CN117925604A

CN117925604A - Bubble linker sequences and uses thereof

Info

Publication number: CN117925604A
Application number: CN202410088374.7A
Authority: CN
Inventors: 胡玉刚; 曲燕; 李彤
Original assignee: Naonda Nanjing Biological Technology Co ltd
Current assignee: Naonda Nanjing Biological Technology Co ltd
Priority date: 2024-01-22
Filing date: 2024-01-22
Publication date: 2024-04-26

Abstract

The application provides a bubble-shaped joint sequence and application thereof. Wherein the bubble-shaped joint element comprises a bubble-shaped structure region formed by annealing the first strand and the second strand, and a first complementary region and a second complementary region positioned at two sides of the bubble-shaped structure; wherein the sequence linked to the bubble structure in the two sequences in the second complementing structure region is a companion sequence, and the sequence complementary to the companion sequence in the second complementing structure region is capable of being fully complementary to the 5' library tag sequence. The application can improve the full-length library ratio and library quantity in the constructed product when the DNA library is constructed, thereby improving the template utilization rate in the DNA library construction process, increasing the template richness, improving the sequencing accuracy and reducing the sequencing cost.

Description

Bubble linker sequences and uses thereof

Technical Field

The invention relates to the technical field of gene sequencing, in particular to a bubble-shaped joint sequence and application thereof.

Background

Along with the increasing importance of the second generation sequencing in the fields of scientific research and diagnosis, the promotion of each link of the second generation sequencing is very important, and the sequencing cost is very low and 10 yuan/g of data can be realized in the optimization of a sequencing chip and a sequencing reagent at present. At present, two key factors influencing detection accuracy, namely sequencing quality and library transformation efficiency, are important factors for improving detection accuracy and accuracy in a future period of time.

Currently, when a mainstream second-generation sequencer is used for constructing a library, an Illumina sequencer adopts a Y-type connector, and a universal connector is used for effectively constructing the library for a target fragment. The MGI sequencer adopts a bubble-shaped universal joint, as shown in 1.1A, 1.1B, 1.2A and 1.2B in figure 1, the application aims to provide a technical scheme for optimizing the bubble-shaped joint, constructing a library by utilizing the optimized bubble-shaped joint and improving the yield of the library, and has a certain significance for improving the utilization rate of the bubble-shaped joint.

Disclosure of Invention

The invention mainly aims to provide a bubble-shaped joint sequence and application thereof, which are used for solving the problem of low library yield when library construction is carried out by utilizing bubble-shaped joints in the prior art.

In order to achieve the above object, according to a first aspect of the present invention, there is provided a bubble-shaped joint element comprising a bubble-shaped structure region formed by annealing a first strand and a second strand, and first and second complementary regions located on both sides of the bubble-shaped structure; wherein the 3 'end of the first strand has a protruding base T, the 3' end of the second strand has 2-4 protruding bases, and the protruding base T is positioned at one end of the first complementary region far away from the bubble structure region, and the 2-4 protruding bases are positioned at one end of the second complementary region far away from the bubble structure region; the longer of the first and second chains forms a bubble in the bubble region; the sequence of the two sequences in the second complementing structure region which is connected with the bubble structure is a companion sequence, and the sequence of the second complementing structure region which is complementary with the companion sequence can be completely complementary with the 5' end library tag sequence.

Further, the above-mentioned chaperone sequence is optionally linked to the bubble structure via a U base; preferably, the length of the companion sequence is 8-14bp.

Further, the length of the first complementary region is 6-10bp; preferably, the length of the second complementary region is 8-14bp; preferably, the sequence of the bubble linker element is shown in SEQ ID NOs 1-5.

In order to achieve the above object, according to a second aspect of the present invention, there is provided a kit comprising the above-mentioned bubble-cap-element.

Further, the kit further comprises: enzyme, DNA ligase and DNA ligation reaction buffer for removing U base; preferably, the enzyme that removes the U base is selected from one or more of the following: uracil-DNA glycosylase, APE1, endoIII and EndoVIII.

Further, the working concentration of the above-mentioned bubble-cap element is 5 to 25. Mu.M.

In order to achieve the above object, according to a third aspect of the present invention, there is provided a method of constructing a sequencing library, the method comprising: connecting the bubble-shaped joint element or the bubble-shaped joint element in the kit with the DNA fragment to be connected to obtain a joint connection fragment; and carrying out PCR amplification on the adaptor-ligated fragments to obtain a sequencing library.

Further, when the partner sequence in the bubble linker element is linked to the bubble structure by a U base, removing the partner sequence in the bubble linker element with an enzyme that removes the U base after the linker connecting fragment is obtained and before PCR amplification is performed; preferably, the initial amount of adaptor-ligated fragments subjected to PCR amplification is 1-500ng; preferably, the number of cycles for performing PCR amplification is 3-10.

Further, the above enzyme for removing U bases is selected from one or more of the following: uracil-DNA glycosylase, APE1, endoIII and EndoVIII.

In order to achieve the above object, according to a fourth aspect of the present invention, there is provided a sequencing library constructed by the above method.

By applying the technical scheme of the application, the sequence which is completely complementary with the tag sequence constructed by the library exists in the second complementary structure region in the bubble-shaped joint element, so that the ratio and the library quantity of the full-length library (namely the full-length library of the fragment to be detected and the tag sequence) in the constructed product can be improved when DNA library construction is carried out, the template utilization rate in the DNA library construction process is further improved, the template richness is increased, the sequencing accuracy is improved, and the sequencing cost is reduced.

Drawings

The accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification, illustrate embodiments of the application and together with the description serve to explain the application. In the drawings:

FIG. 1 shows a schematic view of various types of bubble joints;

FIG. 2 shows a schematic flow diagram of library construction using Y-junctions;

FIG. 3 shows a schematic diagram of a library-building procedure when the sequence complementary to the companion sequence is not complementary to the 5' library tag sequence;

FIG. 4 shows a schematic diagram of a library-building procedure when the sequence complementary to the companion sequence is capable of being fully complementary to the 5' library tag sequence;

FIG. 5 shows a schematic diagram of a library construction procedure when the sequence complementary to the companion sequence is fully complementary to the 5' library tag sequence and there is a U base at the junction of the companion sequence and the bubble;

FIG. 6 shows a data plot of library yields for different types of linkers.

Detailed Description

It should be noted that, without conflict, the embodiments of the present application and features of the embodiments may be combined with each other. The present application will be described in detail with reference to examples.

Term interpretation:

Y-type joint: the two sequences forming the linker are completely paired at one end and not completely paired at the other end, the 3 'end of one strand protrudes by T at the completely paired end, and the 5' end of the other strand is phosphorylated at the completely paired end, thus facilitating construction of a library by TA ligation, and both the positive and negative strands of the constructed DNA fragment are constructed as a library, thus also ensuring measurement of methylation signals, and the specific ligation process is shown in FIG. 2.

Bubble joint: the sequence constituting the linker is also composed of two sequences, the two ends of which are completely complementary, and a non-complementary sequence in the middle, wherein the 3 '-end of one strand for ligating the complementary ends of the DNA fragments protrudes by T, and the 5' -end of the other strand of the complementary ends has a phosphorylation modification; the sequence of the bubble-linked partner, which is distal from the complementary end of the ligated DNA fragment and which is linked to the bubble, is used to assist in stabilizing the linker, and is removed later and is not present in the complete library.

We have found that library construction using existing conventional bubble-shaped linkers (1.1A, 1.1B and 1.2A, 1.2B as shown in FIG. 1) has certain drawbacks, such as the blunt-ended bubble-shaped linkers of 1.1A and 1.1B as shown in FIG. 1, which are due to the presence of self-ligations of the linkers. When the terminal is blunt, the situation that the terminal T is not synthesized or two continuous linkers are connected to one terminal of a fragment after the T base is cut off by exonuclease during the synthesis of the linker can affect the sequencing quality, and as can be seen from specific sequencing data, the defect that two linkers are connected continuously is caused by the bubble-shaped linker with the blunt terminal, so that the sequencing quality of read2 is reduced.

Further, in order to avoid self-ligation by blunt ends of the bubble-shaped linker, the bubble-shaped linker structure in which the 5 '-ends of 1.2A and 1.2B are protruded as shown in FIG. 1 is also present in the conventional bubble-shaped linker, and the variation is that a sequence of 3 bases is added to the 5' -end of one end of the non-ligated DNA fragment. However, it was found by our study that in the case of a high input amount of low amplification cycles (initial amount of adaptor-ligated fragment for PCR amplification is 1-500ng; the number of cycles for PCR amplification is 3-10), the yield of the resulting library was low because the other strand of the vesicle-like adaptor shown in 1.2A and 1.2B, which matches the chaperone sequence, was not complementary to the tag sequence (as shown in FIG. 3). Analysis of this phenomenon has found that the reason for the lower library yields is that the full length library in the library products obtained using the above-described linkers (1.2A, 1.2B as shown in FIG. 1) is relatively low. In addition, as the 5' -end of 1.2A is protruding to the end of the accompanying sequence, the bubble-shaped joint can be extended under the action of the amplifying enzyme, the extended fragment prolongs the incomplete complementary sequence length of the amplified primer of the label, the generation speed of the full-length library is delayed, and compared with the full-length library obtained by the joint shown in 1.2B, the ratio of the full-length library obtained by the joint is lower.

Thus, to further increase library yield, avoiding the adverse effect of sequences in the bubble linker that do not match the tag sequence on the full-length library construction, the present application provides a bubble linker that can increase the full-length library duty cycle and library yield in the product of library construction.

In a first exemplary embodiment of the present application, a bubble-type joint element is provided, and referring to the structure shown in fig. 1.3A and 1.3B, the bubble-type joint element includes bubble-type structure regions formed by annealing a first strand and a second strand, and first and second complementary regions located on both sides of the bubble-type structure; wherein the 3 'end of the first strand has a protruding base T, the 3' end of the second strand has 2-4 protruding bases, and the protruding base T is positioned at one end of the first complementary region far away from the bubble structure region, and the 2-4 protruding bases are positioned at one end of the second complementary region far away from the bubble structure region; the longer of the first and second chains forms a bubble in the bubble region; the sequence of the two sequences in the second complementing structure region which is connected with the bubble structure is a companion sequence, and the sequence of the second complementing structure region which is complementary with the companion sequence can be completely complementary with the 5' end library tag sequence.

Wherein the 5 'end library tag sequence is a tag sequence of a library fragment amplified to obtain the 5' end when constructing the library.

As shown in 1.3A and 1.3B in figure 1, the 3 'end of the second complementary structure region is provided with a protruding sequence, and the sequence matched with the accompanying sequence in the second complementary structure region is completely complementary with the 5' end library tag sequence, so that the tag sequence can be completely matched with the second complementary structure region in the process of carrying out PCR amplification on the first strand obtained by connecting the adaptor with the DNA fragment to be connected (as shown in figure 4), and the occupation ratio of the full-length library in the amplified product can be improved under the condition of low cycle number, and the library yield is improved. However, the 5 'end of the first strand obtained by synthesis has a partner sequence which is not matched with the tag sequence, so that the full-length library obtained by synthesis through twice amplification still has a certain obstruction, but the ratio and the yield of the full-length library in the library obtained by library construction are greatly improved compared with the prior bubble sequence (the sequence matched with the partner sequence is not complementary with the tag sequence of the 5' end library).

To further increase the duty cycle and yield of the full-length library in the library obtained by pooling, in a preferred embodiment, the chaperone sequence is linked to the vesicular structure optionally via a U base; preferably, the length of the companion sequence is 8-14bp. As shown in FIGS. 1.4A and 1.4B, the 3' -end of the second complementary structural region has a protruding sequence, and the sequence of the second complementary structural region that matches the companion sequence is completely complementary to the tag sequence, and the companion sequence is linked to the bubble structure in the bubble structural region by a U base.

After the above-mentioned linker element is ligated to the DNA fragment to be ligated, the U base can be excised before the first strand is amplified by PCR, so that the accompanying sequence in the ligated DNA fragment is completely removed. Furthermore, in the subsequent PCR amplification stage, the tag sequence can be completely matched with the second complementary structure region to obtain a first strand, and then when the first strand is used as a template for secondary amplification, the tag sequence can be completely matched with the bubble structure due to excision of the companion sequence, and a full-length library can be obtained through the secondary amplification (as shown in FIG. 5). It can be seen that the full-length library obtained by library construction using this type of bubble linker has a similar duty cycle and yield to those obtained by using Y-type linker (as shown in FIG. 6), solving the drawbacks of bubble linker in library construction.

To further enhance the efficiency of the ligation of the bubble linker element, in a preferred embodiment the length of the first complementary region is 6-10bp; preferably, the length of the second complementary region is 8-14bp. Preferably, the sequence of the bubble linker element is shown in SEQ ID NOs 1-5.

SEQ ID NO. 1: /phos/AGTCGGAGGCCAAGCGGTCTTAGGAAGACAA, wherein/phos/stands for phosphorylation.

SEQ ID NO. 2: TCTTCCTAAGACCGCACAGAACGACATGGCTACGATCCGACT T wherein x represents a thio modification.

SEQ ID NO. 3: TCTTCCTAAGACCG/rU/CACAGAACGACATGGCTACGATCCGACT, wherein/rU/represents a U base, wherein represents a thio modification.

SEQ ID NO. 4: phos/AGTCGGAGGCCAAGCGGTCTTAGGAAGA/rU/CATGTCGTTCTGTGCCT, wherein/phos/stands for phosphorylation, wherein/rU/stands for U base.

SEQ ID NO. 5: CACAGAACGACATGGCTACGATCCGACT T wherein x represents a thio modification.

In a second exemplary embodiment of the application, a kit is provided, the kit comprising a bubble-cap element as described above. The kit with the bubble-shaped joint element can improve the duty ratio of the full-length library in the library-building product under the condition of high input and low amplification cycle number, and only the full-length library can be cyclized due to the fact that the on-machine sequencing on the MGI sequencer is needed to cyclize, so that the efficiency and the accuracy in the subsequent sequencing stage are further improved, and the sequencing cost is reduced.

To further facilitate the adaptor ligation reaction, in a preferred embodiment, the kit further comprises: enzyme, DNA ligase and DNA ligation reaction buffer for removing U base; preferably, the enzyme that removes the U base is selected from one or more of the following: uracil-DNA glycosylase, APE1, endoIII and EndoVIII.

To further efficiently complete the ligation reaction, in a preferred embodiment, the working concentration of the bubble linker element is 5-25. Mu.M.

In a third exemplary embodiment of the present application, there is provided a method of constructing a sequencing library, the method comprising: connecting the bubble-shaped joint element or the bubble-shaped joint element in the kit with the DNA fragment to be connected to obtain a joint connection fragment; and carrying out PCR amplification on the adaptor-ligated fragments to obtain a sequencing library. The use of the above-mentioned bubble-shaped linker element can increase the ratio of the full-length library in the library-building product under the condition of high input and low amplification cycle number, and because cyclization is required for on-machine sequencing on the MGI sequencer, only the full-length library can be cyclized, and both chains in the linker fragment obtained by the bubble-shaped linker element can be cyclized, thereby obtaining effective MGI sequencing results. Thus, the application can be used for constructing the library, and the probability of detecting the low-frequency mutation possibly existing in the library is increased due to the increase of the full-length library ratio, so that the efficiency and the accuracy in the sequencing stage are further improved, and the sequencing cost is reduced.

In a preferred embodiment, when the partner sequence in the bubble linker element is linked to the bubble structure by a U base, the partner sequence in the bubble linker element is removed with an enzyme that removes the U base after the linker fragment is obtained and before PCR amplification.

The bubble-shaped joint element can effectively improve library yield obtained by library establishment and improve the full-length library ratio under the condition of high input and low amplification cycle number. In a preferred embodiment, the initial amount of adaptor-ligated fragments subjected to PCR amplification is 1-500ng; preferably, it is 10-500ng; specifically, the initial amount is 1ng, 10ng, 25ng, 50ng, 100ng, 250ng, 500ng; preferably, the number of cycles for performing PCR amplification is 3-10 times; the number of cycles is specifically 3, 4, 5, 6, 7, 9.

Any enzyme capable of cleaving a companion sequence with a U base as the cleavage site is suitable for use in the present application, and in a preferred embodiment, the enzyme that removes the U base is selected from one or more of the following: uracil-DNA glycosylase, APE1, endoIII and EndoVIII.

In a fourth exemplary embodiment of the present application, there is provided a sequencing library comprising: the resulting sequencing library will be constructed using the methods described above. Because the full-length library proportion and library yield in the library-building product obtained by utilizing the bubble-shaped joint element are improved, the sequencing efficiency and accuracy of the sequencing library are further improved, and the sequencing cost is reduced.

The application is described in further detail below in connection with specific examples which are not to be construed as limiting the scope of the application as claimed.

Example 1 pooling with a bubble linker that does not have U, but is capable of being fully complementary to the 5' library tag sequence

The sample was human genomic DNA (Promega, G1471) which was higher in quality than the DNA sample of the actual application as the starting DNA for the experiment.

The used connection joint is formed by annealing SEQ ID NO. 1 and SEQ ID NO. 2, mixing two primers with equal mole, incubating for 2min at a high temperature of 95 ℃, and slowly cooling to 20 ℃ to form the joint.

One feature of this scheme is that SEQ ID NO. 1 and the tag sequence are fully complementary upon amplification, which would make use of amplification. The tag sequences used in the embodiment of the application are shown as SEQ ID NO. 7 and SEQ ID NO. 8, and the structure and the library construction process are shown as figure 4.

Tag sequence 1 (SEQ ID NO: 7): /phos/CTCTCAGTACGTCAGCAGTTCGTCGTGTTACAACTCCTTGGCTCACAGAACGACAT GGCTACGA.

Tag sequence 2 (SEQ ID NO: 8): GCATGGCGACCTTATCAGGTCATCGACGTTGTCTTCCTAAGACCGCTTGGCC.

The specific experimental steps are as follows: for manipulating reagentsDNA Universal library construction kit (for MGI), cat#: #1002211.

Step one: end repair & addition A

1. Taking END REPAIR A-Tailing Buffer and END REPAIR A-Tailing Enzyme out, placing on ice, naturally melting, mixing uniformly, and centrifuging instantly for standby.

2. The reaction system formulation was carried out in a 0.2ml PCR tube placed on ice according to table 1 below:

Table 1:

3. Mixing uniformly, and instantaneous centrifuging to make all the reaction liquid be placed at the bottom of PCR tube.

4. The reaction procedure shown in table 2 below was started on the PCR instrument and the reaction tube was placed into the PCR instrument with isothermal stabilization to 20 ℃):

table 2:

Temperature (temperature)	Time of
		20℃	30min
65℃	30min
		10℃	Hold

Step three: joint connection

1. Taking out the Ligation Buffer and DNA LIGASE, naturally melting on ice, uniformly mixing, and performing instantaneous centrifugation for later use.

2. The second PCR reaction tube was taken out from the PCR apparatus, placed on ice, and subjected to adaptor ligation according to the system shown in Table 3.

Table 3:

Reagent(s)	Dosage of
		Step one reaction product	50μl
SEQ ID NO.1 anneals to SEQ ID NO.2 to form (15. Mu.M)	2μl
		Ligation Buffer	26μl
DNA Ligase	2μl
		Totals to	80μl

4. The reaction procedure of the following table 4 was started on the PCR instrument and the reaction tube was placed into the PCR instrument with isothermal stabilization to 20 ℃):

Table 4:

Step four: magnetic bead purification

1. The NanoPrep ^TM SP loads are taken out in advance and are uniformly mixed by vortex, and the mixture is used after being balanced for 30 minutes at room temperature.

2. And (3) adding 40 μl of NanoPrep ^TM SP Beads into the PCR tube of the third connection system, uniformly mixing, and incubating for 5-10 min at 25 ℃.

3. The PCR tube was centrifuged instantaneously and placed on a magnetic rack for 5min until the liquid was completely clarified, and the supernatant was pipetted off using a pipette.

4. 150 Μl of 80% ethanol was slowly added along the side wall of the PCR tube, taking care not to disturb the magnetic beads, standing for 30s, and pipetting the pipetted supernatant.

5. The step 4 is repeated once.

6. The PCR tube was centrifuged instantaneously and placed on a magnetic rack, and a small amount of residual ethanol was removed using a 10. Mu.l tip, taking care not to suck onto the magnetic beads.

7. The PCR tube cap was opened and allowed to stand at room temperature for about 5min until ethanol was completely volatilized.

8. The PCR tube was removed, 21. Mu.l of Nuclease FREE WATER was added to the PCR tube, and the beads were suspended uniformly and incubated at 25℃for 2min.

9. The PCR tubes were centrifuged transiently and placed on a magnetic rack for 2min until the liquid was completely clear, 20. Mu.l of supernatant was pipetted using a pipette and transferred to 1 new 0.2ml PCR tube and placed on ice for use.

Library construction is performed by using the DNA fragments obtained by the ligation, on-machine sequencing is performed on the obtained sequencing library, and the sequencing related effect data are detected, wherein the Qubit detection can detect all double-stranded DNA, qpcr can only detect a full-length library, an incomplete library cannot be amplified and detected due to the fact that the primer has no binding site, and related data are shown in the following table 5:

Table 5:

Example 2 construction of a pool of bubble-shaped linkers using sequences with U and complementary to the chaperone sequences that are fully complementary to the 5' library tag sequences

This example is identical to example 1, except that a U base is added between the companion sequence and the linker.

The used connection joint is formed by annealing SEQ ID NO. 1 and SEQ ID NO.3, mixing two primers with equal mole, incubating for 2min at a high temperature of 95 ℃, and slowly cooling to 20 ℃ to form the joint.

SEQ ID NO. 3: TCTTCCTAAGACCG/rU/CACAGAACGACATGGCTACGATCCGACT, wherein/rU/represents a U base, wherein x represents a thio modification, such as the structure and library building process shown in FIG. 5.

The experimental procedure of example 2 was identical to the procedure of example 1, the only difference being that cleavage of the companion sequence was required after the ligation in step three, the enzyme used was uracil-DNA glycosylase, APE1, endoIII and EndoVIII, or a combination of two or more enzymes, the total amount of enzyme added to the system after ligation was 1. Mu.l, and the subsequent procedure was performed after 15 minutes of reaction.

As shown in the following Table 6, it can be seen that the application uses the bubble-shaped joints shown as 1.4A and 1.4B in FIG. 1 to build a library, and at the X joint, a higher full-length library ratio can be obtained, and more full-length libraries are beneficial to sequencing after MGI cyclization, so that the conversion efficiency of the library is high, and the accuracy and economy of detection are improved.

Table 6:

Example 3 construction of a library Using a bubble linker with U and sequence complementary to the companion sequence that is fully complementary to the 5' library tag sequence

This example is identical to example 2 in that there are U bases between the companion sequence and the bubble structure, the only difference being that the companion sequence of example 3 and example 2 are not on one strand, i.e., the bubble is in the opposite direction.

The used connection joint is formed by annealing SEQ ID NO.4 and SEQ ID NO. 5, mixing two primers with equal mole, incubating for 2min at a high temperature of 95 ℃, and slowly cooling to 20 ℃ to form the joint.

Sequencing results of the sequencing library obtained by the ligation fragment of example 3 are shown in Table 7 below: it can be seen that the full length library obtained using the bubble linker sequences of this example is greater than 90%.

Table 7:

comparative example 1 warehouse building Using common bubble joints

This comparative example 1 was identical to the procedure of example 1, with the only difference that the linker used in this comparative example 1 was a conventional bubble-shaped linker. The used connection joint is formed by annealing SEQ ID NO. 6 and SEQ ID NO. 2, mixing two primers with equal mole, incubating for 2min at a high temperature of 95 ℃, and slowly cooling to 20 ℃ to form the joint.

SEQ ID NO. 6: /phos/AGTCGGAGGCCAAGCGGTCTTAGGAAGAGTT, wherein/phos/stands for phosphorylation. Such as the structure and banking process shown in fig. 3.

As shown in the following Table 8, it can be seen that the library is built by using the ordinary bubble-shaped linker, and that the full-length library in the obtained sequencing library is relatively low under the condition of low cycle number, so that the sequencing efficiency is relatively low, and the sequencing accuracy is affected.

Table 8:

from the above description, it can be seen that the above embodiments of the present application achieve the following technical effects: the optimized bubble-shaped joint element, namely the second complementary structural region is complementary with the 5' -end library tag sequence, and the obtained connecting fragment does not influence the generation of a full-length library when the first strand synthesis is carried out during PCR amplification; furthermore, U base is introduced between the accompanying sequence of the bubble-shaped connector and the bubble-shaped structure, and the first chain obtained by synthesis can be completely complementary with the tag connector in the second chain synthesis process in the subsequent PCR process, so that the template utilization rate is improved, the richness of the template is increased, a library product with a higher full-length sequence accounting for more than 90% is obtained, the library yield is improved, the accuracy of a sequencing result can be improved in the subsequent sequencing process, and the sequencing cost is reduced under the condition of high input quantity and low amplification cycle number.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A bubble-cap element comprising a bubble-cap region formed by annealing a first strand and a second strand and first and second complementary regions on opposite sides of the bubble;

Wherein the 3 'end of the first strand has a protruding base T, the 3' end of the second strand has 2-4 protruding bases, and the protruding base T is located at the end of the first complementary region away from the bubble structure region, and the 2-4 protruding bases are located at the end of the second complementary region away from the bubble structure region;

The longer of the first and second chains forms a bubble in the bubble region;

The sequence connected with the bubble structure in the two sequences in the second complementary structure region is a companion sequence, and the sequence complementary with the companion sequence in the second complementary structure region can be completely complementary with the 5' -end library tag sequence.

2. The bubble linker element according to claim 1, wherein said companion sequence is linked to said bubble structure optionally via a U base;

preferably, the length of the companion sequence is 8-14bp.

3. The bubble-cap element of claim 1, wherein the first complementary region is 6-10bp in length;

Preferably, the length of the second complementary region is 8-14bp;

preferably, the sequence of the bubble linker element is shown in SEQ ID NOs 1-5.

4. A kit comprising the bubble adapter element of any one of claims 1-3.

5. The kit of claim 4, further comprising: enzyme, DNA ligase and DNA ligation reaction buffer for removing U base;

Preferably, the U base-removing enzyme is selected from one or more of the following: uracil-DNA glycosylase, APE1, endoIII and EndoVIII.

6. The kit of claim 4, wherein the working concentration of the bubble cap member is 5-25 μm.

7. A method of constructing a sequencing library, the method comprising:

Ligating the DNA fragment to be ligated with the use of the bubble linker element of any one of claims 1 to 3 or the bubble linker element of the kit of any one of claims 4 to 6 to obtain a adaptor-ligated fragment;

and carrying out PCR amplification on the connector connecting fragments to obtain a sequencing library.

8. The method of claim 7, wherein when the companion sequence in the bubble linker element is linked to the bubble structure by a U base, the companion sequence in the bubble linker element is removed with an enzyme that removes the U base after the linker fragment is obtained and before the PCR amplification is performed;

preferably, the initial amount of the adaptor-ligated fragments subjected to PCR amplification is 1-500ng;

Preferably, the number of cycles for performing PCR amplification is 3-10.

9. The method of claim 8, wherein the U base-removing enzyme is selected from one or more of the following: uracil-DNA glycosylase, APE1, endoIII and EndoVIII.

10. A sequencing library, characterized in that it is constructed by the method of any one of claims 7-9.