CN117881774A

CN117881774A - Genetically modified Saccharomyces yeast strains as prophylactic and therapeutic agents

Info

Publication number: CN117881774A
Application number: CN202280055995.4A
Authority: CN
Inventors: 余华; L·尼亚萨伊; K·霍本; 杨智勇
Original assignee: Fzatukh Co ltd
Current assignee: Fzatukh Co ltd
Priority date: 2021-06-11
Filing date: 2022-06-10
Publication date: 2024-04-12

Abstract

The present disclosure relates to engineered yeast strains that express therapeutic polypeptides and/or include nucleic acids encoding therapeutic polypeptides, as well as methods and uses thereof.

Description

Genetically modified Saccharomyces yeast strains as prophylactic and therapeutic agents

Cross Reference to Related Applications

The present application claims the benefit of priority date of U.S. provisional application 63/209,651 filed on day 11 of 6.2021, U.S. provisional application 63/299,693 filed on day 14 of 1.2022, and U.S. provisional application 63/317,385 filed on day 7 of 3.2022, each of which is incorporated herein by reference in its entirety.

Background

Production of conventional therapeutic polypeptides in bioreactors on a scale of more than one liter (e.g., small, large, or commercial scale), followed by downstream purification of the therapeutic polypeptide is an expensive and time-consuming process. In the united states, therapeutic polypeptides intended for administration by injection or infusion must meet the current good production specification (CGMP) specifications of the FDA in the united states to determine identity, strength, purity, and other qualities. Furthermore, purified polypeptides (e.g., therapeutic polypeptides) are well known to be fragile and may misfold, aggregate, or precipitate, which can lead to loss of efficacy. Thus, maintaining the efficacy of a therapeutic polypeptide from production to administration may require careful formulation, gentle handling, and/or cold chain partitioning of the fragile purified therapeutic polypeptide.

For example, these factors make the development, production and partitioning of therapeutic polypeptides more expensive than small molecules that are also used for therapeutic purposes. In addition, therapeutic polypeptides are typically administered by health professionals using injection or intravenous infusion, which requires the patient to go to a health care facility for treatment. This may reduce patient compliance and lead to poor patient outcome.

Some therapeutic polypeptides include, for example, monoclonal antibodies. Some examples include, but are not limited to adalimumab (adalimumab), infliximab (infliximab), secukinumab (securinumab), and exelizumab (ixekizumab), which neutralize pro-inflammatory cytokines and are very successful in treating many inflammatory diseases. However, these therapeutic polypeptides require needle injections and their long-term use is accompanied by loss of potency and serious side effects due to anti-drug antibody responses and systemic immunosuppression. In addition, other routes of administration are currently limited in that delivering therapeutic polypeptides (e.g., proteins, polypeptides, antibodies, or functional fragments thereof) to the Gastrointestinal (GI) tract via the oral route must overcome several major obstacles 1) it is expensive to produce large quantities of therapeutic polypeptides for oral delivery; 2) Therapeutic polypeptides are sensitive to the high acidity of gastric juice and may lose efficacy; and 3) therapeutic polypeptides are generally sensitive to GI enzyme digestion and lose efficacy.

Despite advances in research related to, for example, crohn's disease, ulcerative colitis, celiac disease and other inflammatory conditions or inflammation-related conditions, there is still a lack of powerful and effective therapies for long-term use. Furthermore, there is a definite commercial and medical need for therapeutic polypeptides that are inexpensive and can be prepared without the need for downstream polypeptide processing and purification, that are non-immunogenic, that avoid cold chain partitioning and refrigeration, and that are patient friendly, e.g., that can be self-administered in an oral dosage form.

The present disclosure meets these and other needs.

Disclosure of Invention

The present disclosure provides a platform for oral delivery routes for therapeutic polypeptides using engineered Saccharomyces yeasts capable of synthesizing such therapeutic polypeptides in the gut. The present disclosure also provides methods of treatment using the disclosed platforms, as well as additional related methods and uses.

In one aspect, the present disclosure provides an engineered saccharomyces yeast strain comprising:

at least one site-specific chromosomal insertion of a nucleic acid encoding a therapeutic polypeptide,

wherein the therapeutic polypeptide is selected from the group consisting of binding proteins including antigen binding domains, immunoglobulins, antibodies, cytokines, hormones and chemokines or combinations thereof.

In some embodiments, the yeast is saccharomyces boulardii (Saccharomyces boulardii).

In some embodiments, the yeast further comprises a complete or partial deletion of URA 3. In some embodiments, the yeast further comprises a complete or partial deletion of GAP 1. In some embodiments, the yeast is ura3 (-/-) and gap1 (-/-).

In some embodiments, the nucleic acid encoding the therapeutic polypeptide is incorporated into at least two different locations in the genome of the yeast or at least one hotspot in the genome of the yeast. In some embodiments, the nucleic acid encoding the therapeutic polypeptide is incorporated into at least two different chromosomes. In some embodiments, the at least two different chromosomes include chromosomes VII and XVI.

In some embodiments, the yeast may further comprise a nucleic acid sequence encoding a dihydrofolate reductase (DHFR) incorporated into the genome of the yeast, wherein the DHFR is optionally mammalian DFHR. Additionally or alternatively, in some embodiments, the yeast can further comprise one or more exogenous nucleic acids encoding yeast DFR 1.

In some embodiments, the therapeutic polypeptide is a binding protein comprising a structure selected from the group consisting of: VHH, fc-VHH, VHH-Fc, VHH-VHH, fc-VHH, VHH-Fc-VHH, and VHH-Fc, wherein each or any one of the VHH or Fc domains is linked to another VHH or Fc domain by an optional linker sequence.

In some embodiments, the therapeutic polypeptide is a binding protein that binds to TcdA, tcdB, or a combination thereof. In some embodiments, the therapeutic polypeptide comprises the amino acid sequence of SEQ ID NO. 5.

In some embodiments, the therapeutic polypeptide is a binding protein that binds to TNF- α. In some embodiments, the binding protein is an IgG or comprises at least one VHH domain. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs 6, 7, 19 and 20.

In some embodiments, the therapeutic polypeptide is a binding protein that binds to IL-17A. In some embodiments, the binding protein is an IgG or comprises at least one VHH domain. In some embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO. 25.

In some embodiments, the therapeutic polypeptide is a bispecific binding protein that binds to TNF- α and IL-17A. In some embodiments, the binding protein is an IgG or comprises at least two VHH domains. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs 8, 9 and 10.

In some embodiments, the therapeutic polypeptide is a binding protein that binds to a norovirus or rotavirus. In some embodiments, the binding protein is an IgG or comprises at least one VHH domain. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs 13, 14, 15 and 16.

In some embodiments, the therapeutic polypeptide is a VHH that binds to cwp84 and is fused to a lysin domain. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs 21 and 22.

In some embodiments, the therapeutic polypeptide is a cytokine or chemokine. In some embodiments, the cytokine is IL-22 or IL-10. In some embodiments, the cytokine or the chemokine is fused to an Fc domain. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs 11, 12 and 27.

In some embodiments, the therapeutic polypeptide is GLP1. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs 17, 23 and 24.

In some embodiments, the therapeutic polypeptide is leptin. In some embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO. 18.

In some embodiments, the yeast comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 or more copies of the nucleic acid encoding the therapeutic polypeptide incorporated into its genome.

In some embodiments, the yeast may further comprise at least one site-specific chromosomal insertion of a second nucleic acid encoding a second therapeutic polypeptide, wherein the second therapeutic polypeptide is selected from the group consisting of binding proteins including VHH domains, immunoglobulins, cytokines, and chemokines, or combinations thereof.

In another aspect, the present disclosure provides methods of binding to an antigen in vivo, the methods comprising administering an engineered saccharomyces yeast strain as disclosed herein (e.g., the foregoing aspects and examples) to a subject. In some embodiments, the antigen is selected from both TcdA, tcdB, tcdA and TcdB, TNF- α, IL-17A, TNF- α and IL-17A, cwp84, rotavirus protein, or norovirus protein.

In another aspect, the present disclosure provides a method of treating or preventing a disease or condition, the method comprising administering to a subject in need thereof an effective amount of an engineered saccharomyces yeast strain of any one of claims 1 to 37.

In some embodiments, the disease or condition is an inflammatory condition. In some embodiments, the inflammatory condition is selected from Inflammatory Bowel Disease (IBD), intestinal inflammation, crohn's disease, and ulcerative colitis.

In some embodiments, the disease or condition is an infection. In some embodiments, the infection is clostridium difficile infection (c.diffiie infection), norovirus infection, rotavirus infection, or a combination thereof. In some embodiments, the subject is further afflicted with IBD.

In some embodiments, the disease or condition is Irritable Bowel Syndrome (IBS).

In some embodiments, the disease or condition is a neurodegenerative disease.

In some embodiments, the disease or condition is diabetes.

In some embodiments, the disease or condition is obesity.

In some embodiments, the disease or condition is fatty liver disease.

In some embodiments, the disease or condition is a metabolic disease.

In some embodiments, the disease or condition is Graft Versus Host Disease (GVHD).

In some embodiments, the disease or condition is an autoimmune disease.

In another aspect, the present disclosure provides a method of selecting an engineered saccharomyces yeast strain, wherein the saccharomyces yeast comprises a nucleic acid sequence encoding a dihydrofolate reductase (DHFR), one or more exogenous nucleic acids encoding a yeast DFR1, or a combination thereof incorporated into the genome of the yeast, the method comprising contacting the saccharomyces yeast with methotrexate (methotrexate) and a sulfonamide. In some embodiments, the DHFR is mammalian DHFR.

In some embodiments, the methotrexate is at a concentration of 1nM to 1mM. In some embodiments, the concentration of the sulfonamide is 0.1 to 10mg/mL.

In some embodiments, the engineered saccharomyces yeast strain comprises: at least one site-specific chromosomal insertion of a nucleic acid encoding a therapeutic polypeptide, wherein the therapeutic polypeptide is selected from the group consisting of binding proteins including antigen binding domains, immunoglobulins, antibodies, cytokines, hormones, and chemokines, or combinations thereof.

In some embodiments, the yeast is saccharomyces boulardii.

In some embodiments, the yeast is ura3 (-/-) and gap1 (-/-).

In some embodiments, the nucleic acid encoding the therapeutic polypeptide is incorporated into at least two different locations in the genome of the yeast.

In some embodiments, the yeast further comprises at least one site-specific chromosomal insertion of a second nucleic acid encoding a second therapeutic polypeptide, wherein the second therapeutic polypeptide is selected from the group consisting of binding proteins including VHH domains, immunoglobulins, cytokines, and chemokines, or combinations thereof.

Other systems, methods, features, and advantages of the disclosure will be or become apparent to one with skill in the art upon examination of the following figures and detailed description. It is intended that all such additional systems, methods, features and advantages be included within this description, be within the scope of the present disclosure, and be protected by the accompanying claims. In addition, all optional and preferred features and modifications of the embodiments described may be made to the various aspects of the disclosure taught herein. Furthermore, the individual features in the dependent claims as well as all optional and preferred features and modifications of the embodiments are combinable and interchangeable with each other.

Drawings

Many aspects of the disclosure can be better understood with reference to the following drawings. The components in the drawings are not necessarily to scale, emphasis instead being placed upon clearly illustrating the principles of the present disclosure. Moreover, in the figures, like reference numerals designate corresponding parts throughout the several views.

FIGS. 1A-1E show in vitro characterization of previously developed strain Sb-ABAB transformed with a plasmid containing an ABAB transgene cassette (pURA 3-AT-yABAB-cMyc) using similar techniques as disclosed herein. Fig. 1A: ABAB antibodies in Sb-ABAB culture supernatants detected by western blotting with antibodies specific for cMyc tags. Fig. 1B: toxin-neutralizing activity of Sb-ABAB culture supernatants compared to purified Fc-ABAB. Fig. 1C: in vitro growth of Sb, sb-EP (Brevibacterium strain carrying empty plasmid as control) and Sb-ABAB. Fig. 1D: ABAB expression levels in Sb-ABAB culture supernatants after multiple passages. Fig. 1E: antibiotic resistance spectra of wild type Sb and Sb-ABAB.

FIGS. 2A-2F show in vivo characterization of previously developed strain Sb-ABAB. Fig. 2A: mice pre-exposed to antibiotics were given daily gavages of PBS, sb, sb-EP and Sb-ABAB (10 ¹⁰ CFU) for 7 days. Fig. 2B: mice body weight was monitored. Fig. 2C: the different groups were monitored for yeast shedding and CFU peaked on day 1 after the gavage, but dropped rapidly to undetectable levels 3 days after the last dose. Fig. 2D: the intestinal lavage fluid collected on day 3 was able to neutralize TcdB (10 pg/mL) on the Vero cell monolayer. Fig. 2E: for yeast strain Sb-ABAB (f) recovered from fecal samples, ABAB expression levels of Sb-ABAB culture supernatants after multiple passages in vitro compared to non-passaged strains from frozen stock. Fig. 2F shows ABAB levels of day 3 feces as determined by ELISA. All experimental data represent one of at least three individual experiments of 3 mice per group and are presented in ± s.e.m.

Figures 3A-3D show that bivalent anti-TNF-alpha VHH-Fc fusions are significantly more effective than monovalent anti-TNF-alpha VHH in neutralizing TNF-alpha cytotoxicity. L929 cells (FIG. 3A) were treated with 100ng/mL TNF- α (FIG. 3B) alone or with monovalent anti-TNF- α (FIG. 3C) or divalent anti-TNF- αVHH-Fc (FIG. 3D) for 6 hours or 24 hours. Cell rounding was observed under a microscope (this may indicate apoptosis).

Figures 4A-4G show that oral Sb-amTNF (FZ 006 m) protects mice from DSS-induced colitis and co-disease of DSS and CDI. Figure 4A shows that oral administration of FZ0006m has a protective trend against DSS-induced colitis (a model of mild colitis). More severe co-morbid disease models are used in fig. 4B-4G. PBS or engineered yeast was orally administered daily to DSS-colitis and CDI co-ill mice 3 days before and 7 days after Clostridium difficile spore challenge. (FIGS. 4B-4F) oral Sb-amTNF protected mice from weight loss (FIG. 4B), death (FIG. 4C), up-regulation of inflammatory cytokines TNF- α (FIG. 4D) and IL-6 (FIG. 4E), colon length reduction (FIG. 4F) and colon tissue damage (FIG. 4G). n=10. Indicates P <0.05; p <0.01 and P <0.001.

FIGS. 5A-5C show the activity of dimeric anti-TNF-. Alpha.VHH. Fig. 5A: neutralization activity. Serial dilutions of VHH-Fc or Humira were mixed with 10pM human TNF- α prior to application to L929 cells. After 24 hours incubation, antibody-mediated cytotoxicity inhibition was measured. Fig. 5B: binding affinity. Binding of serially diluted G1 or Humira to TNF- α coated ELISA plates. Fig. 5C: blocking the interaction of TNF-alpha and TNFR 1. Serial dilutions of G1 or Humira were mixed with 100ng/ml biotinylated human TNF- α and then added to TNFR1 coated wells. The ability of the antibodies to inhibit TNF- α binding to TNFR1 was determined by competition ELISA.

FIGS. 6A-6C show characterization of the Sb-ahTNF (FZ 006) strain. Fig. 6A: the growth rates of the two Sb-ahTNF strains were comparable to their parent strains. Fig. 6B: antibodies were stably produced from Sb-ahTNF after extensive in vitro culture. Sb-ahTNF or Sb-EP was passaged in YPD medium starting at 0.1OD for 8 days. Supernatants from each 24 hour culture were collected and the expression of ahTNF was measured by ELISA. Fig. 6C: the neutralization activity of ahTNF in the supernatant of day 7 culture of Sb-ahTNF in FIG. 6B. The concentration of antibodies in the supernatant was determined by ELISA and then serially diluted prior to mixing with 3ng/ml recombinant human TNF- α. After 30 minutes incubation, the mixture was applied to an L929 monolayer and with resazurin viabilityThe kit measures cytotoxicity. The control group contained purified G1 at the same concentration and

figures 7A-7D show that oral administration of Sb-amTNF and Sb-ABAB protected mice from co-disease of CDI and adoptive T cell transfer colitis (TCC). Fig. 7A: schematic of experimental design. RAG for T cell transfer ^-/- Groups of mice (n=4) were challenged with clostridium difficile spores and then treated with PBS or yeast. Mice were sacrificed and colon tissue was analyzed. Fig. 7B: h of colon tissue of mice of different groups &E, dyeing: a) RAG (radio Access gateway) ^-/- B) TCC, c) TCC treated with Sb-amTNF, d) TCC+CDI, e) TCC+CDI treated with Sb-ABAB, and f) TCC+CDI treated with Sb-amTNF and Sb-ABAB. Fig. 7C: histological scoring of fig. 7B. The scores were evaluated blindly based on signs of colon morphology, inflammatory cell infiltration, and cell death. Normal control RAG ^-/- Mice scored 0, no inflammation; TCC mice showed moderate inflammation; tcc+cdi mice showed severe inflammation. TCC mice treated with Sb-amTNF showed low inflammation; co-diseased mice treated with Sb-ABAB showed moderate inflammation that was reduced to mild inflammation when also treated with Sb-amTNF. The P values between the groups are shown. Fig. 7D: fold changes in IFN-gamma mRNA expression between the indicated groups were compared and P values between the groups are shown.

FIG. 8 shows the concentration of ABAB antibodies secreted into the supernatants of parent strain, pep4 mutant clone and negative control culture in YPD rich medium as measured by ELISA.

Figures 9A-9B demonstrate the kinetics of Sb-ABAB colonization and ABAB secretion in piglets. Two fixed bacteria piglets (2 days old) were treated daily for 10 ¹⁰ Sb-ABAB feeding of CFU was continued for 11 days (from day 1 to day 11). Fecal exchanges were collected daily starting 1 day before oral Sb-ABAB and continuing until 3 days after the last administration. Fecal Sb-ABAB CFU (fig. 9A) and ABAB concentrations (fig. 9B) were determined as measured by ELISA.

FIGS. 10A-10B show the efficacy of Sb-ABAB in preventing CDI in mice. Fig. 10A shows a kaplan-meyer survival curve. Fig. 10B shows H & E stained colon tissue sections. Statistical analysis was performed by comparing the indicated groups using a log rank (Mantel-Cox) test. N=10, p <0.05.

FIG. 11 shows that oral administration of Sb-ahTNF reduced TcdB-induced expression of TNF- α in human colon tissue. Fresh human colon tissue was obtained from normal areas of colon cancer patients (UCLA pathology). Tissues were cut to 3X 3mm size and placed in RPMI 1640 medium (1 ml). Tissues were not treated with any material (blank) or with supernatant (2.5 μl) from Sb-EP or Sb-ahTNF cultures for 30 minutes, followed by PBS or toxin B addition. The tissue was then incubated at 37℃for 4 hours. TNF- α levels in the supernatants were measured by ELISA (DY 210, R & D system).

Figures 12A-12B demonstrate that repeated doses of oral Sb-amTNF do not induce an anti-drug antibody response. Fig. 12A shows a simplified diagram of the experimental design. Mice (n=5) were treated with PBS, sb-amTNF (10) ⁹ CFU/dose) or purified anti-TNF-alpha VHH/VHH-Fc (10 mg/Kg per injection). The Sb-amTNF oral treatment was three courses daily with a total of 36 doses. Purified anti-mouse VHH/VHH-Fc fusion polypeptide ip was injected for two courses of 6 doses total. Fecal and serum samples were collected for ELISA. Figure 12B shows ELISA detection of fecal IgA and serum IgG responses. Fecal samples (1:1 w/v in PBS) and serum samples (1000 fold diluted in PBS) were added to ELISA plates coated with purified anti-TNF VHH/VHH-Fc and the OD of IgA in feces and IgG in serum samples was measured.

FIG. 13 shows a summary of the gene insertion method.

FIG. 14 shows exemplary DNA sequences for developing homology arms for engineered Saccharomyces boulardii strains.

Fig. 15 shows schematic diagrams of delta and sigma insertion sites.

FIG. 16 shows the transformation efficiency at sigma and delta sites.

FIG. 17 shows the average yeGFP fluorescence after 24 hours incubation of clones inserted with GOI at the sigma or delta sites.

FIG. 18 shows that the ABAB expression level of the gene of interest inserted in pTEF or pTDH3 is 3-5 times higher than that of the gene of interest inserted in delta site.

FIG. 19 shows the stability of FZ002 clones. The different clones were passaged daily for 11 days. The supernatant from the 24 hour culture was used to measure ABAB expression by ELISA.

FIG. 20 shows the early generation of ABAB by cloning. Different clones of indicated cell numbers were cultured for 3 hours and ABAB in the supernatant was measured.

FIG. 21 shows a comparison of expression of anti-human TNF- α -Fc at different insertion positions (pTEF, pTDH3 and delta sites). FZ006h is a strain with the insertion of an anti-human TNF- α -Fc cassette at the delta site, while growing robustly in both YPD and SDCAA media, and with the highest and stable expression levels in clones with the same insertion site. To examine the expression properties of anti-human TNF- α -Fc from strains in which the gene cassette of interest was inserted in the promoters of TEF and TDH3, the expression levels of anti-human TNF- α -Fc from pTEF-and pTDH 3-inserted strains were compared with the expression levels of FZ006 h. Based on the standard curve (left), the expression level of anti-human TNF- α -Fc of saccharomyces boulardii with the gene of interest inserted in pTEF or pTDH3 was 2-5 times higher than that inserted at the delta site.

FIG. 22 shows the production of uracil auxotrophic B.brucella strains. Knockout of the Ura3 gene (top) was accomplished using wild-type saccharomyces boulardii chemically transformed with a G418 antibiotic resistant knockout cassette to replace the Ura3 gene and its promoter by homologous recombination. The antibiotic cassette is flanked by LoxP sites. For isolation of double allelic knockout (Ura 3 ^-/- ::G418 ^+/+ ) The screening strategy of the clone (bottom) was performed by transformed b.brucei clone, containing G418 and p Ura3 ^+/+ Or Ura3 ^+/- The Brevibacterium clone that successfully deleted the Ura3 gene in both alleles was isolated on minimal complete medium of the yeast toxic counter-selector 5' FOA.

FIG. 23 shows Ura3 ^-/- ::G418 ^+/+ Candidate clones (E37 and E38) could be grown on media containing either (i) 5' FOA or (ii) G418, but not on media lacking uracil.

FIG. 24 shows Ura3 ^-/- ::G418 ^+/+ PCR on genomic DNA of the candidate clones (E37 and E38) confirmed the loss of the URA3 gene in both alleles and the gene was replaced by the G418 antibiotic resistance cassette.

FIG. 25 shows the knockout of GAP1 gene. Uracil auxotrophs (Ura 3) ^-/- ::G418 ^+/+ Clone E38) was chemically transformed with a phleomycin antibiotic resistance knockout cassette to replace the GAP1 gene and its promoter by homologous recombination. The antibiotic cassette is flanked by LoxP sites.

FIG. 26 shows the selection and isolation of knockdown clones as GAP1 (-/-): phleo (+/+) s. Transformed Sb clones that successfully deleted the GAP1 gene (an extremely rare event) in both alleles were isolated on minimal medium containing L-proline as a nitrogen source and the counter-selector D-histidine, toxic to yeast cells as GAP1+/+ or GAP1 +/-.

FIG. 27 shows that GAP1 (-/-): phleo (+/+) candidate clones (A2-1, A2-6, A2-7) can be grown on media containing (i) 0.16% or 0.5% D-His or (ii) 5ug/mL phleomycin, but not on minimal media with L-citrulline as the sole nitrogen source.

FIG. 28 shows that PCR on the genomic DNA of the GAP1 (-/-): phleo (+/+) candidate clone (A2-1) confirms the loss of the GAP1 gene in both alleles and that the gene was replaced by a phleomycin antibiotic resistance cassette.

FIG. 29 shows excision of both antibiotic cassettes at the URA3 and GAP1 loci. To remove both the G418 antibiotic resistance cassette and the phleomycin antibiotic resistance cassette in Sb clone A2-7, the cells were chemically transformed with a plasmid carrying Cre recombinase (pPL 5071-TEF1-Cre-URA 3). Successful transformants were isolated on uracil-deficient medium. Random clones were selected and 3 rounds of re-streaking (passaging) were performed on various selection media to (i) lose the pPL5071 plasmid while confirming the loss of both antibiotic cassettes.

FIG. 30 shows simultaneous screening of clones that successfully excised both antibiotic cassettes and lost Cre recombinase plasmid. (i) candidate clones grew well on rich medium. (ii) No growth on ypd+g418, (iii) ypd+phleomycin indicated that both the G418 antibiotic resistance cassette and the phleomycin antibiotic resistance cassette were lost. Likewise, GAP (-/-) and URA3 (-/-) states were confirmed by failure to grow on (iv) MC L-citrulline medium and (v) SD-URA, respectively. (vi) Growth on SC+5' FOA confirms that the candidate clone does not carry any URA3 gene and therefore the pPL5071-TEF1-Cre-URA3 plasmid is lost.

Figure 31 shows that loss of both antibiotic cassettes at URA3 and GAP1 loci was confirmed by PCR.

Figure 32 shows a verification that no antibiotic cassette is present anywhere in the genome.

FIG. 33 shows that the mean expression level of mIL-22 correlates with MTX concentration in DHFR selection.

FIG. 34 shows the screening of clones expressing anti-hIL-17A-Fc with the gene of interest (GOI) cassette inserted at the delta site using URA3 or DHFR selection markers. After transformation of FZMYA06-16 (URA 3-/-, GAP 1-/-) strain with DNA fragments containing GOI cassette together with URA3 or DHFR selection marker cassette flanked by delta insertion homology arms. Positive clones were selected from the following corresponding plates: sdcaa+ura3 plates for URA3 selection and ypd+mtx for DHFR selection. 184 positive clones were each sub-cultured in 600. Mu.L of YPD at 37℃with shaking at 250rpm for 24 hours. Culture supernatants were diluted 10-fold and tested by ELISA. Data read out at OD450 nm.

FIG. 35 shows the selection of clones expressing anti-hTNF- α -Fc with the GOI cassette inserted at the pTDH3 locus using URA3 or DHFR selection markers. After transformation of FZMYA06-16 (URA-/-, GAP 1-/-) strain with a DNA fragment comprising the GOI cassette together with the URA3 or DHFR selection marker cassette flanked by pTDH3 homology arms. Positive clones were selected from the following corresponding plates: uracil-free SDCAA for URA3 selection and YPD+MTX for DHFR selection. 84 positive clones were each sub-cultured in 600. Mu. LYPD at 37℃with shaking at 250rpm for 24 hours. Culture supernatants were diluted 20-fold and tested by ELISA. Data read out at OD450 nm.

Figure 36 demonstrates that Pep4 deletion enhances secreted polypeptide stability. The concentration of ABAB antibodies in the supernatant of pep4 mutant clones in minimal medium and parent and WT strain cultures was determined by ELISA and adjusted to account for the difference in optical density, expression/OD 600 (E/O), of the cultures measured at 600-nm wavelength.

FIG. 37 shows that potential Thr1 and Thr4 null clones (numbered sectors) were grown on YPD-rich and minimal SD (threonine-free) medium. Controls comprising parent (+) and Saccharomyces cerevisiae thr1 (-) strains.

FIG. 38 shows that Thr1 and Thr4 null clones grew on YPD-rich and minimal SD medium without threonine (SD) or with standard 76ug/mL threonine (SD+threonine). Comprising parent (+) and Saccharomyces cerevisiae thr1 (-) strains.

FIG. 39 shows the inoculation of cultures with equal numbers of given yeast strains and GFP+ cells in minimal medium. GFP fluorescence relative to culture density at the 16 hour time point is shown here. Fresh medium was inoculated daily with competing cultures for four consecutive days. Values were normalized to WT. Gfp+ is only a non-competing culture of GFP-expressing cells.

FIG. 40 shows B.brucella expressing anti-TNF-. Alpha.VHH3 (Sb.). anti-TNF-. Alpha.VHH3-HA expressed in Sb. (VHH form) was transformed with different selection markers (grey and black, URA3 auxotroph selection; color, FZE1 selection). The 100-fold diluted supernatant collected after 48 hours incubation was reactive with human TNF- α and the HA tag was detected by HRP-anti-HA tag. Specific binding activity was measured at OD450 nm.

FIG. 41 shows B.brucella expressing anti-TNF-. Alpha.VHH3 (Sb.). Transformed Sb. expressed anti-TNF-. Alpha.VHH3-HA (VHH form, orange line) and anti-TNF-. Alpha.VHH3 s-Fc (black line). Serial dilutions of supernatant collected after 48 hours of culture were mixed with human TNF- α (3 ng/ml) prior to application to L929 cells. After 24 hours incubation, antibody-mediated cytotoxicity was inhibited in% presentation. Sb. expressed anti-TNF-alpha VHH3-Fc supernatant was more potent than anti-TNF-alpha VHH3 alone.

FIG. 42 shows the neutralizing activity of anti-TNF-. Alpha.VHH3 expressing yeast supernatant. The transformed b.brucella expresses anti-TNF-alpha VHH3 (VHH form). The 40-fold diluted supernatant collected after 72 hours of induction culture was mixed with human TNF-. Alpha.6.25 ng/ml prior to application to L929 cells. After 24 hours incubation, antibody-mediated cytotoxicity inhibition was measured as proliferation FLI. The red line shows the "proliferation FLI" of the untransformed b.

FIG. 43 shows the expression of functional Sc-FV-Fc antibodies by an Expi293 cell. Expression of Sc-FV-Fc by Expi293 was measured by SDS gel (top) and ELISA (bottom). Less than 5. Mu.l of the supernatant was loaded onto SDS gel for quantification. Lane 1: AVA LV-GS-HV-Fc; lane 2: CAN LV-GS-HV-Fc; lanes 3, 4: GIM LV-GS-HV-Fc; lane 5:1 μg BSA; lanes 6, 7: HUM LV-GS-HV-Fc; lanes 8, 9: MAV-LV-GS-HV-Fc; lanes 10, 11: SILT LV-GS-HV-Fc. Quantitative ELISA was performed by reacting 50-fold diluted supernatants with protein a coated ELISA wells. HRP conjugated goat anti-human IgG (γ) was used to detect antibody binding at OD450 nm. anti-TNF-. Alpha.VHH3/VHH3-Fc was used as a standard. To detect specific antigen binding activity, serial dilutions of the supernatant were added to the corresponding antigen-coated ELISA wells and detected by HRP conjugated goat anti-human IgG (γ) at OD450 nm. The data are summarized in table (bottom). Y is.

FIG. 44 shows the expression of Sc-Fv-Fc antibodies by Saccharomyces boulardii (Sb.). Sb. expression of Sc-FV-Fc was measured by ELISA. The supernatant Sb. expressing Sc-FV-Fc was collected after 48 hours of culture in YPD. 2-fold diluted supernatant was added to the protein a coated ELISA wells. HRP conjugated goat anti-human IgG (γ) was used to detect antibody binding at OD450 nm. anti-TNF-. Alpha.VHH3/VHH3-Fc was used as a standard. To detect specific antigen binding activity, 2-fold dilutions of the supernatant were added to the corresponding antigen-coated ELISA wells and detected by HRP conjugated goat anti-human IgG (γ) at OD450 nm. ND, undetermined.

FIG. 45 shows the expression of functional VHH (monomeric, dimeric), VHH-Fc, VHH-Sc-FV, VHH-Fc-VHH antibodies by Saccharomyces boulardii (Sb.). Sb. expression of Sc-FV-Fc and antigen-specific binding activity were measured by ELISA. The supernatant Sb. expressing Sc-FV-Fc was collected after 48 hours of culture in YPD. Serial dilutions of the supernatant were added to the protein a coated ELISA wells. The HA or Fc tag was detected by HRP-anti-HA tag and HRP conjugated goat anti-human IgG (γ) respectively. OD450 nm was measured. Biological activity is detected by neutralization assay. ND, undetermined; NA, not available.

FIG. 46 shows an exemplary mouse db/db obesity model experimental design.

FIG. 47 shows that FZ010m decreases blood glucose in db/db mice. Male db/db mice (n=4/group) 9 weeks old were given a gavage of 10 per day ⁹ CFU FZ010m (engineered saccharomyces boulardii (Sb) constitutively expressing functional mouse IL22 fused to an Fc fragment) or Sb control for 3 weeks. Body weight and food and water consumption were measured on day 0, day 5, day 10, day 15 and day 21. On day 22, echo mri and fasting blood glucose levels were measured. No significant weight difference was observed between the Sb control and FZ010m groups. Treatment with FZ010m significantly reduced the food and water consumption of the mice and significantly reduced the fasting blood glucose levels of db/db mice.

Fig. 48 shows an exemplary mouse high fat diet obesity model.

Figure 49 shows that FZ010m reduced blood glucose in high fat diet mice. Male c57BL6/J mice (n=4) at 8 weeks of age were fed with HFD for 11 days and then 10 days per day ⁹ CFU FZ010m or Sb controls were gavaged with HFD. Body weight was measured on day 1, day 7, day 13, day 19 and day 22. Echo mri and fasting blood glucose levels were measured on day 22. Mice treated with FZ010m had significantly reduced body weight and fasting blood glucose levels for 12 days compared to mice in the HFD or sb control group.

FIG. 50 shows a schematic diagram of an exemplary generation of a VHH1-Fc-VHH2 transgene construct for genome insertion. Steps for generating four constructs (FIC 1, FIC2, FIC3, FIC 4) for an exemplary final incorporation cassette for yeast chromosome incorporation. The anti-IL-17A gene was synthesized in pUC plasmid pUC-aIL A. pUC-aIL A plasmid and vectors containing the anti-TNF-. Alpha. -Fc gene were digested with restriction enzymes BamH1 and NheI to obtain four different vectors and one insert. The insert is then ligated into a vector for transformation into competent E.coli cells. Four colonies were selected from each construct and plasmids were extracted and verified by enzymatic digestion. The correct plasmid was used to transform yeast.

FIG. 51 shows a schematic diagram of an exemplary generation of a VHH1-VHH2-Fc transgene construct for genome insertion. Gibson assembly was used due to the lack of suitable restriction enzyme sites. The exemplary anti-IL-17 AVHH2 gene was amplified by PCR with primers containing homologous overhangs and mixed with four separate linearized vectors containing anti-TNF-alpha VHH2-Fc with different desired promoters and selectable markers for Gibson assembly. After assembly, E.coli transformation was performed and four clones were selected from each of the four vectors for plasmid extraction.

FIG. 52 shows that the Final Insert Cassette (FIC) plasmids containing the VHH1-Fc-VHH2 and VHH1-VHH2-Fc genes were diagnosed with restriction enzymes (KpnI/NheI and Dral/NcoI) and (NcoI/DraI), respectively.

FIGS. 53A-53B show the expression levels of bispecific antibodies with different final insertion cassettes.

FIG. 54 shows selection of the front clones using a cell-based neutralization assay. The FIC5 clone with the highest VHH1-VHH2-Fc expression was selected to verify the neutralizing activity against human recombinant TNFα (left) and IL-17A (right). Clone G7-E1 (FZ 008) showed consistently high expression of the fusion polypeptide and neutralizing activity against TNFα and IL-17A.

FIG. 55 shows exemplary plasmids for FZMYA06-16 (ura 3 (-/-), gap1 (-/-), cir +) development.

FIG. 56 illustrates an exemplary strategy for FZMYA06-16 development.

FIG. 57 shows an exemplary platform for the development of an auxotrophic B.brucei strain from parent MYA796 to FZMYA 06-16.

FIG. 58 shows an exemplary final characterization (growth phenotype) of FZMYA 06-16.

FIG. 59 shows an exemplary final characterization of FZMYA06-16 (PCR confirmed site-specific deletion of both URA3 gene and the alternative antibiotic cassette).

FIG. 60 shows an exemplary final characterization of FZMYA06-16 (PCR confirmed site-specific deletion of GAP1 gene and the alternative antibiotic cassette).

FIG. 61 shows an exemplary final characterization of FZMYA06-16 (PCR confirmed the absence of antibiotic gene G418 or Phleo-R in the genome).

FIG. 62 shows an exemplary final characterization of FZMYA06-16 (sequencing LoxP-traces at URA3 and GAP1 loci in the genome).

FIG. 63 shows an exemplary final characterization (growth curves at different pH conditions) of FZMYA 06-16.

FIG. 64 shows an exemplary gene of interest (GOI) cassette containing a plasmid platform.

FIG. 65 shows the schematic insertion of GOI cassettes in the promoter region using the end-in homologous recombination method.

FIG. 66 shows exemplary production of engineered Saccharomyces yeast strains.

FIG. 67 shows an exemplary flow chart of a development strategy for engineered Saccharomyces yeast strains expressing different forms of therapeutic polypeptides using the platforms described herein.

FIG. 68 illustrates an exemplary FZ002 development flowchart.

FIG. 69 shows an exemplary PCR for pTEF-ABAB-URA3/DHFR cassette.

FIG. 70 shows a schematic of an exemplary first electroporation of FZMYA 06-16.

Fig. 71 shows a schematic of an exemplary screening process.

Figure 72 shows functional activity (neutralization) screening.

Fig. 73 shows an exemplary ELISA screen.

FIG. 74 shows an exemplary ELISA for clone homogeneity screening.

FIG. 75 shows site-specific insertion of an expression cassette.

FIG. 76 shows an exemplary second electroporation of FZMYA 06-16. Sb pTEF-ABAB-DHFR clones B2 and B10 were selected for competent cell preparation for electroporation 2 nd. Sb pTEF-ABAB-URA3 clones C11 and D10 were selected for competent cell preparation for the 2 nd electroporation.

FIG. 77 shows expression cassette PCR from plasmids for a second electroporation of pTEF-ABAB+ cells.

FIG. 78 shows a second electroporation-positive clone screen.

FIG. 79 shows a second electroporation-positive clone screen.

FIG. 80 shows a second electroporation-positive clone screen.

FIG. 81 shows exemplary front clones selected from each group.

FIG. 82 shows the highest ABAB-expressing clone uniformity of an exemplary selection.

FIG. 83 shows the highest ABAB-expressing clone uniformity of an exemplary selection.

FIG. 84 shows an exemplary ABAB expressing B-expressing B.brucella (FZ 002 clone) characterization.

FIG. 85 shows an exemplary FZ002 characterization (growth curve).

FIG. 86 shows an exemplary FZ002 characterization (growth curve).

FIG. 87 shows an exemplary FZ002 characterization (growth phenotype; first passage).

FIG. 88 shows an exemplary FZ002 characterization (growth phenotype; eleventh passage).

FIG. 89 shows an exemplary FZ002 characterization (stability). The different FZ002 clones (2E9,6G1, δ+hs#1) and negative control (wild type Sb) were serially passaged every 24 hours for 11 passages (about 100 passages), inoculated with an OD600 of 0.1 and shake-cultured at 37 ℃ at 250 rpm. Crude culture supernatants from each passage were collected and assayed by ELISA, with TcdB capture and ABAB expression detected by HRP conjugated anti-llama IgG (h+l).

FIG. 90 shows an exemplary Sb-ABAB characterization (genotype confirmation). Library of saccharomyces boulardii and saccharomyces cerevisiae fungi ITS: sequence alignment difference with Saccharomyces cerevisiae of Braseniaeel is 0.0%; the sequence alignment difference with Saccharomyces cerevisiae was 0.71%. The results are reported as Saccharomyces cerevisiae because they do not report subspecies.

FIG. 91 shows an exemplary FZ002 characterization (genome insert).

FIG. 92 shows an exemplary FZ002 characterization (genome insertion).

Fig. 93 shows an exemplary FZ002 characterization (genome insertion).

FIG. 94 shows an exemplary FZ002 characterization (genome insert).

Fig. 95 shows an exemplary FZ002 characterization (neutralization activity for TcdB).

FIG. 96 shows an exemplary FZ002 characterization (antifungal sensitivity).

FIG. 97 shows an exemplary Sb-ABAB characterization (antibiotic susceptibility). Sb-ABAB is similar to wild type and is insensitive to the following antibiotics at the concentrations indicated for clostridium difficile infection treatment: 42. Mu.g/mL colistin, 35. Mu.g/mL gentamicin, 400. Mu.g/mL kanamycin, 215. Mu.g/mL metronidazole, 45. Mu.g/mL vancomycin, 19.8. Mu.g/mL clindamycin.

FIG. 98 shows an exemplary Sb-ABAB characterization (antifungal activity). Sb-ABAB is sensitive to specified concentrations of G418, clotrimazole, ketoconazole, and itraconazole. FZ 002-sensitive antifungal sensitivity was similar to wild-type. Both WT and FZ002 cells were insensitive to cefmetazole or ceftazidime, even at 10 mM.

FIG. 99 shows an exemplary Sb-ABAB characterization (GI environmental resistance). Sb-ABAB and wild type were treated with the indicated GI-ambient medium conditions for 1 hour before incubation at 37 ℃. CFU counts after 24 hours incubation showed Sb-ABAB to be similar to wild type, tolerant to most of the test conditions, but sensitive to HCL buffer 1.2 (mimicking the gastric environment) and 0.01 bile salts.

Graph 100 shows an exemplary FZ002 characterization (PK (in vivo)); GOI expression in the fecal/GI tract (in vivo). C57BL/6 Male mice were dosed with FZ 0021X 10 from day 0 to day 3 after fecal samples were collected ⁹ Dose/day (total 4 doses). Faecal samples were collected on day 0, one day after the first, second, third administration or one and 4 days after the last administration. Each line indicates the dynamic change in ABAB levels in fecal samples of each mouse.

FIG. 101 shows an exemplary FZ002 characterization (colony forming units (CFU)). Time point 1CFU (left): 1mL of the sample was taken from 100mL of SDC medium inoculated with 1mL of FZ002-6G1 (batch No. 2021-AUG-11, 10≡8 cells/mL), and incubated at 37℃and 250rpm for 0 hour. Sample name: AW-PRO-0123-FOS-SAM10.1.4.2-09DEC21, results: about 8.83E+04CFU. Time point 4CFU (right): 1mL of the sample was taken from 100mL of SDC medium inoculated with 1mL of FZ002-6G1 (lot number AW21024-016-FOS-RCB-10DEC2021, 10≡8 cells/mL) and incubated at 37℃and 250rpm for 0 hours. Sample name: AW-PRO-0123-FOS-SAM10.6.2-14DEC21, results: about 1.82E+05CFU.

FIG. 102 shows exemplary ABAB expression from randomly picked colonies. 14 colonies showed >20ng/mL per 1OD600 cell. 3 colonies showed low expression (between 13ng/ml and 20ng/ml per 1OD600 cell of ABAB). 2 colonies showed no detectable ABAB expression.

FIG. 103 illustrates an exemplary FZ006 development flow chart.

FIG. 104 shows exemplary cassette-containing plasmid construction and cassette preparation.

FIG. 105 shows the first electroporation and colony formation after FZMYA06-16 electroporation.

Fig. 106 illustrates an exemplary screening process.

Fig. 107 shows an exemplary ELISA screen.

FIG. 108 shows an exemplary ELISA for clone homogeneity screening.

FIG. 109 shows an exemplary site-specific insertion of an expression cassette.

FIG. 110 shows a second electroporation of pTEF-ahTNF- α+ cells. Single colonies from 2 previous clones transformed with pTEF-aTNF-alpha-Fc-URA 3 (clone B10, C2) were used for transformation exchange with the pTDH3-URA3 cassette. Single colonies from 2 previous clones transformed with pTEF-aTNF-alpha-Fc-DHFR (clones A2, A4) were used for transformation exchange with the pTDH3 cassette. FZMYA06-16 for single transformation of pTDH3 cassette or co-transformation of pTEF and pTDH3 cassette.

FIG. 111 shows cassette preparation for a second electroporation of pTEF-ahTNF- α+ cells.

FIG. 112 shows a second electroporation in FZMAY06-16 with pTEF/pTDH 3-ahTNF-. Alpha. -DFR1 cassette.

FIG. 113 shows an exemplary second electroporation-positive clone screen.

FIG. 114 shows an exemplary second electroporation-positive clone screen.

FIG. 115 shows an exemplary second electroporation-positive clone screen.

FIG. 116 shows exemplary front clones of each group re-streaked on the corresponding selection plate.

FIG. 117 shows exemplary front clones selected from each group.

Fig. 118 shows an exemplary FZ006 characterization.

Fig. 119 shows an exemplary FZ006 characterization (acute expression level).

Figure 120 shows an exemplary FZ006 characterization (24 hour expression levels of cells cultured at passage 1 and passage 11).

Figure 121 shows an exemplary FZ006 characterization (acute expression and cloning homogeneity of 2 hours prior clones).

Fig. 122 shows an exemplary FZ006 characterization (growth phenotype).

Fig. 123 shows an exemplary FZ006 characterization (growth phenotype).

Fig. 124 shows an exemplary FZ006 characterization (growth curve).

Fig. 125 shows an exemplary FZ006 characterization (growth curve).

Fig. 126 shows an exemplary FZ006 characterization (expression stability).

Fig. 127 shows an exemplary FZ006 characterization (expression stability).

FIG. 128 shows an exemplary characterization of site-specific insertion of an expression cassette.

FIG. 129 shows an exemplary characterization of site-specific insertion of an expression cassette.

FIG. 130 shows an exemplary FZ006m development flow chart.

FIG. 131 shows exemplary cassette-containing plasmids and cassette preparations for FZ006m development.

FIG. 132 shows an exemplary electroporation of FZMYA 06-16.

Fig. 133 shows an exemplary screening process for FZ006 m.

Fig. 134 shows an exemplary ELISA screen for FZ006 m.

FIG. 135 shows ELISA for clone homogeneity screening of FZ006 m.

FIG. 136 shows an exemplary construction of pTDH3-aTNF- α -Fc-aIL A-DHFR.

FIG. 137 shows an exemplary construction of pTDH3-aTNF- α -Fc-aIL17A-DFR 1.

FIG. 138 shows an exemplary construction of pTEF-aTNF- α -Fc-aIL A-DHFR.

FIG. 139 shows an exemplary construction of pTEF-aTNF- α -Fc-aIL A-DFR 1.

FIG. 140 shows an exemplary construction of pTEF-aTNF- α -aIL A-Fc DFR 1.

FIG. 141 shows an exemplary FZ008 development flow chart.

FIG. 142 shows exemplary cassette-containing plasmid construction and cassette preparation.

FIG. 143 shows exemplary cassette-containing plasmid construction and cassette preparation.

FIG. 144 shows an exemplary electroporation of FZMYA 06-16.

FIG. 145 shows an exemplary screening procedure for FZ008 clone (VHH-Fc-VHH).

FIG. 146 shows ELISA screening of FZ008_ahTNF-. Alpha. -Fc-ahIL 17A.

FIG. 147 shows ELISA screening of FZ008_ahTNF-. Alpha. -ahIL 17A-Fc.

FIG. 148 shows an exemplary Sb-aTNF- α -aIL A characterization.

FIG. 149 shows an exemplary characterization (specific binding activity). Both forms bind to hTNF- α (left) and hIL-17A (right), but FZ008_ahTNF- α -ahIL17A-Fc showed higher expression levels than FZ008_aTNF- α -Fc-aIL A.

Graph 150 shows an exemplary characterization (neutralization activity).

Fig. 151 shows an exemplary characterization (growth phenotype).

FIG. 152 shows an exemplary characterization (site-specific insertion of expression cassettes).

FIG. 153 shows an exemplary FZ010m development flow chart.

FIG. 154 shows exemplary cassette-containing plasmid construction and cassette preparation.

FIG. 155 shows an exemplary electroporation of FZMYA 06-16.

FIG. 156 shows an exemplary screening procedure for FZ010m clones.

FIG. 157 shows ELISA screening of clones with the pTEF/pTDH3-mIL22-Fc-URA3 cassette.

FIG. 158 shows ELISA screening of FZ010m_pTEF-mIL 22-Fc-DHFR.

FIG. 159 shows ELISA screening of FZ010m_pTDH3-mIL22-Fc-URA 3/DHFR.

FIG. 160 shows ELISA screening of FZ010m_pTEF-URA3+pTDH3-DHFR cotransformations.

Fig. 161: exemplary characterization of uniformity.

FIG. 162 shows selection for highest expression clone homogeneity.

Fig. 163 shows food and water consumption.

Figure 164 shows body weight and fasting blood glucose levels.

Fig. 165 shows an exemplary FZ014 development flow chart.

FIG. 166 shows an exemplary cassette preparation performed directly from the golden gate reaction.

FIG. 167 shows the preparation of pTDH3-2KD 1-Fc-aprotinin-DFR 1 cassette.

FIG. 168 shows positive clones after electroporation with different cassettes in FZMYA 06-16.

FIG. 169 shows an exemplary screening procedure for FZ014 clones.

FIG. 170 shows ELISA screening for FZ014_2KD 1-Fc.

FIG. 171 shows ELISA screening of FZ 014-aprotinin-2 KD 1-Fc.

FIG. 172 shows ELISA screening of FZ014_2KD 1-Fc-aprotinin.

FIG. 173 shows a comparison of expression of three forms of 2KD 1-Fc.

Fig. 174 shows an exemplary characterization (growth curve) of FZ 024.

Fig. 175 shows an exemplary characterization (growth curve) of FZ 014.

Fig. 176 shows an exemplary characterization of FZ014 (site-specific insertion of the expression cassette).

Figure 177 shows an exemplary characterization of FZ014 (ELISA for detection of binding of 2KD1 to RVA antigen).

Fig. 178 shows an exemplary characterization of FZ014 (virus neutralization assay). Virus = Wa att HRV strain, working dilution 1/500>1/250 1-2 dilutions; passaging 16 from friday to monday MA 104; assay development > infected cells were stained with Alexa 488-labeled nanobody 2KD1, working dilution: 1/500 in PBS-I Wen Lan, 37℃for 45 min.

Fig. 179 shows an exemplary FZ016 development flow chart.

FIG. 180 shows an exemplary cassette preparation performed directly from the golden gate reaction.

FIG. 181 shows an exemplary electroporation of FZMYA 06-16.

Fig. 182 illustrates an exemplary screening process.

FIG. 183 shows an exemplary ELISA screening for FZ 016-M6-M4-Fc.

FIG. 184 shows an exemplary ELISA screen for FZ 016-M6-M5-Fc.

FIG. 185 shows FZ016_M6-M4-Fc and comparison of FZ016_M6-M5-Fc expression.

FIG. 186 shows an exemplary ELISA blocking assay for detecting blocking effect of 2KD1 on adhesion of the natural antigen of the intermediate NoVr VLP GII.4/1974VLP to porcine gastric mucin.

FIG. 187 shows an exemplary ELISA blocking assay for detecting blocking effect of 2KD1 on adhesion of a natural antigen of an intermediate NoVr VLP GII.4/1974VLP to an H3-type carbohydrate.

Fig. 188 shows a schematic structure developed by FZ 020.

FIG. 189 shows an exemplary overview of FZ020 development.

FIG. 190 shows an exemplary FZ020 development flow chart.

FIG. 191 shows an exemplary cassette-containing plasmid construction.

Fig. 192 shows an exemplary cartridge preparation for FZ020 development.

FIG. 193 shows an exemplary first electroporation of FZMYA 06-16.

FIG. 194 shows an exemplary screening process of FZ002_ABAB (pTDH 3-DHFR).

FIG. 195 shows ELISA screening for FZ002_ABAB expression (pTDH 3-DHFR).

FIG. 196 shows top Sb-ABAB (pTDH 3-DHFR) clone uniformity examination.

FIG. 197 shows an exemplary FZ002_ABAB-2E9 (pTDH 3-ABAB-DHFR) characterization (growth phenotype).

FIG. 198 shows an exemplary FZ002_ABAB-2E9 (pTDH 3-ABAB-DHFR) characterization (growth curve).

FIG. 199 shows an exemplary FZ002_ABAB-2E9 (pTDH 3-ABAB-DHFR) characterization (stability).

Graph 200 shows an exemplary ABAB-2E9 (pTDH 3-ABAB-DHFR) characterization (acute expression).

FIG. 201 shows an exemplary ABAB-2E9 (pTDH 3-ABAB-DHFR) characterization (genome-specific insertion sites).

FIG. 202 shows an exemplary production and characterization of the B.brucei strain FZ002-2E9B2.

FIG. 203 shows a schematic representation of FZE1 amplified copy number.

FIG. 204 shows the amplification of copy number by FZE to produce Brevibacterium strain FZ002-2E9-B2. Growth recovery is defined as: during FZE treatment, overnight culture, OD600 was at least half that of cells not treated with FZE1, which was considered growth recovery. Once the cells were recovered, the cells were plated on YPD plates for expression level testing or moved to the next level treatment (FZE higher concentration).

FIG. 205 shows the production of Brevibacterium strain FZ002-2E9B2 by amplification of expression levels by FZE 1.

FIG. 206 shows the production of B.brucei strain FZ002-2E9-B2 by amplifying the expression level by FZE 1.

FIG. 207 shows an exemplary schematic for producing a Brevibacterium strain FZ020 and characterization.

FIG. 208 shows TNF-. Alpha. -Fc expression cassette transformation and transformant screening.

FIG. 209 shows ELISA screening of ahTNF-. Alpha. + ABAB.

Figure 210 shows an exemplary FZ020 characterization (growth phenotype).

Fig. 211 shows an exemplary FZ020 characterization (genome-specific insertion site).

FIG. 212 shows an exemplary FZ020 characterization (genome-specific insertion site).

Fig. 213 shows an exemplary FZ020 characterization (binding activity for both TcdB and human TNFa).

Fig. 214 shows an exemplary FZ020 characterization (neutralization activity against TcdB and human TNFa).

Fig. 215 shows an exemplary FZ024 development flowchart.

FIG. 216 shows PCR for leptin-HA-DFR 1/leptin-Fc-DFR 1 cassette developed by FZ 024.

FIG. 217 shows electroporation of FZMYA 06-16.

Figure 218 shows an exemplary screening process for FZ024 clones.

Figure 219 shows an exemplary ELISA screen of FZ024 clones.

FIG. 220 shows exemplary production of "leptin-HA" strains for mouse studies. Two frozen vials (about 1X 10. Quadrature.8 cells per 1 mL) from FZY14-E6 cell banks were used to inoculate a 2X 50mL flask of YPD.

FIG. 221 shows an exemplary FZ028 development flow chart.

FIG. 222 shows an exemplary cassette preparation performed directly from the golden gate reaction for FZ028 development.

FIG. 223 shows electroporation of FZMYA 06-16.

FIG. 224 shows an exemplary screening process for FZ028 clones.

Figure 225 shows an exemplary ELISA screen of FZ028 clones.

FIG. 226 illustrates an exemplary FZ010 development flow chart.

FIG. 227 shows exemplary cassette-containing plasmid construction and expression cassette preparation for FZ010 development.

FIG. 228 shows an exemplary electroporation of FZMYA 06-16.

Fig. 229 illustrates an exemplary screening process.

FIG. 230 shows the first 2-hour acute ELISA screening of FZ010_pTDH3-hIL22 fused to yFc (N297Q) at the N-terminus or C-terminus.

FIG. 231 shows the first 2-hour acute ELISA screening of FZ010_pTDH3-hIL22-DFR 1.

Fig. 232 shows an exemplary evaluation of uniformity.

FIG. 233 shows a second 2 hour acute ELISA screen of FZ010_pTDH3-hIL22 fused to yFc (N297Q) at the N-terminus or C-terminus.

FIG. 234 shows a second 2 hour acute ELISA screen for FZ010_pTDH3-hIL22-DFR 1.

Fig. 235 shows an exemplary flow chart of FZE (combination of methotrexate and sulfanilamide) selection for the development of saccharomyces boulardii (Sb) (FZE 1 effective dose tested in Sb).

Fig. 236 shows that Methotrexate (MTX) effective doses were tested in saccharomyces boulardii (Sb). FZMYA06-16 transformed with pCEV-G4-Km-DHFR and pCEV-G4-Km, the transformed monoclonal was selected for characterization of growth with MTX. Cells were seeded at od=0.2 and read 24 hours. Even at 500nM, MTX alone is insufficient to cause an effect on growth inhibition.

Figure 237 shows a test of the effective dose of sulfonamide in saccharomyces boulardii (Sb). Sulfonamide was prepared in DMSO. The carrier DMSO does not show toxicity to Sb. The sulfonamide may be used at less than 10 mg/mL.

Figure 238 shows a test of sulfonamide effective doses in saccharomyces boulardii (Sb). Sulfanilamide (< 5 mg/ml) may be used in combination with MTX.

Graph 239 shows a test of the effective dose of FZE (combination of MTX and sulfonamide) in saccharomyces boulardii (Sb). For the combination, MTX > 10-100. Mu.M, the sulfonamide may be used at 1 mg/ml.

Figure 240 shows a test of the effective dose of FZE (combination of MTX and sulfonamide) in saccharomyces boulardii (Sb). For the combination, MTX can be used at 50-250. Mu.M, and the sulfonamide can be used at 1 mg/ml.

Figure 241 shows confirmation of FZE1 dose in Sb for selection. The DHFR-selected transformant can be selected from 50-300. Mu.M MTX plus 1mg/ml of sulfonamide. In some cases, the optimal dose for DHFR selection was 250 μm MTX plus 1mg/ml sulfonamide, because the background was clear and relatively more transformants were used for screening.

FIG. 242 shows amino acid sequence similarity of mouse DHFR and yeast DFR 1.

FIG. 243 shows a schematic diagram of the development of Saccharomyces boulardii (Sb) DFR1 as a selectable marker.

FIG. 244 shows that B.brucei (Sb) anti-TNF-. Alpha. -Fc-DFR1 inserted at different positions showed the highest expression of GOI in clones selected for FZE1 (sulfonamide 1 mg/mL+50. Mu.M MTX).

FIG. 245 shows the selection of high expressing clones for DHFR. The clones expressing anti-hIL-17A-Fc were screened with the GOI cassette inserted at the delta site using URA3 or DHFR selection markers. After transformation into FZMYA06-16 (URA 3-/-, GAP 1-/-) strain with DNA fragments containing the GOI cassette and URA3 or DHFR selection markers flanked by delta insertion homology arms. Positive clones were selected from the following corresponding plates: SDCAA-URA3 plates for URA3 selection and YPD+ FZE1 for DHFR selection. 184 positive clones were each sub-cultured in 600. Mu.l YPD with shaking at 37℃at 250rpm for 24 hours. Culture supernatants were diluted 10-fold and tested by ELISA. Data read out at OD450 nm.

FIG. 246 shows the selection of high expressing clones for DHFR. The clones expressing anti-hTNF- α -Fc, in which the GOI cassette was inserted at the pTDH3 locus, were screened with positive URA3 or DHFR selection markers. After transformation of FZMYA06-16 (URA 3-/-, GAP 1-/-) strain with DNA fragments containing GOI cassette and URA3 or DHFR selection marker flanked by pTDH3 homology arms. Positive clones were selected from the following corresponding plates: sdcaa+ura3 plates for URA3 selection and ypd+ FZE1 for DHFR selection. 84 positive clones were each sub-cultured in 600. Mu.l YPD with shaking at 37℃at 250rpm for 24 hours. Culture supernatants were diluted 20-fold and tested by ELISA. Data read out at OD450 nm.

FIG. 247 shows a schematic representation of FZE1 amplified copy number and increased gene expression.

FIG. 248 shows the amplification of copy number of GFP expression cassette by culturing engineered yeast carrying dihydrofolate reductase in a medium containing FZE 1.

Figure 249 shows FZE1 increases GFP expression. Both the low and high expressing clones were cultured in FZE medium to accommodate increased expression levels.

FIG. 250 shows that FZ002 increases the expression of ABAB after culturing yeast in a medium containing FZE 1. FZ002 clones 2E9 and 6G1 continued to be cultured in FZE1 medium until acclimatized (left panel). Single clones were selected to measure ABAB expression by ELISA, showing OD 450 (right panel).

FIG. 251 shows that FZ002 increases the expression of ABAB after culturing yeast in a medium containing FZE 1.

Additional advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.

Detailed Description

The present disclosure provides techniques related to engineered saccharomyces yeast strains that express therapeutic polypeptides and/or include nucleic acids encoding therapeutic polypeptides. In some embodiments, such engineered saccharomyces yeast strains can provide stable and constitutive expression of therapeutic polypeptides without the need for conventional in vitro polypeptide expression systems (e.g., CHO or e.coli cells) that utilize bioreactors or bacterial fermenters followed by downstream polypeptide processing and purification prior to use as therapeutic agents.

The engineered saccharomyces yeast strains of the disclosure can be delivered, for example, orally or rectally, allowing the subject to self-administer, rather than by a health care professional. Such self-administration may improve therapeutic compliance and ultimately facilitate treatment and/or prevention of diseases and/or conditions.

Many modifications and other embodiments of the disclosure herein will come to mind to one skilled in the art to which the disclosed compositions and methods pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the disclosure is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. The skilled artisan will recognize many variations and adaptations of the aspects described herein. Such variations and modifications are intended to be included within the teachings of this disclosure and are covered by the claims herein.

Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features that may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure.

Any of the recited methods may be performed in the recited order of events or any other order that is logically possible. That is, unless explicitly stated otherwise, it is in no way intended that any method or aspect set forth herein be construed as requiring that its steps be performed in a particular order. Accordingly, where a method claim does not specifically state that steps are limited to a particular order in the claims or specification, no order is intended to be inferred in any respect. This applies to any possible non-expressed basis for interpretation, including matters concerning the arrangement of steps or logic of the operational flow, ordinary meanings derived from grammatical organization or punctuation, or the number or types of aspects described in the specification.

All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are listed. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such publication by virtue of prior invention. Further, the publication dates provided herein may be different from the actual publication dates which may need to be independently confirmed.

Although aspects of the present disclosure may be described and claimed in terms of a particular quorum class, such as a system quorum class, this is for convenience only, and one skilled in the art will appreciate that each aspect of the present disclosure may be described and claimed in any quorum class.

It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only, and is not intended to be limiting. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed compositions and methods belong. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the present specification and relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

Before describing various aspects of the present disclosure, the following definitions are provided and should be used, unless indicated otherwise. Additional terms may be defined elsewhere in this disclosure.

Definition of the definition

As used herein, "comprising" should be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps or components, or groups thereof. In addition, each of the terms "through", "including", "comprising", "including", "containing", "involving" and "involving" are used in their open, non-limiting sense and may be used interchangeably. Further, the term "comprising" is intended to encompass examples and aspects encompassed by the terms "consisting essentially of …" and "consisting of …. Similarly, the term "consisting essentially of …" is intended to encompass examples encompassed by the term "consisting of …".

As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an engineered saccharomyces yeast strain," "genetically modified yeast," "carrier," or "inflammatory bowel disease," includes but is not limited to a mixture or co-occurrence of two or more such engineered saccharomyces yeast strains, genetically modified yeasts, carriers, or inflammatory bowel diseases, and the like.

It should be understood that ratios, concentrations, amounts, and other numerical data may be expressed herein in a range format. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also to be understood that a number of values are disclosed herein, and that each value is disclosed herein as "about" that particular value, in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. Ranges may be expressed herein as from "about" one particular value, and/or to "about" another particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms a further aspect. For example, if the value "about 10" is disclosed, then "10" is also disclosed.

When a range is expressed, another aspect includes from the one particular value and/or to the other particular value. For example, when the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure, and the phrase "x-y" encompasses ranges from ' x ' to ' y ', as well as ranges greater than ' x "and less than ' y '. Ranges can also be expressed as upper limits, such as 'about x, y, z, or less', and should be construed to encompass the specific ranges of 'about x', 'about y', and 'about z', as well as ranges less than x ',' less than y ', and less than z'. Also, the phrase 'about x, y, z, or greater' should be construed to include specific ranges of 'about x', 'about y', and 'about z', as well as ranges of 'greater than x', 'greater than y', and 'greater than z'. In addition, the phrase "about 'x' to 'y'" includes "about 'x' to about 'y'", where 'x' and 'y' are numerical values.

It is to be understood that such range format is used for convenience and brevity and thus should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. For purposes of illustration, a numerical range of "about 0.1% to 5%" should be interpreted to include not only the explicitly recited values of about 0.1% to about 5%, but also include individual values (e.g., about 1%, about 2%, about 3%, and about 4%) and sub-ranges (e.g., about 0.5% to about 1.1%, about 5% to about 2.4%, about 0.5% to about 3.2%, and about 0.5% to about 4.4%) within the indicated range, as well as other possible sub-ranges.

As used herein, the terms "about," "approximate," "equal to or about," and "substantially" mean that the amount or value in question may be an exact value or a value that provides an equivalent result or effect to that recited in the claims or taught herein. That is, it is to be understood that the amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximated and/or greater or lesser as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art to achieve an equivalent result or effect. In some cases, the value that provides the equivalent result or effect cannot be reasonably determined. In such cases, it is generally understood that, as used herein, unless indicated or inferred otherwise, "about" and "equal to or about" mean that the nominal value indicates a change of ±10%. Generally, an amount, size, formulation, parameter, or other quantity or property is "about," "approximately," or "equal to or about," whether or not explicitly stated. It is to be understood that where "about", "approximately" or "equal to or about" is used before a quantitative value, the parameter also includes the particular quantitative value itself, unless specifically stated otherwise.

As used herein, the term "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

"diabetes" refers to a chronic disease characterized by hyperglycemia. Traditionally, most cases of diabetes fall into two major categories of pathogenesis, type 1 diabetes (T1D) and type 2 diabetes (T2D). However, in some subjects, this classification is not applicable because other genetic, immune, or neuroendocrine pathways are involved in pathogenesis.

"inflammatory bowel disease" (IBD) refers to a group of gastrointestinal disorders characterized by chronic, non-specific inflammation of various parts of the gastrointestinal tract. Ulcerative Colitis (UC) and Crohn's Disease (CD) are the most prominent examples of human IBD. However, IBD is also known to be present in animals, particularly dogs, cats and horses. IBD is associated with a number of symptoms and complications, including growth retardation, rectal prolapse, hematochezia (e.g., black stool and/or hematochezia), wasting, iron deficiency, and anemia (e.g., iron deficiency anemia and anemia of chronic disease or chronic inflammation) in children. One or more causes of IBD are not yet known.

"ulcerative colitis" (UC) refers to chronic non-specific inflammatory and ulcerative diseases that manifest primarily in the colonic mucosa. Ulcerative colitis is generally characterized by bloody diarrhea, abdominal cramps, hematochezia and mucous, discomfort, fever, anemia, anorexia, weight loss, leukocytosis, hypoalbuminemia, and increased Erythrocyte Sedimentation Rate (ESR). Complications of UC include bleeding, toxic colitis, toxic megacolon, sporadic rectovaginal fistulae, and increased risk of colon cancer development. Ulcerative colitis is also associated with complications distant from the colon, such as arthritis, ankylosing spondylitis, sacroiliac arthritis, posterior uveitis, erythema nodosum, pyoderma gangrenosum, and episcleritis. Treatment varies greatly depending on the severity and duration of the disease. For example, fluid therapy for preventing dehydration and electrolyte imbalance often occurs at severe episodes. In addition, special dietary measures are sometimes useful. The medicament comprises some of the various corticosteroids, sulfasalazine and derivatives thereof, and possibly immunosuppressive drugs.

"Crohn's disease" (CD) has many common features with ulcerative colitis. Crohn's disease is distinguished in that its lesions tend to be clearly distinguished from the adjacent normal intestine, as compared to lesions of fairly diffuse ulcerative colitis. In addition, crohn's disease afflicts mainly the ileum (ileitis) or the ileum and colon (ileocolitis). In some cases, only the colon has lesions (granulomatous colitis), and sometimes the entire small intestine is affected (jejunum ileitis). In rare cases, the stomach, duodenum or esophagus is also affected. In about half of the clinical cases, the lesions contain sarcoidosis-like epithelioid granulomas. Lesions of crohn's disease may be transmural, including deep ulcers, oedema, and fibrosis, which may lead to obstruction and fistula formation, as well as abscess formation. This is in contrast to ulcerative colitis, which generally produces much shallower lesions, although complications of fibrosis, obstruction, fistula formation and abscess are occasionally seen in ulcerative colitis.

As used herein, "administration" may refer to oral and/or rectal administration, and may be continuous or intermittent. In various aspects, the disclosed organisms, compositions, and/or formulations can be administered therapeutically; i.e., to treat an existing disease or condition. In further various aspects, the disclosed organisms, compositions, and/or formulations can be administered prophylactically; i.e., to prevent a disease or condition.

As used herein, "therapeutic agent" may refer to any substance, compound, molecule, etc., which may be biologically active or otherwise capable of inducing a pharmacological, immunogenic, biological and/or physiological effect in a subject to whom it is administered by local and/or systemic action. The therapeutic agent may be the primary active agent, or in other words, a component of the composition due to the effect of all or part of the composition. The therapeutic agent may be a secondary therapeutic agent, or in other words, a component of the composition due to additional parts of the composition and/or other effects. The term thus encompasses those compounds or chemicals that are traditionally regarded as drugs, vaccines and biopharmaceuticals comprising macromolecules such as proteins, peptides, hormones, nucleic acids, gene constructs, genetically modified microorganisms. The pharmaceutical agent may be a bioactive agent for medical (including veterinary) applications. The term therapeutic agent also includes, but is not limited to, a drug; vitamins; a mineral supplement; a substance for treating, preventing, diagnosing, curing or ameliorating a disease or disorder; or substances that affect the structure or function of the body, such as probiotic microorganisms, prebiotics; or a prodrug that becomes biologically active or more active after being placed in a predetermined physiological environment.

As used herein, a "therapeutic polypeptide" refers to a protein or peptide that has biological activity that is involved in or involved in the treatment or prevention of a disease or condition.

As used interchangeably herein, "subject," "individual," or "patient" may refer to a vertebrate organism, such as a mammal (e.g., human, dog, cat, horse, pig, chicken, turkey, goat, sheep, cow, rabbit). "subject" may also refer to a cell, cell population, tissue, organ or organism, preferably a human and its constituent parts.

As used herein, the terms "treatment" and "treatment" may generally refer to obtaining a desired pharmacological and/or physiological effect. Exemplary conditions that may be treated include, but are not limited to, crohn's disease, ulcerative colitis, and other inflammatory bowel disease and/or inflammation-related conditions, as well as diabetes, obesity, and certain infections. The effect may be therapeutic in partially or completely curing a disease, condition, symptom, or adverse effect due to the disease, condition, or disorder. As used herein, the term "treating" may comprise (a) inducing remission of the disease or condition being treated; (b) inhibiting the disease, i.e., arresting its development; and (c) alleviating the disease, i.e., alleviating or ameliorating the disease and/or symptoms thereof. A subject in need of treatment (e.g., a subject in need thereof) may comprise a subject already with a disorder, disease, or condition and/or a subject suspected of having a disease, disorder, or condition. Treating the disease, disorder, or condition may comprise ameliorating at least one symptom of a particular disease, disorder, or condition, even if underlying pathophysiology is not affected.

As used herein, the terms "preventing", "preventing" or "prophylactics" refer to stopping, excluding, avoiding, eliminating, pre-stopping, stopping or impeding the development of a disease or condition that a subject may be predisposed to develop before the disease or condition develops. In some embodiments, "preventing" or "prophylactic" may refer only to reducing the likelihood that a subject (e.g., a subject having a tendency to develop a disease or condition) develops a given disease or condition (e.g., crohn's disease, diabetes, ulcerative colitis, etc.), as it is understood that most prophylactic agents are not 100% effective in preventing a disease or condition in each subject receiving the agent. In some embodiments, "prevent" or "prophylactic" can refer to preventing onset of disease if the subject is currently in remission at the time of receiving treatment (i.e., "preventing" can be synonymous with maintaining remission in certain contexts).

As used herein, "dose," "unit dose," or "dose" may refer to physically discrete units suitable for a subject, each unit containing a predetermined amount of the disclosed compound and/or pharmaceutical composition thereof calculated to produce one or more desired responses associated with its administration.

As used herein, "therapeutic" may refer to treating, curing, and/or ameliorating a disease, disorder, or condition, or to reducing the rate of progression of a disease, disorder, or condition.

As used herein, an "effective amount" may refer to an amount of a disclosed compound or pharmaceutical composition provided herein sufficient to effect a beneficial or desired biological, affective, medical, or clinical response of a cell, tissue, system, animal, or human. The effective amount may be administered in one or more administrations, applications or doses. The term may also include within its scope an amount effective to enhance or restore substantially normal physiological function.

As used herein, the term "therapeutically effective amount" refers to an amount sufficient to achieve a desired therapeutic result or to act on an undesired symptom but generally insufficient to cause an adverse side effect. The specific therapeutically effective dose level for any particular patient will depend on a variety of factors, including the disease, disorder, and/or condition being treated and the severity of the disease, disorder, and/or condition; the specific composition employed; age, weight, general health, sex, and diet of the patient; the time of administration, the route of administration, the rate of excretion of the particular compound being employed; duration of treatment; drugs used in combination or concurrently with the particular compounds employed, as well as similar factors within the knowledge and expertise of medical practitioners and which may be well known in the medical arts. In the case of treating a particular disease, disorder, and/or condition, in some cases, the desired response may be to inhibit progression of the disease, disorder, and/or condition. This may involve only temporarily slowing the progression of the disease, disorder and/or condition. However, in other cases, it may be desirable to permanently prevent the progression of the disease, disorder, and/or condition. This can be monitored by conventional diagnostic methods known to those of ordinary skill in the art for any particular disease, disorder, and/or condition.

As used herein, the term "prophylactically effective amount" refers to an amount effective to prevent onset or induction of a disease, disorder, and/or condition.

For example, it is well within the skill in the art to begin administration of the compound at lower dosage levels than those required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose may be divided into a plurality of doses for administration purposes. Thus, a single dose composition may contain such amounts or submultiples thereof to make up the daily dose. In the event of any contraindications, the dosage can be adjusted by a separate physician. It is generally preferred to use the maximum dose of the agent of the invention (alone or in combination with other therapeutic agents), i.e. the highest safe dose according to sound medical judgment. However, one of ordinary skill in the art will appreciate that the patient may adhere to lower doses or tolerable doses for medical reasons, psychological reasons, or almost any other reason.

For example, the response to a therapeutically effective dose of the disclosed compounds and/or pharmaceutical compositions can be measured by determining the physiological effect of the treatment or drug, such as a reduction or lack of symptoms of the disease, disorder, and/or condition after administration of the treatment or agent. One of ordinary skill in the art will appreciate other assays and the assays may be used to measure the level of response. The amount of treatment may vary, for example, by increasing or decreasing the amount of the disclosed compounds and/or pharmaceutical compositions, by varying the administration of the disclosed compounds and/or pharmaceutical compositions, by varying the time of administration, etc. The dosage may vary and may be administered in one or more doses per day for one or more days.

As used herein, the term "probiotic microorganism" or "probiotic bacteria" refers to a microorganism or bacteria that when administered in an effective amount imparts a health or benefit to a host (e.g., saccharomyces, engineered saccharomyces yeast strains, including, for example, engineered saccharomyces boulardii strains).

As used herein, the term "promoter" is a transcriptional regulatory sequence at least sufficient to facilitate transcription of a nucleotide sequence in DNA into an RNA transcript. Transcripts transcribed from a promoter typically comprise a promoter sequence downstream from the transcription initiation site, and in the case of mRNA, a downstream sequence encoding an amino acid sequence. Promoters are the best characterized transcriptional regulatory sequences because they are predictably located just upstream of the transcription initiation site. The promoter comprises sequences that regulate the recognition, binding, and transcription initiation activity of the RNA polymerase. These sequences may be cis-acting or may be responsive to trans-acting factors. Promoters may be constitutive or regulated depending on the nature of the regulation. Promoters are generally described as having two separate segments: a core region and an extended promoter region. The core promoter comprises sequences sufficient for RNA polymerase recognition, binding and transcription initiation. The core promoter comprises a transcription initiation site, an RNA polymerase binding site, and other general transcription binding sites, and is where pre-initiation complexes are formed and general transcription mechanisms are assembled. The pre-start complex is typically within 50 nucleotides (nt) of the Transcription Start Site (TSS). The core promoter also contains the sequence of the ribosome binding site, which is necessary for translation of mRNA into a polypeptide. The extended promoter region comprises a so-called proximal promoter that extends about 250 nucleotides upstream of the transcription start site (i.e., -250 nt). The extended promoter region contains primary regulatory elements, such as specific transcription factor binding sites. Many genes have been found to have transcriptional regulatory elements located further upstream. Specifically, fragments comprising most of the transcriptional regulatory elements of a gene may extend up to 700nt or more upstream of the transcription initiation site. (see, e.g., U.S. 2007-0161031). In certain genes, transcriptional regulatory sequences have been found to be located thousands of nucleotides upstream of the transcription initiation site.

As used herein, a nucleotide sequence is "operably linked" or "operably linked" to a transcriptional regulatory sequence when the transcriptional regulatory sequence is used to regulate transcription of the nucleotide sequence in a cell. This involves promoting transcription of the nucleotide sequence by interaction between the polymerase and the promoter.

As used herein, the term "mutation" refers to a change in nucleotide sequence or amino acid sequence. Mutations may comprise substitutions of one or more nucleotides (substitution of a single nucleotide is referred to as "SNV" or "point mutation"), additions of one or more nucleotides or deletions of one or more nucleotides, and changes in amino acid sequence resulting from these nucleotide changes, if any.

As used herein, "parenteral administration" includes administration by bolus injection or infusion, as well as administration by intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intra-articular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and/or infusion.

As used herein, a "vector" is a replicable nucleic acid from which one or more heterologous polypeptides may be expressed when the vector is transformed into an appropriate host cell. When referring to vectors, the inclusion of a nucleic acid encoding a polypeptide or fragment thereof may be generally by restriction digestion and ligation of those vectors into which it is introduced. Reference to vectors also includes those vectors containing nucleic acids encoding polypeptides. Vectors are used to introduce a nucleic acid encoding a polypeptide into a host cell for amplification of the nucleic acid or expression/display of the polypeptide encoded by the nucleic acid. Vectors typically remain episomal, but may be designed to incorporate genes or portions thereof into the chromosome of the genome. Vectors for artificial chromosomes such as yeast artificial chromosomes are also contemplated. The selection and use of such vehicles is well known to those skilled in the art. Vectors also include "viral vectors" or "viral vectors". Viral vectors are engineered viruses that are operably linked to a foreign gene to transfer (as a mediator or shuttle) the foreign gene into a cell. As used herein, an "expression vector" comprises a vector capable of expressing DNA operably linked to regulatory sequences, such as promoter regions, capable of effecting the expression of such DNA fragments. Such additional segments may comprise promoter and terminator sequences, and optionally may comprise one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, and the like. Expression vectors are typically derived from plasmid or viral DNA, or may contain elements of both. Thus, expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, phage, recombinant virus, or other vector that upon introduction into an appropriate host cell produces expression of cloned DNA. Suitable expression vectors are well known to those skilled in the art and include those that are replicable in eukaryotic and/or prokaryotic cells and those that remain episomal or that are incorporated into the genome of a host cell.

The term "pharmaceutically acceptable" describes materials that are not biologically or otherwise undesirable, i.e., materials that do not cause unacceptable levels of undesirable biological effects or interact in a deleterious manner.

As used herein, the term "contacting" refers to bringing a disclosed compound or pharmaceutical composition into close proximity with a cell, target protein or polypeptide or other biological entity in such a way that the disclosed compound or pharmaceutical composition can directly affect the activity of the cell, target protein or polypeptide or other biological entity; i.e., by interaction with the cell, target protein or polypeptide or other biological entity itself, or indirectly; i.e. by interaction with another molecule, cofactor, factor or protein or polypeptide upon which the activity of the cell, target protein or polypeptide or other biological entity itself depends.

Engineered Saccharomyces yeast strains

The present disclosure provides, among other things, engineered Saccharomyces yeast strains. In some embodiments, the engineered saccharomyces yeast strain expresses one or more therapeutic polypeptides as described herein. In some embodiments, the engineered saccharomyces yeast strain includes nucleic acids encoding one or more therapeutic polypeptides described herein.

Techniques for developing engineered Saccharomyces yeast strains are also disclosed. In one aspect, the method results in stable high expression of heterologous genes in an engineered Saccharomyces yeast strain. In another aspect, the engineered saccharomyces yeast strain constitutively secretes therapeutic polypeptides (e.g., in the gastrointestinal tract of a subject). In still another aspect, the methods allow for multiple gene insertions, expression of full length antibodies, expression of multiple therapeutic polypeptides, and/or expression of multiple enzymes to produce a particular metabolite.

In one aspect, the disclosure relates to an engineered saccharomyces yeast strain that produces at least one (e.g., 1, 2, 3, 4, or more) therapeutic polypeptide capable of binding to one or more specific targets (e.g., disease targets) in a subject, wherein the therapeutic polypeptide is produced in the subject. In another aspect, the at least one (e.g., 1, 2, 3, 4, or more) therapeutic polypeptide comprises a mammalian (e.g., human, dog, cat, horse, pig, chicken, turkey, goat, sheep, cow) cytokine or chemokine. Exemplary non-limiting cytokines include IL-1, IL-2, IL-4, TNF- α, IL-17A, IL-6, IL-8, IL-10, IL-12, GM-CSF, IL-13, IL-18, IL-20, IL-22, IL-23, IL-25, IL-27, IL-35, IL-39, TGF- β, or any combination thereof. In one aspect, the inhibition of inflammatory cytokines is superior to inhibition of appropriate reference standards (e.g., inhibition of inflammatory cytokines produced by existing biological agents). In another aspect, the at least one therapeutic polypeptide comprises an antibody or functional fragment thereof. In another aspect, the therapeutic polypeptide comprises one or more of the following: a soluble receptor or binding protein, one or more cytokines or chemokines, or any combination thereof. In another aspect, the therapeutic polypeptide includes, for example, a hormone, an enzyme, an antimicrobial peptide, a microbial peptide, or a set of therapeutic enzymes for the synthesis of a therapeutic metabolite.

In further aspects, the nucleic acid encoding the therapeutic polypeptide may be inserted in one or more copies in a "hot spot" in a site-specific manner, the therapeutic polypeptide may be stably and/or produced at high levels, or any combination of these features. For purposes of this disclosure, a "hot spot" is one or more highly expressed genomic loci. In some embodiments, the site-specific insertion inserts one or more nucleic acids encoding a therapeutic polypeptide in multiple sites of the genome (e.g., in 2, 3, 4, 5, or 6 or more sites). In some embodiments, the site-specific insertion does not disrupt and/or replace any genes endogenously present in the genome. Exemplary hotspots include, but are not limited to, tef1, tdh3, tdh2, tef2, eno2, rpla1, rpla2, rpla3, rpla10e, pdc1, adh2, gpm1, fba1, rpl47a, pgk1, rpla4, ssm a, ssm1b, rpl5a, rpl5b, upf1, rpl16a, rpl16b, cup1a, cup1b, rps31a, rpl2b, rps28a, rpl35b, pyr 1, rpl9a, rpl9b, rpl27a, rps21, rpl43a, nab1b, url 1a, and rps18eb.

In some embodiments, the site-specific insertion (e.g., at Ty, δ, σ, pTEF and/or pTDH3 sites) is performed using transposon directed insertion. In some embodiments, the site-specific insertion is a destructive site-specific insertion (e.g., the nucleic acid to be inserted destroys the nucleic acid originally present). In some embodiments, the site-specific insertion is a non-destructive site-specific insertion (e.g., the nucleic acid to be inserted replaces the nucleic acid originally present). In some embodiments, the site-specific insertion is a terminal-inward site-specific insertion (e.g., in a hot spot). In some embodiments, the site-specific insertion is a terminal-outward site-specific insertion (e.g., in a hot spot). In some embodiments, the site-specific insertion method is efficient relative to an appropriate reference standard (e.g., a different site-specific insertion method).

In further aspects, the nucleic acid encoding the therapeutic polypeptide may be inserted in one or more copies in a non-site specific manner, the therapeutic polypeptide may be stably and/or produced at high levels, or any combination of these features.

In some embodiments, the engineered saccharomyces yeast strain includes modifications (e.g., insertions, deletions, mutations) to increase therapeutic polypeptide expression, secretion, and/or stability.

In some embodiments, the engineered saccharomyces yeast strain includes modifications (e.g., insertions, deletions, mutations, etc.) to increase the safety (e.g., bioprotection) of such living biologic therapeutic products.

Yeast strains

In some embodiments, the engineered saccharomyces yeast strain of the disclosure is a saccharomyces species. For example, but not limited to, saccharomyces comprises Candida (Candida genus), schizosaccharomyces (Schizosaccharomyces genus), kluyveromyces (Kluyveromyces genus), pichia (Pichia genus), issatchenkia (Issachenkia genus), yarrowia (Yarrowia genus), or Hansenula (Hansenula genus). The species classified as saccharomyces may be for example, saccharomyces cerevisiae (S.cerevisiae), saccharomyces bayanus (S.bayanus), saccharomyces boulardii (S.boulardii), saccharomyces boulardii (S.bulderi), saccharomyces caryophyllus (S.cariocanus), saccharomyces lactis (S.cariocus), saccharomyces cerevisiae (S.chevaliri), saccharomyces ceremony (S.dairenensis), saccharomyces ellipsis (S.ellipsilosides), saccharomyces true (S.eubayanus), saccharomyces beet (S.exiguus), saccharomyces frie Luo Lun (S.florentinus), saccharomyces cerevisiae Kluyveromyces (S.kluyveri), martinia yeast (S.martiniae), monilinia (S.monaensis), north yeast (S.norbensis), saccharomyces mirabilis (S.paradoxus), pasteurella (S.pastoris), saccharomyces cerevisiae (S.spline), saccharomyces cerevisiae (S.turcicensis), monilinia (S.unisporus), saccharomyces cerevisiae (S.uvarum), or Saccharomyces cerevisiae (S.zonatum). The species classified as genus Candida may be, for example, candida albicans (C.albicans), candida ascaris (C.ascalacta), candida amphibiana (C.amphxiae), candida antarctica (C.antarctica), candida silvery (C.arginate), candida atlantica (C.atlantica), candida atmospheric (C.atm), candida blattae (C.blattae) Candida ananas (C.bromoxynil), candida fructophila (C.carpophila), candida kava (C.carojalis), candida cerealis (C.cerambidium), candida shore (C.chaulides), candida koraiensis (C.corydali), candida polysacharin (C.dosseyi), candida dubliniensis (C.dubliensis), candida epothilone (C.ergatensis), candida utilis (C.tergatensis) candida glabrata (c.frame), candida glabrata (c.glabra), candida fermentum (c.ferutati), candida Ji Yemeng de (c.gullimomndii), candida hainanensis (c.haemalonii), candida entomophila (c.insolamens), candida entomophila (c.insolorum), candida intermedia (c.inter media), candida jeffresii, candida lactis (c.kefyr), candida krusei (c.krusei), candida Lu Xida ni (c.lusitane), candida tender (c.lyxophila), candida maltosa (c.maltesla), candida maritima (c.marina), candida membranaceus (c.memberacins), candida midwieri (c.mil), candida olea (c.jejuni), candida (c.k.k.k.i), candida albicans (c.k.k) Candida utilis (c.oregonensis), candida parapsilosis (c.parapsilosis), candida quercitica (c.quercitisa), candida rugosa (c.rugosa), candida sake (c.sake), candida huahara (c.shahatea), candida domino (c.temnochia), candida tenuifolia (c.tenuis), candida thearubiginis (c.theae), candida tolerans (c.tolerans), candida tropicalis (c.tropicalis), candida georgiana (c.tsuchiya), candida sinensis (c.sinosporum), candida sojae (c.sojae), candida Sha Xishi (c.subhashi), candida vinifera (c.viswaii), candida utilis (c. Du Binjia) or candida kutsuba (c.35 uba). The species classified as genus Schizosaccharomyces may be, for example, schizosaccharomyces pombe (S.pombe), schizosaccharomyces japonica (S.japonica), schizosaccharomyces octaspore (S.octosporus), or Schizosaccharomyces icephilia (S.crytophilus). Species classified as kluyveromyces may be, for example, kluyveromyces alnicosus (k.aestuarii), kluyveromyces africanus (k.africanus), kluyveromyces bararyosis (k.bacitratus), kluyveromyces brutayaensis (k.blattae), kluyveromyces spinosa (k.dobzhanskii), kluyveromyces hubei (k.hubeiensis), kluyveromyces lactis (k.lactis), kluyveromyces rockwell (k.lodderae), ma Xianshi Lu Wei yeast (k.marxianus), kluyveromyces nonfermenta (k.nonfertans), kluyveromyces (k.piceae), kluyveromyces sinensis (k.sin), kluyveromyces thermotolerans (k.t), kluyveromyces willi (k.waii), kluyveromyces (k.wii), kluyveromyces falciparvoi (k.y) or kluyveromyces (k. Luo Kelu). The species classified as pichia may be, for example, pichia anomala (p.anomala), pichia pastoris (p.heel ii), pichia Ji Yeshi (p.gullimomondii), pichia kluyveri (p.kluyveri), pichia membranacea (p.membrane), pichia novelica (p.nonvegensis), pichia australis (p.ohmmeri), pichia pastoris (p.pastoris), pichia methanolica (p.methanol), or pichia elliptica (p.subsubullosula). The species classified as the genus Issatchenkia may be, for example, issatchenkia orientalis (I.orientalis). The species classified as yarrowia may be, for example, yarrowia lipolytica (y. Lipolytica). The species classified as Hansenula can be, for example, hansenula polymorpha (H.subsubullulosa), hansenula anomala (H.anomala), hansenula polymorpha (H.polymorpha), hansenula polymorpha (H.holsitii wire) or Hansenula capsulata (H.capsula wire).

In one aspect, the Saccharomyces yeast may be Saccharomyces boulardii, an organism that is generally considered safe for probiotic use (GRAS), and is a well-tolerated Over The Counter (OTC) probiotic in unmodified form for promoting intestinal health and improving diarrhea. On the one hand, saccharomyces boulardii grows well at 37℃and is more resistant to acidic environmental conditions than other Saccharomyces strains. On the other hand, however, the molecular genetic tools of Saccharomyces cerevisiae do not develop as well as, for example, saccharomyces cerevisiae.

In some embodiments, the engineered saccharomyces yeast strain does not include a selectable marker (e.g., an antibiotic selectable marker). In a further aspect, this meets the U.S. food and drug administration regulations regarding antibiotic resistance genes, and in a still further aspect, eliminates the possibility of micro-scale fungal evolution under antibiotic stress.

In some embodiments, the engineered saccharomyces yeast strain includes modifications (e.g., mutations, deletions, insertions, etc.) that allow selection of a particular engineered saccharomyces yeast strain (e.g., selectable marker). In some embodiments, the modifications that allow selection include partial deletion of the gene that serves as a selectable marker. In some embodiments, the modifications that allow selection include complete deletion of the gene that is used as a selectable marker.

In some embodiments, the selectable marker allows positive and/or negative selection. In some embodiments, the selectable marker comprises a prototrophic marker, an auxotrophic marker, a marker conferring drug resistance, an autoselection marker, and/or a counter selection marker. Non-limiting examples of genes for use as selectable markers include ura3, gap1, leu2, his3, and trp1 (see, e.g., IMADEARTIKA, HAYATI journal of bioscience (Journal of Biosciences), volume 16, stage 1, 2009, pages 40-42, ISSN 1978-3019). A variety of selectable markers are known in the art. One of ordinary skill in the art will readily recognize and understand how to select and use such markers in accordance with the techniques of this disclosure.

In some embodiments, the selectable marker comprises a modification or deletion of the URA3 gene. URA3 encodes orotidine 5' -phosphate decarboxylase (ODCase), an essential enzyme that catalyzes a reaction in pyrimidine synthesis. Without wishing to be bound by any theory, unless uracil or uridine is added to the medium, loss of ODCase activity results in lack of cell growth. In contrast, ifThe addition of 5-FOA (5-fluoroorotic acid) to the medium, active ODCase will convert 5-FOA to the toxic compound 5-fluorouracil, resulting in cell death. Thus, engineered Saccharomyces yeast strains that include URA3 deletions or inactivation are not viable without uracil or uridine. In some embodiments, the engineered Saccharomyces yeast strain may be deleted for URA3[ expressed as URA3 ] ^-/- Or ura3 (-/-)]Whereas in other strains URA3 may be mutated to nonfunctional (URA 3). In some embodiments, the engineered saccharomyces yeast strain includes an insertion of URA 3.

In some embodiments, the selectable marker comprises a modification (e.g., deletion) of the GAP1 gene. GAP1 encodes a generic amino acid permease that involves the uptake of all naturally occurring L-amino acids, related compounds (such as ornithine and citrulline) and some D-amino acids, toxic amino acid analogs (such as azetidine-2-carboxylate) and polyamine putrescine and spermidine. GAP1 is also involved in the invasive growth of Saccharomyces strains. Thus, engineered saccharomyces yeast strains that include GAP1 modifications (e.g., deletions) exhibit reduced uptake of, for example, methionine, glycine, glutamine, and regulated nitrogen sources. In addition, the deletion of GAP1 reduces the ability of saccharomyces yeast strains to grow invasively. Without wishing to be bound by any theory, it is possible to select strains of GAP1 that are modified (e.g., deleted) for use in combination with toxic D-His using minimal medium in which L-proline is the sole nitrogen source. GAP1 (-/-) strain can survive in a medium containing L-proline as the sole nitrogen source and the toxic amino acid D-histidine as counter-selection, since D-His is taken up by GAP1 and is toxic to yeast cells, resulting in the selection of GAP1 (-/-) strain. Strains that do not include a GAP1 inactivating modification (e.g., GAP1 (+/+) strains) may be selected on minimal medium where L-citrulline is the sole nitrogen source. In some embodiments, the engineered saccharomyces yeast strain includes mutations in GAP 1. In some embodiments, the engineered saccharomyces yeast strain includes a deletion of GAP 1. In some embodiments, the engineered saccharomyces yeast strain includes an insertion of GAP 1.

In some embodiments, the selectable marker includes modification of the dihydrofolate reductase (DHFR) gene (see, e.g., macDonald C et al, yeast.) (2015; 32 (5): 423-438.). DHFR is an enzyme that reduces dihydrofolate to tetrahydrofolate using NADPH as an electron donor, which can be converted to tetrahydrofolate cofactors for 1-carbon chemical transfer. DHFR confers resistance to Methotrexate (MTX) and exhibits dose-effect selection. Thus, without wishing to be bound by any one theory, DHFR may be used as a selectable marker with methotrexate, in some embodiments in combination with sulfanilamide, to screen for high expressing strains. In some such embodiments, methotrexate is administered for selection at a concentration of about 1nM, 5nM, 10nM, 20nM, 50nM, 75nM, 100nM, 150nM, 200nM, 250nM, 500nM, 750nM, 1. Mu.M, 5. Mu.M, 10. Mu.M, 20. Mu.M, 50. Mu.M, 75. Mu.M, 100. Mu.M, 150. Mu.M, 200. Mu.M, 250. Mu.M, 500. Mu.M, 750. Mu.M, or 1mM or any concentration in between. In some such embodiments, methotrexate is administered in combination with a sulfonamide. In some such embodiments, the sulfonamide is administered for selection at a concentration of about 0.1mg/mL, 0.2mg/mL, 0.3mg/mL, 0.4mg/mL, 0.5mg/mL, 0.6mg/mL, 0.7mg/mL, 0.8mg/mL, 0.9mg/mL, 1mg/mL, 2mg/mL, 3mg/mL, 4mg/mL, 5mg/mL, 6mg/mL, 7mg/mL, 8mg/mL, 9mg/mL, or 10mg/mL, or any concentration in between the foregoing. In some such embodiments, about 0.8nM to 20nM methotrexate or 50-250. Mu.M methotrexate and about 0.1-10mg/mL, 1-10mg/mL or 1-5mg/mL sulfanilamide are administered. In some embodiments, the selectable marker comprises the yeast homolog DFR1 of DHFR for selection of chromosomal insertion of the transgene. In some embodiments, DHFR is sensitive to MTX comparable to DFR 1. DHFR is present in all organisms and is function-conserved. Although the sequence identity between DHFR, DFR1 and other homologs is relatively low, in some embodiments, high functional similarity may allow for the use of multiple DHFR and DFR1 homologs according to the presently disclosed techniques. Exemplary amino acid sequences of DHFR and DFR1 are shown in table 1. In view of the sequence homology of mammalian DFHR and yeast DFR1, the present technology is not limited to the use of mouse DHFR, but any homologue is expected to be useful as a selectable marker. In some embodiments, the disclosed engineered yeasts can include a nucleic acid sequence encoding mammalian DHFR. In some embodiments, the disclosed yeast can include one or more exogenous copies of a nucleic acid sequence encoding DFR 1. In view of the sequence homology of mammalian DFHR and yeast DFR1, the present technology is not limited to the use of mouse DHFR, but homologues from any organism are expected to be useful as selectable markers. In some embodiments, the disclosed engineered yeasts can include a nucleic acid sequence encoding mammalian DHFR. In some embodiments, the disclosed yeast can include one or more exogenous copies of a nucleic acid sequence encoding DFR 1.

Table 1: exemplary DHFR and DFR1 amino acid sequences.

In some embodiments, the engineered saccharomyces yeast strain is auxotrophic. In one aspect, the auxotrophic engineered Saccharomyces yeast strain is less likely to survive in the environment relative to an appropriate reference standard (e.g., the parent Saccharomyces yeast strain).

In some embodiments, the engineered saccharomyces yeast strain has a similar growth curve as compared to an appropriate reference standard (e.g., a parent saccharomyces yeast strain).

In some embodiments, extracts and/or supernatants from cultures of engineered saccharomyces yeast strains retain at least some activity against therapeutic targets, immune responses, and/or alter at least one component of metabolic pathways in the subject. In some such embodiments, at least some activity comprises at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% relative to an appropriate reference standard.

Enhancing stable therapeutic polypeptide expression

In some embodiments, the engineered saccharomyces yeast strain includes one or more modifications (e.g., insertions, deletions, mutations, etc.) to increase therapeutic polypeptide expression, secretion, and/or stability.

In some embodiments, the engineered saccharomyces yeast strain with increased therapeutic polypeptide expression, secretion, and/or stability includes modifications (e.g., insertions, deletions, mutations, etc.) in the protease encoding gene. In some such embodiments, the protease encoding gene is or includes pep4, yeast protease a. Pep4 is a vacuolar aspartyl hydrolase that not only degrades polypeptides in vacuoles, but also activates additional vacuolar proteases, such as Prc1 (carboxypeptidase Y), prb1 (proteinase B), and Lap4 (aminopeptidase I). In some such embodiments, the protease encoding genes are or include, for example, PRC1, PRB1, and LAP4. Without wishing to be bound by any theory, deletion and/or inactivation of proteases results in reduced degradation of the therapeutic polypeptide produced by the engineered saccharomyces yeast strain and thus in increased expression, secretion and/or stability of the therapeutic polypeptide.

In some embodiments, the effect of a modification that increases the expression, secretion, and/or stability of a therapeutic polypeptide is assessed using an enzyme-linked immunosorbent assay (ELISA). In some embodiments, such assessment further comprises comparing the therapeutic polypeptide expression, secretion, and/or stability of the engineered saccharomyces yeast strain to an appropriate reference standard (e.g., therapeutic polypeptide expression, secretion, and/or stability in the corresponding parent saccharomyces yeast strain).

Various methods are known in the art to assess the expression, secretion, and/or stability of a polypeptide (e.g., a therapeutic polypeptide). Those of ordinary skill in the art will readily recognize and understand how to select and use such methods in accordance with the present disclosure.

Improving biosafety

In immunocompromised populations, oral administration of a saccharomyces boulardii probiotic can result in eubacteremia (e.g., the presence of fungi or yeasts in the blood). Thus, there is a need for techniques to improve the safety of probiotics, including engineered saccharomyces yeast strains such as described herein. In some embodiments, engineered saccharomyces yeast strains include modifications (e.g., insertions, deletions, mutations, etc.) to increase the safety of such strains, and are particularly useful as live biotherapeutic products (e.g., probiotics). In some embodiments, such modifications result in accumulation of toxic intermediates and control (e.g., reduction) of cell proliferation (e.g., in eukaryotic cells).

In some embodiments, engineered saccharomyces yeast strains with improved biosafety include modifications (e.g., insertions, deletions, mutations, etc.) in genes associated with metabolic pathways (e.g., for the production of amino acid and/or nucleic acid components). A variety of genes associated with metabolic pathways are known in the art, and one of ordinary skill in the art will readily understand and understand how to select such genes for modification in accordance with the present disclosure. In some embodiments, such modifications to the engineered saccharomyces yeast strain reduce the immunogenicity of the engineered saccharomyces yeast strain and/or increase the expression of the therapeutic polypeptide.

In some embodiments, the modification of the gene associated with the metabolic pathway comprises modification of a threonine biosynthesis gene. In some such embodiments, the threonine biosynthesis gene is thr1. Modification of thr1 (an upstream enzyme in the threonine biosynthetic pathway) may lead to serum sensitivity when immunocompromised individuals are exposed to Saccharomyces yeasts. Without wishing to be bound by any theory, it is understood that this sensitivity is due to accumulation of the toxic intermediate homoserine when the cell is exposed to a low threonine environment such as serum, resulting in control (e.g., reduction) of cell proliferation and thus a safer biotherapy relative to appropriate reference standards (e.g., saccharomyces yeast without modified thr 1). In some embodiments, the engineered saccharomyces yeast strain includes mutations in thr1. In some embodiments, the engineered saccharomyces yeast strain includes a deletion of thr1. In some embodiments, the engineered saccharomyces yeast strain includes an insertion of thr1.

In some embodiments, the threonine biosynthesis gene is thr4. The Thr4 enzyme is located directly downstream of Thr1 in the threonine biosynthetic pathway and phosphorylates homoserine. The thr4 null strain of saccharomyces yeast exhibits a phenotype similar to thr1 null cells. Without wishing to be bound by any theory, it is understood that a similar phenotype is a result of the toxic intermediate phosphohomoserine. In some embodiments, the engineered saccharomyces yeast strain includes mutations in thr4. In some embodiments, the engineered saccharomyces yeast strain includes a deletion of thr4. In some embodiments, the engineered saccharomyces yeast strain includes an insertion of thr4.

In some embodiments, the modification of the gene associated with the metabolic pathway comprises modification of the ura3 gene. As described above, ura3 encodes the orotidine 5' -phosphate decarboxylase (ODCase), which catalyzes one reaction in the synthesis of pyrimidine ribonucleotides (components of RNA). Without wishing to be bound by any theory, unless uracil or uridine is added to the medium, loss of ODCase activity results in lack of cell growth. In some embodiments, modification of the ura3 gene results in control (e.g., reduction) of cell proliferation and production of safer biotherapeutics relative to appropriate reference standards (e.g., saccharomyces yeast without modified ura3 gene). In some embodiments, the engineered saccharomyces yeast strain includes a mutation in ura 3. In some embodiments, the engineered saccharomyces yeast strain includes a deletion of ura 3. In some embodiments, the engineered saccharomyces yeast strain includes an insertion of ura 3.

In some embodiments, the modification of the gene associated with the metabolic pathway comprises modification of the gap1 gene. As described above, gap1 encodes a generic amino acid permease that involves the uptake of all naturally occurring L-amino acids, related compounds (such as ornithine and citrulline) and some D-amino acids, toxic amino acid analogs (such as azetidine-2-carboxylate) and polyamine putrescine and spermidine. Without wishing to be bound by any one theory, a decrease in uptake may result in a lack of cell growth. In some embodiments, modification of the gap1 gene results in control (e.g., reduction) of cell proliferation and production of safer biotherapeutics relative to appropriate reference standards (e.g., saccharomyces yeast without modified gap 1). In some embodiments, the engineered saccharomyces yeast strain includes mutations in gap 1. In some embodiments, the engineered saccharomyces yeast strain includes a deletion of gap 1. In some embodiments, the engineered saccharomyces yeast strain includes an insertion of gap 1.

Development of Yeast Strain/expression System

In practicing the methods of the present invention, many conventional techniques in molecular biology, protein biochemistry, cell biology, microbiology and recombinant DNA are used. See, e.g., sambrook and Russell editions (2001) [ molecular cloning: laboratory Manual (Molecular Cloning: A Laboratory Manual), 3 rd edition; the Ausubel et al, eds. (2007) in current molecular biology laboratory guidelines (Current Protocols in Molecular Biology), the EmbH book methods of enzymology (Methods in Enzymology) (Academic Press, inc., N.Y.); macPherson et al (1991) PCR 1: practical methods (PCR 1:A Practical Approach) (IRL Press (IRL Press at Oxford University Press) of oxford university Press); macPherson et al (1995) PCR 2: practical methods (PCR 2:A Practical Approach); harlow and Lane editions (1999) antibody: laboratory manuals (Antibodies, A Laboratory Manual), fresnel (2005) animal cell culture: basic technical Manual (Culture of Animal Cells: A Manual of Basic Technique), 5 th edition; gait editions (1984) oligonucleotide Synthesis (Oligonucleotide Synthesis), U.S. Pat. Nos. 4,683,195; hames and Higgins editions (1984) nucleic acid hybridization (Nucleic Acid Hybridization), anderson (1999) nucleic acid hybridization; hames and Higgins editions (1984) transcription and translation (Transcription and Translation); immobilized cells and enzymes (Immobilized Cells and Enzymes) (IRL Press (1986)); perbal (1984) guidelines for the practicability of molecular cloning (A Practical Guide to Molecular Cloning); miller and Calos editions (1987) Gene transfer vector for mammalian cells (Gene Transfer Vectors for Mammalian Cells) (Cold spring harbor laboratory Press (Cold Spring Harbor Laboratory)); makrides editions (2003) Gene transfer and expression in mammalian cells (Gene Transfer and Expression in Mammalian Cells); mayer and Walker editions (1987) methods of immunochemistry in cell and molecular biology (Immunochemical Methods in Cell and Molecular Biology) (Academic Press, london); herzenberg et al (1996) Manual of experimental immunology Well (Weir' sHandbook of Experimental Immunology).

In some embodiments, the present disclosure provides techniques for developing and/or producing engineered saccharomyces yeast strains (e.g., engineered saccharomyces yeast strains produced according to the present disclosure). In some such embodiments, the use of PCR to amplify sequences (e.g., sequences encoding GOI and ORFs of selectable markers) may result in high copy insertion. In some embodiments, the development and/or production of an engineered saccharomyces yeast strain includes yeast codon optimization (GOI) of the gene of interest. In some such embodiments, the GOI is generated using, for example, synthesis and/or Polymerase Chain Reaction (PCR). In some embodiments, the E.coli is transformed with GOI and the transformants are evaluated by, for example, diagnostic digestion and/or sequencing. In some embodiments, expression cassettes including GOI (e.g., plasmid) are assessed by PCR and gel electrophoresis (e.g., DNA gel) to confirm the expression cassette by size. In some embodiments, the purified expression cassette is electroporated into a Saccharomyces yeast (e.g., FZMAY 06-16) and plated for selection. In some embodiments, the expression cassette is inserted into the genome of a saccharomyces yeast (e.g., to improve stability). In some embodiments, the acute expression of a therapeutic polypeptide encoded by GOI in the supernatant from the supernatant of a positive transformant is assessed, e.g., by ELISA. In some embodiments, one or more rounds (e.g., two, three, four rounds) of clone screening are completed to verify the desired expression level and purity of the clone. In some embodiments, a Cell Bank (CB) from the desired clone is generated and CB characterization is further evaluated.

In some embodiments, the present disclosure provides techniques for evaluating engineered saccharomyces yeast strains (e.g., engineered saccharomyces yeast strains produced according to the present disclosure). In some embodiments, one or more of the following of the engineered saccharomyces yeast strains is evaluated: expression level (e.g., by ELISA, western blot), growth phenotype, growth profile, stability (e.g., by ELISA), genotype confirmation, genome site-specific insertion (e.g., by polymerase chain reaction PCR), genome insertion of a gene of interest (GOI) cassette (e.g., by PCR), copy number inserted, functional activity, antibiotic and/or antifungal sensitivity, gastrointestinal environmental survival, efficacy (e.g., in animal models), pharmacokinetics (e.g., in vivo), GOI expression in the stool/gastrointestinal tract (e.g., in vivo), and/or efficacy (e.g., c.f.u. Attribute, percent positive expression).

Various methods are known in the art in connection with Saccharomyces yeast modification, expression systems and/or growth techniques. Those of ordinary skill in the art will readily recognize and understand how to select and use such methods in accordance with the present disclosure.

The following table provides details of certain embodiments of yeast strains that can be used in various ways for the purposes of the disclosed technology.

Therapeutic polypeptides

The present disclosure provides therapeutic polypeptides and engineered Saccharomyces yeast strains that express such therapeutic polypeptides. In some embodiments, the engineered saccharomyces yeast strain includes one or more nucleic acids encoding one or more therapeutic polypeptides. In some embodiments, the therapeutic polypeptide is synthesized in the gastrointestinal tract of the subject (e.g., expressed from an engineered saccharomyces yeast strain that includes nucleic acids encoding one or more therapeutic polypeptides). The engineered yeasts of the present disclosure can incorporate more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) copies of a gene of interest encoding a therapeutic polypeptide in their genome.

In some embodiments, the therapeutic polypeptide is or includes a polymeric chain of amino acids that elicit a therapeutic effect (e.g., the result of a medical treatment, which is judged to be desirable and/or beneficial).

In some embodiments, the therapeutic polypeptide comprises a naturally occurring amino acid sequence. In some embodiments, the therapeutic polypeptide comprises an amino acid sequence that does not occur in nature. In some embodiments, the therapeutic polypeptide comprises an amino acid sequence engineered as a result of design and/or production by artificial action. In some embodiments, the therapeutic polypeptide may include or consist of natural amino acids, unnatural amino acids, or both. In some embodiments, the therapeutic polypeptide may include or consist of only natural amino acids or only unnatural amino acids. In some embodiments, the therapeutic polypeptide may include a D-amino acid, an L-amino acid, or both. In some embodiments, the therapeutic polypeptide may include only D-amino acids. In some embodiments, the therapeutic polypeptide may include only L-amino acids. In some embodiments, the therapeutic polypeptide may comprise one or more pendant groups or other modifications, for example, modification of or attachment to one or more amino acid side chains at the N-terminus of the therapeutic polypeptide, at the C-terminus of the therapeutic polypeptide, or any combination thereof. In some embodiments, such side groups or modifications may be selected from the group consisting of: acetylation, amidation, lipidation, methylation, pegylation, and the like, including combinations thereof. In some embodiments, the therapeutic polypeptide may be cyclic, and/or may include a cyclic moiety. In some embodiments, the therapeutic polypeptide is not cyclic and/or does not include any cyclic moieties. In some embodiments, the therapeutic polypeptide is linear. In some embodiments, the therapeutic polypeptide may be or include a stapled therapeutic polypeptide. In some embodiments, the term "polypeptide" may be appended to the name of a reference polypeptide, activity, or structure; in such cases, it is used herein to refer to polypeptides having a related activity or structure, and thus may be considered members of the same class or family of polypeptides.

In some embodiments, the therapeutic polypeptide is a monomer. In some embodiments, the therapeutic polypeptide is a dimer. In some embodiments, the therapeutic polypeptide is a multimer. In some embodiments, the therapeutic polypeptide is a fusion polypeptide.

In some embodiments, the therapeutic polypeptide is or includes a receptor, cytokine, chemokine, hormone, enzyme, antimicrobial peptide, and/or any non-naturally functional protein (e.g., DARPin, etc.).

In some embodiments, the therapeutic polypeptide is or includes an antibody or functional fragment thereof. In some embodiments, the antibody is a monoclonal antibody (e.g., igA, igG, igE or IgM antibody). In some embodiments, the antibody is or comprises a bispecific antibody. In some embodiments, the antibody is or comprises a multispecific antibody. In some embodiments, the antibody is a human antibody, a humanized antibody, a chimeric antibody, a reverse chimeric antibody, an antibody having a light chain variable gene segment on the heavy chain, an antibody having a heavy chain variable gene segment on the light chain, and single chain Fv (scFv), single chain antibody, fab fragment, F (ab') fragment, disulfide-linked Fv (sdFv), intracellular antibody, minibody, bifunctional antibody, and anti-idiotype (anti-Id) antibody (comprising, for example, an anti-Id antibody to an antigen-specific TCR), or an epitope-binding fragment of any of the foregoing. Thus, "antigen binding fragments" and "antigen binding portions" and "epitope binding fragments" of an antigen binding molecule are also encompassed herein, and refer to fragments that retain the ability to bind to an antigen. The term "antigen binding protein" also includes, for example, single domain antibodies (e.g., VHH antibodies or "camelid" antibodies), heavy chain-only antibodies, covalent bifunctional antibodies, such as those disclosed in U.S. patent application publication 20070004909, which is incorporated by reference in its entirety, and Ig-DARTS, such as those disclosed in U.S. patent application publication 20090060910, which is incorporated by reference in its entirety. In some particular embodiments, the antibody is a canonical antibody that comprises at least two heavy (H) chains and two light (L) chains (e.g., interconnected by disulfide bonds).

In some embodiments, antibodies include digested fragments, specific portions, derivatives, and/or variants thereof, including, for example, antibody mimics or antibody portions including structures and/or functions that mimic antibodies or specific fragments or portions thereof, including single chain antibodies and fragments thereof. There are five major heavy chain classes (or isotypes) that determine the functional activity of an antibody molecule: igM, igD, igG, igA and IgE. Each heavy and light chain contains constant and variable regions (also referred to as "domains"). In summary, the heavy and light chain variable regions, also known as "Fab regions", bind specifically to a given antigen. The light and heavy chain variable regions comprise a "framework" region, also referred to as a "complementarity determining region" or "CDR," interrupted by three hypervariable regions. The framework regions and CDR ranges have been defined (see, e.g., kabat et al, sequence of proteins of immunological interest (Sequences of Proteins of Immunological Interest), U.S. health and human services (U.S. part of Health and Human Services), 1991). The Kabat database is now maintained online. The sequences of the framework regions of the different light or heavy chains are relatively conserved across species and the framework regions are used to form scaffolds that position the CDRs in the correct orientation by interchain non-covalent interactions.

Antibody CDRs are primarily responsible for binding to epitopes on antigens. The CDRs of each chain are typically referred to as CDR1, CDR2, and CDR3, numbered sequentially from the N-terminus, and are also typically identified by the chain in which the particular CDR is located. Thus, HCDR3 is located in the variable domain of the heavy chain of the antibody for which it was found, while LCDR1 is CDR1 from the variable domain of the light chain of the antibody for which it was found. Antibodies that bind to IL-3IRA will have specific VH and VL region sequences, and thus specific CDR sequences. Antibodies with different specificities typically have different CDRs. Although it is the CDR that varies from antibody to antibody, only a limited number of amino acid positions within the CDR are directly involved in antigen binding. These positions within the CDRs are known as Specificity Determining Residues (SDRs).

The antibody Fc fragment region (Fc) plays a role in modulating immune cell activity. The Fc region is used to ensure that each antibody produces an appropriate immune response to a given antigen by binding to a specific class of proteins or polypeptides found on certain cells, such as B lymphocytes, follicular dendritic cells, natural killer cells, macrophages, neutrophils, etc., and are referred to as "Fc receptors. Since the constant domains of the heavy chains constitute the Fc region of antibodies, the class of heavy chains in antibodies determines their class effect. The heavy chains in antibodies comprise α, γ, δ, ε, and μ and are associated with antibody isotypes IgA, igG, igD, igE and IgM, respectively. Thus, different isotypes of antibodies have different class effects due to the different Fc regions binding and activating different types of receptors. Exemplary Fc sequences are shown in table 2.

Table 2: exemplary Fc amino acid sequences

South llama (e.g., alpaca and llama) produces two immunoglobulin isotypes, igG2 and IgG3, which lack the light chain and are therefore referred to as heavy chain antibodies or hcabs. The VH domain of hcabs, known as VHH, is a single domain and is the smallest antigen binding agent known (about 15 kDa). VHH are easy to express using microorganisms (including yeast) and are generally more stable than conventional antibody fragments. Because of the many advantageous properties of VHHs, they have been widely used for research and show significant commercial potential. In some embodiments, the antibodies of the disclosure are or include VHH-Fc antibodies (e.g., one or more VHHs derived from camelidae pure heavy chain antibodies fused to Fc domains of IgG, igA, etc.). In some such embodiments, the VHH-Fc antibody is or comprises a single VHH fused to an Fc region. In some such embodiments, the VHH-Fc antibody is or includes two VHHs (e.g., VHH-Fc, fc-VHH, VHH-Fc-VHH) fused to an Fc region. In some embodiments, two VHHs may be fused together without an Fc region. In some embodiments, two VHHs may be fused together with other VHHs to form a trimer or tetramer. In some such embodiments, the two VHHs are identical. In some such embodiments, the two VHHs are different. In some embodiments, the biological activity between the forms of VHH-VHH-Fc, fc-VHH-VHH and VHH-Fc-VHH is similar. In some embodiments, the biological activity is different between the forms of VHH-VHH-Fc, fc-VHH-VHH and VHH-Fc-VHH. In some embodiments, the particular form produces higher expression. In some embodiments, the selectable marker affects neither overall screening nor expression of the antibody. In summary, the present disclosure provides binding protein/polypeptide forms, including but not limited to VHH, fc-VHH, VHH-Fc, VHH-VHH, fc-VHH, VHH-Fc-VHH, and VHH-Fc, wherein each or any domain (i.e., VHH or Fc) can be linked to another domain by an optional linker sequence.

In some embodiments, the therapeutic polypeptides of the present disclosure further comprise a tag (e.g., HA tag, his tag, FLAG tag, etc.). A variety of labels are known in the art, and one of ordinary skill in the art will readily recognize and understand how to utilize such labels in accordance with the present disclosure.

In some embodiments, the therapeutic polypeptides of the present disclosure further comprise a linker. In some such embodiments, the linker is a polypeptide linker. Various linkers are known in the art, and one of ordinary skill in the art will readily recognize and understand how to use such linkers in accordance with the present disclosure.

In some embodiments, the therapeutic polypeptides of the present disclosure further comprise aprotinin polypeptides. Exemplary aprotinin sequences are shown in table 3.

Table 3: exemplary aprotinin amino acid sequences.

In some embodiments, the therapeutic polypeptides of the present disclosure are expressed by recombinant expression vectors. Expression vectors are typically derived from plasmid or viral DNA, or may contain elements of both. Thus, expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, phage, recombinant virus, or other vector that upon introduction into an appropriate host cell produces expression of cloned DNA. Suitable expression vectors are well known to those skilled in the art and include those that are replicable in eukaryotic and/or prokaryotic cells and those that remain episomal or those that are incorporated into the host cell genome (e.g., engineered Saccharomyces yeast strains) (see, e.g., chen et al, science of transformation (Sci Transl. Med) 2020).

In some embodiments, the expression vector is one in which a nucleic acid comprising a desired DNA sequence (e.g., a DNA sequence (GOI) encoding a therapeutic polypeptide) can be inserted through restriction and ligation such that it is operably linked to regulatory sequences and can be expressed as an RNA transcript. In some embodiments, the vector may further comprise one or more marker sequences (e.g., as described elsewhere herein) suitable for identifying cells that have or have not been transformed or transfected with the vector. Additional exemplary markers include, for example, genes encoding proteins that increase or decrease resistance or sensitivity to antibiotics or other compounds, genes encoding enzymes whose activity can be detected by standard assays known in the art (e.g., beta-galactosidase, luciferase, or alkaline phosphatase), and genes that significantly affect the phenotype of transformed or transfected cells, hosts, colonies, or plaques (e.g., green fluorescent protein).

As used herein, a coding sequence and a regulatory sequence are considered to be "operably linked" when they are covalently linked in a manner that places the expression or transcription of the coding sequence under the influence or control of the regulatory sequence. In some embodiments, if it is desired to translate the coding sequence into a functional polypeptide (e.g., a therapeutic polypeptide), if induction of the promoter in the 5' regulatory sequence results in transcription of the coding sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frameshift mutation; (2) An interfering promoter region is considered to be operably linked if it directs the transcription of the coding sequence, or (3) interferes with the ability of the corresponding RNA transcript to be translated into a polypeptide (e.g., a therapeutic polypeptide). Thus, if a promoter region is capable of affecting transcription of the DNA sequence such that the resulting transcript can be translated into a desired protein or polypeptide (e.g., a therapeutic polypeptide), the promoter region will be operably linked to the coding sequence.

In some embodiments, when a nucleic acid encoding a therapeutic polypeptide of the present disclosure is expressed in a cell (e.g., saccharomyces yeast), a variety of transcription control sequences (e.g., promoters, enhancer sequences) can be used to direct its expression. The promoter may be a natural promoter, i.e., a promoter of a gene in its endogenous context, which provides for normal regulation of gene expression. In some embodiments, the promoter may be constitutive, comprising, for example, pADH1, pADH2, pHXT7, pHXT4, pHXT2, pPKG1, pPYK1, pTPL1, pSED1a, pSED1b, pJEN1, the promoter being unregulated, allowing for continuous transcription of its associated nucleic acid (e.g., a nucleic acid encoding a therapeutic polypeptide). In some embodiments, the promoter may be inducible, comprising, for example, pICL1, pMAL62, pGUT1, pFBP1, pSUC2, pCUP1, pHGT9, pHGT10, pHGT12, pHGT17, pPCK1. In some embodiments, the inducible promoter is active in the presence or absence of a chemical or under some conditions. Non-limiting examples of promoters include pTDH3 and pTEF. Various conditional promoters may also be used, such as promoters controlled by the presence or absence of a molecule. In some embodiments, the nucleic acid encoding the therapeutic polypeptide is inserted at an endogenous promoter region of a host cell (e.g., an engineered saccharomyces yeast strain). In some such embodiments, the insertion at the endogenous promoter region results in better expression and/or less stress in the host relative to an appropriate reference standard (e.g., an engineered saccharomyces yeast strain in which the exogenous promoter is contained in a nucleic acid encoding a therapeutic polypeptide).

In some embodiments, the regulatory sequences required for gene expression may vary between species or cell types, but should generally comprise 5 'untranslated sequences and 5' untranslated sequences, such as TATA boxes, capping sequences, CAAT sequences, etc., that are involved in the initiation of transcription and translation, respectively, if necessary. In particular, such 5' non-transcriptional regulatory sequences will comprise a promoter region comprising a promoter sequence for transcriptional control of an operably linked nucleic acid.

In some embodiments, the regulatory sequence includes an enhancer sequence or an upstream activator sequence as desired. The selection and design of the appropriate carrier is understood in the art. One of ordinary skill in the art will readily recognize and understand how to select and use such vectors in accordance with the techniques of the present disclosure.

Expression vectors containing all the necessary elements for expression are commercially available and known to those skilled in the art. See, e.g., sambrook et al, molecular cloning: laboratory Manual, fourth edition, cold spring harbor laboratory Press 2012. In some embodiments, the cells are engineered by introducing heterologous DNA (RNA) into the cells. The heterologous DNA (RNA) is placed under the effective control of a transcriptional element to allow expression of the heterologous DNA in a host cell (e.g., an engineered saccharomyces yeast strain). As one of ordinary skill in the art will readily appreciate, the therapeutic polypeptides described herein may also be expressed in other cell types.

Nucleic acid molecules encoding therapeutic polypeptides of the present disclosure can be introduced into one or more cells using methods and techniques standard in the art. For example, nucleic acid molecules can be introduced by standard protocols such as transformation, including chemical transformation and electroporation, transduction, particle bombardment, and the like. Expression of a nucleic acid molecule encoding a therapeutic polypeptide of the present disclosure may also be accomplished by incorporating the nucleic acid molecule into the genome. Incorporation of a nucleic acid (e.g., a nucleic acid encoding a therapeutic polypeptide described herein) can be accomplished by incorporating the new nucleic acid into the genome of a yeast cell (e.g., an engineered saccharomyces yeast strain), or by transient or stable maintenance of the new nucleic acid as an episomal element. In some embodiments, in eukaryotic cells, permanent heritable genetic changes are typically achieved by introducing nucleic acids into the genome of the cell.

Antitoxin ABAB

In some embodiments, the therapeutic polypeptide of the present disclosure is or includes an antitoxin of toxin a (also known as TcdA) and/or toxin B (also known as TcdB) (antitoxin ABAB) produced by clostridium difficile.

In some embodiments, the antitoxin ABAB is or includes an antibody or functional fragment thereof directed against TcdA, tcdB, or a combination thereof.

In some embodiments, the antitoxin of clostridium difficile toxin a and/or toxin B is or comprises a tetra-specific VHH fusion polypeptide. In some such embodiments, the four-specific VHH fusion polypeptide comprises four different toxin-neutralizing VHHs, two for toxin a and two for toxin B. In some such embodiments, the tetra-specific VHH fusion polypeptide is fused to an Fc fragment (e.g., a human IgG1 Fc fragment).

In some embodiments, the engineered saccharomyces yeast strain expresses antitoxin ABAB.

Exemplary antitoxin ABAB sequences are summarized in table 4.

Table 4: exemplary antitoxin ABAB amino acid sequences.

anti-TNF-alpha

In some embodiments, the therapeutic polypeptides of the present disclosure are or include antibodies to TNF- α. Table 5 summarizes exemplary sequences of antibodies against TNF- α.

In some embodiments, the engineered saccharomyces yeast strain expresses antibodies (e.g., FZ 006) to TNF- α. In some embodiments, the engineered saccharomyces yeast strain expresses antibodies (e.g., FZ 020) to TNF- α and antitoxin ABAB.

Table 5: exemplary anti-TNF-alpha antibody amino acid sequences.

anti-IL-17A

In some embodiments, the therapeutic polypeptides of the disclosure are or include antibodies to IL-17A. Table 6 summarizes exemplary sequences of antibodies against IL-17A.

In some embodiments, the engineered Saccharomyces yeast strain expresses an antibody to IL-17A (e.g., FZ 004).

Table 6: exemplary anti-IL-17A antibody amino acid sequences.

Bispecific antibodies against hIL-17A and TNF-alpha

In some embodiments, the therapeutic polypeptides of the present disclosure are or include bispecific antibodies. In some embodiments, the engineered saccharomyces yeast strain is highly efficient in secreting functional bispecific neutralizing antibodies. In some such embodiments, the form of the antibody comprises two fused anti-cytokine single domain antibodies, or VHHs (VHH-Fc-VHH and VHH-Fc), at the N-and C-termini of a human IgG1 Fc or at the N-terminus only. In some embodiments, the functional bispecific antibody is or comprises a bispecific antibody against IL-17 and TNF- α. In some embodiments, different promoters drive different expression of the anti-TNFα/IL-17A bispecific antibody gene.

In some embodiments, the engineered Saccharomyces yeast strain expresses bispecific antibodies (e.g., FZ 008) against IL-17A and TNF- α.

Table 7 summarizes exemplary sequences of bispecific antibodies against IL-17A and TNF- α.

Table 7: exemplary anti-IL-17A and TNF-alpha bispecific antibody amino acid sequences.

IL-22

In some embodiments, the therapeutic polypeptides of the disclosure are or include IL-22 polypeptides (e.g., functional IL-22 polypeptides). Table 8 summarizes exemplary sequences of IL-22 polypeptides.

In some embodiments, the engineered saccharomyces yeast strains disclosed herein express IL-22 polypeptides (e.g., FZ 010). In some such embodiments, the IL-22 polypeptide is linked to an Fc domain. In some embodiments, the engineered Saccharomyces yeast strains disclosed herein express an IL-22 polypeptide and a bispecific antibody (e.g., FZ 012) against IL-17A and TNF-alpha.

Table 8: exemplary IL-22 amino acid sequences expressed by engineered yeast strains.

Anti-rotavirus VHH

In some embodiments, the therapeutic polypeptide of the disclosure is or includes an anti-rotavirus VHH (e.g., an anti-rotavirus VHH,2KD 1). In some embodiments, the anti-rotavirus VHH is fused to aprotinin. Aprotinin is a single-chain polypeptide isolated from bovine lung and has anti-fibrinolytic and anti-inflammatory activity. Bovine aprotinin, a broad spectrum serine protease inhibitor, competitively and reversibly inhibits the activities of many different esterases and proteases, including trypsin, chymotrypsin, kallikrein, plasmin, tissue plasminogen activator, cathepsins and albumin, resulting in attenuation of Systemic Inflammatory Responses (SIR), fibrinolysis and thrombin generation. The agent also inhibits the release of pro-inflammatory cytokines and maintains glycoprotein homeostasis. Without wishing to be bound by any theory, fusion of aprotinin to an anti-rotavirus VHH (e.g., 2KD 1) can reduce or exclude digestion of the anti-rotavirus VHH (e.g., anti-rotavirus VHH,2KD 1) in the gastrointestinal tract and/or reduce inflammation.

In some embodiments, the engineered saccharomyces yeast strains disclosed herein express an anti-rotavirus VHH (e.g., FZ 014).

Table 9 summarizes exemplary sequences of anti-rotavirus VHH.

Table 9: exemplary anti-rotavirus VHH amino acid sequences.

Monospecific and bispecific VHH-Fc against norovirus

In some embodiments, the therapeutic polypeptides of the present disclosure are or include monospecific or bispecific VHH-Fc (e.g., M6M5-Fc and M6M 4-Fc) against norovirus. In some such embodiments, the VHH for the norovirus further comprises a tag (e.g., an HA tag).

In some embodiments, the engineered saccharomyces yeast strains disclosed herein express dual-specific VHH-Fc (e.g., M6M5-Fc and M6M 4-Fc) against norovirus (e.g., FZ 016). In some embodiments, the engineered saccharomyces yeast strains disclosed herein express monospecific VHH-Fc (e.g., FZ016 c) against norovirus. In some embodiments, the engineered saccharomyces yeast strains disclosed herein express bispecific VHH-Fc (e.g., FZ 018) against norovirus and antitoxin ABAB.

Table 10 summarizes exemplary sequences of bispecific or monospecific VHH-Fc against norovirus.

Table 10: exemplary bispecific VHH-Fc (FZ 016a, FZ016 b) and monospecific (FZ 016 c) amino acid sequences against norovirus. Bold and underlined sequences represent HA tag sequences.

GLP-1

In some embodiments, the therapeutic polypeptides of the present disclosure are or include GLP-1 polypeptides (e.g., functional GLP-1 polypeptides). Table 11 summarizes exemplary sequences of GLP-1 polypeptides.

In some embodiments, an engineered saccharomyces yeast strain disclosed herein expresses GLP-1 polypeptides (e.g., functional GLP-1 polypeptides, human functional GLP-1 polypeptides) (e.g., FZ 022).

Table 11: exemplary GLP-1 amino acid sequences.

/>

Leptin protein

In some embodiments, the therapeutic polypeptides of the present disclosure are or include leptin polypeptides (e.g., functional leptin polypeptides). Table 12 summarizes exemplary sequences of leptin polypeptides. In some such embodiments, the leptin polypeptide further comprises a tag (e.g., an HA tag).

In some embodiments, the engineered saccharomyces yeast strains disclosed herein express leptin polypeptides (e.g., functional leptin polypeptides, human functional leptin polypeptides) (e.g., FZ 024).

Table 12: exemplary leptin amino acid sequences. Bold and underlined sequences represent HA tag sequences.

Anti-human TNF-alpha IgG1

In some embodiments, the therapeutic polypeptide of the present disclosure is or includes anti-TNF-alpha IgG1. In some such embodiments, anti-TNF-alpha IgG1 comprises humira. In some such embodiments, the anti-TNF-alpha IgG1 comprises adalimumab (adalimumab). Table 13 summarizes exemplary sequences of anti-TNF-alpha IgG1.

In some embodiments, the engineered saccharomyces yeast strains disclosed herein express anti-TNF-alpha IgG1 (e.g., FZ 026).

Table 13: exemplary anti-TNF-alpha IgG1 acid sequences.

/>

VHH to cwp84 fused to a lytic domain

In some embodiments, the therapeutic polypeptides of the disclosure are or include VHH for cwp84 fused to a lytic domain table 14 summarizes exemplary sequences of VHHs for cwp84 fused to a lytic domain.

In some embodiments, the engineered saccharomyces yeast strains disclosed herein express VHH against cwp84 (e.g., FZ 028) fused to a lysin domain.

Table 14: exemplary VHH amino acid sequences for cwp84 fused to a lysin domain.

/>

IL-10

In some embodiments, the therapeutic polypeptides of the disclosure are or include IL-10 polypeptides (e.g., functional IL-10 polypeptides). Table 15 summarizes exemplary sequences of IL-10 polypeptides.

In some embodiments, the engineered saccharomyces yeast strains disclosed herein express IL-10 polypeptides (e.g., functional IL-10 polypeptides, human functional leptin polypeptides) (e.g., FZ 030).

Table 15: exemplary 1L-10 amino acid sequences.

Table 16 summarizes exemplary therapeutic polypeptide structures and sequences of the present disclosure.

Table 16: exemplary therapeutic polypeptide structures and amino acid sequences.

/>

M, mouse form; wFc, wild-type human Fc; mFc; mutating human Fc; HC, heavy chain; LC, light chain. Bold/underlined, HA tag;

use of the same

The present disclosure provides, among other things, engineered Saccharomyces yeast strains having therapeutic or clinical uses, compositions including the same, and methods of using the same for treating various diseases and conditions. Also described herein are methods of administering an engineered saccharomyces yeast strain and/or compositions thereof to a subject in need thereof. In some aspects, the subject may have an inflammatory bowel disease, such as, for example, crohn's disease, ulcerative colitis, or another inflammatory bowel disease, or may have an immune-related condition, or a liver disease, graft versus host disease, diabetes, obesity, neurodegenerative disease, pain, stroke, cardiovascular disease, infectious disease, autoimmune disease, colon cancer, and other GI malignant disease, or an dysbiosis affecting the skin, oral cavity, gastrointestinal tract, vagina, or another organ. Other compositions, compounds, methods, features and advantages of the present disclosure will be or become apparent to one of ordinary skill in the art upon examination of the following figures, detailed description and examples. It is intended that all such additional compositions, compounds, methods, features, and advantages be included within this description, be within the scope of the present disclosure.

Also disclosed herein are methods of treating (e.g., comprising treating during remission, e.g., to minimize symptoms) or preventing (e.g., comprising preventing recurrence, maintenance therapy) a disease, disorder, and/or condition associated with inflammation in a subject. In some embodiments, the methods comprise administering to a subject in need thereof a therapeutically effective amount of an engineered saccharomyces yeast strain described herein and/or a disclosed pharmaceutical composition as described herein. In some embodiments, the subject may be a vertebrate, such as a human, dog, cat, horse, cow, pig, sheep, goat, rabbit, chicken, or turkey. In some embodiments, the mammal is a human. In some embodiments, the disease is associated with inflammation. In some embodiments, the disease may be, for example, ulcerative colitis, crohn's disease, another inflammatory bowel disease, colon cancer, diabetes, obesity, eczema, bacterial vaginosis, vaginal yeast infection, alzheimer's disease, stress, depression, anxiety, bipolar disorder, neurodegenerative disease, pain, stroke, cardiovascular disease, infectious disease, autoimmune disease, or any combination thereof.

In some aspects, the subject has a disease associated with inflammation, and treatment with an engineered saccharomyces yeast strain described herein is considered therapeutic. In other aspects, the subject is at risk of a disease associated with inflammation (e.g., an immune-related condition), and treatment with an engineered saccharomyces yeast strain is considered prophylactic. In some embodiments, the engineered saccharomyces yeast strain has a further probiotic effect, such as, for example, an effect associated with a wild-type (non-engineered or parent) saccharomyces yeast strain, including, for example, saccharomyces boulardii. In some aspects, the treatment reduces at least one symptom of a disease, disorder, and/or condition associated with inflammation in the subject relative to the symptom of the subject prior to the treatment. In another aspect, the symptom may be, for example, one or more of the following: diarrhea, fever, fatigue, weight loss, hematochezia, abdominal cramps, abdominal pain, loss of appetite, intestinal lesions, rashes, itching, mouth ulcers, or any combination thereof.

Also disclosed herein are methods of treating or preventing a disease associated with inflammation in a subject, the method comprising administering to the subject a therapeutically effective amount of an engineered saccharomyces yeast strain described herein and/or the disclosed pharmaceutical compositions. In another aspect, the subject may be a mammal and the disease may be associated with inflammation. In one aspect, the disease may be ulcerative colitis, crohn's disease, celiac disease, irritable Bowel Syndrome (IBS), colitis induced by Clostridium difficile or another bacterium or virus or by T cell transfer or by sodium dextran sulfate (DSS), another inflammatory bowel disease, infectious gastrointestinal disease, including but not limited to rotavirus, norovirus, cytomegalovirus, herpes virus, enterovirus, adenovirus, human papillomavirus, acute self-limiting colitis, bacterial enterocolitis, enteroclostridia, mycobacterial infection of the GI tract, spirochete infection of the GI tract, fungal infection of the GI tract, protozoal or helminth infection of the GI tract, intestinal inflammation (e.g., chronic intestinal inflammation), cardiovascular disease, including but not limited to coronary artery disease, peripheral artery disease, cerebrovascular disease, renal artery stenosis, aortic aneurysm, cardiomyopathy, hypertensive heart disease, heart failure, pulmonary heart disease, heart dysrhythmias, endocarditis, inflammatory cardiac hypertrophy, myocarditis, valvular heart disease, congenital heart disease, rheumatic heart disease, cancer such as for example esophageal cancer, gastric cancer, rectal cancer, small intestine, gastrointestinal stromal tumor, nasopharyngeal cancer, colon cancer or another gastrointestinal cancer, diabetes (type 1 or type 2), hypoglycemia, hypercholesterolemia or another metabolic disease, obesity, fatty liver disease, steatohepatitis, cirrhosis, liver cancer, eczema, psoriasis, sweaty sweat gland, skin ulcers, bacterial vaginosis, vaginal yeast infection, rotavirus, norovirus HIV-associated inflammation, rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, amyotrophic lateral sclerosis, systemic lupus erythematosus, food allergy, malabsorption, diarrhea, acid reflux (e.g., GERD), biological disorders, diverticulitis, sepsis, solid tumors, including but not limited to breast cancer, bladder cancer, head and neck squamous cell carcinoma, melanoma, neuroblastoma, lung cancer, ovarian cancer, non-small cell lung cancer, liquid tumors, including but not limited to lymphoma, large B-cell lymphoma, diffuse large B-cell lymphoma, acute myelogenous leukemia, aging associated with inflammation, neurological diseases, including but not limited to alzheimer's disease, depression, stress, anxiety, bipolar disorder, schizophrenia, multiple sclerosis, parkinson's disease, stroke, or any combination thereof. In some aspects, the subject has a disease associated with inflammation. In other aspects, the subject is at risk for a disease associated with inflammation and an autoimmune disease. In some aspects, the treatment reduces at least one symptom of a disease associated with inflammation in the subject relative to the symptom of the subject prior to the treatment. In another aspect, the symptom may be diarrhea, fever, fatigue, weight loss, hematochezia, abdominal cramps, abdominal pain, loss of appetite, intestinal damage, rash, itching, mouth ulcers, or any combination thereof.

In some embodiments, a method of treating and/or preventing a disease associated with inflammation in a subject comprises administering to the subject a therapeutically effective amount of an engineered saccharomyces yeast strain described herein or a composition (e.g., a pharmaceutical composition) comprising the same.

Clostridium Difficile Infection (CDI)

Clostridium difficile (Clostridium difficile) or clostridium difficile (Clostridioides difficile) (clostridium difficile (c. Difficilie)) is a gram positive, sporulating, anaerobic bacillus that is widely distributed in the intestinal tract and environment of humans and animals. Spores of clostridium difficile are transmitted through the faecal-oral pathway, and pathogens are widely present in the environment. Potential reservoirs of clostridium difficile include asymptomatic carriers, infected patients, contaminated environments, and animal intestines (canine, feline, porcine, avian). Approximately 5% of adults and 15-70% of infants are colonized by Clostridium difficile, and the prevalence of colonization is several times higher in hospitalized patients or nursing home residents (Czepixel J et al J. European journal of clinical microbiology and infectious diseases (Eur J Clin Microbiol Infect Dis.)) (2019; 38 (7): 1211-1221).

Clostridium difficile infection is mostly a result of spore transmission. Spores are resistant to heat, acids and antibiotics. The primary protective barrier against Clostridium Difficile Infection (CDI) is the normal gut microflora. After reaching the gut, bile acids play an important role in inducing clostridium difficile spore germination. In vitro, primary bile acids (e.g., cholic acid and chenodeoxycholic acid) generally stimulate germination of clostridium difficile spores; secondary bile acids (e.g., deoxycholic acid and lithocholic acid) inhibit this process.

When the balance of intestinal microorganisms is disrupted, clostridium difficile starts to dominate and colonise the large intestine, which may be the first step of infection, without wishing to be bound by any theory. Pathogens are non-invasive and toxicity is understood to be primarily due to two major toxins that disrupt the epithelial cytoskeleton, resulting in disruption of tight junctions, fluid secretion, neutrophil adhesion, and local inflammation, leading to disruption of intestinal barrier integrity and loss of functionality. Most important in the pathogenesis of clostridium difficile disease are toxins a and B, which are enterotoxic and cytotoxic; traditionally, however, toxin a is designated "enterotoxin a" (TcdA) and toxin B is designated "cytotoxin B" (TcdB). Clostridium difficile transferase (CDT or binary toxin) is the third toxin produced by some clostridium difficile strains, comprising the epidemic PCR ribotype 027. The toxin is transported into the cytoplasm where it inactivates the Rho family of gtpases. Rho protein is involved in actin polymerization and thus stabilizes the cytoskeleton of the cell. The inflammatory process is exacerbated by Rho protein inactivation. In more severe cases, micro-ulcers, which are covered with pseudomembranes (composed of destroyed intestinal cells, neutrophils and fibrin), begin to appear at the intestinal mucosal surface.

In some embodiments, an engineered saccharomyces yeast strain as described herein can be used to treat and/or prevent CDI. In some such embodiments, the engineered saccharomyces yeast strain for the treatment and/or prevention of CDI expresses antitoxin ABAB as described herein. In some such embodiments, the engineered saccharomyces yeast strain for the treatment and/or prevention of CDI comprises saccharomyces boulardii (e.g., FZ 002) expressing antitoxin ABAB as described herein.

In some embodiments, the engineered saccharomyces yeast strains as described herein can be used to treat and/or prevent CDI associated with Inflammatory Bowel Disease (IBD). In some cases, CDI is associated with worse outcome in subjects diagnosed with or suffering from IBD. In some such embodiments, the engineered saccharomyces yeast strain for treating and/or preventing CDI associated with IBD expresses anti-tnfα and antitoxin ABAB (e.g., FZ 020) as described herein.

Inflammatory Bowel Disease (IBD)

Inflammatory Bowel Disease (IBD) is characterized by chronic inflammation of the gastrointestinal tract and is understood to be caused by interactions between genetic and environmental factors that affect the immune response. Ulcerative Colitis (UC) and Crohn's Disease (CD) are the predominant forms of IBD and are chronic and frequently recurring diseases characterized by bloody diarrhea and abdominal cramps that require long-term medication, frequent hospitalization, and even surgery. The disease is characterized by a deregulation of the mucosal immune system and a dysbiosis of the intestinal microbiota. According to the centers for disease control and prevention (CDC), approximately 310 million american adults (or 1.3%) suffer from IBD, with annual direct treatment costs exceeding seven (7) billion dollars. Despite the great efforts in developing therapeutic agents, the hospitalization rate for these diseases in the united states has steadily increased over the last few decades, and has increased significantly from 44.2 per 100,000 to 59.7 over 10 years from 2003 to 2013. In addition, overall hospitalization costs continue to rise, resulting in significant economic losses to patients, insurers and employers. Serious complications of IBD can be debilitating and ultimately can lead to death.

The etiology of inflammatory bowel disease is unknown. The pathogenesis of CD and UC is likely to involve interactions between genetic factors and environmental factors, such as bacterial factors, although causative factors have not been identified to date. The main theory is that an abnormal immune response, probably driven by intestinal microbiota, occurs in IBD. However, T cells are known to play an important role in pathogenesis. Activated T cells can produce both anti-inflammatory cytokines and pro-inflammatory cytokines. One existing therapy involves systemic treatment with anti-TNF monoclonal antibodies. Single intravenous administration of cA2 infliximab antibodies ranging from 5 to 20mg/kg resulted in significant clinical improvement of active crohn's disease. The use of systemic administration of recombinant IL-10 in a 7 day treatment regimen at doses ranging from 0.5 to 25 μg/kg showed reduced crohn's disease activity scores and increased remission. However, these strategies require systemic administration by injection of purified protein or polypeptide therapeutics, which is both costly and inconvenient for the patient. Existing UC management strategies also involve the use of anti-inflammatory and immunosuppressive drugs, such as corticosteroids, which are often associated with generalized immunosuppression. However, up to 40% of patients do not respond to the initial treatment. Of the initial responders, 13% -46% relapsed in the following year. Thus, current UC treatment options are not ideal and new treatments are needed.

TNF- α plays a key role in the pathogenesis of UC in both animal models and humans and has been widely accepted as a therapeutic target for inflammatory disorders such as IBD. anti-TNF-alpha biologicals approved by the U.S. Food and Drug Administration (FDA) include infliximab, adalimumab, golimumab, and cetuzumab, with revolutionary therapies for a variety of chronic inflammatory conditions, including rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, CD, and UC. All of these antibody therapeutics must be administered parenterally. While systemically delivered anti-TNF-alpha biologics are very effective, their long term use is often associated with a loss of effectiveness due to anti-drug antibody responses and immunosuppressive side effects. IL-17A is the most widely studied member of the IL-17 family. IL-17A plays a key role in host defense against various microbial pathogens and tissue inflammation. Cd4+ T helper cells, also known as Th17 cells, that produce IL-17A have been widely studied in the last decade and have been demonstrated to be potent inducers of tissue inflammation and have been associated with the pathogenesis of many experimental autoimmune diseases and human inflammatory conditions. Much evidence suggests that IL-17A-producing cells, including Th17 cells, are involved in human psoriasis, rheumatoid arthritis, multiple sclerosis, inflammatory bowel disease and asthma. anti-IL-17A is approved by the FDA for the treatment of psoriasis and this pathway has also been studied in asthma, rheumatoid arthritis, multiple sclerosis, transplant rejection and inflammatory bowel disease.

Interleukin-22 (IL-22) is generally described as a cytokine expressed by immune cells but specific to non-immune cells. The role of the so-called barrier surfaces, such as skin, lung and intestinal tract, in which the role of IL-22 attachment is usually related to proliferation, regeneration or activation of innate immune mechanisms, is best understood. IL-22 may act synergistically with IL-17 and/or TNFα. In the gut, IL-22 signaling promotes important functions, including host defense against pathogens and wound healing. The use of intestinal recombinant IL-22 may have beneficial effects on liver and pancreas injury, ulcerative colitis, graft versus host disease.

In some embodiments, the engineered saccharomyces yeast strains as described herein can be used to treat and/or prevent IBD (e.g., UC and CD). In some such embodiments, the engineered saccharomyces yeast strain for the treatment and/or prevention of IBD expresses anti-tnfa as described herein. In some such embodiments, the engineered saccharomyces yeast strain for use in treating and/or preventing IBD comprises saccharomyces boulardii (e.g., FZ 006) expressing an anti-tnfa antibody as described herein. In some such embodiments, the engineered saccharomyces yeast strain for the treatment and/or prevention of IBD expresses bispecific antibodies against IL-17A and TNF-a described herein. In some such embodiments, the engineered saccharomyces yeast strain for the treatment and/or prevention of IBD comprises saccharomyces boulardii (e.g., FZ 008) that expresses bispecific antibodies against IL-17A and TNF-a. In some such embodiments, an engineered saccharomyces yeast strain for the treatment and/or prevention of IBD expresses an IL-22 polypeptide described herein. In some such embodiments, the engineered saccharomyces yeast strain for use in treating and/or preventing IBD comprises an IL-22 expressing saccharomyces boulardii (e.g., FZ 010). In some such embodiments, an engineered Saccharomyces yeast strain for use in the treatment and/or prevention of IBD expresses IL-22 and bispecific antibodies against IL-17A and TNF- α as described herein. In some such embodiments, the engineered Saccharomyces yeast strain for use in the treatment and/or prevention of IBD comprises Saccharomyces cerevisiae (e.g., FZ 012) expressing IL-22 and bispecific antibodies to IL-17A and TNF-alpha. In some such embodiments, the engineered saccharomyces yeast strain for the treatment and/or prevention of IBD expresses anti-human TNF-alpha IgG1 as described herein. In some such embodiments, the engineered saccharomyces yeast strain for use in the treatment and/or prevention of IBD comprises saccharomyces boulardii expressing anti-human TNF-alpha IgG1 (e.g., FZ 026).

Intestinal inflammation and nervous system diseases

Intestinal inflammation is a contributor to many serious diseases and conditions, such as metabolic disorders and neurological diseases, which significantly affect the quality of life of humans, leading to a large number of loss of function, morbidity and even mortality. Recent studies have demonstrated that chronic intestinal inflammation is a potential key factor in the initiation and progression of neurodegenerative diseases including, for example, depression, parkinson's disease and alzheimer's disease.

Neurodegenerative diseases occur when neurons in the central nervous system (e.g., brain and spinal cord) or peripheral nervous system are nonfunctional and die over time. With age, the risk of developing neurodegenerative diseases increases dramatically. The average life span of humans is increasing each year, which means that more people will be affected by neurodegenerative diseases for the next decades. An increasing number of people recognize that one potential culprit for neurodegenerative diseases is intestinal inflammation. The association between the brain and the gut through the gut-brain axis becomes more and more evident. One such link between the brain and the gut begins in the Enteric Nervous System (ENS). ENS comprises two layers of hundreds of millions of nerve cells, is arranged in the gastrointestinal tract from the esophagus to the rectum, and can induce mood changes. There is evidence that stimulation from the Gastrointestinal (GI) system may signal the Central Nervous System (CNS) through ENS. Thus, intestinal inflammation can trigger emotional changes through the gut-brain axis. Interestingly, psychological disorders such as anxiety and depression are prevalent in patients suffering from Irritable Bowel Syndrome (IBS). Thus, treatment and/or prevention of intestinal inflammation may lead to treatment and/or prevention of neurodegenerative and/or neurological diseases.

Proinflammatory cytokines, such as, for example, TNF- α and interleukin 17A (IL-17A), are key immune mediators that contribute to the pathogenesis of many inflammatory diseases as well as chronic intestinal inflammation and immune-related conditions. Without wishing to be bound by any theory, methods for controlling cytokine-mediated inflammation may be provided using neutralizing antibodies that specifically bind to cytokines and block their interaction with receptors on immune cells, thereby inhibiting downstream inflammatory pathways. Thus, in some embodiments, an engineered saccharomyces yeast strain for use in the treatment and/or prevention of intestinal inflammation and immune-related diseases (e.g., neurological diseases) expresses antibodies to pro-inflammatory cytokines, including bispecific antibodies to IL-17A and TNF-alpha and/or anti-TNF-alpha IgG1, for example, as described herein. In some such embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation and/or immune-related conditions includes saccharomyces boulardii (e.g., FZ 008) that expresses bispecific antibodies against IL-17A and TNF-a. In some such embodiments, the engineered saccharomyces yeast strain for use in treating and/or preventing intestinal inflammation comprises saccharomyces boulardii (e.g., FZ 006) expressing an anti-TNF-alpha VHH. In some such embodiments, the engineered saccharomyces yeast strain for use in treating and/or preventing intestinal inflammation comprises saccharomyces boulardii expressing anti-TNF-alpha IgG1 (e.g., FZ 026). In some embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation comprises saccharomyces boulardii (e.g., FZ 004) expressing an anti-IL-17A antibody as described herein. In some embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation comprises saccharomyces boulardii (e.g., FZ 030) that expresses IL-10 as described herein.

Diabetes mellitus

Diabetes is a chronic disease characterized by hyperglycemia. Impaired glucose tolerance and hyperglycemia are the primary clinical and diagnostic features of diabetes and are understood to be the result of absolute or relative insulin deficiency or resistance to its action. Chronic hyperglycemia associated with diabetes may lead to end organ dysfunction and failure, and may involve, for example, the retina, kidneys, nerves, and blood vessels.

Traditionally, most cases of diabetes fall into two major categories of pathogenesis, type 1 diabetes (T1D) and type 2 diabetes (T2D). However, in some subjects, this classification is not applicable because other genetic, immune, or neuroendocrine pathways are involved in pathogenesis. T1D is associated with insulin deficiency due, at least in part, to immune-mediated destruction of pancreatic beta cells. T2D is the most common form of diabetes and is understood to be caused at least in part by insulin resistance. The new role of inflammation in both T1D and T2D pathophysiology and related metabolic disorders has led to increasing interest in targeting inflammation to improve the prevention and control of both T1D and T2D.

In some embodiments, an engineered saccharomyces yeast strain for the treatment and/or prevention of diabetes expresses a GLP-1 therapeutic polypeptide described herein. In some such embodiments, the engineered saccharomyces strains for use in treating and/or preventing diabetes include saccharomyces boulardii (e.g., FZ 022) expressing GLP-1 polypeptides described herein (e.g., human active GLP-1 therapeutic polypeptides).

In some embodiments, an engineered saccharomyces yeast strain for the treatment and/or prevention of diabetes expresses a leptin therapeutic polypeptide described herein. In some such embodiments, the engineered saccharomyces strains for use in treating and/or preventing diabetes include saccharomyces boulardii (e.g., FZ 024) expressing a leptin polypeptide described herein (e.g., a human active leptin therapeutic polypeptide).

In some embodiments, an engineered Saccharomyces yeast strain for the treatment and/or prevention of diabetes expresses an IL-22 therapeutic polypeptide described herein. In some such embodiments, the engineered saccharomyces yeast strain for the treatment and/or prevention of diabetes comprises saccharomyces boulardii (e.g., FZ 010) expressing an IL-22 therapeutic polypeptide described herein.

In some embodiments, the engineered saccharomyces yeast strains as described herein can be used to treat and/or prevent low-grade chronic intestinal inflammation associated with diabetes. In some embodiments, an engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with diabetes expresses anti-TNF-a as described herein. In some embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with diabetes comprises saccharomyces boulardii (e.g., FZ 006) expressing an anti-TNF-a antibody as described herein. In some embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with diabetes includes saccharomyces boulardii expressing an anti-IL-17A antibody as described herein (e.g., FZ 004). In some embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with diabetes includes saccharomyces boulardii (e.g., FZ 030) that expresses IL-10 as described herein. In some embodiments, an engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with diabetes expresses bispecific antibodies against IL-17A and TNF-a described herein. In some embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with diabetes includes saccharomyces boulardii (e.g., FZ 008) that expresses bispecific antibodies against IL-17A and TNF- α. In some embodiments, an engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with diabetes expresses an IL-22 polypeptide or IL-22-Fc fusion described herein. In some embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with diabetes includes saccharomyces boulardii expressing IL-22 (e.g., FZ 010). In some embodiments, an engineered Saccharomyces yeast strain for use in treating and/or preventing intestinal inflammation associated with diabetes expresses IL-22 and a bispecific antibody directed against IL-17A and TNF-alpha as described herein. In some embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with diabetes includes saccharomyces boulardii (e.g., FZ 012) expressing IL-22 and bispecific antibodies to IL-17A and TNF-a. In some embodiments, an engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with diabetes expresses anti-human TNF-alpha IgG1 as described herein. In some such embodiments, the engineered saccharomyces yeast strain for use in treating and/or preventing intestinal inflammation associated with diabetes includes saccharomyces boulardii expressing anti-human TNF-alpha IgG1 (e.g., FZ 026).

Obesity disease

Obesity, which means that the Body Mass Index (BMI) of an adult is greater than or equal to 30, is an increasingly serious global public health problem. The world health organization reports that 13% of adults over 18 years old are clinically obese, totaling over 6 hundred million people. The health risk of obesity stems from its association with an increased risk of several diseases, including hypertension, type 2 diabetes, cardiovascular disease, osteoarthritis, renal failure, liver disease, and several types of cancer. Interestingly, chronic inflammation, a phenotype associated with obesity, is a major factor in the progression of the chronic disease described above.

Obesity-related inflammation is first triggered by excess nutrients and is mainly located in specialized metabolic tissues, such as white adipose tissue, which serves as a main source of energy and is mainly composed of adipocytes. Adipocytes are endocrine cells that secrete large amounts of cytokines, hormones, and growth factors, known as adipokines, and store energy exclusively in the form of triglycerides in cytoplasmic lipid droplets. Excessive nutrition results in activation of metabolic signaling pathways including c-Jun N-terminal kinase (JNK), nuclear factor κb (nfkb), and protein kinase R. Without wishing to be bound by any theory, it is understood that activation of these pathways results in induction of low levels of inflammatory cytokines, resulting in a low-grade inflammatory response. Overnutrition and obesity also lead to proliferation and hypertrophy of white adipose tissue adipocytes, as well as extensive tissue remodeling and increased free fatty acids, leading to alterations in adipokine production and low grade inflammatory responses. Obesity also leads to increased endoplasmic reticulum stress, leading to activation of unfolded protein responses, which leads to increased activation of nfκ B, JNK and oxidative stress, and in turn leads to up-regulation of inflammatory cytokines. These pathways contribute to the initiation of obesity-related inflammation. While inflammation associated with obesity is primarily limited to white adipose tissue, other tissues, including liver, pancreas, and brain, have been shown to increase in inflammation under obesity.

In some embodiments, an engineered saccharomyces yeast strain for the treatment and/or prevention of obesity expresses a GLP-1 therapeutic polypeptide described herein. In some such embodiments, the engineered saccharomyces strains for use in treating and/or preventing obesity include saccharomyces boulardii (e.g., FZ 022) expressing the human active GLP-1 therapeutic polypeptides described herein.

In some embodiments, an engineered saccharomyces yeast strain for the treatment and/or prevention of obesity expresses a leptin therapeutic polypeptide described herein. In some such embodiments, the engineered saccharomyces yeast strain for the treatment and/or prevention of obesity comprises saccharomyces boulardii (e.g., FZ 024) expressing a human active leptin therapeutic polypeptide described herein.

In some embodiments, an engineered Saccharomyces yeast strain for the treatment and/or prevention of obesity expresses an IL-22 therapeutic polypeptide described herein. In some such embodiments, the engineered saccharomyces yeast strain for the treatment and/or prevention of obesity comprises saccharomyces boulardii (e.g., FZ 010) expressing an IL-22 therapeutic polypeptide described herein.

In some embodiments, the engineered saccharomyces yeast strains as described herein can be used to treat and/or prevent chronic intestinal inflammation associated with obesity. In some embodiments, an engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with obesity expresses anti-TNF-a as described herein. In some such embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with obesity includes saccharomyces boulardii (e.g., FZ 006) expressing an anti-tnfa antibody as described herein. In some embodiments, an engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with obesity expresses bispecific antibodies against IL-17A and TNF-a described herein. In some such embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with obesity includes saccharomyces boulardii (e.g., FZ 008) that expresses bispecific antibodies to IL-17A and TNF- α. In some embodiments, an engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with obesity expresses an IL-22 clone or IL-22-Fc fusion described herein. In some such embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with obesity includes IL-22 expressing saccharomyces boulardii (e.g., FZ 010). In some embodiments, an engineered Saccharomyces yeast strain for use in treating and/or preventing intestinal inflammation associated with obesity expresses IL-22 described herein and bispecific antibodies against IL-17A and TNF-alpha. In some such embodiments, the engineered saccharomyces yeast strain for use in treating and/or preventing intestinal inflammation associated with obesity includes saccharomyces boulardii (e.g., FZ 012) expressing IL-22 and bispecific antibodies to IL-17A and TNF-a. In some embodiments, an engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with obesity expresses anti-human TNF-alpha IgG1 as described herein. In some such embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with obesity includes saccharomyces boulardii expressing anti-human TNF-alpha IgG1 (e.g., FZ 026). In some embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with obesity includes saccharomyces boulardii expressing an anti-IL-17A antibody as described herein (e.g., FZ 004). In some embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with obesity includes saccharomyces boulardii (e.g., FZ 030) that expresses IL-10 as described herein.

Fatty Liver Disease (FLD) and other liver diseases

Fatty liver disease (FLD, or "fatty liver") corresponds to the presence of large vesicular changes without inflammation (steatosis) and inflammation of the small leaves without extensive drinking. It can be divided into two subgroups: NAFL (non-alcoholic fatty liver) or just steatosis and NASH (non-alcoholic steatohepatitis). NAFL is defined as the presence of hepatic steatosis, but without evidence of hepatocyte damage, as a balloon-like change in hepatocytes. NASH is defined as the presence of hepatic steatosis and inflammation with hepatocyte injury (balloon-like), hyaline body (Malloryhyaline), and mixed lymphocyte and neutrophil inflammatory infiltrates with or without fibrotic perivenular regions.

Interestingly, the interleukin-20 (IL-20) cytokine family reduced liver injury and inflammation in both non-alcoholic and alcoholic liver disease models. For example, interleukin-22 (IL-22), a member of the IL-20 subfamily, controls lipid metabolism in the liver by activating STAT3 signaling pathways. Thus, in some embodiments, an engineered saccharomyces yeast strain for the treatment and/or prevention of FLD expresses an IL-22 therapeutic polypeptide described herein. In some such embodiments, the engineered saccharomyces yeast strain for the treatment and/or prevention of FLD includes saccharomyces boulardii (e.g., FZ 010) that expresses an IL-22 therapeutic polypeptide described herein.

The gut-liver axis describes the physiological interactions between the gut and the liver and is of great importance for maintaining health. Disruption of this balance is an important factor in the evolution and progression of many liver diseases. Intestinal inflammation results in an impaired intestinal barrier function, translocation of microorganisms and microbial products, known as microbial or pathogen-associated molecular patterns (MAMP/PAMPs), to the liver, leading to liver inflammation. Thus, in some embodiments, an engineered saccharomyces yeast strain for the treatment and/or prevention of FLD expresses an anti-inflammatory therapeutic polypeptide described herein, such as anti-tnfa, anti-IL-17A. In some such embodiments, the engineered saccharomyces strains for use in treating and/or preventing FLD include saccharomyces boulardii (e.g., FZ006, FZ008, FZ 026) expressing an anti-tnfa, anti-IL-17A therapeutic polypeptide described herein.

Graft Versus Host Disease (GVHD)

Graft Versus Host Disease (GVHD) is a systemic disorder that occurs when immune cells of a graft recognize the host as a foreign object and attack the body cells of the recipient. "graft" refers to transplanted or donated tissue, and "host" refers to the recipient's tissue. GVHD is a significant cause of morbidity in subjects receiving treatments such as allogeneic cell therapy or transplantation. Immune cell recognition hosts can induce "cytokine storms," i.e., related pro-inflammatory responses caused by cytokines.

Thus, in some embodiments, an engineered saccharomyces yeast strain for the treatment and/or prevention of GVHD expresses an IL-22 therapeutic polypeptide described herein and/or a monospecific or bispecific antibody directed against IL-17A and/or TNF-a. In some such embodiments, the engineered saccharomyces yeast strains for use in the treatment and/or prevention of GVHD include saccharomyces boulardii expressing IL-10 or IL-22 therapeutic polypeptides described herein and/or monospecific or bispecific antibodies to IL-17A and/or TNF- α (e.g., FZ004, FZ006, FZ008, FZ010, FZ012, FZ030, and FZ 026). Brevibacterium (e.g., FZ004, FZ006, FZ008, FZ010, FZ012, FZ030 and FZ 026) expressing the IL-10 or IL-22 therapeutic polypeptides described herein and/or monospecific or bispecific antibodies directed against IL-17A and TNF- α can also be used to treat metabolic disorders.

Gastrointestinal viruses (e.g., rotavirus, norovirus)

Viruses are causative agents of acute infectious gastroenteritis that cause inflammation of the lining of the gastrointestinal tract, resulting in vomiting, watery diarrhea or a combination of both that occur suddenly in otherwise healthy individuals. Two different viruses cause most cases. Rotavirus is the major causative agent of sporadic severe gastroenteritis in young children and causes death in about 1600 children worldwide per day, mainly in developing countries. Norovirus is the primary causative agent of epidemic infectious gastroenteritis in infants and adults. For example, the outbreak of gastroenteritis in closed environments such as recreational rounds and nursing homes is a typical manifestation of norovirus infection. However, norovirus is also a common cause of severe gastroenteritis sporadically in young children (see, e.g., franco MA et al, goldman's Cecil medicine 2012), 2144-2147.

Rotaviruses belonging to the reoviridae family are large icosahedral non-enveloped viruses with a segmented double stranded RNA genome and a three-layer protein capsid. Rotaviruses are classified into groups a to G based on the presence of cross-reactive epitopes and their general genetic relevance. Group a rotaviruses are the major enteropathogens in humans and many other species. Group B viruses have been discovered sporadically in outbreaks of chinese adult diarrhea disease, and recently in studies of childhood occasional gastroenteritis, mainly india. Worldwide, group C rotaviruses are associated with relatively low frequency of diarrhea disease in humans and animals. Group D to G rotaviruses were isolated only from animals, mainly birds. Rotavirus is a 100-nm particle with three concentric protein layers: the core consists of VP1, VP2 and VP3, and a segmented double-stranded RNA genome; the middle layer is formed by VP6 (the most abundant and antigenic structural viral protein); and the outer layer is composed of VP7 and VP 4. The genome consists of 11 double stranded RNA segments, which total about 18 kilobases and encode six structural proteins and six non-structural proteins. Like almost all other RNA viruses, rotavirus RNA polymerase is prone to error, coupled with selection pressure such as immune evolution, driving virus diversity. For rotaviruses, gene recombination, i.e. the mixing of gene segments from different parent viruses in cells co-infected with two or more strains, and rearrangement of the viral genome also promotes gene diversity. The reassortment of gene segments between animal and human rotavirus strains also occurs in natural environments, especially in less developed countries.

Norovirus is one of five genera of the caliciviridae family, a non-enveloped icosahedral virus, with a relatively small positive-strand single-stranded RNA genome. Norovirus is further classified into five genomes (GI to GV), of which only three (GI, GII and GIV) are known to infect humans. GIII viruses and GV viruses infect cattle and mice, respectively, and to date, these animal viruses have not been demonstrated to infect humans. Viruses in each genome are further divided into genotypes (more than 25 have been described) and subgroups. Norwalk virus is a prototype genome genotype I1 (GI.1) virus. The norovirus genome is approximately 7.7 kilobases in size and consists of three open reading frames, the first of which encodes a non-structural protein necessary for viral replication. The second open reading frame encodes the major capsid protein, viral protein 1 (VP 1). When it is expressed as a recombinant protein, 180 VP1 molecules automatically assemble into virus-like particles, which is critical for studying norovirus epidemiology and immunity.

Thus, in some embodiments, an engineered saccharomyces yeast strain for use in treating and/or preventing rotavirus expresses an anti-rotavirus VHH described herein. In some such embodiments, the engineered saccharomyces strains for use in treating and/or preventing rotavirus include saccharomyces boulardii (e.g., FZ 014) expressing an anti-rotavirus VHH described herein.

In some embodiments, an engineered saccharomyces yeast strain for the treatment and/or prevention of norovirus expresses a bispecific VHH-Fc (e.g., M6M5-Fc and M6M 4-Fc) against norovirus described herein. In some such embodiments, the engineered saccharomyces yeast strain for use in the treatment and/or prevention of norovirus includes saccharomyces boulardii (e.g., FZ 016) that expresses bispecific VHH-Fc (e.g., M5, M6M5-Fc, and M6M 4-Fc) against norovirus described herein.

In some embodiments, the subject is infected with both norovirus and clostridium difficile. Thus, in some embodiments, an engineered saccharomyces yeast strain for use in the treatment and/or prevention of norovirus and clostridium difficile co-infection expresses a bispecific VHH-Fc (e.g., M6M5-Fc and M6M 4-Fc) and an antitoxin ABAB described herein for a norovirus. In some such embodiments, the engineered saccharomyces yeast strains for use in treating and/or preventing norovirus and clostridium difficile co-infection include saccharomyces boulardii (e.g., FZ 018) expressing bispecific VHH-Fc (e.g., M6M5-Fc and M6M 4-Fc) and antitoxin ABAB for norovirus described herein.

Gastrointestinal tract infection

IL-22 is an important cytokine that maintains homeostasis of various mucosal barriers, including the gastrointestinal tract. During infection by enteric pathogens, IL-22 is highly upregulated, leading to induction of various antimicrobial factors, wound healing, and restoration of barrier function. In the gut, IL-22 signaling promotes important functions, including host defense against pathogens and wound healing. The use of intestinal recombinant IL-22 may have beneficial effects on liver and pancreas injury, ulcerative colitis, graft versus host disease.

In some embodiments, an engineered Saccharomyces yeast strain for use in treating and/or preventing colonization and infection by an enteropathogen expresses an IL-22 polypeptide described herein. In some such embodiments, the engineered saccharomyces yeast strain for use in treating and/or preventing colonization and infection by an enteropathogen includes saccharomyces boulardii (e.g., FZ 010) that expresses an IL-22 polypeptide described herein.

Cardiovascular diseases

Intestinal inflammation results in a decrease in intestinal barrier integrity, which in turn increases circulating levels of bacterial structural components and microbial metabolites (including trimethylamine-N-oxide and short chain fatty acids), which may promote the development of cardiovascular disease (CVD). In some embodiments, an engineered saccharomyces yeast strain as described herein can be used to treat and/or prevent intestinal inflammation associated with CVD. In some embodiments, an engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with CVD expresses anti-TNF-a as described herein. In some such embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with CVD includes saccharomyces boulardii (e.g., FZ004 or FZ 006) expressing anti-IL 17A or anti-TNF-a antibodies as described herein. In some embodiments, an engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with CVD expresses bispecific antibodies against IL-17A and TNF-a described herein. In some such embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with CVD includes saccharomyces boulardii expressing bispecific antibodies to IL-17A and TNF-a (e.g., FZ 008). In some embodiments, an engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with CVD expresses an IL-22 clone or IL-22-Fc fusion described herein. In some such embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with CVD includes saccharomyces boulardii expressing IL-22 (e.g., FZ 010). In some embodiments, an engineered Saccharomyces yeast strain for use in treating and/or preventing intestinal inflammation associated with CVD expresses IL-22 and bispecific antibodies to IL-17A and TNF-alpha described herein. In some such embodiments, the engineered saccharomyces yeast strain for use in treating and/or preventing intestinal inflammation associated with CVD includes saccharomyces boulardii (e.g., FZ 012) expressing IL-22 and bispecific antibodies to IL-17A and TNF-a. In some embodiments, an engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with CVD expresses anti-human TNF-alpha IgG1 as described herein. In some such embodiments, the engineered saccharomyces yeast strain for treating and/or preventing intestinal inflammation associated with CVD includes saccharomyces boulardii expressing anti-human TNF-alpha IgG1 (e.g., FZ 026).

Irritable Bowel Syndrome (IBS)

Irritable Bowel Syndrome (IBS) is a gastrointestinal-related disorder that manifests as persistent abdominal pain or discomfort, often associated with changes in bowel habits and frequency and form of bowel movements. While IBS was thought to primarily affect the western population, it is becoming increasingly common in asian developing countries. IBS is classified into constipation-predominant IBS (IBS-C), diarrhea-predominant IBS (IBS-D), alternating or mixed IBS (A/M-IBS) and post-infection IBS (PI-IBS). Patients with IBS increasingly exhibit various neuropsychiatric symptoms, such as worsening of gastrointestinal physiology, including visceral hypersensitivity, altered intestinal membrane permeability, and gastrointestinal motility dysfunction. The gut-brain axis links the correlation between gut events and central events in IBS-related gastrointestinal, neurological and psychiatric pathologies. The pathophysiology of IBS involves alterations in gut-brain axis signaling, dysbiosis, allovisceral pain signaling, and gut immune activation. Immune activation plays a role in the pathogenesis of IBS through bi-directional communication between the nervous system and the immune system. The gut microbiota is associated with IBS, and changes in the composition, temporal stability and metabolic activity of the gut microbiota have been described in patients with IBS.

In some embodiments, engineered saccharomyces yeast strains as described herein can be used to treat and/or prevent IBS by affecting gut inflammation, barrier function, and gut microbiota, such as FZ004, FZ006, FZ008, FZ010, FZ012, FZ026, and FZ030.

Composition (e.g., pharmaceutical composition)

In another aspect, disclosed herein is a pharmaceutical composition comprising one or more engineered Saccharomyces strains and at least one pharmaceutically acceptable carrier or diluent. In some aspects, the pharmaceutical composition may be formulated as an oral dosage form, a rectal dosage form, a vaginal dosage form, or a topical dosage form. In some aspects, the oral dosage form includes an enteric coating. In still another aspect, the pharmaceutical compositions disclosed herein are less costly to produce than monoclonal or polyclonal antibodies. In any of these aspects, administration of the pharmaceutical composition does not induce an anti-drug response.

In various aspects, the disclosure relates to pharmaceutical compositions comprising a therapeutically effective amount of an engineered saccharomyces yeast strain described herein. As used herein, "pharmaceutically acceptable carrier" means one or more of pharmaceutically acceptable diluents, preservatives, antioxidants, solubilizers, emulsifiers, colorants, mold release agents, coating agents, sweeteners, flavoring and perfuming agents and adjuvants. The disclosed pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy and pharmaceutical sciences.

In a further aspect, the disclosed pharmaceutical compositions comprise a therapeutically effective amount of at least one disclosed engineered saccharomyces boulardii organism strain, a pharmaceutically acceptable carrier, optionally one or more other therapeutic agents, and optionally one or more adjuvants. The disclosed pharmaceutical compositions comprise pharmaceutical compositions suitable for oral administration.

In various aspects, the disclosure also relates to a pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent and, as an active ingredient, a therapeutically effective amount of one or more engineered saccharomyces yeast strains. In one aspect, the therapeutically effective amount of the pharmaceutical composition comprises about 10 to about 100 hundred million Colony Forming Units (CFU) of an engineered saccharomyces yeast strain, or about 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 hundred million CFU of an engineered saccharomyces yeast strain, or a combination of any of the foregoing values, or a range covering any of the foregoing values.

In practice, the organisms of the present disclosure (e.g., engineered Saccharomyces yeast strains) can be intimately mixed in combination as an active ingredient with pharmaceutical carriers according to conventional pharmaceutical mixing techniques. The carrier may take a variety of forms depending on the form of the formulation desired for administration, for example, orally or parenterally (including intravenously). Thus, the pharmaceutical compositions of the present disclosure may be presented as discrete units suitable for administration of: suitable for oral administration, such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient; or suitable for vaginal administration, including bioadhesive delivery systems, phase-change poloxamers, tablets, suppositories, creams, gels, vaginal rings, and the like; suitable for rectal administration (i.e., suppositories and/or enemas); or suitable for topical application (e.g., solutions, lotions, creams, ointments, gels, pastes, aerosol foams, aerosol sprays, powders, solids, transdermal patches, and the like). Further, the composition may be present as a powder, a granule, a solution, a suspension in an aqueous liquid, a non-aqueous liquid, an oil-in-water emulsion, or a water-in-oil liquid emulsion. In some embodiments, the composition is present in combination with a food (e.g., a feed provided to an animal such as a piglet or poultry, a medical food for humans). In addition to the common dosage forms set forth above, the compounds of the present disclosure and/or one or more pharmaceutically acceptable salts thereof may also be administered by controlled release devices and/or delivery devices. The composition may be prepared by any pharmaceutical method. Typically, such methods comprise the step of bringing the active ingredient into association with the carrier which constitutes one or more essential ingredients. Typically, the compositions are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both. The product can then be conveniently shaped to the desired appearance.

For ease of administration and uniformity of dosage, it is particularly advantageous to formulate the aforementioned pharmaceutical compositions in unit dosage form. As used herein, the term "unit dosage form" refers to physically discrete units suitable as unitary dosages; each unit contains a predetermined amount of active ingredient calculated to produce the desired therapeutic effect associated with the required pharmaceutical carrier. That is, "unit dosage form" is understood to mean a single dose in which all active and inactive ingredients are combined in a suitable system such that a patient or person administering a drug to a patient can open a single container or package containing the entire dose therein without having to mix any of the components together from two or more containers or packages. Typical examples of unit dosage forms are tablets (including scored or coated tablets), capsules or pills for oral administration; powder pack (powder packet); a sheet; and isolated multiple unit dosage forms thereof. The list of unit dosage forms is not intended to be limiting in any way, but merely represents a typical example of a unit dosage form.

The pharmaceutical compositions disclosed herein comprise as active ingredients one or more engineered saccharomyces yeast strains of the present disclosure, a pharmaceutically acceptable carrier, and optionally one or more additional therapeutic agents. In various aspects, the disclosed pharmaceutical compositions can comprise a pharmaceutically acceptable carrier and an engineered saccharomyces yeast strain described herein. In further aspects, the engineered saccharomyces yeast strains described herein can also be included in pharmaceutical compositions in combination with one or more other therapeutically active compounds. The compositions of the present disclosure comprise compositions suitable for oral administration. The pharmaceutical composition may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy.

For example, techniques and compositions for preparing dosage forms useful in the materials and methods described herein are described in the following references: modern pharmacy (Modern Pharmaceutics), chapters 9 and 10 (Banker and Rhodes, editions, 1979); pharmaceutical dosage form: tablets (Pharmaceutical Dosage Forms: tables) (Lieberman et al, 1981); introduction to pharmaceutical dosage forms (Introduction to Pharmaceutical Dosage Forms), 2 nd edition (1976); remington's pharmaceutical science (Remington's Pharmaceutical Sciences), 17 th edition (Mich publishing Co., iston, pa. (Mack Publishing Company, easton, pa.), 1985); pharmaceutical science progress (Advances in Pharmaceutical Sciences) (David Ganderton, trevor Jones, editions, 1992); pharmaceutical science progress, volume 7 (David Ganderton, trevor Jones, james McGinity, editions, 1995); aqueous polymer coatings for pharmaceutical dosage forms (Aqueous Polymeric Coatings for Pharmaceutical Dosage Forms) ("pharmaceutical and pharmaceutical science (Drugs and the Pharmaceutical Sciences), series 36) (James McGinity edit, 1989); drug microparticle carrier: therapeutic application: medicine and pharmaceutical science, volume 61 (Alain rocrand, editions, 1993); drug delivery to the gastrointestinal tract (Drug Delivery to the Gastrointestinal Tract) (Ellis Horwood, bioscience, pharmaceutical technology series (Series in Pharmaceutical Technology); J.G.Hardy, S.S.Davis, clive G.Wilson, eds.); modern pharmaceutical and pharmaceutical science (Modern Pharmaceutics Drugs and the Pharmaceutical Sciences), volume 40 (Gilbert s.banker, christopher t.rhodes, editions).

The compounds described herein are generally administered in admixture with a suitable pharmaceutical diluent, excipient, synergist or carrier (referred to herein as a pharmaceutically acceptable carrier or vehicle) that is suitably selected with respect to the form of intended administration and is consistent with conventional pharmaceutical practice. The deliverable compound will be in a form suitable for oral administration. The carrier comprises a solid or a liquid, and the type of carrier is selected based on the type of application used. The compounds may be administered in dosages having known amounts of the compounds.

Oral administration may be the preferred dosage form due to its ease of administration, and tablets and capsules represent the most advantageous oral unit dosage form, in which case solid pharmaceutical carriers are obviously employed. However, other dosage forms may also be suitable depending on the clinical population (e.g., age and severity of clinical condition), the solubility properties of the particular disclosed compounds used, and the like. Thus, the disclosed compounds may be used in oral dosage forms such as pills, powders, granules, elixirs, tinctures, suspensions, syrups and emulsions. In some embodiments, the disclosed compounds (e.g., the engineered saccharomyces yeast strains described herein) are encapsulated. In preparing the composition into an oral dosage form, any convenient pharmaceutical medium may be employed. For example, water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents and the like can be used to form oral liquid preparations such as suspensions, elixirs and solutions; and carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents and the like may be used to form oral solid preparations such as powders, capsules and tablets. Because of ease of administration, tablets and capsules are the preferred oral dosage units whereby solid pharmaceutical carriers are employed. Optionally, the tablets may be coated by standard aqueous or non-aqueous techniques.

The disclosed pharmaceutical compositions in oral dosage form may include one or more pharmaceutical excipients and/or additives. Non-limiting examples of suitable excipients and additives include gelatin, natural sugars such as raw sugar or lactose, lecithin, sucrose, trehalose, inulin, ACP, alginates, sodium ascorbate, magnesium sulfate, pectin, starches (e.g., corn starch or amylose), dextran, microcrystalline cellulose, maltodextrin, magnesium stearate, silica, polyvinylpyrrolidone, polyvinyl acetate, gum arabic, alginic acid, methylcellulose (tylose), talc, powdered rock, silica gel (e.g., colloid), cellulose derivatives (e.g., cellulose ethers, wherein the cellulose hydroxyl groups are partially etherified with a low saturated fatty alcohol and/or a low saturated fatty oxo alcohol, such as methyl oxypropyl cellulose, methyl cellulose, hydroxypropyl methylcellulose phthalate, fatty acids and fatty acids having 12 to 22 carbon atoms, in particular magnesium, ascorbate, sodium, calcium or aluminum ascorbate salts (e.g. stearates), emulsifiers, oils and fats, in particular vegetable oils (e.g. peanut oil, castor oil, olive oil, sesame oil, cottonseed oil, corn oil, wheat germ oil, sunflower seed oil, cod liver oil, in each case optionally also hydrated); c (C) ₁₂ H ₂₄ O ₂ To C ₁₈ H ₃₆ O ₂ Glycerides and polyglycerol esters of saturated fatty acids and mixtures thereof (the glycerol hydroxyl groups may be fully esterified, or may be only partially esterified (e.g., mono-, di-, and tri-glycerides)); pharmaceutically acceptable esters of monovalent or polyvalent alcohols and polyglycols (e.g. polyethylene glycols and derivatives thereof), aliphatic saturated or unsaturated fatty acids (2 to 22 carbon atoms, in particular 10 to 18 carbon atoms) with monovalent aliphatic alcohols (1 to 20 carbon atoms) which may also optionally be etherified or polyvalent alcohols such as ethylene glycol, glycerol, diethylene glycol, pentaerythritol, sorbitol, mannitol, esters of citric acid with primary alcohols, acetic acid, urea, benzyl benzoate, dioxolane, glycerol formal, tetrahydrofurfurylAlcohols, polyglycol ethers with 01-012 alcohols, dimethylacetamide, lactamide, lactates, ethylcarbonates, silicones (especially medium consistency polydimethylsiloxanes), calcium carbonate, sodium carbonate, calcium phosphate, sodium phosphate, magnesium carbonate, magnesium sulfate, and the like.

Other auxiliary substances used for the preparation of oral dosage forms are substances that cause disintegration (so-called disintegrants), such as: crosslinked polyvinylpyrrolidone, sodium carboxymethyl starch, sodium carboxymethyl cellulose or microcrystalline cellulose. Conventional coating materials may also be used to create oral dosage forms. For example, coating substances that may be considered are: polymers and copolymers of acrylic acid and/or methacrylic acid and/or esters thereof; copolymers of acrylates and methacrylates having a relatively low ammonium group content (e.g., RS), copolymers of acrylic and methacrylic acid esters with trimethylammonium methacrylate (e.g.)>RL); polyvinyl acetate; fats, oils, waxes, fatty alcohols; hydroxypropyl methylcellulose phthalate or succinate acetate; cellulose acetate phthalate, starch acetate phthalate, polyvinyl acetate phthalate, carboxymethyl cellulose; methylcellulose phthalate, methylcellulose succinate, methylcellulose phthalate succinate, and methylcellulose phthalate half-ester; corn protein; ethylcellulose and ethylcellulose succinate; shellac, gluten; ethylcarboxyethylcellulose; methacrylate-maleic anhydride copolymers; maleic anhydride-vinyl methyl ether copolymer; styrene-maleic acid copolymers; 2-ethyl-hexyl-acrylate maleic anhydride; crotonic acid-vinyl acetate copolymer; glutamic acid/glutamate copolymer; carboxymethyl ethyl cellulose glycerol monocaprylate; cellulose acetate succinate; polyarginine.

Plasticizers which can be considered coating materials in the disclosed oral dosage forms are: citric acid and tartaric acid esters (acetyl triethyl citrate, acetyl tributyl citrate, triethyl citrate); glycerol and glycerides (diacetin, triacetin, acetylated monoglycerides, castor oil); phthalate esters (dibutyl phthalate, dipentyl phthalate, diethyl phthalate, dimethyl phthalate, dipropyl phthalate), di (2-methoxy or 2-ethoxyethyl) phthalate, ethylphthaloyl glycolate, butylphthaloyl ethyl glycolate, and butylglycolate; alcohols (propylene glycol, polyethylene glycols of different chain lengths), adipates (diethyl adipate, di (2-methoxy-or 2-ethoxyethyl) adipate); benzophenone; diethyl sebacate and dibutyl sebacate, dibutyl succinate, dibutyl tartrate; diethylene glycol dipropionate; ethylene glycol diacetate, dibutyrate, dipropionate; tributyl phosphate, tributyrin; polyethylene glycol sorbitan monooleate (polysorbates, such as Polysorbar 50); sorbitan monooleate.

In addition, suitable binders, lubricants, disintegrating agents, coloring agents, flavoring agents, flow-inducing agents and/or melting agents can be included as carriers. The pharmaceutical carrier employed may be, for example, solid or liquid. Examples of solid carriers include, but are not limited to, lactose, terra alba, sucrose, glucose, methyl cellulose, dicalcium phosphate, calcium sulfate, mannitol, sorbitol talc, starch, gelatin, agar, pectin, gum arabic, microcrystalline cellulose (microcrystalline cellulose), maltodextrin, magnesium stearate, silica, and stearic acid. Examples of liquid carriers are syrup, peanut oil, olive oil, and water.

In various aspects, the binder may comprise, for example, starch, gelatin, natural sugars such as glucose or β -lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth, alginic acid or sodium alginate, carboxymethyl cellulose, polyethylene glycol, waxes, and the like. Lubricants used in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like. In further aspects, the disintegrant may comprise, for example, starch, methylcellulose, agar, bentonite, xanthan gum, and the like.

In various aspects, an oral dosage form, such as a solid dosage form, can include the disclosed microorganisms in contact with one or more biodegradable polymers. Suitable biodegradable polymers that can be used to achieve controlled release of the drug include, for example, polylactic acid, polyglycolic acid, copolymers of polylactic and polyglycolic acid, caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates, and hydrogels, preferably covalently crosslinked hydrogels.

Tablets may contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients may be, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, such as corn starch or alginic acid; binders, such as starch, gelatin or gum arabic; and lubricants such as magnesium stearate, stearic acid or talc. The tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.

Tablets containing the disclosed microorganisms may be prepared by compression or molding, optionally together with one or more auxiliary ingredients or adjuvants. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form (such as powder or granules) optionally mixed with a binder, lubricant, inert diluent, surfactant or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.

In another aspect, the engineered Saccharomyces yeast strain may be lyophilized in a pharmaceutical composition. In some embodiments, the engineered saccharomyces yeast strain can be mixed with a cryoprotectant to enhance viability during lyophilization. In some aspects, the pharmaceutical composition may be formulated into an oral dosage form. In one aspect, the oral dosage form may be a capsule, tablet, caplet, gel capsule, powder, liquid solution, suspension, or any combination thereof. In some aspects, the oral dosage form includes an enteric coating.

In one aspect, the oral dosage form is superior to other methods of administration therapies directed at inflammatory cytokines. In some aspects, standard therapies, such as crohn's disease, ulcerative colitis, etc., may involve administration of biological and/or other therapeutic agents by injection or infusion. In some aspects, such drug administration reduces patient compliance because the trip to the treatment site must be scheduled and medical personnel need to be trained to administer the treatment by injection or infusion. In other aspects, therapeutic agents administered by injection or infusion are required to be sterile and/or potentially elicit an immune response in a subject. Thus, in one aspect, the disclosed pharmaceutical compositions and oral dosage forms represent a significant improvement over existing therapies in that they can be self-administered by the patient at home and do not elicit an immune response. In still another aspect, the pharmaceutical compositions disclosed herein are less costly to produce than monoclonal or polyclonal antibodies.

In various aspects, solid oral dosage forms such as tablets or capsules may be coated with an enteric coating to prevent immediate dissolution in the stomach. In various aspects, the enteric coating agent includes, but is not limited to, hydroxypropyl methylcellulose phthalate, methacrylic acid-methacrylate copolymer, polyvinyl acetate phthalate, and cellulose acetate phthalate. Use of Akihiko Hasegawa "solid dispersion of nifedipine with enteric coating agent in the preparation of sustained release dosage forms (Application of solid dispersions of Nifedipine with enteric coating agent to prepare a sustained-release dosage form)" (chemical and pharmaceutical bulletins (chem. Pharm Bull.)) 33:1615-1619 (1985). Various enteric coating materials can be selected based on testing to achieve enteric coated dosage forms initially designed to have a better combination of dissolution time, coating thickness and diameter crush strength (see, e.g., s.c. Porter et al, "properties of enteric tablet coatings prepared from polyvinyl acetate-phthalate and cellulose acetate phthalate (The Properties of Enteric Tablet Coatings Made From Polyvinyl Acetate-phthalate and Cellulose acetate Phthalate)", journal of pharmacy and pharmacology (j. Pharm. Pharmacol.) (22:42 p (1970)). In further aspects, the enteric coating may include hydroxypropyl-methylcellulose phthalate, methacrylic acid-methacrylate copolymers, polyvinyl acetate-phthalate, and cellulose acetate phthalate.

In various aspects, the oral dosage form may be a solid dispersion with a water-soluble or water-insoluble carrier. Examples of water-soluble or water-insoluble carriers include, but are not limited to, polyethylene glycol, polyvinylpyrrolidone, hydroxypropyl methylcellulose, phosphatidylcholine, polyoxyethylene hydrogenated castor oil, hydroxypropyl methylcellulose phthalate, carboxymethyl ethylcellulose or hydroxypropyl methylcellulose, ethylcellulose or stearic acid.

In various aspects, the oral dosage form may be a liquid dosage form, including a liquid dosage form that is ingested or alternatively administered as a mouthwash or rinse. For example, liquid dosage forms may comprise an aqueous suspension containing the active material in admixture with excipients suitable for the manufacture of aqueous suspensions. Alternatively, oily suspensions may be formulated by suspending the active ingredient in a vegetable oil (for example arachis oil, olive oil, sesame oil or coconut oil) or in a mineral oil such as liquid paraffin. Oily suspensions may also contain various excipients. The pharmaceutical compositions of the present disclosure may also be in the form of an oil-in-water emulsion, which may also contain excipients such as sweetening and flavoring agents.

For the preparation of the solution or suspension, for example, water (in particular sterile water) or physiologically acceptable organic solvents such as alcohols (ethanol, propanol, isopropanol, 1, 2-propanediol, polyethylene glycols and derivatives thereof, fatty alcohols, partial glycerides), oils (e.g. peanut oil, olive oil, sesame oil, almond oil, sunflower oil, soybean oil, castor oil, beef tallow), paraffin, dimethyl sulfoxide, triglycerides, etc. can be used.

In the case of liquid dosage forms such as drinkable solutions, the following may be used as stabilizers or solubilizers: lower aliphatic monovalent and polyvalent alcohols having 2 to 4 carbon atoms, such as ethanol, N-propanol, glycerol, polyethylene glycols having a molecular weight of between 200 and 600 (for example, 1 to 40% aqueous solutions), diethylene glycol monoethyl ether, 1, 2-propanediol, organic amides, for example amides of aliphatic C1-C6 carboxylic acids with ammonia or primary, secondary or tertiary C1-C4 amines or C1-C4 hydroxylamine, such as urea, urethane, acetamide, N-methylacetamide, N-diethylacetamide, N-dimethylacetamide, lower aliphatic amines and diamines having 2 to 6 carbon atoms, such as ethylenediamine, hydroxyethhylline, tromethamine (for example, in the form of 0.1 to 20% aqueous solutions), aliphatic amino acids.

In preparing the disclosed liquid dosage forms, solubilizers and emulsifiers may be used, such as the following non-limiting examples: polyvinylpyrrolidone, sorbitan fatty acid esters (e.g. sorbitan trioleate), phospholipids (e.g. lecithin), gum arabic, tragacanth, polyoxyethylated sorbitan monooleate and other ethoxylated fatty acid esters of sorbitan, polyoxyethylated fats, polyoxyethylated oleic triglycerides, linoleic oleic triglycerides, polyethylene oxide condensation products of fatty alcohols, alkylphenols or fatty acids or 1-methyl-3- (2-hydroxyethyl) imidazolidone- (2). In this context polyoxyethylation means that the substance in question contains polyoxyethylene chains, the degree of polymerization of which is generally between 2 and 40, and in particular between 10 and 20. Such polyoxyethylated materials may be obtained, for example, by reacting hydroxyl-containing compounds (e.g., mono-or diglycerides or unsaturated compounds, such as oleic acid group-containing compounds) with ethylene oxide (e.g., 40Mol ethylene oxide per 1Mol glyceride). Examples of oleic acid triglycerides are olive oil, peanut oil, castor oil, sesame oil, cottonseed oil, corn oil. See also H.P. Fiedler doctor Lexikon der Hillsstoffe f ur Pharmazie Kostnetik und angrenzende Gebiete 1971, pages 191-195.

In various aspects, the liquid dosage form may further include preservatives, stabilizers, buffer substances (e.g., phosphate buffered saline, PBS), flavoring agents, sweeteners, colorants, antioxidants, complex forming agents, and the like. For example, complex forming agents that may be considered are: chelating agents such as ethylenediamine tetraacetic acid, nitrilotriacetic acid, diethylenetriamine pentaacetic acid and salts thereof.

It may optionally be necessary to stabilize the pH range of the liquid dosage form at about 6 to 9 with a physiologically acceptable base or buffer. The pH value is preferably neutral or weakly alkaline (at most pH 8) as much as possible.

In order to enhance the solubility and/or stability of the disclosed microorganisms in the disclosed liquid dosage forms, it may be particularly advantageous to employ alpha-cyclodextrin, beta-cyclodextrin or gamma-cyclodextrin or derivatives thereof, in particular hydroxyalkyl-substituted cyclodextrins, such as 2-hydroxypropyl-beta-cyclodextrin or sulfobutyl-beta-cyclodextrin. In addition, co-solvents such as alcohols may increase the solubility and/or stability of compounds according to the present disclosure in pharmaceutical compositions.

The pharmaceutical compositions of the present disclosure may be in a form suitable for rectal administration, wherein the carrier is a solid. Preferably, the mixture forms a unit dose suppository. Suitable carriers include cocoa butter and other materials commonly used in the art. Suppositories may be conveniently formed by first mixing the composition with the softened or melted carrier, followed by cooling and shaping in a mold.

The pharmaceutical compositions of the present disclosure may be in a form suitable for topical administration. As used herein, the phrase "topically applied" means applied to a biological surface, wherein the biological surface comprises, for example, areas of skin (e.g., hands, forearms, elbows, legs, face, nails, anus, and genital areas) or mucous membranes. The compositions of the present invention may be formulated in any form commonly used for topical application by selection of an appropriate carrier and optionally other ingredients as described in detail below that may be included in the compositions. Topical pharmaceutical compositions may be in the form of creams, ointments, pastes, gels, lotions, milks, suspensions, aerosols, sprays, foams, dusting powders, pads and patches. Further, the composition may be in a form suitable for use in a transdermal device. These formulations may be prepared by conventional processing methods using the compounds of the present disclosure or pharmaceutically acceptable salts thereof. As an example, a cream or ointment is prepared by mixing hydrophilic material and water together with about 5wt% to about 10wt% of a compound to produce a cream or ointment having a desired consistency.

In compositions suitable for transdermal administration, the carrier optionally includes a permeation enhancer and/or a suitable humectant, optionally in combination with minor proportions of any suitable additive of any nature, which does not have a significant deleterious effect on the skin. The additives may facilitate application to the skin and/or may facilitate preparation of the desired composition. These compositions may be applied in a variety of ways, for example in the form of transdermal patches, spot-on (spot-on), ointments.

Ointments are semisolid preparations, usually based on petrolatum or petroleum derivatives. The particular ointment base to be used is one that provides optimal delivery of the active agent selected for a given formulation and also preferably provides other desirable characteristics (e.g., emollient). Like other carriers or vehicles, the ointment base should be inert, stable, non-irritating and non-sensitizing. Such as in the case of ramington: pharmaceutical science and practice (Remington: the Science and Practice of Pharmacy), 19 th edition, mark publication company of islon, pennsylvania (Easton, pa.: mack Publishing co.) (1995), explanation of the ointment base on pages 1399-1404, can be grouped into four categories: an oleaginous base; an emulsifiable matrix; an emulsion matrix; a water-soluble matrix. The oleaginous ointment base comprises, for example, vegetable oils, fats obtained from animals and semi-solid hydrocarbons obtained from petroleum. Emulsifiable ointment bases, also known as absorbent ointment bases, contain little or no water and contain, for example, hydroxystearin sulfate, anhydrous lanolin, and hydrophilic petrolatum. The emulsion ointment base is a water-in-oil (W/O) emulsion or an oil-in-water (0/W) emulsion and comprises, for example, cetyl alcohol, glycerol monostearate, lanolin, and stearic acid. Preferably, the water-soluble ointment base is prepared from polyethylene glycols having different molecular weights.

Lotions are formulations that can be applied to the skin surface without friction. Lotions are typically liquid or semi-liquid formulations in which solid particles comprising the active agent are present in a water or alcohol matrix. Lotions are generally preferred for treating large body areas because of the ease of application of the more fluid compositions. Lotions are typically suspensions of solids and typically comprise liquid oily emulsions of the oil-in-water type. Insoluble materials in the wash solution generally need to be finely dispersed. Lotions typically contain suspending agents for better dispersion, as well as compounds such as methylcellulose, sodium carboxymethylcellulose, and the like, which can be used to locate the active agent and keep the active agent in contact with the skin.

The cream is a viscous liquid or semisolid emulsion of the oil-in-water type or water-in-oil type. The cream base is typically water washable and contains an oil phase, an emulsifier, and an aqueous phase. The oil phase, also referred to as the "internal" phase, typically comprises petrolatum and/or fatty alcohols such as cetyl or stearyl alcohol. The aqueous phase typically, although not necessarily exceeding the volume of the oil phase, typically contains a humectant. The emulsifier in the cream formulation is typically a nonionic, anionic, cationic or amphoteric surfactant. For additional information, reference may be made to "leimington: science and practice of pharmacy, supra.

Pastes are semi-solid dosage forms in which the bioactive agent is suspended in a suitable matrix. Depending on the nature of the matrix, the pastes are classified as fatty pastes or pastes prepared from single-phase hydrogels. The matrix in the fat paste is typically petrolatum, hydrophilic petrolatum, or the like. Pastes prepared from single phase hydrogels often incorporate carboxymethyl cellulose or the like as a matrix. For additional information, reference may additionally be made to "leimington: science and practice of pharmacy.

Gel formulations are semi-solid, suspension type systems. Single phase gels contain organic macromolecules distributed substantially uniformly throughout a carrier liquid, which is typically aqueous, but preferably also contains an alcohol and optionally an oil. Preferred organic macromolecules (i.e., gellants) are cross-linked acrylic polymers, such as a family of carbomer polymers, e.g., which can be prepared by Carbopol ^TM Trademark is a commercially available carboxypolyalkylene. In this context, other types of preferred polymers are hydrophilic polymers such as polyethylene oxide, polyoxyethylene-polyoxypropylene copolymers and polyvinyl alcohol; modified celluloses such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methylcellulose phthalate, and methylcellulose; gums, such as tragacanth and xanthan gum; sodium alginate; and gelatin. To prepare a homogeneous gel, a dispersing agent such as an alcohol or glycerin may be added, or the gelling agent may be dispersed by grinding, mechanical mixing or stirring, or a combination thereof.

Sprays typically provide the active agent in the form of an aqueous and/or alcoholic solution that can be sprayed onto the skin for delivery. Such sprays include those formulated to provide, upon delivery, a concentration of the active agent solution at the site of application, e.g., the spray solution may consist essentially of an alcohol or other similar volatile liquid in which the active agent may be dissolved. When delivered to the skin, the carrier evaporates, leaving the concentrated active agent at the site of application.

The foam composition is typically formulated in a single-phase or multi-phase liquid form and is optionally contained in a suitable container with a propellant that facilitates expulsion of the composition from the container so as to convert it to a foam upon application. Other foamer formation techniques include, for example, "Bag-in-can" dispensing techniques. The compositions so formulated typically contain low boiling hydrocarbons such as isopropyl alcohol. Application and agitation of such compositions at body temperature in a manner similar to pressurized aerosol foaming systems can evaporate the isopropyl alcohol and produce a foam. The foaming agent may be water-based or alkanol-based, but is typically formulated with a high alcohol content that will quickly volatilize upon application to the skin of a user, driving the active ingredient through the upper skin layer to the treatment site.

Skin patches typically include a backing with a reservoir containing an active agent attached thereto. The reservoir may be, for example, a pad in which the active agent or composition is dispersed or soaked, or a liquid reservoir. The patch typically further comprises a front water permeable adhesive for adhering and securing the device to the treatment area. Silicone rubber having self-tackiness may alternatively be used. In both cases, a permeable protective layer may be used to protect the adhesive side of the patch prior to use. The skin patch may further comprise a removable cover for protecting the skin patch during storage.

Examples of patch configurations that may be used in the present invention include single or multi-layer drug-in-adhesive systems characterized by the drug being contained directly in the skin contact adhesive. In the design of such transdermal patches, the adhesive is used not only to adhere the patch to the skin, but also as a formulation base containing the drug and all excipients under a single backing film. In a multi-layer drug-in-adhesive patch, a film is disposed between two different drug-in-adhesive layers, or multiple drug-in-adhesive layers are incorporated under a single backing film.

Examples of pharmaceutically acceptable carriers for pharmaceutical compositions suitable for topical application include well known carrier materials in the cosmetic and medical fields as a matrix for: such as emulsions, creams, aqueous solutions, oils, ointments, pastes, gels, lotions, milks, foams, suspensions, aerosols, etc., depending on the final form of the composition. Representative examples of suitable carriers according to the present invention thus include, but are not limited to, water, liquid alcohols, liquid glycols, liquid polyalkylene glycols, liquid esters, liquid amides, liquid protein hydrolysates, liquid alkylated protein hydrolysates, liquid lanolin and lanolin derivatives, and similar materials commonly employed in cosmetic and pharmaceutical compositions. Other suitable carriers according to the present invention include, but are not limited to, alcohols, such as monohydric and polyhydric alcohols, e.g., ethanol, isopropanol, glycerin, sorbitol, 2-methoxyethanol, diethylene glycol, ethylene glycol, hexylene glycol, mannitol, and propylene glycol; ethers such as diethyl ether or dipropyl ether; polyethylene glycol and methoxypolyethylene oxide (carbowax having a molecular weight ranging from 200 to 20,000); polyoxyethylene glycerol, polyoxyethylene sorbitol, stearoyl glycerol diacetate, and the like.

If desired, the topical compositions of the present disclosure may be presented in a package or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The dispenser device may for example comprise a tube. The package or dispenser device may be accompanied by instructions for administration. The package or dispenser device may also be accompanied by an announcement in the form prescribed by a government agency regulating the manufacture, use or sale of pharmaceuticals, which announcement reflects approval by the agency of the form of the composition for human or veterinary administration. For example, such announcements may contain labeling for prescription drugs or approved product inserts approved by the U.S. food and drug administration. Compositions comprising the topical compositions of the present invention formulated in a pharmaceutically acceptable carrier may also be prepared, placed in a suitable container, and labeled for treatment of a specified condition.

Another patch system configuration that may be used with the present invention is a reservoir transdermal system design that is characterized by containing a liquid chamber containing a drug solution or suspension separated from a release liner by a semipermeable membrane and an adhesive. The adhesive component of such a patch system may be incorporated as a continuous layer between the film and the release liner, or around the film in a concentric configuration. Yet another patch system configuration that may be used with the present invention is a matrix system design that is characterized by comprising a semi-solid matrix containing a drug solution or suspension in direct contact with a release liner. The components responsible for skin adhesion are incorporated in the cover layer and form a concentric configuration around the semi-solid matrix.

The pharmaceutical compositions (or formulations) may be packaged in a variety of ways. Typically, the article of manufacture for dispensing comprises a container containing the pharmaceutical composition in a suitable form. Suitable containers are well known to those skilled in the art and comprise materials such as bottles (plastic and glass), sachets, aluminum foil blister packs and the like. The container may also include a tamper evident assembly to prevent easy access to the contents of the package. In addition, the container typically has a label and any appropriate warning or instructions placed thereon that describe the contents of the container.

If desired, the disclosed pharmaceutical compositions may be present in a package or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The package may for example comprise a metal or plastic foil, such as a blister package. The package or dispenser device may be accompanied by instructions for administration. The package or dispenser may also be accompanied by an announcement associated with the container in a form prescribed by a government agency regulating the manufacture, use or sale of pharmaceuticals, which announcement reflects approval by the agency of the form of the medicament for human or veterinary administration. For example, such announcements may be labeling for prescription drugs or approved product inserts approved by the U.S. food and drug administration. Pharmaceutical compositions comprising the disclosed compounds formulated in compatible pharmaceutical carriers may also be prepared, placed in appropriate containers, and labeled for treatment of the indicated conditions.

The exact dosage and frequency of administration will depend on the particular disclosed organism or mixture of organisms; the particular condition being treated and the severity of the condition being treated; various factors specific to the medical history of the subject to whom the dose is administered, such as age; body weight, sex, degree of disorder and general physical condition of the particular subject, other medications that the individual may be taking; these are well known to those skilled in the art. Furthermore, it will be apparent that the effective daily dose may be reduced or increased, depending on the response of the subject being treated and/or on the evaluation of the physician prescribing the compounds of the instant disclosure.

Depending on the mode of administration, the pharmaceutical composition will comprise 0.05 to 99 wt%, preferably 0.1 to 70 wt%, more preferably 0.1 to 50 wt% active ingredient, and 1 to 99.95 wt%, preferably 30 to 99.9 wt%, more preferably 50 to 99.9 wt% pharmaceutically acceptable carrier, all percentages based on the total weight of the composition.

In treating conditions such as, for example, crohn's disease, ulcerative colitis, or other forms of inflammatory bowel disease, suitable dosage levels are typically from about 10 to about 100 hundred million CFU per unit dose, and may be administered in single or multiple doses. Within this range, the dosage may be about 10, 50, 100, 150, 200, 250, or about 300 hundred million CFU of genetically modified saccharomyces boulardii per day. The compounds may be administered according to a regimen of 1 to 4 times per day, preferably once or twice per day. In one exemplary aspect, the oral dosage form may contain 50 hundred million CFU in a 250mg capsule, and two capsules may be administered twice daily. Such dosing regimens may be adjusted to provide the optimum therapeutic response.

In one aspect, in a pharmaceutical composition, an oral dosage form comprises about 10 to about 100 hundred million Colony Forming Units (CFU) per unit dose of an engineered saccharomyces yeast strain, or about 10, 50, 60, 70, 80, 90, or about 100 hundred million CFU per unit dose, or a combination of any of the foregoing values, or a range covering any of the foregoing values. In some aspects, the pharmaceutical composition is acid resistant.

In another aspect, the method comprises administering the pharmaceutical composition for the following period of time: about 3 days to about 4 weeks, months or years, or about 3, 4, 5, 6, or 7 days, or 2, 3, or 4 weeks, or about 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 months, or about 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 years, or more, or a combination of any of the foregoing values, or a range encompassing any of the foregoing values. In another aspect, the pharmaceutical composition is administered once to four times per day, or 1, 2, 3, or 4 times per day.

Such unit doses as described above and below may be administered more than once a day, for example 2, 3, 4, 5 or 6 times a day. In various aspects, such therapies may extend over weeks or months, and in some cases, over years or as long as the patient's symptoms persist. In the case of inflammatory bowel disease, on the one hand, the oral dosage form may be administered as long as the symptoms persist. In one aspect, in one example of inflammatory bowel disease, an oral dosage form may be administered to maintain disease remission for years or for life. However, it will be appreciated that the specific dosage level for any particular patient will depend on a variety of factors, including the activity of the particular compound employed; age, weight, general health, sex and diet of the individual being treated; the time and route of administration; excretion rate; other drugs previously administered; as well as the severity of the particular disease undergoing therapy, as is well known to those skilled in the art.

Typical dosages may be 1mg to about 100mg tablets or 1mg to about 300mg tablets taken once a day or multiple times a day, or disposable sustained release capsules or tablets taken once a day and containing proportionally higher amounts of active ingredient. The time release effect may be achieved by capsule materials that dissolve at different pH values, by capsules that slowly release under osmotic pressure, or by any other known controlled release means.

In some cases, it may be desirable to use dosages outside of these ranges, as will be apparent to those skilled in the art. Further, it should be noted that the clinician or attending physician will know how and when to initiate, interrupt, adjust or terminate therapy in conjunction with individual patient responses.

The disclosed pharmaceutical compositions may further comprise other therapeutically active compounds, which are commonly used in the treatment of the above-mentioned pathological or clinical conditions.

Application of

The administration of the presently disclosed technology (e.g., engineered saccharomyces strains and pharmaceutical compositions comprising the same) can be accomplished continuously or intermittently in one dose. Methods of determining the most effective mode and dosage of administration are known to those of ordinary skill in the art and will vary with the composition used, the purpose of the therapy, and the like. Single or multiple administrations may be carried out by the treating physician selecting the dosage level and mode. In some embodiments, the techniques of this disclosure are administered once daily for a period of time. In some embodiments, the techniques of the present disclosure are administered twice daily for a period of time. In some such embodiments, the period of time comprises days (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 14, 21, or 30 days), months (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months), or years (e.g., 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 years, or more).

Suitable dosage formulations and methods of administering the techniques of the present disclosure are known in the art. The route of administration may also be determined, and the method of determining the most effective route of administration is known to those skilled in the art and will vary with the composition used for treatment, the purpose of the treatment, the health or disease stage of the subject being treated, and the target cell or tissue. Non-limiting examples of routes of administration include oral administration, vaginal administration, nasal administration, injection, topical administration, and suppositories.

In any of these aspects, the engineered saccharomyces yeast strain occupies the intestinal tract of the subject for about 3 days to about 5 days after oral delivery of the pharmaceutical composition. In one aspect, due to this brief occupancy of the intestine, the dosage of the pharmaceutical compositions disclosed herein, as well as the duration of treatment, can be carefully controlled using the disclosed oral delivery mechanisms.

Combination therapy

Also provided herein are methods for treating and/or preventing a disease, disorder, and/or condition in a subject in need thereof, the methods comprising administering to the subject an effective amount of an engineered saccharomyces yeast strain as described herein, or a pharmaceutical composition comprising the engineered saccharomyces yeast strain and a therapeutically effective amount of an antibiotic. In some embodiments, the antibiotic is administered concurrently with the engineered saccharomyces yeast strain as described herein or a pharmaceutical composition comprising the engineered saccharomyces yeast strain. In some embodiments, the antibiotic is administered prior to the engineered saccharomyces yeast strain as described herein or a pharmaceutical composition comprising the engineered saccharomyces yeast strain. In some embodiments, the antibiotic is administered after the engineered saccharomyces yeast strain as described herein or a pharmaceutical composition comprising the engineered saccharomyces yeast strain.

In some embodiments, the antibiotic may be selected from, for example, metronidazole, ciprofloxacin, rifaximin, ampicillin, tetracycline, amoxicillin, doxycycline, levofloxacin, potassium clavulanate, vancomycin, sulfamethoxazole, trimethoprim, clindamycin, tinidazole, tylosin, or any combination thereof. In one aspect, the pharmaceutical compositions disclosed herein are advantageous over probiotic compositions comprising only bacteria because they are capable of co-administering antibiotics when needed. Further, in this regard, unlike bacterial probiotics, engineered Saccharomyces yeast strains are not susceptible to antibiotics.

In some embodiments, the efficacy of a parenterally used drug may be enhanced by modulating intestinal function. It is well known that intestinal microorganisms may affect cancer treatment. Without wishing to be bound by any theory, intestinal inflammation may affect the abundance and composition of intestinal microorganisms, and thus the anticancer therapy, and thus, in some embodiments, engineered saccharomyces yeast strains may be co-administered with anticancer agents to enhance therapeutic efficacy.

Having now described aspects of the present disclosure, in general, the following examples describe some additional aspects of the present disclosure. While aspects of the present disclosure are described in connection with the following examples and the corresponding text and figures, it is not intended to limit aspects of the present disclosure to that described herein. On the contrary, the intent is to cover all alternatives, modifications and equivalents as included within the spirit and scope of the disclosure.

Examples

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices, and/or methods claimed herein are made and evaluated, and are intended to be purely exemplary of the disclosure and are not intended to limit the scope of what the inventors regard as their disclosure. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless otherwise indicated, parts are parts by weight, temperature is in degrees celsius or at ambient temperature, and pressure is at or near atmospheric pressure.

Example 1: sb-mSdAb (BioPYM) ^TM ) Platform for technology

The work described herein builds on a novel platform technology by engineering the probiotic yeast saccharomyces boulardii to secrete, for example, multispecific single domain (VHH) antibodies (Sb-msdabs) to directly neutralize the primary gut disease biomarkers, thereby targeting, for example, gut pathogens. This platform is also known as bioengineered probiotic yeast drug (biopim) ^TM )。

Using this innovative technology, an exemplary Sb-ABAB therapeutic precursor, designated FZ002, has been generated that constitutively secretes the four specific single domain antibody ABAB as an mSdAb fusion polypeptide consisting of 4 non-overlapping VHHs, effectively and extensively neutralizing the two major clostridium difficile enterotoxins TcdA and TcdB. Secretion of functional ABAB was verified both in vitro and in vivo. For in vitro characterization, ABAB secretion was verified by western immunoblotting (fig. 1A), and the expected neutralization activity of secreted ABAB on both TcdA and TcdB was also confirmed, similar to the purified Fc-ABAB fusion polypeptide (fig. 1B). The final Sb-ABAB clone had comparable growth to wild-type Sb and Sb (Sb-EP) control transformed with empty plasmid (fig. 1C), and stably secreted ABAB in 7 days of passage (fig. 1D). Sb-ABAB has similar resistance to a group of antibiotics, but not to antifungal G418, which is toxic to eukaryotic cells, compared to wild type (fig. 1E).

To examine the in vivo properties of Sb-ABAB and the tolerance of mice to the highest achievable dose, 10 was used ¹⁰ Engineered yeasts for individual Colony Forming Units (CFU) mice were fed orally (fig. 2A). Mice that were gavage with B, sb-EP (Sb yeast transformed with "empty plasmid" without ABAB transgene (puca 3-AT-cMyc)) or Sb-ABAB received a body weight similar to Placebo (PBS) (fig. 2B), and these strains had comparable persistence patterns in these mice (fig. 2C). In addition, sb-ABAB, but not Sb-EP, secreted functional ABAB into the ileum, cecum and colon of mice after oral gavage (fig. 2D). Finally, sb-ABAB recovered from mouse feces continued to stably secrete ABAB (fig. 2E). ABAB levels in the feces of day 3 were determined by ELISA (fig. 2F). Furthermore, oral FZ002 proved to provide significant protection against both primary and recurrent clostridium difficile infection in mice.

Figures 9A-9B show that piglets administered Sb-ABAB excrete live yeast and ABAB in their faeces. Figures 10A-10B show that mice gavaged with Sb-ABAB are protected from clostridium difficile induced death and gut inflammation. With PBS, sb-EP or Sb-ABAB (10) ⁹ CFU/dose/day) the mice were gavaged for three days and continued for another three days after bacterial challenge. The mice were treated with 10 ⁴ Clostridium difficile spores of CFU are stimulated. Mice survival and intestinal histology are shown.

Example 2: construction of Sb-amTNF

Prototype yeast Sb-amTNF (FZ 006 m) secreting anti-mouse TNF-alpha VHH was constructed, which enabled assessment of the therapeutic potential of engineered yeasts for intestinal inflammatory disease in conventional mice. It was demonstrated that homodimers against mouse TNF-alpha VHH exhibited the highest neutralizing activity when fused to Fc (fig. 3A-3D). Thus, sb-amTNF strains were engineered by inserting a VHH/VHH-Fc cassette into the pTEF or pTDH locus of an auxotrophic Sb strain. The Sb-amTNF stably secreted functional anti-mouse TNF-alpha VHH/VHH-Fc as detected by ELISA and cell culture assays (fig. 3A-3D).

Example 3: oral administration of Sb-amTNF reduces the severity of inflammatory bowel disease

First, it was tested whether the intestinal delivery of effective TNF-a neutralizing antibodies ameliorated the symptoms of sodium dextran sulfate (DSS) -colitis. As previously described, mice drink water containing 2% DSS for 8 days. Mice were given a gavage of 10 daily starting on day 3 ⁹ Sb-amTNF of CFU for 11 days. The control group was gavaged with the same amount of Sb-EP control or PBS. Fig. 4A shows that none of the mice treated with oral Sb-amTNF died, whereas 20% of the mice in the control group died. Since DSS-colitis alone did not induce significant mortality in mice, a significantly more severe intestinal inflammation model of DSS-colitis co-morbid with clostridium difficile infection was utilized. In this co-morbid model, mice developed severe intestinal inflammation, tissue damage, and 80% of mice died. Since TNF- α is significantly up-regulated, it was investigated whether enteral delivery of anti-TNF- α antibodies by engineered saccharomyces boulardii would improve disease severity and reduce intestinal inflammation. From day-3 to day 7, the co-morbid mice group was treated with 10 ⁹ CFU/dose PBS, sb-EP or Sb-amyTNF (total 11 doses) was orally administered daily. Significant weight loss was evident and in the PBS and Sb-EP control groups, about 80% of the mice died from the disease, while oral Sb-amTNF conferred substantial protection, significantly reduced weight loss (fig. 4B), and 40% of the mice died (fig. 4C). Upregulation of colonic pro-inflammatory cytokines TNF- α (fig. 4D) and IL-6 (fig. 4E) was also significantly reduced. Subsequently, colon length reduction and tissue damage were also significantly reduced in mice treated with oral Sb-amTNF (fig. 4F-4G). In summary, the proof of concept data demonstrates that intestinal delivery of anti-TNF-alpha neutralizing antibodies by engineered brazier yeast (oral Sb-amTNF) significantly improves by reducing intestinal inflammation and tissue damageSeverity of disease.

Example 4: construction of Yeast Strain (FZ 006) secreting anti-human TNF-alpha neutralizing antibody Sb-ahTNF

From the immune VHH yeast display library, 8 VHHs have been identified that bind to human TNF-alpha proteins or polypeptides and neutralize their cytotoxic activity on L929 cells. These VHHs were then randomly paired to form monomeric VHH-Fc and dimeric VHH/VHH-Fc, and 14 candidates showing optimal neutralising activity were identified (fig. 5A). With adalimumab (trade name is ) In contrast, heterodimer G1 was 24-fold more potent in neutralizing human TNF- α mediated cytotoxicity of L929 cells (fig. 5A). In ELISA, G1 had a higher binding affinity for TNF- α than Humira (FIG. 5B) and was more effective at blocking TNF- α binding to TNFR1 as determined by competition ELISA (FIG. 5C).

To construct an engineered yeast that secretes anti-human TNF-alpha antibodies, the expression cassette for ahTNF (VHH-Fc fusion) was optimized and inserted into the yeast genome using the same strategy that produced other therapeutic precursors. The resulting yeast Sb-ahTNF strain (designated FZ 006) had the same growth rate as the parent strain (fig. 6A), and stably expressed ahTNF in culture for nearly 100 generations (8 days) (fig. 6B). Representative 24-hour culture supernatants collected at passage 7 contained 1.2ug/ml ahTNF. ahTNF in yeast supernatant had similar neutralizing activity to purified G1 antibody from HEK293 cultures, which was significantly more potent than Humira in neutralizing human TNF- α cytotoxicity on cultured L929 cells (fig. 6C). These data demonstrate that FZ006 stably expresses a fully functional anti-human TNF- α antibody.

Example 5: experimental method

Sequencing

Whole genome sequencing can be performed using pacbrio P6C4 chemistry and Illumina HiSeq-1000 high throughput sequencing techniques followed by standard assembly and annotation procedures, with particular attention to loci into which cassettes (e.g., ahTNF cassettes) have been inserted or for which site-specific insertion sequencing can be accomplished.

Growth of Sb strains

The growth kinetics of FZ006 and related strains (e.g., engineered saccharomyces strains described herein) can be characterized, as well as stability, uniformity, and temperature tolerance. Knowledge of these factors can be used in an upstream scale-up process to prepare commercial formulations of the disclosed products. The medium is chemically defined and free of animal derived components. Synthetic Yeast Nitrogen Base (YNB) containing glucose and yeast synthesis exit medium supplements was used. For example, sb-amTNF and Sb-ahTNF grew well as wild-type yeasts in this medium.

Daily passages of the engineered saccharomyces yeast strains described herein (comprising, e.g., FZ 006) in YNB medium are performed for 10 days, or about 100-120 passages of the engineered saccharomyces yeast strains described herein (comprising, e.g., FZ 006), and growth is monitored by measuring optical density of the culture and viability of the yeast. Temperature tolerance experiments were performed by culturing the engineered saccharomyces yeast strains described herein (comprising FZ006, for example) and parent strains for 4 hours at different temperatures (30, 37, 40 and 45 ℃). After optimizing the culture conditions, high density culture will be performed in the BioFlo 320, allowing for scale-up of process development as needed. The engineered saccharomyces yeast strains described herein, including FZ006 for example, will be sampled at different culture densities during fermentation, and stability and uniformity monitored by measuring the growth and secretion (e.g., ahTNF secretion) of randomly selected clones.

Gastric, intestinal and bile salt stress conditions

The anti-stress ability against the intestinal environment was assessed according to the protocol previously described for some of the precursors (e.g., FZ002 and FZ 006). Cultures of engineered yeast or wild-type yeast cells (od=0.8-1.2) were collected by centrifugation and washed with distilled water, then incubated at 37 ℃ for 1 hour in the following: 1) A simulated gastric environment consisting of an aqueous solution containing 3g/L pepsin (3200-4500U/mg) and 5g/L NaCI, pH 2.0; 2) An aqueous simulated intestinal environment solution containing 1g/L pancreatin (903U/mg) and 5g/L NaCI, pH 8.0; and 3) YPD (Yeast extract, peptone, glucose) broth supplemented with 0.1% bile salt mixture (50% sodium cholate and 50% sodium deoxycholate). For experiments on solid medium, cells grown in a finger in liquid YPD (4%) were diluted to an OD of 1.0 and 5 μl of this dilution was used to inoculate solid YPD medium (4%) supplemented with bile salts at different concentrations. Colonies were observed after 48 hours at 37 ℃. The parameters generated here will be used to verify the growth of the engineered lead yeast strain in future CMC development.

Antimicrobial drug sensitivity

Exemplary Sb-ABAB and FZ002 were tested for sensitivity to antifungal and antibacterial agents as previously described (fig. 96-99). This important QC assay is used not only to identify engineered yeast strains, including attributes such as FZ006 and FZ002, but also to determine potential bacterial contamination. Four antifungal agents (clotrimazole, fluconazole, itraconazole, and ketoconazole) were tested (fig. 96). Another exemplary therapeutic precursor FZ002 and Sb-ABAB for clostridium difficile has been tested for a group of antibacterial agents (fig. 1E and 97). Additional agents that may be evaluated include amoxicillin, ampicillin, bacitracin, ceftriaxone, chloramphenicol, cloxacillin, enrofloxacin, erythromycin, methicillin, penicillin G, streptomycin, and tetracycline from Sigma Aldrich. The parental strains were tested in parallel and as previously reported, no changes in the antibiotic resistance profile were identified (fig. 1E).

Example 6: development of analytical methods

Properties of FZ006 and additional exemplary engineered Saccharomyces yeast strains

The full genomic sequence of FZ006 and other exemplary engineered saccharomyces yeast strains described herein lay the foundation for their properties. In addition, biochemical/phenotypic characteristics may be used to verify the properties of FZ006 and other exemplary engineered saccharomyces yeast strains described herein. To develop analytical methods to ensure the properties of the engineered saccharomyces yeast strains described herein (comprising FZ006, for example) during process development and manufacture, primers for amplifying spacer regions (ITS) of rDNA internal transcription were used (fig. 90). Alternatively, primers for amplification of the 18S and 26S ribosomal RNA genes (on ATCC product instructions) and the ahTNF cassette and flanking sequences may be synthesized. These primers can be used to amplify the corresponding genes for sequencing. In addition to sequence information, morphology and growth kinetics, the stress resistance patterns and antibiotic/antifungal resistance profiles described above can be used to determine engineered Saccharomyces yeast strains, including, for example, the properties of FZ 006.

Strength of FZ006 and additional exemplary engineered saccharomyces yeast strains

The strength of the exemplary engineered saccharomyces yeast strains described herein (comprising, e.g., FZ 006) is determined by, e.g., two factors, the number of live yeasts and their GOI (e.g., nucleic acids encoding, e.g., ahTNF) yields. The viability of the engineered saccharomyces yeast strains described herein (comprising, e.g., FZ 006) is determined by staining with reactive dyes under an automatic cytometer and counting Colony Forming Units (CFU) on agar plates. The production of therapeutic polypeptides (e.g., ahTNF) was measured by the amount of antibody secretion (picograms/cell/day, PCD) in picograms by a yeast over 24 hours under the given culture conditions. Using synthetic YNB medium, 0.1OD overnight cultures will be transferred to 50mL fresh medium to culture the exemplary engineered Saccharomyces yeast strains described herein, including, for example, FZ006, until late log phase of OD 10. Culture supernatants may be collected every 3 hours over a 24 hour period and the production of therapeutic polypeptides (comprising, for example, ahTNF) may be determined by ELISA.

Quality and purity

Quality and purity are determined primarily during the manufacturing process. Parameters that may be used include, for example, sterility, physical appearance, pH of the culture, endotoxin levels, bioburden, viability, purity, and attributes. To ensure the quality and purity of the exemplary engineered saccharomyces yeast strains described herein (including FZ006, for example), all chemicals used for culture can be USP grade or food grade to produce cell libraries. Cell banks can be developed according to, for example, CVD standard protocols. The exemplary engineered saccharomyces yeast strains described herein, including FZ006, for example, can be grown on agar plates with non-selective chemically defined media. Cultures can be checked to ensure homogeneity and morphology of the colony types prior to harvest and resuspended in medium supplemented with 20% glycerol. The frozen vials (100) may be prepared and stored in a dedicated-80 ℃ freezer. Based on the test described in USP, three vials can be tested for purity. If any microbial contamination is found, the pool can be discarded and a new pool of cells can be generated.

Example 7: exemplary engineered Saccharomyces yeast strains comprising pharmacokinetic and safety profiles such as FZ006 and FZ002

Oral administration of Sb-amTNF prevented intestinal tissue damage and inflammation-associated DSS-colitis in mice, indicating that live Sb-amTNF distributed to the colon and produced therapeutic levels of amTNF. Pharmacokinetic (PK) properties of FZ006, sb-ABAB and FZ002 were assessed by determining yeast gastrointestinal distribution, attachment or excretion, ahTNF or ABAB secretion, yeast and antibody or ABAB shedding (FIGS. 2A-2F, chen et al, science conversion medicine 2020). Potential anti-drug responses were determined by evaluating host anti-amTNF IgA and IgG after oral long-acting FZ006m (fig. 12A-12B). Furthermore, the ability of e.g. intestinal FZ006 to translocate to the circulation can be determined in immunosuppressive mice.

Exemplary engineered Saccharomyces yeast strains, including, for example, pharmacokinetics of FZ006 and FZ002

Preliminary PK studies showed that oral gavage of FZ002 resulted in shedding live yeast and secretion of ABAB in mice intestinal tracts (fig. 2A-2E). Oral Sb-amTNF also significantly reduced the symptoms of colitis by improving intestinal inflammation (fig. 4A-4G). These data demonstrate that following oral administration, live yeast reaches the lower intestine of the mice and therapeutic doses of neutralizing antibodies are secreted. The intestinal distribution of yeast and the production and excretion of antibodies can be systematically studied. The mice can be 10 ⁸ 、10 ⁹ And 10 ¹⁰ CFU/dose/day administration for 7 days. Comprises 10 of ¹⁰ CFU (computational fluid dynamics)The dose allowed assessment of mice tolerance to FZ006 at the highest dose possible by gavage needle. Feces (for background) may be collected from each mouse prior to oral yeast administration and then daily until 7 days after yeast treatment is stopped. In each group, 6 mice (3 males and 3 females) can be sacrificed on day 0, day 1, day 3, day 6, day 9 and day 14, and the following tissues/organs can be collected: small and large intestine (from different sections of the ileum, cecum and colon and lavage), mesenteric Lymph Nodes (MLN), liver, spleen and blood samples. All samples can be analyzed based on the previously described assays. As previously described, mouse faeces and intestinal lavage may be diluted in PBS and plated on a sand agar plate selected for growth of Sb to determine CFU in each group. Sb colonies can be randomly picked and placed into liquid cultures to measure secretion (e.g., secretion of ahTNF) to verify stable antibody production. To assess live yeast uptake and potential systemic spread, MLN, spleen and liver tissue can be weighed, homogenized and filtered. These tissues can then be plated on sand agar along with the blood sample to identify colonies; if any colonies are observed, PCR can be used to analyze the ahTNF gene in yeast as previously described. To assess the absorption, distribution and excretion of ahTNF, stool, intestinal contents, intestinal tissue sections, MLN, liver tissue lysates and blood samples can be diluted in protease-containing PBS and the amount of ahTNF can be quantified by standard ELISA, for example.

Exemplary host anti-ahTNF response following oral FZ006 administration

It can be determined whether oral FZ006 induces mucosal IgA and systemic IgG to secreted ahTNF during multiple procedures of FZ006 treatment. The dose of oral FZ006 that showed the highest intestinal secretion of ahTNF in the PK study was selected and a total of 21 doses were administered so that it could be assessed whether long term oral FZ006 induced any potential anti-drug response that could reduce the therapeutic potential of FZ 006. Groups of mice (n=10, 5 males and 5 females) can be orally administered FZ006 daily for 7 days (considered an oral FZ006 treatment cycle) followed by a 14 day rest period. This can be repeated 3 times with 3 oral FZ006 cycles (21 doses total FZ 006). The control group may be administered the same amount of Sb-EP. Controls for systemic injection of purified ahTNF (intravenous (i.v.) injection of 10mg/kg ahTNF) may also be included. Mouse faeces and blood samples may be collected on day 0 before the first oral yeast dose and then on one of 7 days after each oral FZ006 cycle. Ten days after the last FZ006 administration, mice can be sacrificed and intestinal lavage fluid collected. Specific IgA from faeces and intestinal lavage fluid, as well as serum IgG against ahTNF, can be measured by ELISA using plates coated with purified anti-human TNF antibodies. If an anti-ahTNF antibody response is detected, a cell-based bioassay is used to determine neutralization of ahTNF activity by the host anti-ahTNF antibody (FIG. 5A).

Determination of Sb system translocation in immunosuppressive individuals following exemplary oral FZ006 administration

Sb has been used as a probiotic since the 50 s of the 20 th century and is widely studied in clinical trials with excellent safety features. However, rare cases of eubacteremia were identified, mainly individuals with severe complications and central venous catheters in the intensive care unit. In animals, 10 have been administered ¹⁰ The CFU (highest possible dose obtained by a gavage needle) of engineered yeast, no side effects were observed. For example, it can be determined whether oral FZ006 leaks into the systemic circulation of an immunosuppressive mouse. Mice (n=10, 5 males and 5 females) can be injected with 100mg/kg cyclophosphamide on the abdominal cavity (ip) every other day (0, 2, 4, 6 and 8) for a total of five injections to induce immunosuppression. On day 3, mice were given gavage 10 daily for 7 consecutive days ¹⁰ FZ006 of CFU. Control mice may be given PBS or Sb-EP. Mice were sacrificed on day 10; blood, MLN, spleen and liver tissue can be collected; and determining the presence of live yeast. In addition, samples were plated on BHI agar plates to determine bacterial counts, which allowed for determination of whether FZ006 or Sb-EP treatment affects bacterial translocation, for example. Previous studies have found that probiotic Sb yeasts help maintain intestinal barrier function and reduce Translocation of bacteria from the intestinal lumen to the blood circulation. Oral FZ006 and other exemplary engineered saccharomyces yeast strains described herein, when administered to humans, can reduce intestinal inflammation by secreting therapeutic polypeptides (e.g., anti-human TNF-a), thereby exhibiting additional beneficial effects on intestinal barrier function.

Further experiments and expected results

Characterization of other products (e.g., engineered saccharomyces yeast strains described herein, such as FZ 006) can be performed. When analyzing PK results, the following can be monitored: 1) When the mice begin shedding, e.g., FZ006 after oral administration, and how long the mice continue to shed yeast after the last administration; 2) When yeast shedding becomes stable; 3) Intestinal localization of live yeast; 4) A relationship between oral dosage and intestinal therapeutic polypeptide (e.g., ahTNF) production; and 5) intestinal distribution of therapeutic polypeptides (e.g., ahTNF) and systemic dissemination thereof. These studies can yield useful information regarding the kinetics of the enteroengineered saccharomyces yeast strains described herein (e.g., FZ 006) and the secretion and distribution of therapeutic polypeptides (e.g., ahTNF). It is expected that systemic spreading of live yeast and uptake of therapeutic polypeptides (e.g., ahTNF) may not be detectable in normal mice. Without wishing to be bound by any theory, it may be difficult to accurately measure intestinal metabolism of a therapeutic polypeptide (e.g., ahTNF) due to the complex intestinal environment and constitutive production of the therapeutic polypeptide (e.g., ahTNF) by an engineered saccharomyces yeast strain (e.g., FZ 006). However, PK studies may allow for assessment of stable intestinal levels of therapeutic polypeptides (e.g., ahTNF) during oral yeast administration. Although intestinal therapeutic polypeptide (e.g., ahTNF) levels may fluctuate under different pathophysiological conditions, ADME/PK studies and animal efficacy studies can provide knowledge of the oral dose of an engineered saccharomyces yeast strain (e.g., FZ 006) that produces therapeutic levels of an intestinal therapeutic polypeptide (e.g., anti-TNF antibody). This information may be important in determining future dosages and regimens for oral engineered saccharomyces yeast strain (e.g., FZ 006) treatment in clinical trials.

VHH are generally non-immunogenic, even when injected systemically. An exemplary therapeutic polypeptide ahTNF delivered to the gut by probiotic yeasts should be at even lower risk of inducing an anti-drug response. If detectable levels of IgA or IgG for e.g.ahTNF are induced with 21 doses of e.g.FZ 006 over a period of 8 weeks, it can be determined whether the magnitude of the anti-VHH response is dose and time dependent, so that the extent of the anti-drug response can be minimized by optimizing the administration and regimen of the engineered Saccharomyces yeast strain (comprising FZ 006). Sb exhibits protective effects in immunosuppressive mice and prevents translocation of bacteria and pathogens into the circulation. When high doses of Sb are administered, it is possible to detect low counts of Sb systemically in immunosuppressive mice; in this case, the mice may experience side effects, which will be closely monitored during the administration of the engineered Saccharomyces yeast strain (comprising FZ006 or Sb-EP). Any side effects may be related to the amount of Sb in the circulation; if such correlations are established and significant adverse effects occur, experiments can be repeated to assess whether systemic fluconazole can efficiently clear yeasts in the blood stream and alleviate symptoms. In such cases, serum-sensitive yeasts can be engineered for therapeutic strains such that the engineered yeasts die rapidly when disseminated into the bloodstream.

Example 8: preclinical efficacy assessment of FZ006 in human TNF- α transgenic mice

Since the ahTNF (VHH-Fc fusion protein) secreted by FZ006 only neutralizes human TNF- α, human TNF- α transgenic mice can be used to verify their therapeutic efficacy. IBD is a complex disease and no single animal disease model can generalize the pathogenesis of human disease. Thus, both DSS and adoptive T cell transfer-induced colitis can be used as models, as these are the two most widely used animal colitis models for mimicking some aspects of human UC pathogenesis.

Due to its relatively simple regimen, DSS-induced colitis model is one of the most widely used model types in preclinical studies. Colitis is the epithelial cell of DSS (a negatively charged sulfated polysaccharide)Caused by the destructive action of the cells. Inflammation limited to the colon is mainly induced by pro-inflammatory cytokines (i.e., TNF- α) produced by innate immune cells and is mainly characterized by ulcers and granulocyte infiltration. Adoptive T cell transfer models are used to induce chronic colon inflammation, similar to some key aspects of human IBD. The model is that the original CD4 is to be treated ⁺ T cells (i.e., cd4+cd45rbhi) were developed after adoptive transfer from donor mice to syngeneic immunodeficiency recipients, which primarily caused colonic inflammation about ten weeks after cell transfer. This inflammation is due to the lack of T in the original T cell population _regs Cells, and this is consistent with observations in IBD patients, which show CD4 compared to control patients ⁺ CD45RB ^hi Intestinal tissue ratio of T cell influx to CD4 ⁺ CD45RB ^low T cells produce less IL-10, IL-4 and more pro-inflammatory cytokines, such as TNF- α. DSS and adoptive T cell transfer models have been widely used to assess the therapeutic efficacy of anti-TNF- α agents for UC, as inflammation is primarily localized to the colon, and TNF- α plays a major role in the immunopathology of colitis. Thus, both models can be used to assess the therapeutic efficacy of FZ 006.

Efficacy of oral FZ006 on DSS-induced colitis in human TNF- α transgenic mice

Since FZ006 secretes anti-human TNF-. Alpha.VHH-Fc that only neutralizes human TNF-. Alpha.its therapeutic efficacy can be demonstrated using human TNF-. Alpha.transgenic Tg1006 mice. Due to overexpression of human TNF- α, tg1006 mTFKO mice expressing only human TNF- α (mTNFα: -/-, hTNFα: +/-; from Takara corporation) can spontaneously develop severe arthritis in both the anterior and posterior paws at about 20 weeks of age. Both DSS acute and chronic colitis can be induced in Tg1006 mice following previously published protocols. In the acute colitis model, mice were fed with 3% (wt/vol) DSS in drinking water for 7 days. Long-term chronic colitis can be induced by three cycles of 2% DSS (8 days of DSS induction, 14 days of water). Since these Tg mice overexpress human TNF- α, it is expected that they can produce more severe colitis symptoms than normal, conventional mice in both acute and chronic models.

To evaluate the efficacy of FZ006 treatment for acute colitis, mice can be orally administered FZ006 daily starting on day 3 of DSS treatment (10 ⁷ 、10 ⁸ Or 10 ⁹ CFU) for 11 days. Control mice can be treated with water or 10 ⁹ Sb-EP gavage of CFU. Clinical symptoms such as body weight, diarrhea, body temperature and survival rate can be monitored. In addition to clinical symptoms, experiments can be designed to evaluate the protective effect of oral FZ006 against damage and inflammation of the intestinal tissue of mice. On the same day after the last yeast administration and 7 days after the last administration, 4 mice (2 males and 2 females) were sacrificed and colon tissues of these mice were collected to evaluate tissue damage and inflammation by histology. In addition, cytokine levels in blood and colon tissues can be assessed using a multiplex ELISA as previously described. In addition to monitoring disease symptoms, fecal samples and intestinal lavage can be collected to monitor intestinal distribution and shedding of live yeast, as well as secretion of ahTNF.

To assess the efficacy of FZ006 treatment for chronic colitis, one can go from day 3 to day 14; day 24 to day 35; day 45 to day 56; ranges covering certain DSS treatments and post-treatment periods daily water, sb-EP or FZ006 (10 ⁷ 、10 ⁸ Or 10 ⁹ CFU) gavage mice. The clinical symptoms of the mice, such as body weight, diarrhea, body temperature, and survival rate of the mice can be monitored. In addition to clinical symptoms, experiments can be designed to evaluate the protective effect of oral FZ006 against damage and inflammation of the intestinal tissue of mice. All mice can be given the same dosing regimen, except for 4 mice (2 males and 2 females) per group, which can be sacrificed on the day of the last oral yeast dosing per cycle. The colon tissue of these mice can be collected for length measurement and general examination. Intestinal epithelial lesions and inflammation can be examined histologically. Pro-inflammatory cytokines and chemokines in intestinal tissue and blood circulation can be evaluated using a multiplex ELISA as previously described. In addition to monitoring disease symptoms, fecal samples and intestinal lavage can be collected to monitor intestinal distribution and shedding of live yeast, as well as secretion of ahTNF. As described previously, canTo detect whether anti-ahTNF IgG and IgA are induced by assessing the anti-drug response of fecal and blood samples. These results can be compared to data generated from previous experiments to see if host intestinal inflammatory disease alters the PK and anti-drug response of FZ 006.

Therapeutic efficacy of FZ006 in immune T cell transfer model using Rag mice

In this model, CD4 can first be prepared from 8 week old Tg1006 mice using the disclosed protocol ⁺ CD45Rb ^hi T cells. Briefly, donor spleen cells were isolated from slightly minced spleen by a 70 μm cell filter. T cells were isolated from other cells using T cell EasySep kit (stem cell technologies (STEMCELL Technologies)). CD4 ⁺ CD45Rb ^hi T cells were isolated using a cell sorter and transferred to sex matched RAG ^-/- Recipient mice (jackson laboratories (Jackson Laboratories)). After 10 weeks, chronic colitis can develop completely in the transplant recipient mice. The control group was RAG without T cell transfer ^-/- Mice, which do not develop colitis.

Based on previous observations, inflammatory disease occurs mainly about ten weeks after T cell transfer. When diarrhea occurs approximately 10 weeks after T cell injection, mice can be given oral gavage of FZ006 daily for 14 days. FZ006 doses that exhibit optimal protection in DSS colitis models as previously determined may be used. The control group may be gavaged with PBS or the same dose of Sb-EP. Disease symptoms were closely monitored during and after oral yeast treatment. If diarrhea reoccurs after stopping FZ006 treatment, another oral FZ006 treatment process can be initiated. Chronic DSS-colitis can be treated for up to three courses of treatment to assess whether oral FZ006 can reduce the severity and duration of colitis in T cell transfer mice when compared to control treatments. In addition to monitoring disease symptoms, 4 mice from each group can be sacrificed at the end of the first course of FZ006 treatment and intestinal tissue can be collected to assess mucosal protection as described previously.

Expected results

Sb-amTNF protects conventional mice from DSS-induced and clostridium difficile-induced severe colitis, indicating that yeast strains express therapeutic doses of anti-mouse TNF- α in the gut. Oral FZ006 is expected to exhibit PK properties similar to Sb-amTNF and express anti-human TNF-a in the mouse gut; thus, human-specific FZ006 should significantly reduce DSS-colitis in Tg1006 transgenic mice expressing human TNF. Oral FZ006 was also expected to protect mice from colitis in an adoptive T cell transfer model. Since transgenic mice express only human TNF- α, TNF- α overexpression may result in significantly more severe colitis than conventional mice. In such cases, significant protection was observed, as oral Sb-amTNF provided significant protection against severe colitis co-induced by DSS and clostridium difficile (fig. 4A-4G). Given the high affinity and potent neutralizing activity of G1, even lower doses of 10 may be observed when compared to the control group ⁷ Or 10 ⁸ The oral FZ006 of CFU has significant efficacy against intestinal inflammation, reducing clinical symptoms, intestinal tissue damage and inflammation. One potential problem is the use of CD4 over-expressing human TNF-alpha ⁺ CD45Rb ^hi RAG with T cell adoptive transfer ^-/- Mice may experience onset of intestinal inflammation and disease symptoms earlier than commonly observed. Symptoms of the disease in mice can be monitored at the earliest 6 weeks after T cell transfer. However, the adoptive T cell transfer model is typically highly reproducible and the time window for onset of disease should be easily identifiable. Based on these experiments, an oral yeast dosing regimen for testing FZ006 therapeutic efficacy can be designed.

In testing the efficacy of treatment, up to 10 per day may be used ⁹ Oral dose of CFU yeast. In human studies, up to 2g of dry Sb per day was encapsulated (4×10 per day ¹⁰ ) Used in the present invention. Taking into account the difference in body shape between mice and humans, the mice were orally administered 10 a day ⁹ CFU yeast is a significantly higher dose. As shown in fig. 2C, at 10 per day ¹⁰ After CFU oral gavage of yeast, mice only discharged about 10 per gram of faeces ⁶ To 10 ⁷ Live yeast of CFUIndicating that most of the gavage yeasts in solution do not survive and may be killed by gastric acid. Thus, despite the high oral doses of mice used in these experiments, the amount of live yeast reaching the colon was relatively low. This problem can be alleviated by future formulation development, wherein the live yeast in the dry powder can be encapsulated with an enteric coating, protecting the live yeast from gastric acid and significantly improving the therapeutic potential.

Statistical analysis

The difference in Sb shedding and anti-TNF- α antibody levels can be assessed using the fischer's exact test. The kaplan-mel method (Kaplan Meier method) and Wilcoxon and log-rank test (Wilcoxon and log-rank test) can be used to compare survival time to survival rate. Comparison of clinical symptoms, weight loss and diarrhea can be performed using variance and co-variance analysis, dunn multiplex comparison method (Duncan multiple comparison method). Data are expressed as mean ± SEM or SD. The protective effect of FZ006 can be analyzed with the two-tailed Mann-Whitney test or without t-test. All statistical analyses can be performed using GraphPad Prism v.6, and when the P value is less than 0.05, the data is considered significant.

Selection of animals

The effect of gender on the response to engineered yeasts in colitis is unknown. To reduce biological variables, both male and female animals may be used. For mice, 6 to 10 week old C57BL/6J weighing 16-22g can be used. Tg1006 breeders with C57BL background were from Taconic. There can be 10-24 animals per group to minimize experimental errors caused by differences between mice. Descriptions of animal use, procedures and strength, as well as statistical analysis, are provided above.

Example 9: additional co-morbid models of CDI and adoptive T cell transfer colitis

Methods for T cell transfer colitis (TCC) have been previously described. Preparation of CD4 from 8 week old female C57BL/6 donor mice ⁺ CD45Rb ^hi T is thinCells, and injected into female RAG on day 0 ^-/- In the recipient mice (fig. 7A). Three weeks after T cell injection developed moderate colitis (TCC group alone, fig. 7B-7D). CDI was induced by antibiotic cocktail treatment followed by oral gavage of clostridium difficile spores (VP 110463, 10) ⁴ Mice, fig. 7A), and co-morbid mice developed severe colitis (tcc+cdi group, fig. 7B-7D). For yeast treatment, groups of mice were orally administered Sb-amTNF (10 ⁹ CFU/day/mouse), sb-ABAB (10 ⁹ CFU/day/mouse) or FZ006p (Sb-amtnf+sb-ABAB, 5×10 per group) ⁸ CFU/day/mouse) (fig. 7A). Mice were sacrificed on day 22 and colon tissue was collected for histological and quantitative real-time RT-PCR analysis of interferon gamma (IFN- γ) mRNA expression. Slicing H&E staining and micrographs were recorded at multiple locations and scored blindly by two researchers.

These new preliminary data indicate that oral administration of Sb-amTNF reduced colon tissue damage (fig. 7B-7C) and inflammation (fig. 7A) in TCC mice. Although Sb-ABAB alone did not significantly reduce IFN-ymRNA expression in colon tissue (fig. 7D), its combination with Sb-amTNF significantly reduced colon inflammation and tissue damage in co-ill mice (fig. 7B-7D), indicating synergy of the combination therapy. These data are consistent with those presented in fig. 6A-6C, i.e., oral FZ006p significantly protects mice from co-disease of CDI and DSS colitis.

Example 10: development and use of yeast strains

The present examples demonstrate exemplary methods for developing yeast strains. ^c MYA-796 is a parent diploid strain from ATCC and formally designated as Saccharomyces cerevisiae Meyen ex. E.C.Hansen (also known as Saccharomyces boulardii or Saccharomyces boulardii), a whole genome sequencing strain. Genomic information can be extracted from GenBank jrhe 00000000 yeast. Blakeslea strain ATCC MYA-796, whole genome shotgun sequencing project.

^d MYA-796 (ura 3-/-) is shown in ^c Uracil auxotrophs produced on the MYA-796 parent strain are due to the lack of a functional ura3 gene. Ura3 is a group on chromosome V in MYA-796Because of this. Ura3 encodes orotidine 5' -phosphate decarboxylase (ODCase), which catalyzes one reaction in the synthesis of pyrimidine ribonucleotides (components of RNA). Ura3 allows both positive and negative selection, making dMYA-796 (Ura 3-/-) a powerful tool for genome manipulation. This strain was genetically modified using homologous recombination in combination with loxp-export strategy. Double knockout of the Ura3 gene can be produced by one or two-step homologous recombination, replacing the Ura3 gene with two different antibiotic cassettes flanked on the outside by 5-HAL-Ura3 (40 bp) and 6-HAL-Ura3 (40 bp) and on the inside by LoxP sites. The two antibiotic resistant double positive strains were screened and then further Ura3 counter selection (negative selection) was performed on the URA3 double knockout phenotype with 5' -FOA. The PCR-based site-specific deletion of the genomic Ura3 gene and insertion of the antibiotic marker cassette was accomplished using Cre-LoxP deletion of two antibiotic cassettes. The X (exchange) locus of LoxP (P1) is a 34 base pair long recognition sequence (ATAACTTCGTATAGCATACATTATACGAAGTTAT; SEQ ID NO: 23) consisting of two 13-bp long palindromic repeats separated by an 8-bp long asymmetric core spacer sequence. After successful transformation of the Cre plasmid, the loop out of the antibiotic marker cassette flanked by LoxP sites was induced. The Cre-plasmid positive clone was selected and then the Cre-plasmid was naturally lost by culturing the clone without selection stress. Clones that lost original antibiotic resistance, lost the Cre-plasmid selection marker, but were positive for 5' -FOA counter selection were screened. PCR and sequencing was performed to confirm the deletion of the antibiotic cassette and LoxP trace. CRISPR/Cas9 is also used to indicate genes and produce desired variants. Exemplary variants include ^e MYA-796(ura3-/-，gap1-/-)、 ^f MYA-796(ura3-/-，gap1-/-，pep4-/-)、 ^g MYA-796(ura3-/-，gap1-/-，prb1-/-)、 ^h MYA-796(ura3-/-，gap1-/-，thr1-/-)、 ⁱ MYA-796(ura3-/-，gap1-/-，thr4-/-)。

Mutations in protease genes for enhanced, stable protein or polypeptide expression and secretion

In addition to maximizing the expression of therapeutic polypeptides by incorporating cassettes that utilize the cellular mechanisms of these loci at highly expressed regions of the yeast genome, protein or polypeptide (e.g., therapeutic polypeptide) expression, secretion, and stability are also increased by deleting protease encoding genes. Pep4 is targeted, yeast protease a, pep4 is a vacuolar aspartyl hydrolase that not only degrades proteins or polypeptides in vacuoles, but also activates additional vacuolar proteases, including Prc1 (carboxypeptidase Y), prb1 (protease B), and Lap4 (aminopeptidase I). Without wishing to be bound by any theory, by deleting pep4, it is hypothesized that secretion of a protein or polypeptide of interest (e.g., a therapeutic polypeptide) is increased by removing or preventing maturation of all of these degrading enzymes.

To test the effectiveness of this method, pep4 was deleted from a saccharomyces boulardii strain that secreted neutralizing antibodies to clostridium difficile toxins a and B (Sb-ABAB). Sb-ABAB cells were transformed with PCR amplification cassettes conferring resistance to geneticin or phleomycin using a chemical transformation protocol. The homologous sequences of these cassettes were designed to completely remove the pep4 open reading frame and short sequences of the gene promoter near the start codon. Each resistance gene is surrounded by two LoxP sites to allow for later removal by transformation of the Cre recombinase plasmid; since the exemplified engineered Saccharomyces yeast strain is a gap1 mutant, cre recombinase plasmids containing the selectable and counter-selectable gene gap1 were designed. Cells with successful pep4 targeted incorporation were selected on rich media containing geneticin and phleomycin, and pep4 mutant clones were confirmed by colony PCR. Sb-ABAB pep4 clones 10 and 6b were confirmed as pep4 mutants.

These protease null clones were incubated with parental Sb-ABAB cells, wild-type (WT) yeast that did not secrete ABAB antibodies, and uninoculated medium as a negative control in YPD-rich medium for 24 hours. Supernatants were collected from each culture and the concentration of ABAB in the samples was determined using a designed ELISA protocol, and then compared to concentration reference standards contained on ELISA plates. The designed ELISA involved coating the plates with clostridium difficile toxin B, blocking with milk, incubating the plates with diluted milk supernatant, and treating with HRP conjugated antibodies targeting the therapeutic polypeptides. The results show that the deletion of pep4 resulted in an increase in ABAB concentration in the supernatant of about 42% (fig. 8).

Since intracellular proteases may degrade proteins or polypeptides (e.g., therapeutic polypeptides) in the extracellular environment due to secretion or release following cell death, the loss of pep4 and inhibition of its activated enzymes were tested to determine if increased stability of the protein or polypeptide of interest over a longer period of time was observed. Sb-ABAB pep4 null clones were cultured with control strain in minimal medium without buffer, which became acidified during yeast growth; previously, very low stability of the protein or polypeptide in unbuffered medium over 24 hours was observed. Supernatant samples were collected every 24 hours for 5 consecutive days from each culture and the concentration of ABAB antibodies was determined using the ELISA protocol described above. The data show higher and more stable concentration of ABAB in samples from pep4 mutants (fig. 36). In addition to minimizing degradation of therapeutic polypeptides released into the gut during treatment, this approach also enables the use of the b.brucella cells for highly stable expression and purification of secreted proteins or polypeptides of interest. As a result of the success of this approach, pep4 mutations are introduced into other biotherapeutic yeast strains (e.g., engineered saccharomyces yeast strains) by such lines and similar strategies to target other proteases, both alone and in combination with other protease deletions. These include direct targeting, e.g., prc1, prb1 and Lap4, which are inhibited in the absence of Pep4, and plasma membrane localized protease Yps1.

Mutation of key genes of safe biological agents

The examples of the present invention demonstrate the use of mutations in key genes to create safer biologics. Cases of eubacteremia have been recorded in people with impaired immune function caused by oral administration of a probiotic of the genus saccharomyces boulardii. To create safer active biotherapeutic products, mutations have been introduced in threonine biosynthesis genes. Mutations in the threonine synthesis pathway upstream enzyme thr1 lead to Saccharomyces cerevisiae serum sensitivity (Kingsbury and Mcusker, 2010). Without wishing to be bound by any theory, this sensitivity is understood to be due to accumulation of the toxic intermediate homoserine when the cell is exposed to a low threonine environment such as serum. In this pathway, the Thr4 enzyme is located directly downstream of Thr1 and phosphorylates homoserine. thr4 null strains exhibited a phenotype very similar to thr 1-deficient cells, as phosphohomoserine is also a toxic intermediate.

Using the same strategy as described above for mutating protease genes, thr1 or thr4 was deleted in exemplary biotherapeutic yeasts to construct safer yeast therapeutics. To screen threonine-auxotrophic clones, cells were grown on both threonine-rich medium (YPD) and minimal medium (SD) lacking threonine. Multiple clones were identified to grow on threonine-rich media, but not on threonine-free media, indicating successful deletion of the threonine synthesis gene (fig. 37). These strains also failed to grow on minimal medium supplemented with standard concentrations of amino acids (containing 76ug/ml threonine) (FIG. 38). After analysis by SPE-LC-MS/MS, the threonine concentration in human plasma was reported to be about 16.7. Mu.g/ml after that (Calderon-Santiago et al 2012), well below 76. Mu.g/ml, which is insufficient to grow therapeutic B.brucei cells. Thus, threonine auxotrophs are less likely to cause eubacteremia and are advantageous for safer living biological agents.

In addition to increasing the biosafety of therapeutic agents (e.g., engineered saccharomyces yeast strains described herein) to patients, auxotrophic mutations, such as those in thr1, thr4, and deletions of ura3 in the yeast platform, are also strategies to enhance biosafety. Once expelled from the patient's gut, the need for therapeutic yeasts (e.g., engineered saccharomyces yeast strains as described herein) to acquire specific amino acids from the growing environment makes them more environmentally safe (fig. 37). The engineered yeasts described herein are less suitable for competition than the wild-type (WT) parent strain MYA-796, even in the presence of nutrients necessary for growth.

To demonstrate this decrease in fitness, a competitive assay was developed in which therapeutic cells were competitively cultured and passaged in 24-well plates with GFP-expressing strains with other aspects of the WT background. After taking into account the density differences, the amount of GFP fluorescence emitted by the cultures after excitation was measured using a plate reader. As the proportion of gfp+ cells decreases, more suitable cell cultures will emit less fluorescence over time; in contrast, less suitable yeast cultures will fluoresce more over time as the percentage of cells expressing GFP increases. Samples of the co-cultures were then used to inoculate fresh medium daily for four consecutive days.

Two yeast strains that uniformly secrete anti-TNF-alpha antibodies (Sb-anti-TNF-alpha) were co-cultured with gfp+ yeast. Two Sb-anti-TNF-alpha strains were also ura3 mutants. In one strain, the incorporation of the antibody cassette was selected to use ura3 as a marker, while in the second strain the selection was performed using the DHFR gene. During the experiment, fluorescence from uracil-prototrophic strains remained similar to control co-cultures of WT and GFP+ cells (GFP+; FIG. 39). However, fluorescence from DHFR competition was higher than WT control on day 1 and increased to the level of gfp+ control cultures containing GFP-expressing cells alone. While it is under investigation whether the presence of the DHFR gene resulted in a decrease in the observed fitness, these data indicate that ura3 mutants are less competitively adaptive than uracil prototrophy.

The introduction of auxotrophic mutations, including ura3, thr1 and thr4, appears to be an effective bioprotective strategy that can improve the environmental safety of the therapeutic strain. It is contemplated that other auxotrophic genes in both uracil and threonine biosynthetic pathways, as well as other pathways, are also tested. Commonly used yeast gene markers will be targeted, such as trp1 (tryptophan), lys2 (lysine), his3 (histidine), leu2 (leucine) and other genes encoding enzymes involved in the synthesis of these amino acids.

Example 11: DSS and bacterial colitis

The examples of the present invention demonstrate that intestinal delivery of anti-TNF-alpha neutralizing antibodies by engineered saccharomyces boulardii (oral Sb-amTNF or FZ006 m) significantly improves disease severity by reducing intestinal inflammation and tissue damage.Engineered Sb expressing anti-mouse TNF- α is effective in protecting mice from DSS colitis or colitis caused by DSS and clostridium difficile infection. First, it was tested whether the intestinal delivery of TNF- α neutralizing antibodies ameliorated the symptoms of Dextran Sodium Sulfate (DSS) -colitis. As previously described, mice drink water containing 2% DSS for 8 days (see, e.g., wirtz, s. Et al, nature laboratory manual (Nat Protoc), 12,1295-1309 (2017)). Mice were given a gavage of 10 daily starting on day 3 ⁹ Sb-amTNF of CFU for 11 days. The control group was gavaged with the same amount of Sb-EP control or PBS. Fig. 4A shows that none of the mice treated with oral Sb-amTNF died, whereas 20% of the mice in the control group died. Since DSS-colitis alone did not induce significant mortality in mice, a significantly more severe intestinal inflammation model of co-disease of DSS-colitis and clostridium difficile infection was utilized (see, e.g., zhou, f. Et al, inflammatory bowel disease (Inflamm Bowel Dis) 24,573-582 (2018)). In this co-morbid model, mice developed severe intestinal inflammation, tissue damage, and 80% of mice died. Since TNF- α is significantly up-regulated, it was tested whether enteral delivery of anti-TNF- α antibodies by engineered saccharomyces boulardii would improve disease severity and reduce intestinal inflammation. From day-3 to day 7, the co-morbid mice group was treated with 10 ⁹ CFU/dose PBS, sb-EP or Sb-amyTNF (total 11 doses) was orally administered daily. Significant weight loss was evident and in the PBS and Sb-EP control groups, about 80% of the mice died from the disease, while oral Sb-amTNF conferred substantial protection, significantly reduced weight loss (fig. 4B), and 40% of the mice died (fig. 4C). Upregulation of colonic pro-inflammatory cytokines TNF- α (fig. 4D) and IL-6 (fig. 4E) was also significantly reduced. Subsequently, colon length reduction and tissue damage were also significantly reduced in mice treated with oral Sb-amTNF (fig. 4F and 4G).

Example 13: human colon tissue

Clostridium difficile toxins are pro-inflammatory and induce colitis in both animals and humans (see, e.g., yu, h. Et al, clinical and vaccine immunology (Clin Vaccine Immunol) 24 (2017), zhang, y. Et al, cell and molecular gastroenterology and hepatology (Cell Mol Gastroenterol Hepatol) 5,611-625 (2018)). Oral administration of Sb-amTNF reduced colonic inflammation in mice (FIGS. 4A-4G and 7A-7D). Since Sb-ahTNF (FZ 006) expresses antibodies against human TNF- α, it was evaluated whether Sb-ahTNF reduced clostridium difficile toxin-induced expression of pro-inflammatory cytokines in human colon tissue. The results in fig. 11 show that supernatant from control Sb-EP cultures significantly reduced TcdB-induced upregulation of TNF- α in human colon tissue, consistent with the results presented herein and other reports of the anti-inflammatory properties of this probiotic yeast (see, e.g., sougioultzis, s. Et al, communication of biochemistry and biophysics studies (Biochem Biophys Res Commun) 343,69-76 (2006), castaglulolo, i. Et al, infection and immunity (infection Immun) 64,5225-5232 (1996), ponthousakis, c. Alimentary canal pharmacology and therapeutics (Aliment Pharmacol Ther) 30,826-833 (2009)). Supernatant of Sb-ahTNF culture further reduced TNF- α up-regulation (fig. 11, sb-EP versus Sb-ahTNF, p=0.001), indicating that Sb secreted neutralizing antibodies to TNF- α reduced the pro-inflammatory activity of TcdB in human colon tissue.

Oral Sb-amTNF administration did not induce an anti-drug response. Sbamtf constitutively expresses a bivalent VHH fused to human Fe. Experiments were conducted to determine if prolonged, repeated oral administration of Sb-amTNF would induce an anti-antibody response, potentially reducing the pharmaceutical activity. 36 oral doses over a period of 8 weeks (10 ⁹ CFU/dose) of Sb-amTNF, mice failed to produce any detectable anti-antibody IgA in feces or IgG in serum, whereas mice injected with purified VHH/VHH-Fc induced a potent anti-antibody IgG response (fig. 12A-12B).

Example 14: exemplary Gene of interest (GOI)

The examples of the invention show a summary of exemplary nucleic acids encoding therapeutic polypeptides (genes of interest (GOI)). Table 14.1 summarizes exemplary GOIs.

Table 14.1: exemplary GOI

/>

A summary of the gene insertion method is shown in fig. 13, and exemplary DNA sequences for developing homology arms of engineered saccharomyces boulardii strains are shown in fig. 14.

Example 15: destructive site-specific and Tn-based insertion

The present examples demonstrate destructive site-specific and Tn-based insertions. Sb strain (ura 3) ^-/- And gap1 ^-/- ) Electroporation was performed with 10. Mu.g of linear DNA of different sizes for incorporation into the genome by conventional (end-out) homologous recombination. For the about 2kb and about 3kb cassettes, the transformation efficiency of the delta site was 4.3-fold and 5.9-fold higher than that of the sigma site, respectively (FIG. 16). Interestingly, the use of CRISPR incorporation resulted in a 3-fold decrease in the conversion efficiency of the delta site (about 2kb cassette) and ≡100-fold (about 3kb cassette), but no increase or decrease in the conversion efficiency of the sigma site. For the sigma site, increasing the amount of linear DNA to 20 μg for the approximately 3kb cassette resulted in a 4.1 fold increase in transformation efficiency, while the delta site had a dramatic 64.5 fold increase in the same situation.

Sb strain (ura 3) ^-/- And gap1 ^-/- ) Electroporation was performed with yeGFP expression cassettes targeted for incorporation at the sigma or delta sites. Single colonies were grown in rich medium (YPD) or minimal medium for 24 hours followed by FACS analysis to measure yeGFP fluorescence. In general, clones with yeGFP at the delta site have a fluorescence 28% -36% higher than that of the sigma clone, which means δgramsHigher expression of yeGFP in the tubers. Representative clones from the sigma and delta groups are shown. By way of comparison, sb-Ch-yeGFP with a yeGFP cassette at the ura3 locus showed 36% -56% lower fluorescence intensity of yeGFP than the sigma or delta clones, indicating overall lower yeGFP expression from the ura locus (fig. 17).

Example 16: generation of exemplary final construct (FIC) and evaluation thereof

The present examples demonstrate the generation of an exemplary final construct (FIC) with different combinations of antibody gene forms, promoters and selectable markers for probiotic yeast transformation (e.g., the generation of engineered saccharomyces yeast strains). The resulting plasmid was first diagnosed using restriction digestion (FIG. 57) and DNA sequencing. The transgene cassette was electroporated into competent saccharomyces bravais along with the selectable marker and the yeast plated on agar plates. Single colonies from the selection plates were collected and cultured in synthetic medium containing specific chemicals for selection of those clones with correct genomic insertion of the transgene cassette. Two rounds of screening were performed. For the first round, bispecific antibody expression was assessed by ELISA for a total of about 200 clones from each FIC construct (fig. 53A). Specifically, fc fusion polypeptides in supernatants were captured by coated streptavidin in 96-well plates and detected using HRP conjugated anti-human IgG1 heavy chain antibodies. This assay allowed the assessment of the total Fc fusion polypeptide in different clones to identify highly expressed strains (figure 53A). In a subsequent round of screening, about 6-10 clones with highest protein or polypeptide (e.g., therapeutic polypeptide) expression were further assessed by ELISA for recombinant TNF- α (fig. 53B, left) and recombinant IL-17A (fig. 53B, right). These data indicate that expression cassettes with VHH1-VHH2-Fc forms showed the highest expression levels for TNF- α and IL-17A by ELISA (FIG. 53B), and thus these clones from FIC5 (FIC 5) were selected for functional assays.

Cell-based neutralization assays were used to further evaluate FIC5 clones. To measure the anti-TNF- α neutralizing activity of bispecific antibodies secreted by yeast clones, serial dilutions of supernatants were mixed with human TNF- α (10 pM) prior to application to L929 cells. After 24 hours incubation, antibody-mediated inhibition of TNF- α mediated cytotoxicity was measured (fig. 54, left). To assess the anti-IL-17A neutralizing activity of bispecific antibodies secreted by yeast clones, serial dilutions of supernatants were mixed with human recombinant IL-17A (10 ng/mL) prior to application to HEK293 cells. The biological activity of human IL-17A can be measured by reporter HEK293 cells, and thus antibody-mediated inhibition of IL-17A biological activity was measured (FIG. 54, right). The supernatant of clone G7-E1 (also known as FZ 008) showed high neutralizing activity against both TNF- α and IL-17A.

Thus, promoter P2 was determined to drive higher secretion of exemplary anti-TNF- α/IL-17A bispecific antibodies. The biological activity between the two typical forms, VHH-VHH-Fc and VHH-Fc-VHH, is comparable, but the former form gives higher expression in probiotic yeasts. The selection marker does not particularly affect the overall screening or expression of the antibody.

Example 17: exemplary production and characterization of engineered Saccharomyces yeast strains

The present examples illustrate exemplary production and characterization of the engineered Saccharomyces yeast strains described herein.

FIGS. 15-17 show destructive site-specific and Tn-based insertions.

FIGS. 50-52 illustrate steps for generating a final cassette for yeast chromosome incorporation and diagnostic digestion thereof.

FIGS. 18-20 show expression of antitoxin ABAB and stability of clones in different insertion positions (e.g., pTEF, pTDH3 and delta sites).

FIG. 21 shows a comparison of hTNFα -Fc expression between different insertion positions (e.g., pTEF, PTDH3, and delta sites).

FIGS. 22-32 show exemplary production and validation of auxotrophic B.brucei strains.

FIGS. 33-35 show DHFR/DFR1 systems.

Figures 235-251 show the development of FZE1 (methotrexate plus sulfanilamide) selection against b.

FIG. 36 illustrates the use of deletion of protease genes to increase polypeptide stability.

FIGS. 37-39, 55-57 illustrate the production of exemplary auxotrophic strains.

FIGS. 40-42 show exemplary engineered Saccharomyces boulardii strains for expression of anti-TNF-. Alpha.VHH3 and characterization thereof.

FIGS. 43-45 show the expression of functional Sc-FV-Fc antibodies by B.brucella and functional VHH, VHH-Fc, VHH-Sc-FV, VHH-Fc-VHH antibodies by B.brucella.

Fig. 46-49 show exemplary uses of FZ010m in a mouse obesity model.

FIGS. 53-54 show exemplary evaluations (expression and cell-based neutralization) of constructs for genomic insertion.

FIGS. 58-63 illustrate exemplary characterizations of FZMYA 06-16. Exemplary characterizations include assessment of growth phenotype, PCR validation of site-specific deletions of antibiotic cassettes, sequencing of LoxP-scores at ura3 and gap1 loci, growth curves, and antibiotic resistance.

FIGS. 64-65 show schematic representations of exemplary nucleic acids (e.g., plasmids containing GOI cassettes) and the insertion of GOI cassettes.

FIGS. 61-62 illustrate exemplary production of engineered Saccharomyces yeast strains.

FIGS. 68-102 show exemplary production and characterization of engineered Saccharomyces boulardii strains (e.g., FZ 002) expressing tetra-specific antitoxin ABAB.

Figures 103-129 show exemplary production and characterization of engineered saccharomyces boulardii strains (e.g., FZ006 h) constitutively expressing a single VHH screened from a yeast display immune library and fused to an Fc fragment, neutralizing htnfα, porcine tnfα, and monkey tnfα.

FIGS. 130-135 show exemplary production and characterization of engineered Saccharomyces boulardii strains (e.g., FZ006 m) that constitutively express VHH dimers that neutralize mTNFα and fuse with the Fc fragment.

FIGS. 136-152 show exemplary production and characterization of engineered Brevibacterium strains (e.g., FZ 008) constitutively expressing bispecific VHH that fuse with the Fc fragment, neutralize hTNFα and hIL-17A.

FIGS. 153-164 show exemplary production and characterization of engineered Brevibacterium strains (e.g., FZ010 m) that constitutively express functional mouse IL-22 fused to an Fc fragment.

FIGS. 165-178 show exemplary production and characterization of engineered Brevibacterium strains (e.g., FZ 014) constitutively expressing anti-rotavirus VHH (2 KD 1) and aprotinin fused to an Fc fragment.

FIGS. 179-187 show exemplary production and characterization of engineered Brevibacterium strains (e.g., FZ 016) constitutively expressing anti-norovirus bispecific VHHs (M6M 5-Fc and M6M 4-Fc) fused to Fc fragments for norovirus.

FIGS. 188-214 show exemplary production and characterization of engineered Saccharomyces boulardii strains (e.g., FZ 020) that constitutively express anti-hTNFα and antitoxin ABAB.

Figures 215-220 illustrate exemplary production and characterization of engineered saccharomyces boulardii strains (e.g., FZ 024) that constitutively express leptin polypeptides (e.g., human active leptin).

FIGS. 221-225 show exemplary production and characterization of engineered Brevibacterium strains (e.g., FZ 028) that constitutively express VHH's that can specifically lyse Clostridium difficile, directed against cwp84 and fused to the lytic hormone domain of CDI.

FIGS. 226-234 illustrate exemplary production and characterization of engineered Saccharomyces boulardii strains (e.g., FZ010 h) that constitutively express IL-22 polypeptides (e.g., functional human IL-22) that are not fused or fused at the N-terminus or C-terminus to a mutant Fc fragment.

It should be emphasized that the above-described examples of the present disclosure are merely possible examples of implementations set forth for a clear understanding of the principles of the disclosure. Many variations and modifications may be made to the above-described embodiments without departing substantially from the spirit and principles of the disclosure. All such modifications and variations are intended to be included herein within the scope of this disclosure and protected by the following claims.

Claims

1. An engineered saccharomyces yeast (Saccharomyces yeast) strain comprising:

2. The engineered saccharomyces yeast strain of claim 1 wherein said yeast is saccharomyces boulardii (Saccharomyces boulardii).

3. The engineered saccharomyces yeast strain of claim 1 or 2 further comprising a complete or partial deletion of URA 3.

4. The engineered saccharomyces yeast strain of any one of claims 1-3 further comprising a complete or partial deletion of GAP 1.

5. The engineered saccharomyces yeast strain of any one of claims 1 to 4 wherein said yeasts are ura3 (-/-) and gap1 (-/-).

6. The engineered saccharomyces yeast strain of any one of claims 1 to 5 wherein the nucleic acids encoding said therapeutic polypeptides are incorporated into at least two different locations in the genome of said yeast or at least one hotspot in the genome of said yeast.

7. The engineered saccharomyces yeast strain of any one of claims 1 to 6 wherein the nucleic acids encoding said therapeutic polypeptides are incorporated into at least two different chromosomes.

8. The engineered saccharomyces yeast strain of claim 7 wherein said at least two different chromosomes comprise chromosomes VII and XVI.

9. The engineered saccharomyces yeast strain of any one of claims 1 to 8 further comprising a nucleic acid sequence encoding a dihydrofolate reductase (DHFR) incorporated into the genome of said yeast, wherein said DHFR is optionally mammalian DFHR.

10. The engineered saccharomyces yeast strain of any one of claims 1 to 9 further comprising one or more exogenous nucleic acids encoding yeast DFR 1.

11. The engineered saccharomyces yeast strain of any one of claims 1 to 10 wherein said therapeutic polypeptide is a binding protein comprising a structure selected from the group consisting of: VHH, fc-VHH, VHH-Fc, VHH-VHH, fc-VHH, VHH-Fc-VHH, and VHH-Fc, wherein each or any one of the VHH or Fc domains is linked to another VHH or Fc domain by an optional linker sequence.

12. The engineered saccharomyces yeast strain of any one of claims 1 to 10 wherein said therapeutic polypeptide is a binding protein that binds to TcdA, tcdB, or a combination thereof.

13. The engineered saccharomyces yeast strain of claim 12 wherein said therapeutic polypeptide comprises the amino acid sequence of SEQ ID No. 5.

14. The engineered saccharomyces yeast strain of any one of claims 1 to 10 wherein said therapeutic polypeptide is a binding protein that binds TNF-a.

15. The engineered saccharomyces yeast strain of claim 14 wherein said binding protein is IgG or comprises at least one VHH domain.

16. The engineered saccharomyces yeast strain of claim 14 or 15 wherein the therapeutic protein comprises an amino acid sequence selected from any of SEQ ID NOs 6, 7, 19 and 20.

17. The engineered saccharomyces yeast strain of any one of claims 1 to 10 wherein said therapeutic polypeptide is a binding protein that binds to IL-17A.

18. The engineered saccharomyces yeast strain of claim 17 wherein said binding protein is IgG or comprises at least one VHH domain.

19. The engineered saccharomyces yeast strain of claim 17 or 18 wherein said therapeutic protein comprises the amino acid sequence of SEQ ID No. 25.

20. The engineered saccharomyces yeast strain of any one of claims 1 to 10 wherein said therapeutic polypeptide is a bispecific binding protein that binds TNF-a and IL-17A.

21. The engineered saccharomyces yeast strain of claim 20 wherein said binding protein is IgG or comprises at least two VHH domains.

22. The engineered saccharomyces yeast strain of claim 20 or 21 wherein said therapeutic protein comprises an amino acid sequence selected from any of SEQ ID NOs 8, 9 and 10.

23. The engineered saccharomyces yeast strain of any one of claims 1 to 10 wherein said therapeutic polypeptide is a binding protein that binds to a norovirus or rotavirus.

24. The engineered saccharomyces yeast strain of claim 23 wherein said binding protein is IgG or comprises at least one VHH domain.

25. The engineered saccharomyces yeast strain of claim 23 or 24 wherein said therapeutic protein comprises an amino acid sequence selected from any of SEQ ID NOs 13, 14, 15 and 16.

26. The engineered saccharomyces yeast strain of any of claims 1-10 wherein said therapeutic polypeptide is a VHH that binds to cwp84 and is fused to a lysin domain.

27. The engineered saccharomyces yeast strain of claim 26 wherein said therapeutic protein comprises an amino acid sequence selected from any of SEQ ID NOs 21 and 22.

28. The engineered saccharomyces yeast strain of any one of claims 1 to 10 wherein said therapeutic polypeptide is a cytokine or chemokine.

29. The engineered saccharomyces yeast strain of claim 28 wherein said cytokine is IL-22 or IL-10.

30. The engineered saccharomyces yeast strain of claim 28 or 29 wherein said cytokine or said chemokine is fused to an Fc domain.

31. The engineered saccharomyces yeast strain of any one of claims 28 to 30 wherein said therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs 11, 12 and 27.

32. The engineered saccharomyces yeast strain of any one of claims 1 to 10 wherein said therapeutic polypeptide is GLP1.

33. The engineered saccharomyces yeast strain of claim 32 wherein said therapeutic protein comprises an amino acid sequence selected from any of SEQ ID NOs 17, 23 and 24.

34. The engineered saccharomyces yeast strain of any one of claims 1 to 10 wherein said therapeutic polypeptide is leptin.

35. The engineered saccharomyces yeast strain of claim 34 wherein said therapeutic protein comprises the amino acid sequence of SEQ ID No. 18.

36. The engineered saccharomyces yeast strain of any one of claims 1 to 35 wherein said yeast comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 or more copies of said nucleic acid encoding said therapeutic polypeptide incorporated into its genome.

37. The engineered saccharomyces yeast strain of any of claims 1-36 further comprising at least one site-specific chromosomal insertion of a second nucleic acid encoding a second therapeutic polypeptide,

wherein the second therapeutic polypeptide is selected from the group consisting of binding proteins including a VHH domain, immunoglobulins, cytokines and chemokines or combinations thereof.

38. A method of binding to an antigen in vivo, the method comprising administering to a subject an engineered saccharomyces yeast strain according to any one of claims 1 to 27.

39. The method of claim 38, wherein the antigen is selected from the group consisting of both TcdA, tcdB, tcdA and TcdB, TNF- α, both IL-17A, TNF- α and IL-17A, cwp84, rotavirus protein, or norovirus protein.

40. A method of treating or preventing a disease or condition, the method comprising administering to a subject in need thereof an effective amount of the engineered saccharomyces yeast strain of any one of claims 1 to 37.

41. The method of claim 40, wherein the disease or condition is an inflammatory condition.

42. The method of claim 41, wherein the inflammatory condition is selected from the group consisting of Inflammatory Bowel Disease (IBD), intestinal inflammation, crohn's disease, and ulcerative colitis.

43. The method of claim 40, wherein the disease or condition is an infection.

44. The method of claim 43, wherein the infection is clostridium difficile infection (c.diffiile infection), norovirus infection, rotavirus infection, or a combination thereof.

45. The method of claim 43 or 44, wherein the subject is otherwise suffering from IBD.

46. The method of claim 40, wherein the disease or condition is Irritable Bowel Syndrome (IBS).

47. The method of claim 40, wherein the disease or condition is a neurodegenerative disease.

48. The method of claim 40, wherein the disease or condition is diabetes.

49. The method of claim 40, wherein the disease or condition is obesity.

50. The method of claim 40, wherein the disease or condition is fatty liver disease.

51. The method of claim 40, wherein the disease or condition is a metabolic disease.

52. The method of claim 40, wherein the disease or condition is Graft Versus Host Disease (GVHD).

53. The method of claim 40, wherein the disease or condition is an autoimmune disease.

54. A method of selecting an engineered saccharomyces yeast strain, wherein the saccharomyces yeast comprises a nucleic acid sequence encoding a dihydrofolate reductase (DHFR), one or more exogenous nucleic acids encoding a yeast DFR1, or a combination thereof incorporated into the genome of the yeast, the method comprising contacting the saccharomyces yeast with methotrexate (methotrerate) and a sulfonamide.

55. The method of claim 54, wherein said DHFR is mammalian DHFR.

56. The method of claim 54 or 55, wherein the methotrexate is at a concentration of 1nM to 1mM.

57. The method according to any one of claims 54 to 56, wherein the concentration of the sulfonamide is 0.1 to 10mg/mL.

58. The method of any one of claims 54 to 57, wherein the engineered saccharomyces yeast strain comprises:

59. The method of any one of claims 54 to 58, wherein the yeast is saccharomyces boulardii.

60. The method of any one of claims 54 to 59, wherein the yeast is ura3 (-/-) and gap1 (-/-).

61. The method of any one of claims 58 to 60, wherein the nucleic acid encoding the therapeutic polypeptide is incorporated into at least two different locations in the genome of the yeast.

62. The method of any one of claims 58 to 61, wherein the yeast comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 or more copies of the nucleic acid encoding the therapeutic polypeptide incorporated into its genome.

63. The method of any one of claims 58 to 62, wherein the yeast further comprises at least one site-specific chromosomal insertion of a second nucleic acid encoding a second therapeutic polypeptide,