CN117925647A - Responsive transcription regulator gene and application thereof - Google Patents

Abstract

The invention discloses a response transcription regulator gene and application thereof, belonging to the technical field of genetic engineering. The nucleic acid sequence of the response transcription regulator gene provided by the invention is shown as SEQ ID NO. 1. The gene is proved to be related to acid resistance regulation of strains for the first time by the invention. The development of the acid resistance is beneficial to improving the fermentation performance of the wine coccus in the fermentation of the grape wine malic acid, thereby further improving the quality of the grape wine and having important application prospect.

Description

Responsive transcription regulator gene and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a response transcription regulator gene and application thereof.

Background

The wine brewing mainly comprises two fermentation processes: the alcohol fermentation and the malic acid lactic acid fermentation are respectively completed by different microorganism dominance. The alcohol fermentation process is mainly completed by Saccharomyces cerevisiae, and organic saccharides such as glucose are decomposed to produce ethanol and form CO ₂. The lactic acid fermentation of malic acid is mainly completed by the wine coccus, the process is necessary for producing high-quality wine, because the lactic acid fermentation of malic acid can reduce the acidity of the wine, enhance the stability of microorganisms and weaken the bitter and astringent feeling, and the process can change the fragrance structure of the wine and increase the fruit fragrance of the wine, and in addition, the wine coccus can produce diacetyl and other fragrance compounds in the metabolic process, so that the taste and flavor of the wine are increased.

The malic acid lactic acid fermentation process is usually started in the later stage of the alcoholic fermentation, and the fermentation liquid has a relatively bad environment and a relatively low pH value of 3.0-3.5. Lower pH values generally affect the intracellular pH stability of bacteria, increase the difficulty of cell removal of protons from the cell, and when the intracellular pH is lowered, affect the stability of various enzymes and DNA in the cell, thereby affecting cell growth and division. Most lactic acid bacteria cannot survive in the severe environment formed by the stress condition, and the wine coccus is a main strain in the process of brewing the wine due to the long-term adaptive evolution of the wine coccus, and is a main finished product of the malic acid fermentation. Therefore, the method has important significance on the mechanism exploration of why the wine coccus can adapt to the acid stress condition in the brewing process of the wine.

Disclosure of Invention

The invention provides a response transcription regulator gene, the nucleic acid sequence of which is shown as SEQ ID NO. 1.

The present invention also provides a mutant of the above responsive transcription regulator gene, the nucleic acid sequence of which is as follows

SEQ ID NO. 2.

The invention also provides a recombinant expression vector, an expression cassette, a transgenic cell line, a recombinant bacterium or a recombinant virus containing the responsive transcription regulator gene and/or a mutant thereof.

The invention also provides application of the response transcription regulator gene and/or the mutant thereof in improving acid resistance of strains.

In the above applications, the strains include, but are not limited to, species of wine coccus, lactobacillus plantarum, and the like.

The invention provides a method for improving acid resistance of strain, which comprises constructing the response transcription regulator gene or mutant thereof into an expression vector to form a recombinant expression vector, then transforming the recombinant expression vector into strain to obtain recombinant strain containing the response transcription regulator gene or mutant thereof, and finally improving acid resistance of the strain through expression of the response transcription regulator gene or mutant thereof.

In the above method, the expression vector includes, but is not limited to, a vector such as E.coli pIB184 plasmid.

The invention provides application of the response transcription regulator gene and/or mutant thereof in improving the fermentation quality of wine dominated by wine coccus in the malic acid fermentation process.

In the above application, the wine coccus is transformed with an exogenous gene of the above responsive transcription regulator and/or its mutant form.

The beneficial effects of the invention are as follows:

The orf00404 encoding gene in the wine coccus is proved to be relevant to the acid resistance regulation of the strain for the first time by the invention. The development of the acid resistance is beneficial to improving the fermentation performance of the wine coccus in the fermentation of the grape wine malic acid, thereby further improving the quality of the grape wine and having important application prospect.

Drawings

FIG. 1 shows orf 00404-purpose gene amplification band; wherein lane 1 is SD-2a source, lane 2 is DEa3 source;

FIG. 2 is a schematic diagram of a recombinant plasmid construction process;

FIG. 3 is an agarose gel electrophoresis of the enzyme-cleaved products; wherein, lane 1 represents the pIB184 plasmid after BamHI and EcoRI double cleavage, and lanes 2-5 represent the pIB184 plasmid;

FIG. 4 is a PCR electrophoresis chart of colony transformation of E.coli; wherein, lane 0 represents pIB184 plasmid empty vector colony PCR electrophoresis, lanes 1-5 represent the wine coccus DEa3 source orf00404 gene recombinant plasmid colony PCR electrophoresis patterns, and lanes 6-10 represent the wine coccus SD-2a source orf00404 gene recombinant plasmid colony PCR electrophoresis patterns;

FIG. 5 is a graph showing the result of electrotransformation culture of wild-type wine coccus SD-2 a-derived orf00404 gene;

FIG. 6 is an electrophoretogram of PCR products of mutant wine coccus DEa 3-derived orf00404 gene colonies;

FIG. 7 is an electrophoretogram of PCR products of wild-type wine coccus SD-2a source orf00404 gene colonies;

FIG. 8 is a graph showing the growth curves of recombinant strain and control strain at different pH conditions; wherein the pH values of A to E are respectively 3.2, 3.4, 3.6, 3.8 and 4.0;

FIG. 9 is a graph of an intracellular pH calibration curve;

FIG. 10 shows the results of measurements of intracellular and extracellular pH values for recombinant strain versus control strain over various time periods;

FIG. 11 is a graph of Ka value determinations of recombinant strain versus control strain at different times of acid stress treatment, wherein different letters indicate significant differences, p < 0.05;

FIG. 12 is a graph of cell membrane permeability assays for recombinant strains versus control strains at different times of acid stress treatment, wherein the different letters indicate significant differences, p < 0.05;

FIG. 13 is a graph showing cell membrane integrity measurements of recombinant strains versus control strains at different times of acid stress treatment, wherein the different letters indicate significant differences, p < 0.05;

FIG. 14 is a protein content calibration curve;

FIG. 15 is a graph of intracellular protein content determination of recombinant strain versus control strain at different times of acid stress treatment, wherein different letters indicate significant differences, p < 0.05;

FIG. 16 is a graph showing intracellular ATP content assays of recombinant strains and control strains at different times of acid stress treatment; wherein, the different letters represent significant differences, p < 0.05;

FIG. 17 shows the consumption of malic acid and the amount of lactic acid produced.

Detailed Description

The test materials of the present invention are as follows:

Strains: wild type wine coccus SD-2a, mutant type wine coccus DEa3, escherichia coli Top10, plasmid pIB184 and lactobacillus plantarum WCFS1. Among them, mutant wine coccus DEa3 was obtained by screening in the present laboratory.

Reagent: AG SteadyPure plasmid DNA extraction kit, AG SteadyPure bacterial genome DNA extraction kit, AG SteadyPure PCR reaction solution purification kit, PCR high-fidelity enzyme, AG 2000bp DNA Marker, AG 5000bp DNA Marker, quickCut EcoR I, quickCut BamH I, seamless cloning connection kit, erythromycin, fluorescent probe BCECF AM, HEPES-K (pH 8.0), phosphate buffer solutions with different concentrations, formaldehyde, embedded dinaphthyl probe, pNPG, pI, solarbio BCA protein concentration determination kit and Solarbio ATP content detection kit.

Instrument: ultra clean bench (SW-CJ-2D, suzhou purification Equipment Co., ltd.), autoclave (GT-180, micro (Xiaomen) instruments Co., ltd.), PCR instrument (T100 TM THERMAL CYCLER, beijing six biotechnology Co., ltd.), electrophoresis instrument (DYY-6D, beijing six biotechnology Co., ltd.), gel imager (GenoSens 1860, shanghai Kogynecomastia instruments Co., ltd.), biochemical incubator (LRH-250-A, shaog Tai macro medical instruments Co., ltd.), micro-spectrometer (MD 2000D, UK Biofuture Co., ltd.), high speed refrigerated centrifuge (Sorvall ST 16R, beijing world trade far-east scientific instruments Co., ltd.), electric converter (SCIENTZ-2C, ningbo Xinzhi biotechnology Co., ltd.), ultraviolet-visible spectrophotometer (UV-5500, shanghai Centipeda instruments Co., ltd.), enzyme label instrument (INNITE 200PROCAN), high performance liquid chromatograph (1220Infinity LC,Agilent Technologies Inc), fluorescent spectrometer (F-4700, japanese Highway, highway).

Culture medium: LB medium: 10g of peptone, 10g of sodium chloride, 5g of yeast extract powder, 1000g of water, 15g of agar, pH of 7.2-7.4 and sterilization conditions: 121 ℃ for 20min. MRS medium: 10g of beef extract, 5g of yeast extract, 20g of glucose, K ₂HPO₄ g of sodium acetate, 5g of magnesium sulfate, 0.2g of manganese sulfate, 1mL of Tween 80, 2g of triammonium citrate, 1000mL of water, 15g of agar, pH of 6.2 and sterilization conditions: 115 ℃ for 15min.

Other materials used in the present invention, such as those not specifically stated, are available through commercial sources. Other terms used herein, unless otherwise indicated, generally have meanings commonly understood by those of ordinary skill in the art. The invention will be described in further detail below in connection with specific embodiments and with reference to the data. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

The mutant strain DEa3 of which the growth condition is obviously better than that of the wild type wine coccus SD-2a is obtained by the directed evolution technology in the early stage of the laboratory.

The early directed evolution test is as follows:

before the experiment, the wine coccus SD-2a was inoculated with an inoculating loop onto ATB medium at pH 4.8 for activation. The activated bacterial liquid was inoculated onto an ATB medium having a pH of 3.2, and cultured at 25℃for about five generations. Then, the culture was transferred to ATB medium having a pH of 3.1, and further, the culture was continued for five generations. The above procedure was repeated until the reaction was continued on ATB medium at pH 2.8. Then, experiments for detecting various indexes are prepared. After the strain is subjected to directed evolution experiments for more than four months, the strain is stressed by an acidic environment and influenced by various factors, and can generate favorable mutation while being adaptive. The acid-resistant wine coccus strain is obtained in the directional evolution process. The genome sequencing shows that the gene coded by the response transcription regulator orf00404 in the strain has point mutation at 331bp, and the base is mutated from G to T.

The orf00404 encoding gene sequence of wild type wine coccus SD-2a is as follows:

ATGGTAAAACCAATCATTCTTATAATCGAAGATGAGACAGCTATTGTAGCTTATTTACAGACGGAACTTAAATTTGAAGATTATATTGTTTTGACAGCTAGTGATGGCGAAATGGGCCTTTCAGTTTTTGAACAGAATTCAAACCGAATTAATGTAGTTTTGCTTGATTGGATGTTGCCAAAACGAGATGGGCTCGAAGTTTTACGGCGCATTAGAAAATTAAATAGTCAGGTTTCTATAATTCTTATGACCGCTAAAAGTGATATTGGCGATAAAGTAGCTGCATTAGATTCTGGTGCAGATGACTATATTACGAAGCCTTTTGAAATTGAAGAACTTTTAGCACGTTTAAGAGTGACGATTCGTCATCAAAATAAGCCACGCCCAAAACTATATCAGGTATCTAACTTAGTGCTGGATTTAGACGCACACCGTGTTACAAGGGATGGACAGGTTATTGATTTAACGCAAAGAGAGTTCCAACTTTTAACATATTTAATTGAAAATGCAGGCAAAACGCTTACTCGCGATGATTTACTTGATAATGTTTGGGGAGTTGATTTTAACGGTCAATATAATACAGCTGATGTTTATATACGCTATCTTCGTCAAAAGATAGATGATCATTTTTATCCGAAGCTTATTCATACGGTTCGTAGTGTTGGATATGTCTTAAGGGCAAAATAA(SEQ ID NO:1)

The orf00404 encoding gene sequence of mutant wine coccus DEa3 is as follows:

ATGGTAAAACCAATCATTCTTATAATCGAAGATGAGACAGCTATTGTAGCTTATTTACAGACGGAACTTAAATTTGAAGATTATATTGTTTTGACAGCTAGTGATGGCGAAATGGGCCTTTCAGTTTTTGAACAGAATTCAAACCGAATTAATGTAGTTTTGCTTGATTGGATGTTGCCAAAACGAGATGGGCTCGAAGTTTTACGGCGCATTAGAAAATTAAATAGTCAGGTTTCTATAATTCTTATGACCGCTAAAAGTGATATTGGCGATAAAGTAGCTGCATTAGATTCTGGTGCAGATGACTATATTACGAAGCCTTTTGAAATTTAAGAACTTTTAGCACGTTTAAGAGTGACGATTCGTCATCAAAATAAGCCACGCCCAAAACTATATCAGGTATCTAACTTAGTGCTGGATTTAGACGCACACCGTGTTACAAGGGATGGACAGGTTATTGATTTAACGCAAAGAGAGTTCCAACTTTTAACATATTTAATTGAAAATGCAGGCAAAACGCTTACTCGCGATGATTTACTTGATAATGTTTGGGGAGTTGATTTTAACGGTCAATATAATACAGCTGATGTTTATATACGCTATCTTCGTCAAAAGATAGATGATCATTTTTATCCGAAGCTTATTCATACGGTTCGTAGTGTTGGATATGTCTTAAGGGCAAAATA(SEQ ID NO:2)

Because the genetic transformation system of the wine coccus is not mature enough, the recombinant plasmid and transformation technology are utilized in the laboratory to obtain the lactobacillus plantarum WCFS1 recombinant strain containing the wild type strain SD-2a of the wine coccus and the orf00404 encoding gene derived from the mutant strain DEa3 and the control strain containing the empty vector, and the way of acting the orf00404 encoding gene is determined by measuring indexes such as cell membrane fluidity, cell membrane integrity, cell membrane permeability, intracellular pH value and the like of the recombinant strain and the control strain under the stress condition, so that a foundation is laid for finally explaining the function of the orf00404 encoding gene in the wine coccus SD-2 a.

Orf00404 encoding gene function verification, specific experiments were as follows:

1. Construction of recombinant plasmids

(1) Genome extraction and primer synthesis

And (3) taking a small amount of the bacterial liquids of the Jiujiujiuzu SD-2a and the DEa3, streaking on a FT80 solid plate, standing and culturing at 30 ℃, picking a single colony for amplification culture after the colony grows out, and extracting genome DNA. The orf00404 primer and transformant-verifying primer sequences are shown in table 1:

TABLE 1

Note that: italic thickening sequence is pIB184 plasmid homologous arm sequence, which is used for seamless cloning

(2) PCR amplification of target Gene

And respectively carrying out PCR amplification by taking SD-2a and DEa3 genome DNA as templates, wherein a PCR reaction system is as follows: template 1. Mu.L, forward primer 1. Mu.L, reverse primer 1. Mu.L, high fidelity enzyme 12.5. Mu L, ddH ₂ O9.5. Mu.L, PCR amplification reaction conditions were as follows: pre-denaturation (94 ℃,30s, cycle 1), denaturation (98 ℃,10s, cycle 34), annealing (57 ℃,30s, cycle 34), extension (72 ℃,1min, cycle 34), final extension (72 ℃,2min, cycle 1). And (3) performing agarose gel electrophoresis on the PCR product, and comparing whether the amplified fragment meets the design length.

The electrophoresis results are shown in FIG. 1: the electrophoresis band is clear and single and has correct size, so that the PCR amplified product can be used for subsequent experiments.

(3) Purification of target Gene fragment

The amplified fragment of correct size was purified according to the instructions of the purification kit.

(4) Extraction of pIB184 plasmid

E.coli Top10 (containing pIB184 plasmid) was streaked onto LB plates containing erythromycin (final concentration 100. Mu.g/mL) to extract the plasmid.

(5) PIB184 double enzyme digestion

The pIB184 plasmid was digested with EcoRI and BamHI to give a linearized vector. The method is described with reference to EcoRI and BamHI specifications. The digested product was purified and frozen at-35℃after concentration measurement.

(6) Construction of recombinant plasmids

The recombinant plasmid construction procedure is shown in FIG. 2. Incubating for 30min at 37 ℃ by using a PCR instrument, and finally cooling to 4 ℃ to finish seamless cloning. The recombination reaction system is as follows: linearized vector Xμl, insert Y μl, 5 XCE II Buffer 4 μ L, exnase II 2 μ L, ddH ₂ O was added to 20 μl. The optimal cloning fragments were added according to Vazyme instructions.

The results of the double cleavage product validation are shown in FIG. 3: the electrophoresis band is clear and single, and the length of the enzyme digestion product is longer than that of the original pIB184 plasmid. The concentration was measured to be 102.0251 ng/. Mu.L after purification and less protein and RNA remained in the product. Thus, the linear vector can be used in subsequent recombination experiments.

(7) Preparation of E.coli Top10 competent cells

Preparation method of the competent cells of the coli Top10 is described in reference: liu Lu construction of enhanced Green fluorescent protein reporter System in lactococcus lactis NZ9000 [ J ]. Food and fermentation industries, 2020,46 (11): 46-5.

2. Recombinant product conversion

The method for transforming the recombinant product is shown in the instructions of Vazyme.

3. Verification of transformants

Single colony is selected as a template, and a reaction solution is added according to the following system, namely a PCR reaction system: template 1. Mu. L, pIB 184-BDYZ-F1. Mu. L, pIB 184-BDYZ-R1. Mu.L, 2X Accurate Taq Master Mix 12.5. Mu. L, ddH ₂ O was added to 25. Mu.L. Colony PCR was performed according to the following procedure, PCR reaction procedure: pre-denaturation (94 ℃,30s, cycle 1), denaturation (98 ℃,10s, cycle 34), annealing (57 ℃,30s, cycle 34), extension (72 ℃,1min, cycle 34), final extension (72 ℃,2min, cycle 1). After the PCR reaction procedure was completed, 2. Mu.L of the PCR product was subjected to 1% agarose gel electrophoresis at 100V for 30min. After electrophoresis, the size of the strip is observed through ultraviolet perspective by a gel imager. The plasmid was extracted from the transformants with correct sequence length alignment and sequenced. And finally, the sequences of the frozen genes are aligned with the correct plasmid.

The recombinant transformation verification results are shown in FIG. 4: the bands are clear and single, the sizes of the electrophoresis bands are compared according to the lengths of the target genes, and the sizes of the bands detected by lanes 2,3, 4, 5, 7, 8, 9 and 10 meet the lengths of the target bands, and the corresponding colonies are colonies which are successfully transferred into the recombinant plasmid.

Transformants with correct electrophoresis verification are cultured and preserved, and plasmids are extracted and sent to a company for sequencing after activation transfer. And comparing the gene sequences after sequencing, and determining the transformant with correct sequencing as a subsequent experimental material.

4. Recombinant plasmid transfer into Lactobacillus plantarum WCFS1

The recombinant plasmid constructed successfully and the pIB184 plasmid were respectively electrotransferred into competent cells of Lactobacillus plantarum WCFS1, the electrotransfer method was described in the following literature ：Teresa A M,Carmen R M,Mesas J M.Transformation of Lactobacillus plantarum by electroporation with in vitro modified plasmid DNA[J].Fems Microbiology Letters,2010,241(1):73-77. and then cultured on FT80 solid medium.

The results of the post-electrotransformation culture are shown in FIG. 5: the single colonies on the plates were conformed to the colony morphology of lactobacillus plantarum.

5. Verification of transformants

The transformant verification method is the same as the step 3: "verification transformant". Single colonies were picked for colony PCR experiments and colony PCR products were detected by 1% agarose gel electrophoresis.

The electrophoresis results are shown in fig. 6 and 7:

The electrophoresis band is clear and bright, no double peaks and no tailing exist, the length of the band accords with the length of the target gene, and the cultured transformant can be used for subsequent experiments. And (5) after the cultured transformant bacterial liquid grows to a turbid state, the transformant bacterial liquid is stored in a glycerol tube at the temperature of minus 35 ℃.

6. Recombinant tolerance test

(1) Acid stress tolerance test

The WCFS1 (pIB 184), WCFS1 (pIB 184-wild) and WCFS1 (pIB 184-mutant) strains were individually activated and inoculated in 1% amounts into MRS medium having pH values of 3.2, 3.4, 3.6, 3.8 and 4.0, respectively, OD _600nm values were measured every 12 hours at 37℃and growth curves were drawn. Analyzing the influence of orf00404 gene on lactobacillus plantarum acid stress tolerance, and selecting the culture condition with the largest difference between the growth condition of the recombinant strain and the growth condition of the control strain. The physical and chemical index measurement conditions are described in the following documents: zhao Wenying, li Hua, wang Hua. Effect of ethanol stress treatment on physiological properties of Brevibacterium SD-2a [ J ]. Microbiological notification 2011,38 (01): 51-56.

The growth curves of the strains under different acid stress conditions are shown in fig. 8:

In the acid stress environment with 5 different pH values, the growth speed of the recombinant strain is obviously faster than that of the control strain, the biomass of the recombinant strain in the logarithmic growth phase and the stationary growth phase is obviously higher than that of the control strain under the conditions of pH 3.2 and pH3.4, and the growth speed of the recombinant strain WCFS1 (pIB 184-mut) is slightly faster than that of the WCFS1 (pIB 184-wild), so that the recombinant strain has stronger acid stress resistance than that of the control strain under the conditions of pH 3.2 and pH3.4, and the acid stress resistance of the recombinant strain WCFS1 (pIB 184-mutnt) is better than that of the recombinant strain WCFS1 (pIB 184-wild). Under the conditions of pH 3.6, pH 3.8 and pH 4.0, the biomass of the recombinant strain and the biomass of the control strain are obviously higher than that of the pH 3.2 and pH3.4 acid stress conditions, the growth speed of the recombinant strain in the logarithmic growth phase is obviously faster than that of the control strain, and the biomass of the control strain gradually approaches to the recombinant strain or has no obvious difference from the control strain due to factors such as nutrient condition limitation of a culture medium after entering a stabilization period. The growth curve measurement results show that the growth performance of the recombinant strain under the acid stress condition is superior to that of the control strain.

(2) Determination of physicochemical Properties

A. Intracellular pH

Intracellular pH is a fundamental parameter of the intracellular environment and plays an important role in maintaining various enzymatic reactions within the cell. Intracellular pH and extracellular pH stability are also an important mechanism for Lactobacillus plantarum to resist acid stress. The determination of the pH standard curve and the determination and calculation of the intracellular pH of the sample group are described in the following documents: zhang Mengru Effect of DNA repair protein RecO and leucine metabolism on various stress resistances of lactic acid bacteria [ D ]. University of Jiangnan, 2014.

The standard curve of intracellular pH value is drawn by lactobacillus plantarum WCFS1 containing empty vector, as shown in figure 9, the square value of R is 0.9943, and the result shows that the standard curve has good linear relation and can be used for measuring the intracellular pH value of the subsequent recombinant strain and the control strain.

The results of the measurement of the intracellular pH values of the recombinant strain and the control strain in different time periods are shown in FIG. 10, and the intracellular pH values of the recombinant strain and the control strain are reduced after the acid stress treatment and subjected to fluctuation, wherein the intracellular pH of the recombinant strain WCFS1 (pIB 184-mutant) is stabilized at 6.62, the intracellular pH of the recombinant strain WCFS1 (pIB 184-wild) is stabilized at 6.47, and the intracellular pH value of the control strain is stabilized at 6.42. By comparison, the intracellular pH value of the recombinant strain is not significantly different from that of the control strain after acid stress treatment for 108 hours, but the intracellular pH is reduced in an amplitude (compared with 0 hour) after the acid stress treatment of the recombinant strain for 108 hours, which is lower than that of the control strain. After the acid stress treatment, the extracellular pH values of the recombinant strain and the control strain gradually decreased, the extracellular pH of the recombinant strain WCFS1 (pIB 184-mutant) decreased to 3.58, the extracellular pH of the recombinant strain WCFS1 (pIB 184-wild) decreased to 3.65, and the control strain decreased to 3.79. Unlike the intracellular pH, the extracellular pH of the recombinant strain was decreased more than that of the control strain, and it was found that the recombinant strain grew better than the control strain in the case that the extracellular pH was decreased more than that of the control group in combination with the experimental results of FIG. 8, which indicated that the acid resistance of the recombinant strain was better than that of the control strain.

B. Cell membrane fluidity

The cell membrane is the first barrier of bacteria against the environment of the cell's external stress, and acid stress culture promotes cell membrane hardening. After acid stress treatment of the strain for different periods of time, the cell membrane mobility of the cells is indicated by the measured fluorescence intensity ratio Ka using the embedded dinaphthyl as a cell membrane probe, and a larger ratio indicates a poorer mobility. Cell membrane fluidity was adjusted to OD _600nm =0.6 (cell collection time was the same as in step a) above), and the following was referred to: wu Chongde physiological mechanism analysis of Lactobacillus casei against acid stress [ D ]. University of Jiangnan 2012.

The cell membrane fluidity results of the recombinant strain and the control strain are shown in figure 11, and after the recombinant strain and the control strain are subjected to acid stress treatment for 60 hours, the Ka values measured by the recombinant strain and the control strain are remarkably increased compared with 0 hour, which indicates that the cell membrane is hardened and the cell membrane fluidity is reduced due to the fact that the cell body is resistant to the external acidic environment in the stage. The measured Ka value of the acid stress treatment for 72h is obviously reduced compared with 60h, and the Ka value of each strain cultivated for 108h by acid stress is obviously increased. The Ka values of the recombinant strain are smaller than those of the control strain when the recombinant strain is subjected to acid stress treatment for 72h and 108h, which shows that the cell membrane mobility of the recombinant strain is better than that of the control strain at the two time points, and the cell membrane mobility of the recombinant strain WCFS1 (pIB 184-wild) is better than that of the recombinant strain WCFS1 (pIB 184-mut) when the recombinant strain is subjected to acid stress treatment for 72h and 108h (P is less than 0.05).

C. cell membrane permeability

Lactobacillus plantarum also contains beta-D-galactosidase in the cell, which permeates out of the cell when the permeability of the intracellular membrane increases to a certain level. The substrate of beta-D-galactosidase is pNPG, which has an absorption peak at a wavelength of 420nm, so that the permeability change of the intracellular membrane can be expressed according to the absorption value of the treated cells at 420 nm.

Cells were collected by centrifugation (3000 rpm,15 min) and resuspended in 10mmol/L phosphate buffer (pH 7.4) and OD _600nm was adjusted to 1 (cell collection time was the same as in step a) above), 10. Mu.L of 5mmol/L pNPG was added, and the mixture was treated at 37℃and read at 420nm after 2 hours.

The test results are shown in FIG. 12:

The permeability of the cell membrane is obviously reduced when the acid stress treatment is carried out for 60 hours; after the strain is adapted to acid stress for a period of time, the tolerance is enhanced, the permeability of the cell membrane is obviously increased at 72 hours, and the permeability of the cell membrane is obviously reduced at 108 hours along with the extension of the acid stress treatment time. The cell membrane permeability of the recombinant strain is higher than that of the control strain when the recombinant strain is subjected to acid stress treatment for 60 hours and 72 hours.

D. Cell membrane integrity

Acid stress treatment affects the cell membrane integrity of the strain, and PI probes stain only cells with damaged cell membranes, and a higher measured fluorescence value indicates poorer cell membrane integrity. The cells were collected by centrifugation (the cell collection time was the same as in step a). Sample group cell membrane integrity assays are described in the following references:da Silveira M,Vitória SanM,Loureiro-Dias Maria C,Rombouts Frans M,Abee T.Flow cytometric assessment of membrane integrity of ethanol-stressed Oenococcus oeni cells[J].Applied and environmental microbiology,2002,68:6087-6093.

The test results are shown in fig. 13:

The cell membrane integrity of the recombinant strain which is not subjected to acid stress treatment at 0h is not significantly different from that of the control strain (P > 0.05); when the recombinant strain is subjected to acid stress for 60 hours, the cell membrane integrity of the recombinant strain and the control strain is reduced to the minimum, and the cell membrane integrity of each strain is gradually recovered along with the extension of the acid stress treatment time. The cell membrane integrity of the recombinant strain was better than the control strain at both acid stress treatments for 60h and 72 h. However, at 108h of stress treatment, the recombinant strain WCFS1 (pIB 184-mutant) had lower cell membrane integrity than the other two strains (P < 0.05).

E. determination of intracellular protein concentration

The intracellular protein concentration of the strain is mainly used to assist in the expression of intracellular ATP content. After the cells were collected by low-temperature centrifugation, the cells were washed with PBS (pH 7.0) and resuspended (cell collection time was the same as in step a) above), and the cells were sonicated to collect the supernatant. Ultrasonic conditions: 40% power, 20min, 5s on duty, 5s off. The determination method is carried out according to the instructions of Solarbio BCA protein concentration determination kit.

The intracellular protein content calibration curve is shown in fig. 14, and the square value of R is 0.99937, which shows that the standard curve has a better linear relationship and can be used for subsequent experiments.

Intracellular protein content results of recombinant strain and control strain as shown in fig. 15, the intracellular protein content was maintained at a higher level and the recombinant strain WCFS1 (pIB 184-mutant) was not significantly different from the control strain (P > 0.05) when the recombinant strain and the control strain were not subjected to acid stress treatment; at 60h after the acid stress treatment, no significant up-down regulation of the control strain occurred, but the intracellular protein content of recombinant strain WCFS1 (pIB 184-mutant) was significantly increased, and the intracellular protein content of recombinant strain WCFS1 (pIB 184-wild) was significantly decreased. After 72h of acid stress treatment, the intracellular protein content of the recombinant strain and the intracellular protein content of the control strain are obviously reduced. At 108h of acid stress, the intracellular protein content of the recombinant strain was increased compared to that of the control strain at 72 h. The recombinant strain has a significant difference in protein content (P < 0.05) from the control strain during the three periods of acid stress treatment, while the intracellular protein content of the recombinant strain is significantly higher than that of the control strain (P < 0.05) during the later periods of acid stress treatment (72 h and 108 h).

F. Intracellular ATP content assay

Under the acid stress environment, protons in cells are gradually consumed and discharged, and proton gradient-driven transmembrane electromotive force is gradually formed inside and outside the cell membrane of the strain, so that ATPase on the cell membrane of the strain is driven to synthesize ATP, and energy necessary for survival of the cells of the strain is provided.

The cells are crushed by ultrasonic, the cell collection time is the same as in the step a, the crushing condition is the same as in the step e, and the measuring method is referred to Solarbio ATP content detection kit instruction.

The test results are shown in fig. 16:

Intracellular ATP was at a higher level prior to acid stress treatment for both the recombinant strain and the control strain, but there was no significant difference between recombinant strain WCFS1 (pIB 184-wild) and the control strain. After 60h of acid stress treatment, the intracellular ATP content of the recombinant strain and the intracellular ATP content of the control strain are obviously reduced, and after the acid stress treatment, the intracellular ATP content of the recombinant strain and the intracellular ATP content of the control strain are obviously different (P is less than 0.05), and at the same time, the intracellular ATP content of the control strain is obviously reduced more than that of the two recombinant strains. As the strains adapt to acid stress treatment, intracellular ATP content of each strain gradually recovers or increases. Under acid stress treatment, intracellular ATP content of the recombinant strain is significantly higher than that of the control strain (P < 0.05), and intracellular ATP content of the recombinant strain WCFS1 (pIB 184-mutant) is significantly higher than that of the recombinant strain WCFS1 (pIB 184-wild) (P < 0.05). This indicates that the intracellular ATP synthesis capacity of the recombinant strain is stronger than that of the control strain under acid stress conditions.

G. Determination of consumption of malic acid and production amount of lactic acid

And (3) centrifuging the bacterial liquid at 2mL at the temperature of 4 ℃ for 2min at the time of 0h, 60h, 72h and 108h for 12000r/min, taking supernatant, and detecting the content of malic acid and lactic acid by adopting a high performance liquid chromatography.

The conditions of high performance liquid chromatography are described in the following references: mo Runming analysis of change of characteristic organic acid during aging of Chen-Xiang Tie Guanyin [ J ]. Food research and development, 2021,42 (20): 21-27. The method is slightly adjusted: the aqueous phase was changed to 99% ultrapure water (pH 2.5, pH was adjusted with perchloric acid), and the column temperature was set to 55 ℃.

The test results are shown in fig. 17:

Along with the continuous extension of the acid stress time, the malic acid content in the culture medium of the recombinant strain and the control strain is in a decreasing trend. As can be seen from comparison of the malic acid content of the culture medium of each strain at 0h, 60h, 72h and 108h, the recombinant strain WCFS1 (pIB 184-wild) and WCFS1 (pIB 184-mutant) have higher malic acid degradation capacity than the control strain, and the malic acid content of the recombinant strain at 108h is 42.358% and 86.145% of the control strain respectively. In contrast, the change rule of the lactic acid content in the culture medium of the recombinant strain and the culture medium of the control strain is opposite to that of malic acid, and the lactic acid content in the culture medium gradually increases along with the extension of the culture time, and the lactic acid content in the culture medium of the recombinant strain is obviously higher than that of the control strain when the recombinant strain is cultured for 108 h. The data show that the lactic acid fermentation activity of the recombinant strain malic acid under the acid stress condition is obviously stronger than that of the control strain.

In conclusion, according to the results of the acid stress tolerance measurement of the recombinant strain and the control strain, the growth performance of the recombinant strain under the acid stress condition is superior to that of the control strain, which indicates that the heterologous expression transcription regulatory factor orf00404 gene can improve the acid stress tolerance performance of lactobacillus plantarum. It also shows that orf00404 gene can regulate acid resistance of strain.

The wine coccus is used as one of the strains for starting the fermentation process of the wine malic acid, and the degradation capability of the malic acid and the lactic acid production are key indexes for evaluating the fermentation performance of the wine coccus. The functional development of orf00404 gene is beneficial to improving the fermentation performance of the wine coccus in the fermentation of the wine malic acid, thereby further improving the quality of the wine and having important application prospect.

The above description is only a preferred embodiment of the present invention, and is not intended to limit the invention in any way, and any person skilled in the art may make modifications or alterations to the disclosed technical content to the equivalent embodiments. However, any simple modification, equivalent variation and variation of the above embodiments according to the technical substance of the present invention still fall within the protection scope of the technical solution of the present invention.

Claims (9)

1. A response transcription regulator gene is characterized in that the nucleic acid sequence is shown in SEQ ID NO. 1.

2. A mutant form of a gene responsive to a transcription regulator as claimed in claim 1, wherein the nucleic acid sequence of the mutant gene is shown in SEQ ID NO. 2.

3. A recombinant expression vector, expression cassette, transgenic cell line, recombinant bacterium or recombinant virus comprising the gene of claim 1 or 2.

4. Use of the gene according to claim 1 or 2 for improving acid resistance of a strain.

5. The use according to claim 4, wherein the bacterial species is selected from the group consisting of oenococcus or lactobacillus plantarum.

6. A method for improving acid resistance of a strain, comprising constructing the gene of claim 1 or 2 into an expression vector to form a recombinant expression vector, transforming the recombinant expression vector into a strain to obtain a recombinant strain containing the gene of claim 1 or 2, and finally improving acid resistance of the strain by expressing the gene of claim 1 or 2.

7. The method of claim 6, wherein the expression vector is selected from the group consisting of E.coli pIB184 plasmid.

8. Use of a gene according to claim 1 or 2 for improving the fermentation quality of wine dominated by kefir in a malic acid fermentation process.

9. Use according to claim 8, characterized in that the oenococcus is transformed with an exogenous gene according to claim 1 or 2.