CN117866984A - Transcription factor TaABI3 for inhibiting wheat starch synthesis and application thereof - Google Patents

Abstract

The invention discloses a transcription factor TaABI3 for inhibiting wheat starch synthesis and application thereof, wherein the transcription factor TaABI3 corresponds to three copies of a gene:TaABI3‑A1、TaABI3‑B1andTaABI3‑D1the nucleotide sequences of the polypeptide are respectively shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3. The transcription factor TaABI3 inhibits the expression of starch synthesis genes in the filling period in common wheat and finally reduces the starch content in mature grains. In practical application, can rootAccording to the actual breeding requirement, the method of over-expression or gene knockout is adopted to reduce or improve the starch content in the plant, which has important significance for improving the quality of the plant.

Description

Transcription factor TaABI3 for inhibiting wheat starch synthesis and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a transcription factor TaABI3 for inhibiting wheat grain starch synthesis and application thereof.

Background

The yield of wheat kernels is mainly dependent on the production, transport and eventually the distribution and accumulation of plant photosynthetic products into the kernels. Wheat grain consists essentially of starch and protein, wherein the starch comprises about 70% by weight of the grain. At the same time, the interaction between starch and gluten may also have an important impact on the quality of the wheat kernel. Starch is therefore considered an important factor affecting grain yield and quality.

Wheat starch is classified into amylose and amylopectin according to the degree of polymerization and branching of glucose, and the ratio of the amylose to the amylopectin in the grain is about 1:3, the content of which varies between different wheat varieties. The amylose content and the chain length of amylopectin affect the aging characteristics of wheat flour. Starch is widely distributed in plants mainly in the form of granules, the shape and quantity of which vary depending on the plant species. Starch is classified into type a (23-28 μm), type B (9-11 μm) and type C (2-3 μm) according to the average particle size of the starch granules, and type B and type C are generally considered as small type B starch granules.

Starch biosynthesis is a complex metabolic pathway that co-regulates starch biosynthesis during wheat endosperm development by a total of 28 key enzymes and a range of transcription factors, including 5 ADP glucose phosphorylases (AGPases), 1 ADP glucose transporter (ADPG), 2 granule-bound starch synthetases (GBSSs), 7 Starch Synthetases (SSs), 4 Starch Branching Enzymes (SBEs), 4 starch debranching enzymes (DBEs), 4 starch/α -glucan Phosphorylases (PHOs), 2 starch disproportionating enzymes (DPEs), and 1 starch targeting Protein (PTST).

Transcription factors regulate the expression of their target genes primarily by binding to cis-acting elements of their target gene promoter regions. Starch accumulation is mainly affected by the transcriptional and translational levels of starch synthesis genes. The starch synthesis gene is mainly expressed in the grouting period, so that changing the expression level of the starch synthesis gene in the process of grain grouting is a key for changing the final accumulation amount of starch in endosperm. In recent years, a series of transcription factors involved in regulating and controlling starch synthesis genes have been continuously identified in rice, corn, barley and wheat while functionally analyzing starch synthesis related enzymes. In the case of rice plants, the plant species,OsbZIP58(also known asRISBZ1) By binding to starch synthesis genesAGPL3、GBSSI、SSIIa、BE1、BEIIbAndISA2and activates their expression,OsbZIP58the deletion results in abnormal rice grain morphology, and the total starch content and the amylose content are reduced. CornO2The gene codes a bZIP family transcription factor which is expressed by endosperm specificity,o2in the mutant, starch synthesis geneGBSSI、ZpuI、BE2Elevated transcript levels, amylopectin glucan chain elongation results in a softer starchy endosperm. Barley WARK family transcription factor SUSIBA2 can bind to starch synthesis genesiso1And activates its expression, thereby participating in barley sugar signaling, ultimately affecting starch biosynthesis. In wheat, the bZIP family transcription factor TaSPA can regulate the expression of gluten and starch synthesis related genes. Overexpression ofTaSPA-BPost starch synthetic gene [ ]SUSase、ADPase、Pho1、Waxy、SBE、SSIAndSSIIa) The transcription is down-regulated, the starch content is slightly reduced, and the starch granules show more polarized distribution, the volume of the A-type starch granules is increased, and the volume of the B-type starch granules is reduced. Research on expression regulation of starch synthesis genes will greatly enrich the gene resources for improving wheat yield and quality.

Disclosure of Invention

The invention aims to provide a transcription factor TaABI3 for inhibiting wheat starch synthesis and application thereof.

In order to achieve the above object, the technical scheme of the present invention is summarized as follows:

a method for determining and regulating the expression candidate transcription factor of starch synthesis gene by using the coexpression analysis and the construction of transcription regulation network features that the transcriptome and open chromatin region of endosperm in the filling period of Chinese spring wheat are determined by RNA-Seq analysis and chromatin accessibility analysis (ATAC-Seq) to find the transcription factor with similar or opposite expression mode to starch synthesis gene.

By analyzing transcriptome and chromatin accessibility sequencing data of endosperm in the grain filling stage of Chinese spring wheat, transcription of expressed starch synthesis genes starts from 4DAP after flowers, reaches a peak after flowers by 8DAP and then rapidly descends. Identification by Co-expression analysisTaABI3Has similar expression pattern with starch synthesis gene. By constructing a transcription regulatory network for discovery,TaABI3it is possible to regulate the biosynthesis of wheat starch. Detection of the dual luciferase reporter system demonstratedTaABI3Can inhibit the expression of starch synthesis genes. The results of wheat transgenes also indicate knockoutTaABI3Up-regulating the expression of starch synthesis gene in immature seed and raising the starch content in mature seed.

Wherein, the transcription factor TaABI3 for regulating and controlling the expression of the starch synthesis gene, which transcription factor down regulates the expression of the starch synthesis gene, the transcription factorTaABI3Three copies of the corresponding gene:TaABI3-A1、TaABI3-B1andTaABI3-D1the nucleotide sequences of the polypeptide are respectively shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3. The DNA sequence length is respectively as follows:TaABI3-A1a protein of 2076bp and encoding 691 amino acid residues,TaABI3-B1a2064 bp, 687 amino acid residue encoded protein, taABI3-D1 2076bp, 691 amino acid residue encoded protein.

The present invention provides amplificationTaABI3Universal primer pair for sequence full length. Wherein the sequence of the forward primer is shown as SEQ ID NO.10, and the sequence of the reverse primer is shown as SEQ ID NO. 11.

Preferably, we pairTaABI3Exon regions A, B and D subgenomic conserved sgRNAs were designed and characterizedThe common wheat is transformed by being connected to a gene editing vector pBUE 411; respectively utilizing the primers to identify and screen transgenic plants to obtain positive plants, wherein the positive plants are obtained by the methodTaABI3-A1The forward identification primer sequence of the gene is shown as SEQ ID NO.4, and the reverse identification primer sequence is shown as SEQ ID NO. 5;TaABI3-B1the forward identification primer sequence of the gene is shown as SEQ ID NO.6, and the reverse identification primer sequence is shown as SEQ ID NO. 7;TaABI3-D1the forward identification primer sequence of the gene is shown as SEQ ID NO.8, and the reverse identification primer sequence is shown as SEQ ID NO. 9.

The specific primer sequences are as follows:

SEQ ID NO.4：ATCTCCGAGCAGCAGCAGTT；

SEQ ID NO.5：AGCTGGCCATGGGGCTGGCT；

SEQ ID NO.6：ACTTCGCGTCCATCAACGAC；

SEQ ID NO.7：CTGGACCATGAGCTGGCCCT；

SEQ ID NO.8：GGCCGCTGGTGGAGGAGAT；

SEQ ID NO.9：GCCTCCCCAGCCGGAAGAG；

SEQ ID NO.10：ATGGACGCCTCCGCCGGC；

SEQ ID NO.11：GATGCTCACCGCCATCTGGT。

the invention also protects the application of the transcription factor TaABI3 in wheat grain starch synthesis.

Specifically, transgenic plants with increased starch content of wheat kernels are obtained by reducing the expression of TaABI3 in wheat.

More specifically, the expression of TaABI3 in wheat can be reduced by gene knockout, and thus, one specific method of operation is to encode the gene encoding the transcription factorTaABI3Knocking out and screening out in plantTaABI3Transgenic positive plants with knocked-out genes. Wherein gene knockout can be achieved using the Crispr/Cas9 technique.

The invention also discloses a plant breeding method for improving starch synthesis, which comprises the following steps:

(1) Construction to enable knockoutTaABI3Is a carrier of (2); (2) Transforming the constructed gene knockout vector into plant tissue or plant cells; (3) ScreeningTaABI3A knockout strain; compared with wild type, theTaABI3Starch synthesis up-regulation of the gene knockout line.

In particular during plant breeding, it is possible to applyTaABI3-A1、TaABI3-B1AndTaABI3-D1in order to prevent functional redundancy between subgenomic groups during actual operation, three genes are often knocked out simultaneously.

In addition, a plant breeding method for reducing starch synthesis is disclosed, the method comprising:

(1) Construction of the inclusionTaABI3Is an over-expression vector of (2); (2) Transforming the constructed overexpression vector into plant tissues or plant cells; (3) screening for over-expressed strains; starch synthesis of the over-expressed strain is down-regulated compared to wild-type.

In particular in the course of plant breeding,TaABI3-A1、TaABI3-B1andTaABI3-D1the homology of (C) is very high, and only any one of the genes needs to be over-expressed. The specific operation steps are carried out by adopting a conventional method.

The invention also provides a method for detecting the regulation and control intensity of the transcription factor on the starch synthesis gene promoter region, which specifically comprises the following steps: the over-expression vector of the transcription factor and the report vector of the starch synthesis gene promoter driving the expression of firefly luciferase (Firefly luciferase) genes are injected into tobacco leaves together, and the strength of the transcription factor for regulating and controlling the activity of the starch synthesis gene promoter is detected by taking renilla luciferin (Renilla luciferase) as a control. We used the dual luciferase reporter gene system to detectTaABI3-A1The experiment shows that TaABI3 obviously reduces the regulation and control effect of the downstream starch synthesis gene promoterTaAGPS1aAndTaSSIIIais a promoter activity of (a) in a host cell. These results illustrate that the results show that,TaABI3-A1can negatively regulate the expression of starch synthesis genes.

The invention has the advantages that:

the invention uses coexpression analysis and construction of transcription regulation network to determine candidate transcription factor for regulating starch synthesis gene expression, and uses RNA-Seq analysis and ATAC-Seq analysis to determine the transformation of endosperm in Chinese spring wheat grouting periodTranscriptome and open chromatin regions, finding the transcription factor TaABI3 with similar or opposite expression patterns to the starch synthesis gene，By means of genetic engineeringTaABI3Gene knockout，Experiments prove that compared with the wild type,TaABI3the starch content of the knockout line is significantly increased. In the case of a dual-luciferase reporter system,TaABI3the activity of the starch synthesis gene promoter is obviously reduced. In any case the number of the devices to be used in the system,TaABI3can inhibit the expression of starch synthesis genes in vitro and finally in vitroTaABI3Increasing the starch content of the endosperm in the knockout transgenic line. In addition, the invention also provides an experimental system for verifying the expression of the starch synthesis gene regulated by the transcription factor. Thus, the first and second substrates are bonded together,TaABI3has important significance for improving the quality of wheat.

Drawings

FIG. 1 is a correlation between wheat starch synthesis gene expression pattern and upstream regulatory factors; a: expression patterns of wheat starch synthesis genes and upstream regulatory factors in endosperm slurry phase; b: binding activity of upstream regulatory factor to downstream target gene.

FIG. 2 is a transcriptional regulation network of wheat endosperm development process; a:TaABI3、TaABI5andTaAG1schematic diagram of regulation and control relation in starch and storage protein synthesis process; b: schematic diagram of report vector and expression vector in double luciferase report gene system; c:TaABI3-A1、TaABI5-A1andTaAG1the promoter activity of the downstream gene is regulated in a dual luciferase reporter gene system.

FIG. 3 is a schematic diagram of a preferred embodiment of the present inventionTaABI3Constructing a gene knockout strain; a: in situ hybridization results showedTaABI3-A1Specific expression in endosperm; b:TaABI3schematic representation of gene knockout vector; c: first generation sequencing assaysTaabi3The strain editing situation is knocked out.

FIG. 4 is a diagram of RT-qPCR detection of wild type andTaabi3expression level of starch coding gene in the gene knockout line.

FIG. 5 is a tobacco dual luciferase reporter assayTaABI3-A1Regulation of downstream genes; a: schematic diagram of report vector and expression vector in double luciferase report gene system; b:TaABI3-A1in double pairsThe promoter activity of the starch synthesis gene is regulated in a luciferase reporter gene system.

FIG. 6 is a resin slice displayTaabi3Starch granule number of 15DAP after pollination of the gene knockout line and wild type grain.

FIG. 7 is a schematic diagram of a preferred embodiment of the present inventionTaabi3The seed phenotype of the gene knockout strain; a: wild type and wild typeTaabi3Phenotype after the mature seed of the gene knockout strain; b: wild type and wild typeTaabi3The gene knockout strain has grain length, grain width, thousand grain weight and total starch content.

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. However, unless otherwise indicated, all the specific examples described in the examples below were either conventional or were carried out under the conditions recommended by the manufacturer's instructions.

The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise indicated, all reagents and materials used are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the present invention. The preferred methods and materials described herein are presented for illustrative purposes only.

Example 1 construction of a transcriptional regulatory network during endosperm development of Chinese spring wheat

The coexpression analysis of starch synthesis gene and upstream regulatory factor in the development process of Chinese spring wheat endosperm specifically comprises the following steps:

(1) RNA-Seq analysis: selecting endosperm of 0DAP, 2DAP, 4DAP, 6DAP, 8DAP and 12DAP after pollination of Chinese spring wheat grains with genome sequenced, adding liquid nitrogen into a mortar frozen by liquid nitrogen, and grinding to powder; total RNA was extracted by guanidine hydrochloride, and was initially purified and recovered using RNeasy Plant Mini Kit (Qiagen, hilden, germany); RNA concentration and quality were measured with an ultra-micro spectrophotometer NanoDrop 2000 and verified by 1.0% agarose gel electrophoresis, ensuring at least 5. Mu.g per sample and a concentration above 100 ng/. Mu.L. Sending to a sequencing company for library building sequencing.

(2) Calculation of gene expression level (TPM): raw data filters out low-quality reads to obtain clean reads; adding the coding region sequence of the known starch synthesis genes into the genome sequence of China spring to form an integrated genome sequence, and ensuring that each starch synthesis gene only retains one sequence; comparing the clean reads to a reference genome integrated by Chinese spring wheat by HISAT (HierarchicalIndexing for Spliced Alignment of Transcripts), and reserving reads which are compared to unique positions on the genome; the calculation of the read count for each gene by featurecount TPM (transcripts per million) is to divide the number of reads aligned to the gene by the length of all reads aligned to the genome and RNA.

(3) Starch synthesis gene and upstream regulatory factor expression analysis: the reported transcription factors for regulating and controlling the starch synthesis genes and the expression patterns of the starch synthesis genes are clustered together so as to find the transcription factors with similar expression patterns to the starch synthesis genes, and the transcription factors are taken as candidate genes involved in the expression regulation of the starch synthesis genes. As a result, as shown in FIG. 1A, the starch synthesis gene of Chinese spring wheat was specifically expressed in endosperm, starting with 4DAP after flowers, then rising sharply and reaching a peak at 8DAP after flowers, and then falling sharply. In addition, there are transcription factors that are specifically expressed during wheat endosperm development, such as the MADS, MYB, AP/ERF, bZIP, and NAC families of transcription factors, suggesting that these transcription factors may regulate the expression of starch synthesis genes (fig. 1B).

(4) Construction of a transcription regulation network: to construct the transcriptional regulatory network, we integrate the RNA-seq and ATAC-seq data. This integrated approach enabled us to map Transcription Factor (TF) interactions and gene regulation relationships in wheat. We first performed a blastp search using diamonds, and aligned the plant transcription factor protein sequences in the JASPAR database with the wheat protein sequences to identify TFs-Motif relationships in wheat. For each gene we analyzed the open chromatin region (pACRs) sequence using the ATAC-seq, which generated the Motif-targets relationship. Combining TFs-Motif and Motif-targets data we have derived the TFs-targets relationship. Using the GENIE3 algorithm, we analyzed the transcriptional correlation between wheat TFs and all genes based on RNA-seq data (fig. 2A).

(5) And (3) verifying a transcription regulation network: dual luciferase reporter system detectionTaABI3、TaABI5AndTaAGregulation of downstream gene promoters: will beTaABI3-A1、TaABI5-A1AndTaAG1respectively recombining the recombinant DNA into pSuper-GFP vector to drive a 35S promoter thereinTaABI3-A1、TaABI5-A1AndTaAG1and (3) expressing in large quantity, and replacing the 35S promoter of the report gene vector with the promoter (3,000 bp) of the downstream gene to drive the expression of firefly luciferase (firefly luciferase) gene. The two recombinant vectors are used for co-transforming tobacco leaves, and the Renilla luciferase (Renilla luciferase) is used as a control, so that wheat can be detectedTaABI3-A1、TaABI5-A1AndTaAG1promoter strength for the downstream gene promoter region. Fluorescence intensity was measured using the Dual-Luciferase Reporter Assay System kit (Promega, madison, USA) and the Gloma20/20 Luminometer (Promega, madison, USA). The results are shown in figures 2B and 2C,TaAG1the promoter activity of DA1 is obviously improved,TaABI3-A1remarkably improveSUT1AndTaABI5is selected from the group consisting of a promoter activity of (A),TaABI3-A1significantly reduceTaARF25Is selected from the group consisting of a promoter activity of (A),TaABI5-A1remarkably improveWPBFIs selected from the group consisting of a promoter activity of (A),TaABI3-A1significantly reduceGW7Is a promoter activity of (a) in a host cell.

Example 2 wheatTaABI3Gene function

1. WheatTaABI3Modulation of starch synthesis genes

(1) In situ hybridization: seeds of 12DAP after pollination of chinese spring wheat grain were fixed overnight in formaldehyde-acetic acid-ethanol at 4 ℃, dehydrated through a standard ethanol series, embedded in Paraplast Plus tissue embedding medium, and cut into 8 μm width sections using a microtome (Leica Microsystems, RM 2235). According toTaABI3-A1DNA sequences were synthesized based onThe digoxin sense and antisense RNA probes were run using the DIG Northern Starter kit according to the manufacturer's instructions and the results are shown in fig. 3A.

2.TaABI3Transformation of Gene knockout vector and transgenic Strain RT-qPCR

(1) Construction of gene knockout vector and transformation of wheat: will be designed to be able to identify simultaneouslyTaABI3The sgRNA of the A, B and D subgenomic of (A) was ligated into vector pBUE411 to transform Agrobacterium. Transforming in a transgenic platform of Shandong agricultural university by using an agrobacterium infection method to obtain a T0 generation transgenic plant.

(2)TaABI3Identification and screening of gene knockout lines: the T0 generation transgenic plant obtained by transformation is planted in a greenhouse, 2-3 cm leaves are taken, and genome DNA is extracted by a CTAB method. 1. Mu.l of genomic DNA was used as a template forTaABI3The A genome identification of (2) is carried out by using a primer pair (shown as SEQ ID NO.4 and shown as SEQ ID NO. 5), the B genome identification is carried out by using a primer pair (shown as SEQ ID NO.6 and shown as SEQ ID NO. 7), the D genome identification is carried out by using a primer pair (shown as SEQ ID NO.8 and shown as SEQ ID NO. 9) through conventional PCR amplification, and the identification screening is carried out by using wild wheat genome DNA as a control, so that a positive plant for gene editing is obtained, and the generation-added planting is carried out in a greenhouse, wherein the result is shown as figures 3B and 3C.

(3)TaABI3 RT-qPCR of the knock-out line: the T3 generation homozygous transgenic plants are planted in the field, and the knockout lines are respectively knocked out in the grouting periodTaabi3Two systemsTaabi3-1AndTaabi3-2immature seeds 15d after flowers were sampled and rapidly frozen with liquid nitrogen, and the material was then stored in a-80 ℃ freezer. Extracting total RNA from the obtained sample by Trizol method, and reverse transcribing the RNA into cDNA toTaActinAs an internal reference, verification was performed by RT-PCR. The results are shown in FIG. 4, and the RT-qPCR verification result shows that the strain is knocked outTaabi3In (3), the starch synthesis gene is significantly up-regulated.

(4)TaABI3-A1Regulation of downstream genes: similarly, we used the dual luciferase reporter gene system to detectTaABI3-A1Regulatory action on downstream starch synthase promoters: will beTaABI3-A1Is recombined in a pSuper-GFP vector to drive a 35S promoter thereinDynamic movementTaABI3-A1Expressed in large quantities using downstream genesTaAGPS1aAndTaSSIIIathe 35S promoter of the reporter vector was replaced with the promoter (3,000 bp) of (A) to drive the expression of firefly luciferase (Firefluciferase) gene. The two recombinant vectors are used for co-transforming tobacco leaves, and the Renilla luciferase (Renilla luciferase) is used as a control, so that wheat can be detectedTaABI3-A1Promoter strength for the downstream gene promoter region. Fluorescence intensity was measured using the Dual-Luciferase Reporter Assay System kit (Promega, madison, USA) and the Gloma20/20 Luminometer (Promega, madison, USA). As shown in FIG. 5 (FIGS. 5A and 5B), taABI3 is significantly reducedTaAGPS1aAndTaSSIIIais a promoter activity of (a) in a host cell. These results illustrate that the results show that,TaABI3-A1can negatively regulate the expression of starch synthesis genes.

3.TaABI3Phenotype identification of Gene knockout lines

(1)Taabi3Determination of 15DAP grain starch number after gene knockout strain flowers

We willTaabi3The grain of 15DAP after the gene knockout strain and the wild plant flowers is fixed by FAA fixing solution, the material is embedded into resin through ethanol gradient dehydration treatment, a sample with the thickness of 5 mu m is prepared by a slicer, finally, the sample is dyed by coomassie brilliant blue, the starch grain is counted by selecting the area with the same area, the result is shown in figure 6,Taabi3the number of starch granules in the knockout line is significantly increased compared to the wild type. ImplicationsTaABI3Negative regulation of wheat starch biosynthesis.

(2)TaABI3Gene knockout strainTaabi3Mature grain phenotype assay

The thousand grain weight, grain length and grain width of wheat seeds are inspected by using a ten thousand-depth SC-G tester, 6 repeats are taken from each sample, and the weight of each repeated seed is about 25G.

By investigating the grain shape of field-grown transgenic wheat, the results are shown in fig. 7A, 7B, where the grain width is significantly different, and both grain length and thousand grain weight are significantly increased compared to wild type.

(3)TaABI3Determination of starch content in mature seed of gene knockout strain

2 parts of flour which is 0.1000 and g and passes through a 65-mesh sieve is weighed and put into a test tube (20X 125 mm), and the test tube is flicked to enable the flour to fall to the bottom of the test tube; 200. Mu.L of 80% alcohol was added and vortexed to disperse the whole; adding 2mL precooling 1.7M NaOH solution, swirling 15. 15 s, placing the test tube on a magnetic stirrer, swirling for 15 min, and swirling for 2-3 times at intervals to ensure no massive precipitation; 8 mL of solution A (NaAc solution (0.6M, pH 3.8), 5mM CaCl2) was added, and vortexed to a pH of about 5.0; to one of the tubes (T1) 100. Mu.L of undiluted. Alpha. -amylase (reagent bottle 1) was immediately added, followed by 100 mL of AMG solution (reagent bottle 2); to another tube (T2) was added 200. Mu. L B (NaAc solution (0.1M, pH 5.0)); water bath at 50 ℃ for 30 min; taking out, cooling to room temperature, mixing, and centrifuging at 13000 rpm for 5 min; sucking 1 mL supernatant, placing into a new test tube, adding 4 mL of B solution, and mixing; 100. Mu.L of the sample was aspirated and placed in a fresh tube, 100. Mu.L of 1 mg/mL glucose and 100. Mu. L B of each were placed in the fresh tube, 3 mL GOPOD (reagent bottle 3) was added, and the values were read at a wavelength of 510 nm using a continuous spectrum microplate reader in a water bath at 50℃for 20 minutes. And (3) calculating: starch content= (sample absorbance-blank absorbance) ×9.36/glucose absorbance.

The calculation is shown in fig. 7C, the total starch content of the kernels in the wild type plants is 70.77%,Taabi3the total starch content of the seeds in the gene knockout strain is 75.78% and 87.06 respectively, and is improved by 7% and 23% respectively compared with the wild type strain. We therefore have derivedTaABI3Negatively regulating starch biosynthesis during wheat grain development.

The above-mentioned embodiments are merely preferred embodiments of the present invention, which are not intended to limit the scope of the present invention, and other embodiments can be easily made by those skilled in the art through substitution or modification according to the technical disclosure in the present specification, so that all changes and modifications made in the principle of the present invention shall be included in the scope of the present invention.

Claims (9)

1. A transcription factor TaABI3 for inhibiting wheat starch synthesis, which is encoded by the transcription factorTaABI3Three copies of the gene:TaABI3-A1、TaABI3-B1andTaABI3-D1the nucleotide sequences of the polypeptide are respectively shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.

2. Use of the transcription factor TaABI3 of claim 1 for starch synthesis.

3. Use according to claim 2, characterized in that the reduction in wheat is achieved by reducing the amount of protein in wheatTaABI3And expressing the gene to obtain the transgenic plant with increased starch content in wheat grains.

4. The use according to claim 3, wherein saidTaABI3Knockout of the gene in wheat and screeningTaABI3Transgenic positive plants with knocked-out genes.

5. The use according to claim 4, wherein the transcription factor encoding geneTaABI3Designing A, B and D subgenomic conserved sgRNA, connecting to a gene editing vector pBUE411, and transforming common wheat; identifying and screening transgenic plants by utilizing A, B and D subgenomic specific primers to obtain positive plants, wherein the method comprises the following steps ofTaABI3-A1The forward identification primer sequence of the gene is shown as SEQ ID NO.4, and the reverse identification primer sequence is shown as SEQ ID NO. 5;TaABI3-B1the forward identification primer sequence of the gene is shown as SEQ ID NO.6, and the reverse primer identification sequence is shown as SEQ ID NO. 7;TaABI3-D1the forward identification primer sequence of the gene is shown as SEQ ID NO.8, and the reverse identification primer sequence is shown as SEQ ID NO. 9.

6. The use according to claim 5, wherein the amplification isTaABI3Universal primer pair with sequence, and forward primer with sequence shown as SEQ ID N0.10The sequence of the reverse primer is shown as SEQ ID NO. 11.

7. A plant breeding method for increasing starch synthesis, the method comprising:

constructionTaABI3A gene knockout vector; (2) Will be constructedTaABI3The gene knockout vector is transformed into plant tissues or plant cells; (3) ScreeningTaABI3A knockout strain; compared with wild type, theTaABI3Starch content of the gene knockout strain is improved; wherein the saidTaABI3The nucleotide sequence of the gene is shown in any one of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.

8. A method of plant breeding for reducing starch synthesis, the method comprising:

(1) Construction of a kit comprising the composition of claim 1TaABI3An over-expression vector for the gene; (2) Transforming the constructed overexpression vector into plant tissues or plant cells; (3) screening for over-expressed strains; the over-expressed strain has a reduced starch content compared to the wild type; wherein the saidTaABI3The nucleotide sequence of the gene is shown in any one of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.

9. A method of breeding according to claim 7 or 8, wherein the plant is wheat.