CN117924508A

CN117924508A - BiTE and application thereof in antitumor drugs

Info

Publication number: CN117924508A
Application number: CN202211315749.6A
Authority: CN
Inventors: 王刚; 刘勋; 杨月瑶; 刘明
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2022-10-26
Filing date: 2022-10-26
Publication date: 2024-04-26

Abstract

The invention discloses a BiTE and application thereof in antitumor drugs, wherein the BiTE is prepared from VL _αGPC3 -polypeptide PP _S‑S -substrate-IgG antibody hinge region-polypeptide PP _S‑S-VH_αGPC3 -substrate-VH _αCD3 -polypeptide PP _S‑SIgG -substrate-polypeptide PP _S‑S-VL_αCD3; disulfide bonds are formed between the C-terminus of VL _αGPC3 and the C-terminus of VH _αGPC3, between the C-terminus of VH _αCD3 and the C-terminus of VL _αCD3, and between the hinge region of the C-terminus of VH _αGPC3 and the hinge region of the C-terminus of VH _αCD3. The invention rearranges the codons of the protein coding gene by a genetic engineering technology, so that the amino acid sequence of the bispecific antibody is completely the same as the original sequence, but the translation directions of partial light/heavy chains are opposite, and the structure is more similar to that of a natural antibody molecule, and the bispecific antibody can be used for preparing antitumor drugs.

Description

BiTE and application thereof in antitumor drugs

Technical Field

The invention belongs to the field of biological medicine, and in particular relates to BiTE and application thereof in anti-tumor medicines.

Background

Glypican 3 (gpc 3) is a cell surface protein belonging to the family of heparan sulfate proteoglycans. The GPC3 gene encodes a precursor core protein of about 70kDa that is capable of being cleaved by furin (furin) to yield a soluble amino-terminal (N-terminal) peptide of about 40kDa capable of entering the blood and a membrane-bound completion-terminal (C-terminal) peptide of about 30kDa containing 2 Heparan Sulfate (HS) sugar chains. GPC3 is highly expressed in fetal liver, but not in liver tissue of normal adult, but resumes expression in hepatocellular carcinoma, has very close relation with occurrence and development of liver cancer, has higher detection rate in early stage of liver cancer occurrence, and increases detection rate with development of liver cancer.

The family of matrix metalloproteinases (matrix metallo proteinase, MMPs) may be useful for infiltration and metastasis of hepatoma cells by degrading the extracellular matrix, disrupting the normal tissue structure of cell adhesion molecules, and degrading perivascular matrix in combination with other related enzymes. MMP-9 is a relatively massive class of enzymes in the matrix metalloproteinase family. The expression of MMP-9 in liver cancer tissues is detected by a learner through immunohistochemistry and western blotting experiments, and the result shows that the expression of MMP-9 in liver cancer is over-high.

Bispecific antibodies (bispecific antibody, biabs) are artificial antibodies containing two specific antigen binding sites, capable of specifically recognizing and binding two different antigens or epitopes, which can bridge between target cells and functional molecules (cells), produce a targeted effector function, redirect specific immune cells to tumor cells to enhance killing of tumors, or block two different mediators/pathways simultaneously to perform a unique or overlapping function. Bispecific antibodies for tumor therapy can be classified into three classes according to their mechanism of action: redirecting effector cells; immunomodulation; targeting tumor cell receptor dual binding. Among them, antibodies for the redirecting function occupy the majority of them, and two antibodies for tumor treatment that have been currently marketed are also based on T cell redirecting. Depending on the nature of the bispecific antibody, it can also be well applied in other therapeutic systems, such as dual immunomodulation or targeting two molecules of the same cell membrane. BiTE (bispecific T-CELL ENGAGER) is a kind of bispecific antibody with obvious anti-tumor effect, and can target activated T cells to kill tumor cells. BiTE consists of two single-chain variable region fragments (scFv) connected in series by a flexible fusion linker. One scFv recognizes the T cell surface protein CD3 epsilon, while the other scFv recognizes a specific tumor cell surface antigen. This structure and specific binding protein ability of BiTE allows it to physically bridge T cells to tumor cells, forming T cell-BiTE-tumor cell complexes, inducing immune synapse formation, stimulating T cell activation, and producing cytokines that kill tumors. However, the existing BiTE connecting peptide is (Gly ₄Ser)₃, because the peptide chain is too short, the spatial conformation of the connected scFv is far away from that of the natural antibody, and the existing scFv targeting GPC3 cannot achieve the ideal effect of inhibiting tumor growth, therefore, development of bispecific antibodies with strong targeting and spatial conformation closer to that of the natural antibody is urgently needed.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a bispecific antibody with strong targeting and spatial conformation more similar to that of a natural antibody and application thereof in anti-tumor drugs.

The aim of the invention is achieved by the following technical scheme:

The first aspect of the present invention provides a BiTE comprising an αgpc3 light chain variable region VL, an αgpc3 heavy chain variable region VH, an αcd3 light chain variable region VL, an MMP-9 degradable polypeptide substrate, an IgG antibody hinge region, and a disulfide bond forming polypeptide PP _S-S linked in the following order:

VL _αGPC3 -polypeptide PP _S-S -substrate-IgG antibody hinge region-polypeptide PP _S-S-VH_αGPC3 -substrate-VH _αCD3 -polypeptide PP _S-S -IgG antibody hinge region-substrate-polypeptide PP _S-S-VL_αCD3;

Disulfide bonds are formed between the C end of VL _αGPC3 and the C end of VH _αGPC3 and between the C end of VH _αCD3 and the C end of VL _αCD3 through a polypeptide PP _S-S, and the IgG antibody hinge region at the C end of VH _αGPC3 and the IgG antibody hinge region at the C end of VH _αCD3 form disulfide bonds;

The nucleotide sequence of the MMP-9 degradable polypeptide substrate is shown as SEQ ID No. 1.

Further, the nucleotide sequence of the light chain variable region VL of the alpha GPC3 is shown as SEQ ID No.2, the nucleotide sequence of the heavy chain variable region VH of the alpha GPC3 is shown as SEQ ID No.3, the nucleotide sequence of the heavy chain variable region VH of the alpha CD3 is shown as SEQ ID No.4, the nucleotide sequence of the light chain variable region VL of the alpha CD3 is shown as SEQ ID No.5, the nucleotide sequence of the hinge region of the IgG antibody is shown as SEQ ID No.6, and the gene sequence forming disulfide bonds is shown as SEQ ID No. 7.

In a second aspect, the invention provides a nucleic acid molecule comprising a BiTE as described above.

Further, it has the nucleotide sequence shown in SEQ ID No. 8.

In a third aspect the invention provides a secretory expression vector comprising a nucleic acid molecule as described above.

Furthermore, the expression vector is an enhanced muscle specific expression plasmid pEMS, the promoter of pEMS is EMS, the nucleotide sequence of which is shown as SEQ ID No.9, and a mouse Ig kappa signal peptide is added in a multi-cloning site region after the promoter EMS, and the nucleotide sequence of the mouse Ig kappa signal peptide is shown as SEQ ID No. 10.

In a fourth aspect, the invention provides a cell line comprising a nucleic acid molecule as described above or a secretory expression vector as described above.

The invention also provides a construction method of the cell strain, which comprises the following steps:

S1, synthesizing a target gene fragment according to claim 1;

S2, cloning and connecting the target gene fragment constructed in the step S1 to pLVX-Puro vectors to form transfection plasmids;

s3, co-transferring psPAX plasmids, pMD2.G and the transfection plasmids into HEK293T cells to obtain virus liquid;

s4, infecting CHO-K1 cells by using virus liquid, and screening cell lines with stable expression by using puromycin to obtain CHO-K1 cell lines with stable expression transfection plasmid.

In a fifth aspect, the invention provides a pharmaceutical composition comprising a BiTE as described above, a nucleic acid molecule as described above, a secretory expression vector as described above, a host cell as described above or a plurality of pharmaceutically acceptable carriers, diluents or excipients.

A "pharmaceutically acceptable" ingredient is a substance that is suitable for use in humans and/or mammals without undue adverse side effects (such as toxicity, irritation, and allergic response), commensurate with a reasonable benefit/risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent, including various excipients and diluents. Pharmaceutically acceptable carriers described herein include (but are not limited to): water, saline, liposomes, lipids, proteins, protein-antibody conjugates, peptides, cellulose, nanogels, or combinations thereof. The choice of carrier should be compatible with the mode of administration and will be well known to those of ordinary skill in the art.

In a sixth aspect, the present invention provides the use of the BiTE, the nucleic acid molecule, the secretory expression vector, the host cell, and the pharmaceutical composition for preparing an antitumor drug, wherein the tumor is liver cancer.

The invention has the following advantages: the invention provides a targeting liver cancer cell high expression GPC3 and CD3 protein alpha-GPC 3 x alpha-CD 3 bispecific antibody, which is characterized in that the traditional connecting peptide (Gly ₄Ser)₃ is replaced by polypeptide substrate which can be degraded by MMP-9 to be connected, after the skeletal muscle is injected with plasmid, the expression of therapeutic protein can be detected in 7-14 days, when the bispecific antibody produced by skeletal muscle expression is transported to liver cancer tissue through blood system, the connecting peptide is degraded by MMP-9 which is high expressed by liver cancer tissue, the codon sequence of protein coding gene is rearranged by genetic engineering technology, the amino acid sequence of bispecific antibody is identical with the original sequence but the partial light/heavy chain translation direction is opposite, so that the formed BiTE structure is more similar to the structure of natural antibody molecule, and the T cell is led to kill liver cancer cell.

Drawings

FIG. 1 is a schematic diagram of mαGPC3×CD3-Ctrl and mαGPC3×CD3-Exp, wherein A is a schematic diagram of mαGPC3×CD3-Ctrl structure and B is a schematic diagram of mαGPC3×αCD3-Exp structure.

FIG. 2 shows a pcDNA3.1 vector map.

FIG. 3 is a pLVX-Puro vector map.

FIG. 4 is an in vitro killing ability test of 2 BiTEs against Hepa 1-6 cells.

FIG. 5 shows IFN-gamma release from 2 BiTE-induced PBMC.

FIG. 6 shows TNF- α release from 2 BiTE-induced PBMC.

FIG. 7 is a schematic of in situ plasmid injection in mice.

FIG. 8 is a graph showing tumor growth curves after in situ injection of tumor-bearing mouse plasmids.

FIG. 9 shows survival rate of tumor-bearing mice after plasmid in situ injection.

Detailed Description

The invention will be further described with reference to the accompanying drawings and examples, to which the scope of the invention is not limited:

Example 1: a BiTE comprising an αgpc3 light chain variable region VL, an αgpc3 heavy chain variable region VH, an αcd3 light chain variable region VL, an MMP-9 degradable polypeptide substrate, an IgG antibody hinge region, and a disulfide bond forming polypeptide PP _S-S linked in the following order:

The nucleotide sequence of the MMP-9 degradable polypeptide substrate is shown as SEQ ID No.1, the nucleotide sequence of the alpha GPC3 light chain variable region VL is shown as SEQ ID No.2, the nucleotide sequence of the alpha GPC3 heavy chain variable region VH is shown as SEQ ID No.3, the nucleotide sequence of the alpha CD3 heavy chain variable region VH is shown as SEQ ID No.4, the nucleotide sequence of the alpha CD3 light chain variable region VL is shown as SEQ ID No.5, the nucleotide sequence of the hinge region of the IgG antibody is shown as SEQ ID No.6, and the gene sequence for forming disulfide bond polypeptide is shown as SEQ ID No. 7.

(1) MMP-9 degradable polypeptide substrate total length 21bp, sequence as follows (SEQ ID No. 1):

5’-CCCCTGGGCATGTGGAGCAGG-3’

(2) The total length of the alpha GPC3 light chain variable region VL is 336bp, and the sequence is as follows (SEQ ID No. 2):

5’-GACGTGGTGATGACCCAGACCCCCCTGAGCCTGCCCGTGAGCCTGGGCGACC

AGGCCAGCATCAGCTGCAGGAGCAGCCAGAGCCTGGTGCACAGCAACGGCAACACCTACCTGCACTGGTACCTGCAGAAGCCCGGCCAGAGCCCCAAGCTGCTGATCTACAAGGTGAGCAACAGGTTCAGCGGCGTGCCCGACAGGTTCAGCGGCAGCGGCAGCGGCACCGACTTCACCCTGAAGATCAGCAGGGTGGAGGCCGAGGACCTGGGCGTGTACTTCTGCAGCCAGAACACCCACGTGCCCCCCACCTTCGGCAGCGGCACCAAGCTGGAGATCAAG-3'

(3) The heavy chain variable region VH of alpha GPC3 was 345bp in total and had the following sequence (SEQ ID No. 3):

5'-CAGGTGCAGCTGCAGCAGAGCGGCGCCGAGCTGGTGAGGCCCGGCGCCAGCGTGAAGCTGAGCTGCAAGGCCAGCGGCTACACCTTCACCGACTACGAGATGCACTGGGTGAAGCAGACCCCCGTGCACGGCCTGAAGTGGATCGGCGCCCTGGACCCCAAGACCGGCGACACCGCCTACAGCCAGAAGTTCAAGGGCAAGGCCACCCTGACCGCCGACAAGAGCAGCAGCACCGCCTACATGGAGCTGAGGAGCCTGACCAGCGAGGACAGCGCCGTGTACTACTGCACCAGGTTCTACAGCTACACCTACTGGGGCCAGGGCACCCTGGTGACCGTGAGCGCC-3'

(4) The total length of the αCD3 heavy chain variable region VH is 348bp, and the sequence is as follows (SEQ ID No. 4):

5'-GAGGTGCAGCTGGTGGAGAGCGGCGGCGGCCTGGTGCAGCCCGGCAAGAGCCTGAAGCTGAGCTGCGAGGCCAGCGGCTTCACCTTCAGCGGCTACGGCATGCACTGGGTGAGGCAGGCCCCCGGCAGGGGCCTGGAGAGCGTGGCCTACATCACCAGCAGCAGCATCAACATCAAGTACGCCGACGCCGTGAAGGGCAGGTTCACCGTGAGCAGGGACAACGCCAAGAACCTGCTGTTCCTGCAGATGAACATCCTGAAGAGCGAGGACACCGCCATGTACTACTGCGCCAGGTTCGACTGGGACAAGAACTACTGGGGCCAGGGCACCATGGTGACCGTGAGCAGC-3'.

(5) The light chain variable region VL of αCD3 is 321bp in total length and has the sequence as follows (SEQ ID No. 5):

5'-GACATCCAGATGACCCAGAGCCCCAGCAGCCTGCCCGCCAGCCTGGGCGACAGGGTGACCATCAACTGCCAGGCCAGCCAGGACATCAGCAACTACCTGAACTGGTACCAGCAGAAGCCCGGCAAGGCCCCCAAGCTGCTGATCTACTACACCAACAAGCTGGCCGACGGCGTGCCCAGCAGGTTCAGCGGCAGCGGCAGCGGCAGGGACAGCAGCTTCACCATCAGCAGCCTGGAGAGCGAGGACATCGGCAGCTACTACTGCCAGCAGTACTACAACTACCCCTGGACCTTCGGCCCCGGCACCAAGCTGGAGATCAAG-3'.

(6) The hinge region of the IgG antibody is 39bp in total and has the following sequence (SEQ ID No. 6):

5’-GTGCCCAGGGACTGCGGCTGCAAGCCCTGCATCTGCACC-3’。

(7) The disulfide-bond forming polypeptide PP _S-S has a sequence of 15bp and the sequence is as follows (SEQ ID No. 7):

5’-CTGGGCTGCCTGGTG-3’。

since the mouse IgG antibody CH1 also contains a disulfide bond formed by this sequence segment, the partial structure of the mouse IgG antibody CH1 (containing this sequence) was used in the following experiments.

Example 2:

the invention relates to a secretion type expression vector, which is an enhanced muscle specificity expression plasmid pEMS, wherein the promoter of pEMS is EMS, the EMS is an enhanced skeletal muscle cell specificity promoter (Enhanced Muscle Specific Promoter) and is named EMS, the nucleotide sequence of the EMS is shown as SEQ ID No.9, in order to help the protein expressed by the plasmid to secrete out of cells, after the promoter, a mouse Ig kappa signal peptide is added in front of a multiple cloning site region so as to guide the expressed protein to secrete out of cells, and the nucleotide sequence of the mouse Ig kappa signal peptide is shown as SEQ ID No. 10.

EMS total length 701bp, sequence as follows (SEQ ID No. 9):

5'-GGTACCTTGATGTACTGCCAAGTTGGAAAGTCCCGTTAGTGCCCATTGACGTCAATAATATATGGCGACGGCCGGGCCCCTCCCTGGGGACAGCCCCGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGACTATATAAAAAACCTGACCCGATATGCCTGGCCAGCCAATAGCGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGACACCCAAATATGGCGACGGGTGAGGAATGGTGACCAAGTCAGCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCACCAACACCTGCTGCCTGCCCGCTCTAAAAATAACTCCCGGCTTCAGGTTTCCCTAGGGCCCCTCCCTGGGGACAGCCCCATATGGCGACGGCCCCCCATTGACGTCAATGGGACGGTAAATGGCCCGCCTGGCGCCCATTGACGTCAATAATCCAGCCAATAGCACCCGATATGCCTGGGGACTATATAAAAAACCTGGGACACCCGAGATGCCTGGTTACAAGGCCTGGGGACACGCTCTAAAAATAACTCCCCCAACACCTGCTGCCTGCCGGCTTCAGGTTTCCCTACTCGAG-3'

B. The total length of the mouse Ig kappa signal peptide is 60bp, and the sequence is as follows (SEQ ID No. 10):

5’-GAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC-3’

EMS and mouse Ig kappa signal peptide are connected, then the above MMP-9 degradable polypeptide substrate, alpha GPC3 heavy chain variable region VH, alpha GPC3 light chain variable region VL, alpha CD3 heavy chain variable region VH, alpha CD3 light chain variable region VL, igG antibody hinge region, CH1 structure are connected into malpha GPC3 xCD 3-Exp according to the sequence shown in B in figure 1, and are synthesized by Shanghai engineering, and constructed on pcDNA3.1 (+) carrier, the map of which is shown in figure 2. The mαGPC3×CD3-Exp nucleotide sequence was sequenced as shown in SEQ ID No. 8.

5'-ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGACGTGGTGATGACCCAGACCCCCCTGAGCCTGCCCGTGAGCCTGGGCGACCAGGCCAGCATCAGCTGCAGGAGCAGCCAGAGCCTGGTGCACAGCAACGGCAACACCTACCTGCACTGGTACCTGCAGAAGCCCGGCCAGAGCCCCAAGCTGCTGATCTACAAGGTGAGCAACAGGTTCAGCGGCGTGCCCGACAGGTTCAGCGGCAGCGGCAGCGGCACCGACTTCACCCTGAAGATCAGCAGGGTGGAGGCCGAGGACCTGGGCGTGTACTTCTGCAGCCAGAACACCCACGTGCCCCCCACCTTCGGCAGCGGCACCAAGCTGGAGATCAAGGGCGGCCTGGGCTGCCTGGTGCCCCTGGGCATGTGGAGCAGGACCTGCATCTGCCCCAAGTGCGGCTGCGACAGGCCCGTGGTGCTGTGCGGCCTGGCCAGCGTGACCGTGCTGACCGGCCAGGGCTGGTACACCTACAGCTACTTCAGGACCTGCTACTACGTGGCCAGCGACGAGAGCACCCTGAGCAGGCTGGAGATGTACGCCACCAGCAGCAGCAAGGACGCCACCCTGACCGCCAAGGGCAAGTTCAAGCAGAGCTACGCCACCGACGGCACCAAGCCCGACCTGGCCGGCATCTGGAAGCTGGGCCACGTGCCCACCCAGAAGGTGTGGCACATGGAGTACGACACCTTCACCTACGGCAGCGCCAAGTGCAGCCTGAAGGTGAGCGCCGGCCCCAGGGTGCTGGAGGCCGGCAGCCAGCAGCTGCAGGTGCAGCCCCTGGGCATGTGGAGCAGGGAGGTGCAGCTGGTGGAGAGCGGCGGCGGCCTGGTGCAGCCCGGCAAGAGCCTGAAGCTGAGCTGCGAGGCCAGCGGCTTCACCTTCAGCGGCTACGGCATGCACTGGGTGAGGCAGGCCCCCGGCAGGGGCCTGGAGAGCGTGGCCTACATCACCAGCAGCAGCATCAACATCAAGTACGCCGACGCCGTGAAGGGCAGGTTCACCGTGAGCAGGGACAACGCCAAGAACCTGCTGTTCCTGCAGATGAACATCCTGAAGAGCGAGGACACCGCCATGTACTACTGCGCCAGGTTCGACTGGGACAAGAACTACTGGGGCCAGGGCACCATGGTGACCGTGAGCAGCCTGGGCTGCCTGGTGGTGCCCAGGGACTGCGGCTGCAAGCCCTGCATCTGCACCCCCCTGGGCATGTGGAGCAGGGTGCTGTGCGGCCTGAAGATCGAGCTGAAGACCGGCCCCGGCTTCACCTGGCCCTACAACTACTACCAGCAGTGCTACTACAGCGGCATCGACGAGAGCGAGCTGAGCAGCATCACCTTCAGCAGCGACAGGGGCAGCGGCAGCGGCAGCTTCAGGAGCCCCGTGGGCGACGCCCTGAAGAACACCTACTACATCCTGCTGAAGCCCGCCAAGGGCCCCAAGCAGCAGTACTGGAACCTGTACAACAGCATCGACCAGAGCGCCCAGTGCAACATCACCGTGAGGGACGGCCTGAGCGCCCCCCTGAGCAGCCCCAGCCAGACCATGCAGATCGACCACCATCACCACCATCACTGA-3'

Example 3: construction of cell lines

The genes required for the expression of proteins in this example were cloned in pEMS for expression of secreted proteins. The structure of mαGPC3 xCD 3-Ctrl and mαGPC3 xαCD3-Exp of plasmids expressing the double-targeting adapter antibodies recognizing T cells and tumor cells is shown as 1, and the connection mode of the light chain variable region and the heavy chain variable region of the mαGPC3 xCD 3-Ctrl antibody is consistent with the traditional connection mode, as shown as A in FIG. 1. The BiTE comprises an antibody alpha CD3 for recognizing a mouse T cell surface antigen CD3 and an antibody alpha GPC3 for recognizing a mouse liver cancer cell surface antigen GPC3, which are connected through peptide segments. The BiTE acts to simultaneously recognize and link two cells to direct T cells to kill tumor cells. The plasmid expressing the BiTE was designated pEMS-mαGPC3 xCD 3-Ctrl, pEMS-mαGPC3 xαCD3-Exp.

Lentivirus packaging:

to construct CHO-K1 cell lines capable of stably expressing pEMS-mαGPC3 xCD 3-Ctrl and pEMS-mαGPC3 xαCD 3-Exp. The present invention is characterized in that mαGPC3 xCD 3-Ctrl and mαGPC3 xαCD3-Exp target gene fragments are connected to pLVX vectors by means of molecular cloning, and pLVX vector patterns are shown in FIG. 3.

1) Inoculating HEK293T cells in a 10cm dish until the cell confluency reaches 70% -90%;

2) HEK293T cell medium (10% FBS, DMEM medium containing 100IU/mL penicillin and 100. Mu.g/mL streptomycin) was replaced with 10mL fresh Quan Pei (10% FBS, 100IU/mL penicillin and 100. Mu.g/mL streptomycin DMEM medium) 1h in advance;

3) Viral packaging plasmid (psPAX and pMD2. G), transfection plasmid (pLVX-mαGPC3 αCD3-Ctrl, pLVX-mαGPC3 αCD3-Exp) were prepared as described in Table 1, added to 750. Mu.L Opti-MEM, mixed and left to stand for 5min;

Table 1: preparation of lentivirus packaging plasmid

4) Adding 24 μL of Lipo8000 into 750 μL of Opti-MEM, mixing, and standing for 5min;

5) Mixing the solutions obtained in the steps 3 and 4, and incubating for 5min at room temperature;

6) Uniformly dispersing the mixed solution obtained in the step 5 into HEK293T cells, uniformly shaking in a cross manner, and putting into an incubator;

7) After 12h, 10mL of complete medium (DMEM medium containing 10% FBS, 100IU/mL penicillin and 100. Mu.g/mL streptomycin) was changed, and calculation was started from this point. After 48 hours, collecting the cell culture solution (namely virus solution) into a 15mL centrifuge tube, and centrifuging at 1000rpm for 5 minutes;

8) The supernatant was aspirated by syringe, filtered through 0.45 μm microporous filter membrane, dispensed into 1.5mL EP tubes, 500. Mu.L per tube, sealed with sealing membrane and stored at-80 ℃.

Lentivirus infects CHO-K1 cells:

1) And (3) paving: spreading a 6-hole plate to be infected with cells CHO-K1 until the cells grow to 60-80%;

2) Changing 600 μl of complete culture medium, sequentially adding 500 μl of virus solution, and polybrene (final concentration 10 μg/mL); incubating the incubator overnight;

3) The following day the complete medium was changed and after 48h screened with puromycin (final concentration 2. Mu.g/mL).

Screening of stably expressed cell lines:

1) After 72h, adding puromycin with a final concentration of 2 mug/mL for culturing for 24h, changing to normal culture medium if the cell confluency is lower than 30%, culturing until the cell confluency is higher than 30%, changing to fresh culture medium with a concentration of 8 mug/mL puromycin (10% FBS, 100IU/mL penicillin, 100 mug/mL streptomycin and 8 mug/mL DMEM culture medium) for culturing and screening for 2 weeks; if the cell confluency is not less than 30%, the culture selection is continued for 2 weeks using 2. Mu.g/mL puromycin fresh medium (10% FBS, 100IU/mL penicillin, 100. Mu.g/mL streptomycin and 2. Mu.g/mL DMEM medium);

2) The obtained CHO-K1 cell lines stably expressing pLVX-mαGPC3 xαCD3-Ctrl and pLVX-mαGPC3 xαCD3-Exp were frozen at-80℃for use.

Example 4: the effect of expressed antibodies on T cell killing capacity was studied:

Mice Hepa 1-6 were labeled with 1 μ L Cell TrackerViolet and tumor cells after labeling were incubated overnight at 37 ℃. After obtaining peripheral blood mononuclear cells (PERIPHERAL BLOOD MONOCYTE CELL, PBMC) from mice, enriched lymphocytes were incubated overnight at 37℃at a concentration of 1X 10 ⁶/mL, and adherent cells were removed the next day, at which time the cells were ready for use in subsequent co-culture experiments. Target cells were co-incubated with adherent cell depleted PBMCs [ effector cells: target (E: T) cell ratio, 1:1,4:1, 10:1]. After the co-culture is completed, the upper layer of suspended lymphocytes is discarded, washed with PBS, and the attached target cells are digested with pancreatin and subjected to flow cytometry analysis. From FIG. 4, it can be seen that mαGPC3 xαCD3-Exp exhibits a stronger tumor cell killing effect than mαGPC3 xαCD3-Ctrl.

The IFN-gamma content released by lymphocytes in PBMC is detected by ELISA kit, the operation steps are described by referring to the Eboltag kit (Cat: RK 00019), the TNF-alpha content released by lymphocytes in PBMC is detected by ELISA kit, the operation steps are described by referring to the Eboltag kit (Cat: RK 00027), and after mαGPC3 xαCD3-Exp treatment, as shown in FIG. 5, more IFN-gamma is released by PBMC than after mαGPC3 xαCD3-Ctrl treatment; after mαGPC3 xαCD3-Exp treatment, the PBMC released a comparable amount of TNF- α as compared to mαGPC3 xαCD3-Ctrl treated groups, as shown in FIG. 6. From the cellular level, it was verified that mαGPC3 xαCD3-Exp exhibits a stronger cell killing ability than conventional mαGPC3 xαCD3-Ctrl.

Example 5: treatment effect detection

Mice weight detection:

In situ plasmid injection is schematically shown in FIG. 7 (cell inoculation 6X 10 ⁵/mouse, plasmid injection (40. Mu.g/mouse), time to kill mice, etc.); day 0 each mouse was inoculated with 6 x 10 ⁵ Hepa 1-6 liver cancer cells, day 2 mice were injected with 40 μg plasmid, and 1h post-plasmid injection was shocked with a Datura-brand electric needle for 3min to assist plasmid nucleation (continuous wave, 5Hz, intensity 3).

Tumor volume detection in mice:

tumor volume was measured every two days during animal experiments, and tumor growth curves of tumor-bearing mice were drawn, and it can be seen from FIG. 8 that tumor growth of tumor-bearing mice was significantly inhibited after mαGPC3 xαCD3-Exp treatment, and the therapeutic effect was superior to mαGPC3 xαCD3-Ctrl.

Median survival of mice:

Counting the death time of the mice, and judging whether each treatment scheme prolongs the service life of the mice; the experimental endpoint was considered when the tumor volume of mice exceeded 1500mm3 or mice died, and the survival curve of tumor-bearing mice was plotted, as shown in fig. 9, and it can be seen that the survival rate of mαgpc3×αcd3-Exp-treated mice was optimal.

The foregoing is only a preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art who is skilled in the art to which the present invention pertains will appreciate that the technical scheme and the inventive concept according to the present invention are equally substituted or changed within the scope of the present invention.

Claims

1. A BiTE comprising an αgpc3 light chain variable region VL, an αgpc3 heavy chain variable region VH, an αcd3 light chain variable region VL, an MMP-9 degradable polypeptide substrate, an IgG antibody hinge region, and a disulfide bond forming polypeptide PP _S-S, connected in the following order:

2. The BiTE according to claim 1, wherein the nucleotide sequence of the light chain variable region VL of αgpc3 is shown in SEQ ID No. 2, the nucleotide sequence of the heavy chain variable region VH of αgpc3 is shown in SEQ ID No. 3, the nucleotide sequence of the heavy chain variable region VH of αcd3 is shown in SEQ ID No. 4, the nucleotide sequence of the light chain variable region VL of αcd3 is shown in SEQ ID No. 5, the nucleotide sequence of the hinge region of the IgG antibody is shown in SEQ ID No. 6, and the disulfide bond forming gene sequence is shown in SEQ ID No. 7.

3. A nucleic acid molecule comprising the BiTE of claim 1 or 2.

4. A nucleic acid molecule according to claim 3, characterized by having the nucleotide sequence shown in SEQ ID No. 8.

5. A secreted expression vector comprising the nucleic acid molecule of claim 3 or 4.

6. The secretory expression vector of claim 5, wherein: the expression vector is an enhanced muscle specific expression plasmid pEMS, the promoter of the pEMS is EMS, the nucleotide sequence of the pEMS is shown as SEQ ID No. 9, a mouse Ig kappa signal peptide is added in a polyclonal site area after the promoter EMS, and the nucleotide sequence of the mouse Ig kappa signal peptide is shown as SEQ ID No. 10.

7. A cell line comprising the nucleic acid molecule of claim 4 or the secretory expression vector of claim 5.

8. The method for constructing a cell line according to claim 7, wherein the method for constructing comprises:

s1, synthesizing the target gene fragment of claim 1;

S4, infecting CHO-K1 cells by using virus liquid, and screening cell strains with stable expression by using puromycin to obtain CHO-K1 cell strains with stable expression transfection plasmid.

9. A pharmaceutical composition comprising a BiTE as defined in claim 1 or 2, a nucleic acid molecule as defined in claim 3 or 4, a secretory expression vector as defined in claim 5 or 6, a host cell as defined in claim 7 or 8, or a plurality of pharmaceutically acceptable carriers, diluents or excipients.

10. Use of the BiTE of claim 1 or 2, the nucleic acid molecule of claim 3 or 4, the secretory expression vector of claim 5 or 6, the host cell of claim 7 or 8, the pharmaceutical composition of claim 9 for the preparation of an antitumor drug, wherein the tumor is liver cancer.