CN117904314A - CYP27A1 single nucleotide polymorphism molecular marker related to chicken carcass traits and application thereof - Google Patents
CYP27A1 single nucleotide polymorphism molecular marker related to chicken carcass traits and application thereof Download PDFInfo
- Publication number
- CN117904314A CN117904314A CN202410080416.2A CN202410080416A CN117904314A CN 117904314 A CN117904314 A CN 117904314A CN 202410080416 A CN202410080416 A CN 202410080416A CN 117904314 A CN117904314 A CN 117904314A
- Authority
- CN
- China
- Prior art keywords
- genotype
- single nucleotide
- nucleotide polymorphism
- cyp27a1
- chicken
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000287828 Gallus gallus Species 0.000 title claims abstract description 53
- 239000002773 nucleotide Substances 0.000 title claims abstract description 35
- 125000003729 nucleotide group Chemical group 0.000 title claims abstract description 35
- 101000875401 Homo sapiens Sterol 26-hydroxylase, mitochondrial Proteins 0.000 title claims abstract description 19
- 239000003147 molecular marker Substances 0.000 title claims abstract description 19
- 102100036325 Sterol 26-hydroxylase, mitochondrial Human genes 0.000 title claims abstract description 18
- 235000013330 chicken meat Nutrition 0.000 claims abstract description 48
- 230000035772 mutation Effects 0.000 claims abstract description 15
- 101000690100 Homo sapiens U1 small nuclear ribonucleoprotein 70 kDa Proteins 0.000 claims abstract description 14
- 101100029173 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173) SNP2 gene Proteins 0.000 claims abstract description 14
- 101100094821 Saccharomyces cerevisiae (strain ATCC 204508 / S288c) SMX2 gene Proteins 0.000 claims abstract description 14
- 102100024121 U1 small nuclear ribonucleoprotein 70 kDa Human genes 0.000 claims abstract description 14
- 101100236128 Saccharomyces cerevisiae (strain ATCC 204508 / S288c) LSM2 gene Proteins 0.000 claims abstract description 11
- 238000000034 method Methods 0.000 claims description 11
- 238000012408 PCR amplification Methods 0.000 claims description 10
- 230000003321 amplification Effects 0.000 claims description 7
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 7
- 238000012163 sequencing technique Methods 0.000 claims description 6
- 238000011144 upstream manufacturing Methods 0.000 claims description 5
- 238000000137 annealing Methods 0.000 claims description 3
- 239000003795 chemical substances by application Substances 0.000 claims description 3
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 210000003205 muscle Anatomy 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 238000001514 detection method Methods 0.000 claims description 2
- 238000002360 preparation method Methods 0.000 claims description 2
- 230000001488 breeding effect Effects 0.000 abstract description 6
- 238000009395 breeding Methods 0.000 abstract description 5
- 210000002414 leg Anatomy 0.000 description 19
- 210000000579 abdominal fat Anatomy 0.000 description 13
- 108020004414 DNA Proteins 0.000 description 7
- 239000008280 blood Substances 0.000 description 7
- 210000004369 blood Anatomy 0.000 description 7
- 239000000523 sample Substances 0.000 description 6
- 101150079919 Cyp27a1 gene Proteins 0.000 description 5
- 238000007918 intramuscular administration Methods 0.000 description 5
- 238000007400 DNA extraction Methods 0.000 description 4
- 210000003555 cloaca Anatomy 0.000 description 4
- 230000002596 correlated effect Effects 0.000 description 4
- 238000013461 design Methods 0.000 description 4
- 239000000463 material Substances 0.000 description 4
- 210000002976 pectoralis muscle Anatomy 0.000 description 4
- 108090000623 proteins and genes Proteins 0.000 description 4
- 238000010586 diagram Methods 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 102000054765 polymorphisms of proteins Human genes 0.000 description 3
- 238000003307 slaughter Methods 0.000 description 3
- 210000001015 abdomen Anatomy 0.000 description 2
- 238000012098 association analyses Methods 0.000 description 2
- 230000037396 body weight Effects 0.000 description 2
- 210000001217 buttock Anatomy 0.000 description 2
- 210000000038 chest Anatomy 0.000 description 2
- 210000000349 chromosome Anatomy 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 210000003746 feather Anatomy 0.000 description 2
- 238000003205 genotyping method Methods 0.000 description 2
- 235000020997 lean meat Nutrition 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 210000002832 shoulder Anatomy 0.000 description 2
- 210000004003 subcutaneous fat Anatomy 0.000 description 2
- 229920000936 Agarose Polymers 0.000 description 1
- 241001083847 Berberis Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 241000286209 Phasianidae Species 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 239000012805 animal sample Substances 0.000 description 1
- 210000000988 bone and bone Anatomy 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000010219 correlation analysis Methods 0.000 description 1
- 230000000875 corresponding effect Effects 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 235000013601 eggs Nutrition 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 244000144977 poultry Species 0.000 description 1
- 235000013594 poultry meat Nutrition 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000007920 subcutaneous administration Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 230000007704 transition Effects 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses CYP27A1 single nucleotide polymorphism molecular markers related to chicken carcass traits and application thereof, and relates to the technical field of biology. The nucleotide sequence of the CYP27A1 single nucleotide polymorphism molecular marker is shown in SEQ ID NO. 1; the CYP27A1 single nucleotide polymorphism molecular marker has SNP1, SNP2 and SNP33 single nucleotide polymorphism sites; SNP1 is located at NC_052579.1:g21963641 site, and G > A mutation exists; the SNP2 is located at NC_052579.1:g21963567 site, and A > G mutation exists; the SNP3 is located at the NC_052579.1:g21963433 site, and an A > C mutation is present. The molecular marker provided by the invention can accurately identify the carcass traits of chickens, thereby providing technical support for breeding chickens with excellent carcass properties.
Description
Technical Field
The invention relates to the field of biotechnology, in particular to CYP27A1 single nucleotide polymorphism molecular markers related to chicken carcass traits and application thereof.
Background
Chickens are poultry that are derived from wild raw chickens and have a domestication history of at least about 4000 years, but chicken and eggs have not become commercial products in mass production until around 1800 years. The chicken is turkey, black-bone chicken, pheasant, etc. Chicken bones or pottery chickens are found in Hubei, jiangxi, shandong, henan, gansu provinces of China, and the like, which are four thousands of years ago. The yellow feather broiler is formed by breeding local yellow feather broiler breeds in China in a hybridization way and introduced broiler breeds, has excellent characteristics, such as high uniformity and consistency of chicken, developed chest and leg muscles, high yield and excellent quality after slaughtering and ice fresh, and has higher scientific research value and economic value. The characteristics of abdominal fat, leg weight, half-bore-free rate, full-bore-free rate and the like are key indexes for identifying the carcass performance of chickens.
Single nucleotide polymorphisms (Single Nucleotide Polymorphism, snps), which are most common among human heritable variations, account for over 90% of all known polymorphisms, refer to DNA sequence polymorphisms, such as single base transitions, transversions, insertions or deletions, at the genomic level caused by single nucleotide variations. At present, many studies have demonstrated that SNPs in gene structure have a certain effect on actual animal production. SNP can be used for Molecular Mark-assistt Selection (MAS) to improve seed Selection accuracy and breeding effect. The development of new SNP molecular markers related to carcass performance indexes can provide technical support for the breeding of chickens with excellent carcass performance.
Disclosure of Invention
The invention aims to provide CYP27A1 single nucleotide polymorphism molecular markers related to chicken carcass traits and application thereof, so as to solve the problems of the prior art, and the invention discovers SNP loci related to chicken carcass traits in CYP27A1 genes, thereby providing a novel single nucleotide polymorphism molecular marker for breeding chicken with excellent carcass properties.
In order to achieve the above object, the present invention provides the following solutions:
The invention provides a CYP27A1 single nucleotide polymorphism molecular marker related to chicken carcass traits, wherein the nucleotide sequence of the CYP27A1 single nucleotide polymorphism molecular marker is shown in SEQ ID NO. 1; the CYP27A1 single nucleotide polymorphism molecular marker has SNP1, SNP2 and SNP33 single nucleotide polymorphism sites;
the SNP1 is positioned at NC_052579.1:g21963641 site, and G > A mutation exists;
The SNP2 is located at NC_052579.1:g21963567 site, and A > G mutation exists;
The SNP3 is located at NC_052579.1:g21963433 site, and an A > C mutation exists.
Further, the genotype of the SNP1 is GG, GA or AA; the genotype of the SNP2 is AA, AG or GG; the genotype of SNP3 is AA, AC or CC.
The invention also provides a primer pair for amplifying the CYP27A1 single nucleotide polymorphism molecular marker, wherein the nucleotide sequence of an upstream primer of the primer pair is shown as SEQ ID NO.2, and the nucleotide sequence of a downstream primer of the primer pair is shown as SEQ ID NO. 3.
The invention also provides application of the primer pair in preparation of a kit for identifying chicken carcass traits.
The invention also provides a kit for identifying chicken carcass traits, which comprises the primer pair.
The invention also provides application of the CYP27A1 single nucleotide polymorphism molecular marker, the primer pair or the kit in identifying chicken carcass traits.
Further, the chicken variety is spotted-brown chicken.
The invention also provides a method for identifying the chicken carcass traits, which comprises the following steps:
Extracting genomic DNA of a chicken to be detected, and carrying out PCR amplification by using the genomic DNA as a template and using the primer pair to obtain an amplification product;
Sequencing the amplification products, detecting genotypes of SNP1, SNP2 and SNP33 single nucleotide polymorphism sites, and identifying carcass traits of the chickens to be detected according to genotype detection results:
When the genotype of the SNP1 is GG, the fat width, the fat percentage and the fat percentage of the chicken muscle are larger than the GA genotype and the AA genotype;
When the genotype of the SNP2 is AA, the leg weight and the leg ratio are larger than those of the GG genotype;
when the genotype of the SNP3 is CC, the legweight of the SNP3 is greater than the AA genotype;
the SNP1 is positioned at NC_052579.1:g21963641 site, and G > A mutation exists;
The SNP2 is located at NC_052579.1:g21963567 site, and A > G mutation exists;
The SNP3 is located at NC_052579.1:g21963433 site, and an A > C mutation exists.
Further, the amplification system of the PCR amplification comprises: 2. Mu.L of template DNA, 2X ES TAQ MASTER Mix 25. Mu.L, 1. Mu.L of upstream primer, 1. Mu.L of downstream primer and 1. Mu.L of ddH 2 O;
The reaction procedure for PCR amplification includes: pre-denaturation at 94℃for 2min; denaturation at 94℃for 30s, annealing at 61.2℃for 30s, elongation at 72℃for 30s,33 cycles; finally, the extension is carried out for 2min at 72 ℃.
Further, the chicken variety is spotted-brown chicken.
The invention discloses the following technical effects:
The CYP27A1 gene is analyzed, a plurality of SNP loci which are obviously related to chicken carcass performance are found, and experiments prove that the molecular marker NC_052579.1 g21963641G > A locus is obviously related to intramuscular fat width, abdominal fat and abdominal fat rate (P < 0.05); there was a significant correlation between nc_052579.1 g21963567a > g site and both leg weight and leg ratio (P < 0.05); nc_052579.1 g21963433a > c site is significantly correlated with leg weight presence (P < 0.05). The molecular marker provided by the invention can accurately identify the carcass traits of chickens, thereby providing technical support for breeding chickens with excellent carcass properties.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a schematic diagram showing the position of CYP27A1 gene on chromosome and primer design;
FIG. 2 is a schematic diagram of SNP locus of CYP27A1 gene.
Detailed Description
Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.
Example 1
1. Materials and methods
1.1 Animal sample
368 80-Day-old Mahonia alternatively (supplied by Jiang Fengshu Co., ltd.) were collected and stored at-80℃with 2mL of subcutaneous venous blood, and used as DNA extraction samples. The carcass traits of the selected populations, such as subcutaneous fat thickness, intramuscular fat width, total evisceration weight, semi evisceration weight, abdominal fat, leg weight, pectoral muscle, living body weight, shin length, shin circumference, carcass weight, pectoral muscle rate, leg rate, abdominal fat rate, lean meat rate, semi evisceration rate, total evisceration rate, slaughter rate, and skin color yellowness values of living cloaca, carcass cloaca, shoulder, buttocks, abdomen, chest, leg, shin, abdominal fat, etc., were recorded.
1.2 Major reagents
Blood sample DNA extraction kit (brand: OMEGA; product number: D3392; guangzhou Living Biotechnology Co., ltd.), 2X ES TAQ MASTER Mix (Dye) (brand: kashi; product number: CW0690M; kashi Biotechnology Co., ltd.), DNAMARKER (brand: tsingke; product number: MD101; jiangsu Norvigour Biotechnology Co., ltd.), high purity low electroosmotic agarose (brand: optimu.S.; product number: TSJ001; beijing Optimu.The.).
1.3 Experimental methods
1.3.1 Primer design
Primers were designed according to the sequence of the CYP27A1 gene (NC_ 052538.1) published by NCBI (National Center for Biotechnology Information Search database) by the family of chickens (Gallus gallus domesticus) using the NCBI primer-BLAST tool, offered by the company Prime Biotechnology, inc. of Guangzhou. The position of CYP27A1 gene on chromosome and the primer design are schematically shown in figure 1. The primer sequence-related information is shown in Table 1.
TABLE 1PCR amplification primer sequences
1.3.2 DNA extraction of blood samples
Blood sample DNA is extracted by reference to a blood sample DNA extraction kit operating manual.
PCR amplification of 1.3.3CYP27A1 Gene sequences
PCR amplification was performed using the above 368 spotted-brown chicken blood sample genomic DNA as a template according to the following reaction system: template DNA 2. Mu.L, 2X ES TAQ MASTER Mix (Dye) 25. Mu.L, upstream primer 1. Mu.L, downstream primer 1. Mu.L and ddH 2 O1. Mu.L.
The reaction procedure: pre-denaturation at 94℃for 2min; denaturation at 94℃for 30s, annealing at 61.2℃for 30s, elongation at 72℃for 30s,33 cycles; finally extending for 2min at 72 ℃; preserving at 4 ℃.
PCR products were submitted to Sanger generation sequencing by the university of armed-day-bright distal biotechnology limited.
1.3.4SNPs determination and genotyping
Sequence peak mapping analysis was performed on Sanger-generation sequencing results of PCR products using Seqman tools in DNAStar software to determine potential SNP sites. Genotyping was performed by SeqMan tools of DNAStar software comparing the sequencing data of each sample.
1.3.5 Genotypic and carcass trait association analysis
SNPs loci and carcass trait data of individuals corresponding to genotypes are subjected to association analysis by using a SAS 9.0GLM program package.
2. Results
2.1CYP27A1 Gene sequence PCR amplification and SNP screening
Selecting 450 spotted-brown chickens, carrying out PCR amplification by taking blood sample DNA of each spotted-brown chickens as a template, carrying out Sanger first-generation sequencing on the obtained PCR product (the nucleotide sequence is shown as SEQ ID NO. 1), comparing and analyzing the sequenced peak diagram, and detecting 3 SNP loci respectively: NC_052579.1:g21963641G > A, NC_052579.1:g21963567A > G, and NC_052579.1:g21963433A > C, as shown in FIG. 2.
SEQ ID NO.1：
CAGCCTGGACGAGGTGTATGGCAGCGTGGCCGAGCTGCTGCTGGCCGGCGTGGACACGGTGAGGGCCACCGGGGCATCCCCAGAAATCTCAGTGCTAGGGGCACGGGCAGGGAAGCGGTCAGTGGAGACCCCATACMCCCCTCTGCCACCTGTCTGCTCTGTGCCTCAGTTTCCCCATTCTCACTGCTTCTCACCCGTCTGCACCCCCAGACCTCCAACACGCTGTGCTGGGCCCTCTACCACCTCTCCCGGGACTTGGGCATCCAGGACCTCTGTATCAGGAGCTGAAAGCCGTCGTGCCCCCAGACCGGTTTCCTGGTGCTGAGGATATCCCCAAGATGCC/>ATGCTGCGGGCTGTTATCAAGGAGACGCTGAGGTACAGCCCCTGTTCCCCTTTGGGTTGGGGTGAGTAGAGTTGGGTTGGCACAGCCTGTTCCCCCACACGAGGGCATGTGTTTAGCGGGGGACCCAGGGAATGGGACGTGGGAGCATTGGCCAGGGTGTAGAGCTGGCTTACAGCCCCTTGGGGCCGCATTCAGCCACCCACCTCCTCCCTGGTGAGGGAGATGGAGCTGCGGAGCAGCAGGAGATATTCTCCCTAGCTCCTGCCTTGGGCTTGGCGGGTCCATCTCCCACAACACCTCTCCCCCTATCCTGGTCCAGGGTGTACCCCGTGGTGCCCACCAACGCCAGGGTCTTCTATGAGAAGGACATCGTCATCGGAGACTACCTCTTCCCCAAGAACGTGAGTGGGGGCTGTGCCGAGGGTACCCCACTGCATCCAAGGCCATTAACCCCTTCTCGCCCTGCAGACCCTCTTTGTCCTGGCTCACTATGCCATGTCCCATGACGAGACCTACTTTCCTGAGCCGG; Wherein M is A or C; r is A or G; "" is NC_052579.1:g21963433A > C site; /(I)At NC_052579.1:g21963567A > G site; /(I)At NC-052579.1 g21963641G > A site.
Correlation analysis of 2.2CYP27A1 gene sequence SNP locus and carcass traits
The above 3 SNP loci were analyzed in association with carcass traits (subcutaneous fat thickness, intramuscular fat width, total evisceration weight, half evisceration weight, abdominal fat, leg weight, pectoral muscle, living body weight, shin length, shin circumference, carcass weight, pectoral muscle rate, leg rate, abdominal fat rate, lean meat rate, half evisceration rate, total evisceration rate, slaughter rate, and skin color yellowness values of living cloaca, carcass cloaca, shoulder, buttock, abdomen, chest, leg, shin, abdominal fat, etc.), and the results are shown in tables 2 to 4.
As shown in table 2, nc_052579.1 g21963641g > a site was significantly correlated with all of the intramuscular fat width, abdominal fat and abdominal fat rate (P < 0.05), with chicken intramuscular fat width, abdominal fat and abdominal fat rate of GG genotype significantly greater than AG genotype and AA genotype.
TABLE 2 association of SNP loci and carcass traits
Note that: the different lower case letters in the upper right hand corner of the data represent significant differences.
As shown in table 3, nc_052579.1 g21963567a > g locus was significantly correlated with both leg weight and leg ratio (P < 0.05), with AA genotypes having significantly greater leg weight and leg ratio than GG genotypes.
TABLE 3 association of SNP loci and carcass traits
Note that: the different lower case letters in the upper right hand corner of the data represent significant differences.
As shown in Table 4, NC_052579.1 g21963433A > C locus was significantly correlated with leg weight presence (P < 0.05), the leg weight of CC genotype was significantly greater than AA genotype.
TABLE 4 association of SNP loci and carcass traits
Note that: the different lower case letters in the upper right hand corner of the data represent significant differences.
The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.
Claims (10)
1. The CYP27A1 single nucleotide polymorphism molecular marker related to chicken carcass traits is characterized in that the nucleotide sequence of the CYP27A1 single nucleotide polymorphism molecular marker is shown in SEQ ID NO. 1; the CYP27A1 single nucleotide polymorphism molecular marker has SNP1, SNP2 and SNP33 single nucleotide polymorphism sites;
the SNP1 is positioned at NC_052579.1:g21963641 site, and G > A mutation exists;
The SNP2 is located at NC_052579.1:g21963567 site, and A > G mutation exists;
The SNP3 is located at NC_052579.1:g21963433 site, and an A > C mutation exists.
2. The CYP27A1 single nucleotide polymorphism molecular marker according to claim 1, wherein the genotype of said SNP1 is GG, GA or AA; the genotype of the SNP2 is AA, AG or GG; the genotype of SNP3 is AA, AC or CC.
3. A primer pair for amplifying the CYP27A1 single nucleotide polymorphism molecular marker of claim 1, wherein the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID No.2, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID No. 3.
4. Use of a primer pair as claimed in claim 3 in the preparation of a kit for identifying a chicken carcass trait.
5. A kit for identifying chicken carcass traits comprising the primer pair of claim 3.
6. Use of the CYP27A1 single nucleotide polymorphism molecular marker of claim 1 or 2, the primer pair of claim 3, or the kit of claim 5 for identifying chicken carcass traits.
7. The use according to claim 6, wherein the chicken breed is spotted-brown.
8. A method for identifying chicken carcass traits comprising the steps of:
extracting genomic DNA of a chicken to be detected, and carrying out PCR amplification by using the primer pair of claim 3 by taking the genomic DNA as a template to obtain an amplification product;
Sequencing the amplification products, detecting genotypes of SNP1, SNP2 and SNP33 single nucleotide polymorphism sites, and identifying carcass traits of the chickens to be detected according to genotype detection results:
When the genotype of the SNP1 is GG, the fat width, the fat percentage and the fat percentage of the chicken muscle are larger than the GA genotype and the AA genotype;
When the genotype of the SNP2 is AA, the leg weight and the leg ratio are larger than those of the GG genotype;
when the genotype of the SNP3 is CC, the legweight of the SNP3 is greater than the AA genotype;
the SNP1 is positioned at NC_052579.1:g21963641 site, and G > A mutation exists;
The SNP2 is located at NC_052579.1:g21963567 site, and A > G mutation exists;
The SNP3 is located at NC_052579.1:g21963433 site, and an A > C mutation exists.
9. The method of claim 8, wherein the amplification system of PCR amplification comprises: 2. Mu.L of template DNA, 2X ES TAQ MASTER Mix 25. Mu.L, 1. Mu.L of upstream primer, 1. Mu.L of downstream primer and 1. Mu.L of ddH 2 O;
The reaction procedure for PCR amplification includes: pre-denaturation at 94℃for 2min; denaturation at 94℃for 30s, annealing at 61.2℃for 30s, elongation at 72℃for 30s,33 cycles; finally, the extension is carried out for 2min at 72 ℃.
10. The method of claim 8, wherein the chicken breed is spotted-brown.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410080416.2A CN117904314A (en) | 2024-01-19 | 2024-01-19 | CYP27A1 single nucleotide polymorphism molecular marker related to chicken carcass traits and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410080416.2A CN117904314A (en) | 2024-01-19 | 2024-01-19 | CYP27A1 single nucleotide polymorphism molecular marker related to chicken carcass traits and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117904314A true CN117904314A (en) | 2024-04-19 |
Family
ID=90681434
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410080416.2A Pending CN117904314A (en) | 2024-01-19 | 2024-01-19 | CYP27A1 single nucleotide polymorphism molecular marker related to chicken carcass traits and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117904314A (en) |
-
2024
- 2024-01-19 CN CN202410080416.2A patent/CN117904314A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114438231B (en) | CRELD1 gene molecular marker related to chicken carcass traits and application | |
| CN113913538B (en) | SNP molecular marker related to chicken carcass traits and application | |
| CN114457170B (en) | DNAJC30 gene molecular marker related to chicken carcass traits and application thereof | |
| CN104673902B (en) | SNP molecular marker related to breast muscle weight and breast muscle percentage of chicken and application of SNP molecular marker | |
| CN114736973A (en) | SNP molecular marker related to chicken carcass skin color trait and application thereof | |
| CN114369669B (en) | Molecular marker related to pork quality traits and application thereof | |
| CN115820870B (en) | CDK5 gene molecular marker related to chicken complexion and carcass traits and application | |
| CN115896299B (en) | PSMD3 gene molecular marker related to chicken complexion traits and carcass traits and application | |
| CN115851966B (en) | ApoD gene molecular marker related to chicken carcass traits and application | |
| CN116179714B (en) | Molecular marker related to chicken slaughtering and meat quality characteristics and breeding method of high-quality slaughtering and processing type novel variety | |
| CN115181805B (en) | Molecular marker related to yellow-feather broiler leg skin yellowness and application thereof | |
| CN117904314A (en) | CYP27A1 single nucleotide polymorphism molecular marker related to chicken carcass traits and application thereof | |
| CN112176073B (en) | PROS1 gene molecular marker related to chicken carcass traits and application | |
| CN110835651B (en) | Primer and kit for detecting indel multiple allele markers of chicken CDKN3 gene promoter region and application of primer and kit | |
| CN116334235B (en) | SERCA2 gene molecular marker related to chicken carcass traits and application thereof | |
| CN116814801B (en) | LncEDCH1 gene molecular marker related to chicken skin yellowness and application thereof | |
| CN117004740B (en) | Application of EDNRB2 gene SNP molecular marker in molecular assisted breeding of black-bone chickens | |
| CN116694774A (en) | LncEDCH1 gene molecular marker related to chicken carcass traits and application thereof | |
| CN115838809B (en) | Molecular marker related to chicken slaughter traits and breeding method of new slaughter processing type strain | |
| CN116837110B (en) | SNP locus on chromosome 7 and related to chicken growth traits and application thereof | |
| CN116987795B (en) | Molecular marker combination for identifying recessive white feather chicken and application thereof | |
| CN106367519A (en) | Method for improving slaughter performance of Jinghai yellow chicken by MSTN genes | |
| CN114350821B (en) | Molecular marker related to pig muscle pH value and lean meat percentage and application thereof | |
| CN114854867B (en) | Molecular marker related to abdominal fat character of yellow-feathered broiler chicken and application thereof | |
| CN110144405B (en) | Chicken weight character gene diagnosis kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |