTGGGCCGGCAGCGGCTACTTCGACTACTGGGGCCAGGGCACCCTGGTCACAGTGTCCTCT

SEQ ID NO. 4 sequence:

Light chain:

GACATCCAGATGACCCAGAGCCCATCCTCCCTGAGCGCCAGCGTGGGCGACAGAGTGACCATTACATGCAAGGCTTCTCAGAACGTGGGCAACAACCTGGCCTGGTACCAGCAGAAACCTGGCAAGGCCCCTAAGCTGCTGATCTACTATACATCTAATAGATTCACCGGCGTCCCCAGCAGATTCAGCGGATCTGGCAGCGGCACAGATTTTACCCTGACCATCAGCAGCCTGCAACCTGAGGACTTCGCCACCTACTACTGTCAGCGGATCTACAACAGCCCCTGGACCTTCGGCCAGGGAACAAAGCTGGAAATCAAG

D. Monoclonal antibody generation and screening

Balb/c mice (commercially available mice, available from the Ming Chemie) were immunized with the human TREM2 expression vector prepared as described above and the human TREM2 ECD-hFc protein prepared as described above. The DNA antigen and gold powder are mixed and freeze-dried, and then the abdomen of the mouse is immunized for multiple times by a gene gun. The expression vector DNA is immunized 4ug each time, two weeks are separated from each other, the titer of the mice is measured by blood sampling, and the mice with high serologic titer are selected for boosting, and each mouse is injected with 25ug of human TREM2 ECD-hFc protein by the abdominal cavity, and spleen, lymph node and bone marrow cells of the target animal are respectively collected after 3 days. Immune cells were plasma cell isolated and enriched by a mouse CD138+ plasma cell isolation kit (Miltenyi, cat: 130-092-530), the plasma cells being the cells that secreted the antibody mainly. After the plasma cells are adjusted to the appropriate concentration, they are passed through a Berkeley light guide system (BLIOptofluidic System) into an independent pen on the chip, positive B cells were obtained by screening. Single cells can be directly exported to 96-well plates after lysis in Beacon's pen, and RNA from the lysed single cells is collected by Agencourt RNAClean XP Beads (Beckman Coulter, cat: A63987) and subsequently used/>CDNA synthesis was performed using the RACE 5'/3' kit (Clontech, cat: 634859). cDNA purification was performed by Agencourt AMPure XP Beads (Beckman Coulter, cat: A63881). The heavy and light chain variable regions were PCR amplified using cDNA as a template and mouse Ig-PRIMER SET (Novagen, 69831-3) as a Gene-specific primer (Gene-SPECIFIC PRIMER, GSP).

Example 2 detection of binding Activity of anti-TREM 2 antibody to cell surface huTREM2

Plasmids containing the heavy and light chains of TREM2 antibody were co-transferred into FUT8-KO ExpiCHO (wise chemical construction) cells by PEI transfection. The supernatant of the medium containing the antibody of interest was harvested 9 days after transfection by centrifugation and filtration and the antibody Protein was purified using a Protein A column (Cytiva, cat: 17549851). The purified antibodies will be identified by SDS-PAGE, SEC-HPLC and the like.

The binding activity was assessed by measuring EC50 by FACS detection of binding of antibody molecules to cell surface huTREM2 at various concentrations.

The stably transformed cell line CHOK1-human TREM2-DAP12 expressing human TREM2 antigen was cultured and processed as described above by flow cytometry. The cells harvested after digestion were centrifuged at 300g for 5 minutes at room temperature, and the supernatant was discarded and washed 2 times with FACS buffer (PBS+2% FBS). Cells were placed in 96-well plates at 2-5E+05/well, the supernatant was discarded by centrifugation, and the cells were resuspended in diluted antibody solution at 100 uL/well, mixed well and incubated at 4℃for 1 hour. The supernatant antibody solution was discarded after centrifugation at 300g for 5 min at 4℃and cells were washed 2 times using FACS buffer, and Goat anti humanlgG-Alexa fluro 488 secondary antibody solution, 100 uL/well, was added and incubated at 4℃for 1 hour. After centrifugation at 300g for 5 min at 4℃and discarding the supernatant antibody solution, cells were washed 2 times with FACS buffer, and finally resuspended with PBS, the signal values were detected on a BD flow cytometer.

As a result, as shown in fig. 1A, 1B and 1C, C1, G3, 2A6, 2a10, mAb006C and mAb008C have strong binding activity to human TREM2 on the cell surface. It was demonstrated that C1, G3, 2A6, 2A10, mAb006C and mAb008C were able to bind efficiently to the cell surface of CHOK1-human TREM2-DAP12 over-expressing human TREM2, and had a dose-dependent ability, and that the binding capacity of C1, G3, 2A6, 2A10, mAb006C and mAb008C were significantly better than that of reference antibody PY314.

Example 3 Cross Activity detection

EC50 was measured by FACS detection of C1, G3, 2A6, 2a10, mAb006C and mAb008C binding to cell surface Cyno TREM2 at different concentrations and species cross-reactivity was assessed.

The steady transfer cell line CHOK1-cyno TREM2-DAP12 expressing monkey TREM2 antigen was cultured and treated as described above by flow cytometry. The cells harvested after digestion were centrifuged at 300g for 5 minutes at room temperature, and the supernatant was discarded and washed 2 times with FACS buffer (PBS+2% FBS). Cells were placed in 96-well plates at 2-5E+05/well, the supernatant was discarded by centrifugation, and the cells were resuspended in diluted antibody solution at 100 uL/well, mixed well and incubated at 4℃for 1 hour. The supernatant antibody solution was discarded after centrifugation at 300g for 5 min at 4℃and cells were washed 2 times using FACS buffer, and Goat anti humanlgG-Alexa fluro 488 secondary antibody solution, 100 uL/well, was added and incubated at 4℃for 1 hour. After centrifugation at 300g for 5 min at 4℃and discarding the supernatant antibody solution, cells were washed 2 times with FACS buffer, and finally resuspended with PBS, the signal values were detected on a BD flow cytometer.

The results of cross-reactivity with species of monkey are shown in fig. 2A, 2B and 2C, 6 antibodies all had better cynoTREM binding activity, wherein the binding activity of C1, G3, 2A6, 2A10, mAb006C and mAb008 to Cyno were significantly better than the reference antibodies.

EC50 was measured by FACS detection of binding of C1, G3, 2A6, 2a10, mAb006C and mAb008C to cell surface mouseTREM2 at different concentrations and species cross-reactivity was assessed.

The stably transformed cell line CHOK1-mouse TREM2-DAP12 expressing the mouse TREM2 antigen was cultured and treated as described above by the flow cytometry method. The cells harvested after digestion were centrifuged at 300g for 5 minutes at room temperature, and the supernatant was discarded and washed 2 times with FACS buffer (PBS+2% FBS). Cells were placed in 96-well plates at 2-5E+05/well, the supernatant was discarded by centrifugation, and the cells were resuspended in diluted antibody solution at 100 uL/well, mixed well and incubated at 4℃for 1 hour. The supernatant antibody solution was discarded after centrifugation at 300g for 5 min at 4℃and cells were washed 2 times using FACS buffer, and Goat anti humanlgG-Alexa fluro 488 secondary antibody solution, 100 uL/well, was added and incubated at 4℃for 1 hour. After centrifugation at 300g for 5 min at 4℃and discarding the supernatant antibody solution, cells were washed 2 times with FACS buffer, and finally resuspended with PBS, the signal values were detected on a BD flow cytometer.

Cross-reactivity with murine species results as shown in FIGS. 3A, 3B and 3C, 6 antibodies were each able to bind to mouse TREM2, with mAb008C, C1, G3 antibodies binding to the mouse significantly better than the reference antibody.

Example 4TREM2 reporter Gene experiment

The activation or inhibition of the TREM2 signaling pathway by therapeutic antibodies can be quantitatively detected by the activity of Luciferase produced by NFAT pathway activation using genetically engineered Jurkat cells as effector cells, stable expression of TREM2 receptor and DAP12 on Jurkat cells, and drive expression of the Luciferase gene by NFAT responsive elements.

Antibody coating or mixing with Crosslinker (anti-Fc) for crosslinking, incubating with Jurkat-NFAT-TREM2-DAP12 cells in a 37 ℃ incubator for 6 hours, adding an equal volume of ONE-Glo (Promega, E6120), standing for 10-15 minutes at room temperature in a dark condition after uniform mixing, reading fluorescent signals by an enzyme-labeled instrument, and analyzing data.

The effect of the C1, G3 and mAb008C antibodies on the cells was shown to be slightly inhibited by using crosslinker to increase the aggregation of the antibodies (Abs: crosslinker =1:0.5), and the inhibition of the cells by 2A6, 2A10 and mAb006C was stronger than that of PY314 as shown in FIG. 4, after 6h incubation of Jurkat-TREM2-DAP12-NFAT cells.

Example 5 affinity detection

The affinities of C1, G3, 2A6, 2a10, mAb006C and mAb008C were detected by Biacore.

The detection was performed by using SPR technique, CM5 chip coupled with Anti-mFc antibody was used to capture His-tagged recombinant hTREM, cyno-TREM2 or mTREM2 protein as Ligand (Ligand), different concentrations of TREM2 antibody were set as analyte (Analysis), kinetic detection was performed with captured human recombinant hTREM, cyno-TREM2 or mTREM2 protein, and binding curves were subjected to kinetic fitting by Biacore software to obtain affinities, and experimental results are shown in Table 1.

TABLE 1TREM2 antibody affinity

EXAMPLE 6 evaluation of in vivo efficacy

The in vivo efficacy of the PD-1 antibodies in EMT6 cell subcutaneous allograft mice tumor models was evaluated with the co-reference antibodies PY314 test subjects for C1, G3, 2A6, 2a10, mAb006C and mAb 008C.

2X10 ⁶/mL of EMT6 cells were subcutaneously inoculated on the right side of each mouse with 0.1mL of cell suspension (containing 2X10 ⁵ cells) on the right back of BALB/c mice. On day 5 after inoculation, lotus tumor mice with tumor volumes ranging from 40 to 67mm ³ (average tumor volume 55mm ³) were selected and grouped by hierarchical randomization according to tumor volume, with 8 mice per group. The administration was started on the day of the group (noted as PG-D0), 2 times per week, and the experimental group is as shown in Table 2 (ip is intraperitoneal injection, BIW is twice per week):

TABLE 2 grouping experiments of drug effects

Group of	Test article	Administration mode
			Group 1	PBS	i.p.BIW
Group 2	RMP1-14-mIgG(3mg/kg)	i.p.BIW
			Group 3	PY314m(10mg/kg)+RMP1-14-mIgG(3mg/kg)	i.p.BIW
Group 4	C1(10mg/kg)+RMP1-14-mIgG(3mg/kg)	i.p.BIW
			Group 5	G3(10mg/kg)+RMP1-14-mIgG(3mg/kg)	i.p.BIW
Group 6	2A6(10mg/kg)+RMP1-14-mIgG(3mg/kg)	i.p.BIW
			Group 7	2A10(10mg/kg)+RMP1-14-mIgG(3mg/kg)	i.p.BIW
Group 8	mAb006c(10mg/kg)+RMP1-14-mIgG(3mg/kg)	i.p.BIW
			Group 9	mAb008c(10mg/kg)+RMP1-14-mIgG(3mg/kg)	i.p.BIW

TABLE 3 tumor growth inhibition

Tumor growth and inhibition results as shown in fig. 5 and table 3, statistics show that there were significant differences in tumor volumes of treatment group 2, treatment group 3, treatment group 4, treatment group 5, treatment group 6, treatment group 7, treatment group 8, and treatment group 9 compared to the solvent control group. Compared with the curative effect of the PD-1 drug combined with the reference molecule PY314, the efficacy of 2A6+RMP1-14 and mAb006c+RMP1-14 is obviously better than that of the reference molecule.

The time from the start of administration to the euthanasia of the mice was taken as the survival time of the mice with tumor volumes reaching 2000mm ³ as the survival endpoint. The survival curves and survival analysis are shown in fig. 6 and table 4. The median survival (Median Survival Time, MST) of the solvent control group tumor-bearing mice was 17 days. The MST values for treatment group 2, treatment group 3, treatment group 4, treatment group 5, treatment group 6, treatment group 7, treatment group 8, and treatment group 9 were 18 days, 23 days, 19.5 days, 22 days, 29 days, 22 days, 24 days, and 18 days, respectively. Treatment group 3 treatment group 5, treatment group 6, treatment group 7 and treatment group 8 were able to significantly extend the survival of mice (ILS > 25%) compared to the solvent control group. Statistical Kaplan-Meier survival analysis showed significant differences in treatment group 5, 6, 7 and 8 compared to the solvent control group.

TABLE 4 survival analysis of mice in each group

Finally, it should be noted that: the foregoing description is only a preferred embodiment of the present disclosure, and is not intended to limit the present disclosure, but although the present disclosure has been described in detail with reference to the foregoing embodiment, it will be apparent to those skilled in the art that modifications may be made to the technical solutions described in the foregoing embodiments, or equivalents may be substituted for some of the technical features thereof. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present disclosure should be included in the protection scope of the present disclosure.

Claims

1. An isolated antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof specifically binds TREM2, wherein the isolated antibody or antigen-binding fragment thereof comprises a heavy chain variable region (HCDR) and a light chain variable region (LCDR), wherein the light chain variable region comprises LCDR1, LCDR2, and LCDR3, wherein,

The LCDR1 comprises the following sequence:

the LCDR2 comprises the following sequence:

[L/K/G/H/R][V/A/M]S[K/N/E][L/R/S][D/F/Y/I/A][S/T]；

the LCDR3 comprises the following sequence:

[W/S/G/Q/M]Q[G/S/H][T/Y/N/L][H/S/N/E][F/V/Y/W]P[Y/L/F]T；

the heavy chain variable region comprises HCDR1, HCDR2 and HCDR3, wherein,

The HCDR1 comprises the following sequence:

[D/S][G/*]Y[G/W/Y/N][M/W][H/N]；

The HCDR2 comprises the following sequence:

the HCDR3 comprises the following sequence:

2. the isolated antibody or antigen-binding fragment thereof of claim 1, wherein,

The LCDR3 comprises a nucleotide sequence corresponding to SEQ ID NO: 37. 40, 43, 46, 49 and 52 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, or a sequence consisting of SEQ ID NO: 37. 40, 43, 46, 49 and 52;

3. The isolated antibody or antigen-binding fragment thereof of any one of the preceding claims, wherein the heavy chain variable region comprises a sequence that hybridizes to SEQ ID NO: 20. 22, 24, 26, 28, and 30 has a sequence of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, or a sequence of SEQ ID NO: 20. 22, 24, 26, 28 and 30;

Wherein the light chain variable region comprises a sequence identical to SEQ ID NO: 19. 21, 23, 25, 27, and 29 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, or a sequence consisting of SEQ ID NO: 19. 21, 23, 25, 27 and 29.

4. The isolated antibody or antigen-binding fragment thereof of any one of the preceding claims, further comprising a heavy chain constant region, wherein the heavy chain constant region comprises a sequence identical to SEQ ID NO:34 or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 34;

Also included is a light chain constant region comprising a sequence that hybridizes to SEQ ID NO:33 or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 33.

5. The isolated antibody or antigen-binding fragment thereof of any of the preceding claims, wherein,

6. The antibody or antigen binding fragment thereof of any one of the preceding claims, wherein the antibody is a chimeric or humanized antibody or an improved antibody such as an improved chimeric antibody.

7. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding the antibody or antigen-binding fragment thereof of any one of claims 1-6.

8. A conjugate comprising the antibody or antigen-binding fragment thereof of any one of claims 1-6 coupled to at least one detectable label.

9. A multispecific molecule comprising the antibody or antigen-binding fragment thereof of any one of claims 1-6; preferably, the multispecific molecule specifically binds TREM2, and additionally specifically binds one or more other targets; further preferred, the multispecific molecule further comprises at least one molecule having a second binding specificity for a second target.

10. Use of an antibody or antigen-binding fragment thereof according to any one of claims 1-6, a nucleic acid molecule according to claim 7, or a conjugate according to claim 8, or a multispecific molecule according to claim 9, in the manufacture of a medicament for treating or determining the prognosis of a disease associated with TREM2 expression.