CN1179052C - Russel pond crayfish noda virus nucleic acid RT-PCR detection method - Google Patents
Russel pond crayfish noda virus nucleic acid RT-PCR detection method Download PDFInfo
- Publication number
- CN1179052C CN1179052C CNB03118734XA CN03118734A CN1179052C CN 1179052 C CN1179052 C CN 1179052C CN B03118734X A CNB03118734X A CN B03118734XA CN 03118734 A CN03118734 A CN 03118734A CN 1179052 C CN1179052 C CN 1179052C
- Authority
- CN
- China
- Prior art keywords
- detection method
- nucleic acid
- russel
- minutes
- virus nucleic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a detection method of noda virus nucleic acid RT-PCR of Luo's paludal shrimps. The detection method comprises the following steps: firstly, design of a virus specific attractor; secondly, extraction of tissue RNA; thirdly, a reaction system; fourthly, a multiplication system. The detection method has the advantages of high sensitivity and short detection time. The detection method is suitable for pathogenic diagnosis of whitish muscle diseases of Luo's paludal shrimps and health monitoring of parent shrimps, shrimp seedlings and adult shrimps.
Description
Technical field:
The invention belongs to shrimps disease detection technique field, be specifically related to the method that a kind of Russel pond crayfish noda virus nucleic acid RT-PCR detects, be applicable to the diagnosis of Macrobrachium rosenbergii whitish muscle diseases virus causing disease.
Background technology:
Macrobrachium rosenbergii (Macrobrachium rosenbergii) lean type disease is main disease (Nash et al., 1987 that influenced South East Asia and Caribbean country Macrobrachium rosenbergii aquaculture since the nineties; Tung etal., 1999; Arcier et al., 1999).The infection of this disease is to liking the seedling of nursery, and the muscle of morbidity seedling is the gonorrhoea phenomenon.This disease causes the mass mortality at short notice of shrimp seedling, knows from " aquaculture animals and plants state of an illness monthly magazine " that whole nation aquatic products technology popularization master station of Fishery Bureau of the Ministry of Agriculture edits, and this disease has propagated into me at present and crossed main Macrobrachium rosenbergii breed area.The France researchist has successfully separated the promise da virus of a kind of 27nm from the Macrobrachium rosenbergii sample from the trouble lean type disease of Antillean (Antillan), temporary called after Macrobrachium rosenbergii promise da virus Antillan strain isolated (M.Rosenbergii Nodavirus, MrRV-ant), and this virus genomic clone and immunodetection work (Bonami, 2002 have been carried out; Romestand ﹠amp; Bonami, in press).The Macrobrachium rosenbergii promise da virus immunoassay technology that is about to deliver lays particular emphasis on antigen-antibody reaction, and sensitivity is lower than the present invention, does not have the patent of relevant test kit.Do not know from present document and patent Query Result, not the method that detects about the RT-PCR of Macrobrachium rosenbergii promise da virus and the report of test kit thereof.
Reference:
(1)Arcier?J.M.，Herman?F.，Lightner?D.V.，Redman?R.M.，MariJ.?&?Bonami?J.R.(1999).A?viral?disease?associated?withmortalities?in?hachery-reared?postlarvae?of?the?giantfreshwater?prawn?Macrobrachium?rosenbergii.Diseases?ofAquatic?organisms，38，177-181.
(2)Bonami?J.R.(2002)A?new?viral?disease?in?the?giantfreshwater?prawn?Macrobrachium?rosenbergii.WorldAquaculture?2002.Annual?Meetings?of?the?World?AquacultureSociety?and?the?China?Society?of?Fisheries，April?23-27，2002.Beijing?Convention?Center，Beijing?China.Abstract，p.79.
(3) money winter Yang Guoliang Liu Wen etc.The research of Luo pond crayfish fries whitish muscle diseases cause of disease.The hydrobiont journal, 2002,26:472-476
(4)Romestand?B.?&?Bonami?J.R.(2002)A?sandwich?enzyme?linkedimmunosorbent?assay(S-ELISA)for?detection?of?MrNV?in?thegiant?fresh?water?prawn?Macrobrachium?rosenbergii.Journalof?Fish?Diseases，(in?press).
(5)Tung?C.W.，Wang?C.S.?&?Chen?S.N.(1999)Histological?andelectron?microscopic?study?on?Macrobrachium?muscle?virus(MMV)infection?in?the?giant?freshwater?prawn，Macrobrachium?rosenbergii(de?Man)，cultured?in?Taiwan.Journal?of?Fish?Diseases，22，1-5.
Bibliography (1), (2) (3) and (5) mainly lay particular emphasis on the cause of disease research of Macrobrachium rosenbergii whitish muscle diseases, on the level of the ultrastructure of histopathology, virus and biochemical character virus are described.Data (4) has been reported a kind of immunologic detection method of Macrobrachium rosenbergii promise da virus, and this method is easy and simple to handle fast, but sensitivity is low.
Summary of the invention:
The method that the object of the present invention is to provide a kind of Russel pond crayfish noda virus nucleic acid RT-PCR to detect.CDNA library sequence according to Macrobrachium rosenbergii promise da virus nucleic acid, design specificity virus nucleic acid primer, method with RT-PCR, infection state to promise da virus in the Macrobrachium rosenbergii body detects. and this method is easy fast, highly sensitive, be suitable for diagnosis and close shrimp, seedling and the health monitoring that becomes shrimp of Macrobrachium rosenbergii whitish muscle diseases cause of disease.
In order to reach above purpose, the present invention takes following technical scheme:
A, preparation detection kit: test kit contains the neccessary composition in all trace routines, comprise total RNA extraction reagent (4M guanidinium isothiocyanate, 25mM Trisodium Citrate pH7.0,0.5% sodium lauryl sarcosinate salt, 0.1M mercaptoethanol, 0.2M sodium-acetate), viral special primer (design upstream primer: ccacgttcttagtggatcct; Downstream primer: cgtccgcctggtagttcc), the amplification system composition is (in 50 μ l reaction systems, add 4 μ l 10mM ribodesose nucleic acid mixtures, 2.5 μ l 100mM DTT, 1 μ l RNA enzyme inhibitors 5U/ μ l, 10 μ l 5x RT-PCR damping fluids, the upstream and downstream primer of 2 μ l (10pmol/ μ l), 1 μ l ThermoScript II and heat-stable DNA polymerase mixture, substrate are the total RNA from the sick shrimp tissue extraction of 10-50mg.
B, top condition (55 ℃ of 30min, 1 circulation of setting up DNA cloning; 94 ℃, 30s, 55 ℃ of 30s, 72 ℃ of 1min 30s, 30 circulations, 72 ℃ of 7min, 1 circulation.1.2% agarose electrophoresis is checked amplified production).
The present invention compared with prior art has following advantage: highly sensitive, can detect the sick shrimp total tissue RNA that is less than 2.5pg; The sample preparation program is simple; Detection time is short; Can detect a plurality of samples simultaneously.
Embodiment:
Concrete steps are as follows:
(1) designs viral special primer, upstream primer: ccacgttcttagtggatcct; Downstream primer: cgtccgcctggtagttcc.
(2) total tissue RNA is extracted: take by weighing the sick shrimp seedling of 10-50mg or become the shrimp tissue, with 1ml sample preparation liquid (4M guanidinium isothiocyanate, 25mM Trisodium Citrate pH7.0,0.5% sarcosyl salt, 0.1M mercaptoethanol, 0.2M sodium-acetate), grind the centrifugal 10min of 3000g.Get the chloroform that supernatant adds 0.2ml, mixed centrifugal 10 minutes of 12000g 30 seconds, water intaking phase 0.6ml adds the primary isoamyl alcohol mixing of 0.5ml, places after 10 minutes centrifugal 10 minutes of 12000g, 75% ethanol is washed 2 times, the distilled water dissolving that handle with diethylpyrocarbonate dry back.
(3) reaction system: in 50 μ l reaction systems, add 4 μ l 10mM dNTP, 2.5 μ l 100mMDTT, 1 μ l RNA enzyme inhibitors 5U/ μ l, 10 μ l 5x RT-PCR buffer, the upstream and downstream primer of 2 μ l (10pmol/ μ l), 1 μ l ThermoScript II and heat-stable DNA polymerase mixture, substrate are the total RNA. from the sick shrimp tissue extraction of 10-50mg
(4) amplification condition: 55 ℃ of 30min, 1 circulation; 94 ℃, 30s, 55 ℃ of 30s, 72 ℃ of 1min 30s, 30 circulations, 72 ℃ of 7min, 1 circulation.1.2% agarose electrophoresis is checked amplified production.
Claims (1)
1, a kind of method of Russel pond crayfish noda virus nucleic acid RT-PCR detection comprises the following steps:
(1) designs viral special primer, upstream primer: ccacgttcttagtggatcct; Downstream primer: cgtccgcctggtagttcc;
(2) sick shrimp total tissue RNA is extracted: take by weighing the sick shrimp seedling of 10-50mg or become the shrimp tissue, grind with 1ml sample preparation liquid, the centrifugal 10min of 3000g gets the chloroform that supernatant adds 0.2ml, mixes 30 seconds, centrifugal 10 minutes of 12000g, water intaking phase 0.6ml adds the primary isoamyl alcohol mixing of 0.5ml, places centrifugal 10 minutes of 12000g 10 minutes, 75% ethanol is washed 2 times, the distilled water dissolving that handle with diethylpyrocarbonate dry back; Sample preparation liquid is: 4M guanidinium isothiocyanate, 25mM Trisodium Citrate pH7.0,0.5% sarcosyl salt, 0.1M mercaptoethanol, 0.2M sodium-acetate;
(3) reaction system: in 50 μ l reaction systems, add 4 μ l 10mM dNTP, 2.5 μ l 100mMDTT, 1 μ l RNA enzyme inhibitors 5U/ μ l, 10 μ l, 5 x RT-PCR buffer, the upstream and downstream primer of 2 μ l, 1 μ l ThermoScript II and heat-stable DNA polymerase mixture, substrate are the total RNA from the sick shrimp tissue extraction of 10-50mg;
(4) amplification condition: 55 ℃ of 30min, 1 circulation; 94 ℃, 30s, 55 ℃ of 30s, 72 ℃ of 1min30s, 30 circulations, 72 ℃ of 7min, 1 circulation, 1.2% agarose electrophoresis is checked amplified production.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB03118734XA CN1179052C (en) | 2003-03-06 | 2003-03-06 | Russel pond crayfish noda virus nucleic acid RT-PCR detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB03118734XA CN1179052C (en) | 2003-03-06 | 2003-03-06 | Russel pond crayfish noda virus nucleic acid RT-PCR detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1443855A CN1443855A (en) | 2003-09-24 |
| CN1179052C true CN1179052C (en) | 2004-12-08 |
Family
ID=27814983
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB03118734XA Expired - Fee Related CN1179052C (en) | 2003-03-06 | 2003-03-06 | Russel pond crayfish noda virus nucleic acid RT-PCR detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1179052C (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8895240B2 (en) * | 2008-05-19 | 2014-11-25 | E I Du Pont De Nemours And Company | Method, kit and system for collecting and processing samples for DNA and RNA detection |
| CN102352366B (en) * | 2011-09-28 | 2013-08-14 | 浙江省淡水水产研究所 | Macrobrachium rosenbergii bicistronic messenger ribonucleic acid (mRNA) viral genome complete sequence and application thereof |
| CN109988870B (en) * | 2019-05-05 | 2023-05-30 | 湛江出入境检验检疫局检验检疫技术中心 | Triple fluorescence PCR detection kit for shrimp mortem nodavirus, blood cell iridovirus and nodavirus and application thereof |
| CN110846441B (en) * | 2019-12-20 | 2023-04-11 | 浙江省淡水水产研究所 | Specific primer, probe and rapid detection kit for detecting macrobrachium flaviviridae-1 |
-
2003
- 2003-03-06 CN CNB03118734XA patent/CN1179052C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1443855A (en) | 2003-09-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hu et al. | Identification, characterization and immunological analysis of Ras related C3 botulinum toxin substrate 1 (Rac1) from grass carp Ctenopharyngodon idella | |
| CN104592378B (en) | A kind of freshwater shrimp FoxL2 albumen and its encoding gene and application | |
| CN103642797B (en) | A kind of Extraction method of total RNA of intermuscular bone of megalobrama amblycephala | |
| CN1179052C (en) | Russel pond crayfish noda virus nucleic acid RT-PCR detection method | |
| Li et al. | Effects of nanoplastic exposure on the growth performance and molecular characterization of growth-associated genes in juvenile Macrobrachium nipponense | |
| CN104232643B (en) | RNAi interference fragments, interference carrier, preparation method and applications | |
| CN1451764A (en) | Method for compound rverse transcription polymerase chain reaction detection of Ro's pond shrimp viral | |
| CN103665131B (en) | The NPF neuropeptide of bollworm and tobacco budworm and encoding gene thereof and application | |
| CN105969745B (en) | Fish hypoxemia tolerance gene and application thereof | |
| CN115679004A (en) | Primers, method and kit for identifying Pelteobagrus vachelli, leiocassis longirostris and hybrid species | |
| Xu et al. | Molecular cloning and expression of the stress gene HSP70 in the marine crab Charybdis Japonica (Decapoda: Brachyura: Portunidae) in response to ammonia-N, Nitrite-N, and sulfide exposure | |
| CN108277218A (en) | A kind of Leymus chinensis seeds RNA extraction method at sprouting initial stage | |
| CN110592095A (en) | Clone and expression of sepiella maindroni tretinoin X receptor gene | |
| CN102492777B (en) | Standard plasmid molecule for transgenic maize Mon810 detection and construction method thereof | |
| CN103665132B (en) | The NPY neuropeptide of bollworm and tobacco budworm and encoding gene thereof and application | |
| Johan et al. | Molecular epidemiology of Megalocytivirus in freshwater angelfish (Pterophyllum scalare) from Johor, Malaysia | |
| CN102876800B (en) | Turn the quantitative detecting method of phytase gene in phytase gene corn or feed | |
| CN116762898B (en) | Prawn immunopotentiator based on CpG oligonucleotide tandem molecules and application thereof | |
| Mo et al. | Analysis of adaptive molecular mechanisms in response to low salinity in antennal gland of mud crab, Scylla paramamosain | |
| CN1438330A (en) | Method for detecting Nuoda Virus mucleic-acid point cross-breeding of luoshi shrimp in natural pond | |
| Yao et al. | Two autophagy-related proteins, ATG5 and ATG7, from Eriocheir sinensis involved into Spiroplasma eriocheiris infection | |
| Puvanendran et al. | Intergenerational effects of early life-stage temperature modulation on gene expression and DNA methylation in Atlantic cod (Gadus morhua) | |
| CN102757946B (en) | Gobiocypris rarus alpha type Na+/K+-ATPase, and encoding gene and application thereof | |
| Deng et al. | Population genetic structure and genetic diversity of Acetes chinensis in the East China Sea | |
| CN106755595A (en) | A kind of Eva Green fluorescent quantificationally PCR detecting kits for detecting salmon Alphavirus and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |