CN117858881A - Phospholipid compounds and methods of making and using the same - Google Patents

Phospholipid compounds and methods of making and using the same Download PDF

Info

Publication number
CN117858881A
CN117858881A CN202280056233.6A CN202280056233A CN117858881A CN 117858881 A CN117858881 A CN 117858881A CN 202280056233 A CN202280056233 A CN 202280056233A CN 117858881 A CN117858881 A CN 117858881A
Authority
CN
China
Prior art keywords
compound
pharmaceutically acceptable
acceptable salt
compound according
formula
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202280056233.6A
Other languages
Chinese (zh)
Inventor
B-K·全
M·O·克拉克
D·恩桑
R·V·卡拉
R·L·麦克曼
J·N·曼达
D·纳杜坦比
D·S·西格尔
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gilead Sciences Inc
Original Assignee
Gilead Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gilead Sciences Inc filed Critical Gilead Sciences Inc
Priority claimed from PCT/US2022/075036 external-priority patent/WO2023023527A1/en
Publication of CN117858881A publication Critical patent/CN117858881A/en
Pending legal-status Critical Current

Links

Abstract

Phospholipid compounds and methods of using the same, alone or in combination with additional agents, and pharmaceutical formulations of the compounds for treating viral infections are disclosed.

Description

Phospholipid compounds and methods of making and using the same
Cross Reference to Related Applications
The present application claims priority from U.S. provisional application number 63/234,515 filed 8/18/2021 and U.S. provisional application number 63/313,633 filed 2/24/2022, both of which are incorporated herein by reference in their entirety for all purposes.
Sequence listing
The present application contains a sequence listing that is electronically filed and hereby incorporated by reference in its entirety.
Background
There is a need for compounds, pharmaceutical formulations and methods for treating viral infections such as Paramyxoviridae, pneumoviridae, picornaviridae, flaviviridae, filoviridae and orthomyxoviridae infections. Embodiments of the present disclosure may address these and other needs.
Disclosure of Invention
Disclosed herein are compounds of formula I:
or a pharmaceutically acceptable salt thereof, wherein:
R 1 is C 3 -C 10 Cycloalkyl, C 6 -C 10 Aryl or 5-10 membered containing one, two or three NHeteroaryl; wherein R is 1 Optionally one, two or three are independently selected from R 1A and-NR 13A R 14A Is substituted by a group of (2);
wherein each R is 1A Independently is halogen, cyano, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy or a 5-10 membered heteroaryl group containing one, two or three heteroatoms selected from N and O;
wherein each R is 13A Independently H or C 1 -C 3 An alkyl group; and is also provided with
Wherein each R is 14A Independently H or C 1 -C 3 An alkyl group;
R 2 is H or C 1 -C 3 An alkyl group;
R 3 is C 1 -C 3 An alkyl group;
each R 4 Independently is a bond, H, halogen, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl or C 3 -C 6 A cycloalkyl group,
each R 5 Independently of which is a bond or H,
wherein two or more adjacent (CR) 4 R 5 ) The groups are optionally linked by double bonds;
R 6 is H or-C (O) C 1 -C 6 An alkyl group;
R 7 is H or-C (O) C 1 -C 6 An alkyl group;
m is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21;
l is-O- (CR) 12A R 12B ) n -、-O-(CR 12A R 12B ) n -、-(CR 12A R 12B ) n -O-, or
-(CR 12A R 12B ) n -O-(CR 12A R 12B ) n -；
Wherein the method comprises the steps of
Each R 12A Independently isH or C 1 -C 6 An alkyl group;
each R 12B Independently H or C 1 -C 6 An alkyl group; and is also provided with
n is 1 or 2;
q is a bond or phenylene;
t is a bond or-O-;
x is a bond or C 1 -C 3 An alkylene group; and is also provided with
Z is-O-, -O- (C) 1 -C 6 ) Alkylene or NR 15 -(C 1 -C 6 ) -an alkylene group;
wherein R is 15 Is H or C 1 -C 3 An alkyl group.
Also disclosed herein are compounds of formula I, e.g., formulas Ia, ib, II, III, IV, V, VI, VII, VIII, IX, X, XI, XIa, XIb, XII, XIIa, XIIb, XIII, XIIIa and XIIIb.
Disclosed herein are pharmaceutical formulations comprising a pharmaceutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient.
Also disclosed herein are methods of treating or preventing a viral infection in a subject in need thereof, wherein the method comprises administering to the subject a compound disclosed herein or a pharmaceutically acceptable salt thereof.
The present disclosure also provides a method of treating or preventing a viral infection in a human in need thereof, wherein the method comprises administering to the human a compound of the present disclosure or a pharmaceutically acceptable salt thereof.
The present disclosure provides methods of making a medicament for treating or preventing a viral infection in a subject in need thereof, characterized by using a compound disclosed herein or a pharmaceutically acceptable salt thereof.
The present disclosure provides methods of making a medicament for treating or preventing a viral infection in a human in need thereof, characterized by using a compound disclosed herein or a pharmaceutically acceptable salt thereof.
The present disclosure provides the use of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for treating or preventing a viral infection in a human in need thereof.
Detailed Description
I. Summary of the invention
The present disclosure relates generally to methods and compounds for treating or preventing viral infections, such as paramyxoviridae, pneumoviridae, picornaviridae, flaviviridae, filoviridae, and orthomyxoviridae infections. The following description sets forth exemplary methods, parameters, and the like. However, it should be recognized that such description is not intended as a limitation on the scope of the present disclosure, but is instead provided as a description of exemplary embodiments.
II. Definition of
As used in this specification, the following words, phrases and symbols are generally intended to have the meanings described below, unless the context in which they are used indicates otherwise.
A dash ("-") that is not between two letters or symbols is used to indicate a point of attachment for a substituent. For example, -CONH 2 Through a carbon atom. Dashes at the front or end of the chemical group are for convenience; chemical groups can be depicted without one or more dashes without losing their ordinary meaning. Wavy lines drawn through lines in the structure indicate attachment points of the groups. No directionality is indicated or implied by the order in which chemical groups are written or named unless chemical or structural requirements.
For example, a corrugated line on a chemical group as shown below,indicating the attachment point, i.e. it shows a broken bond through which the group is connected to another described group.
As used herein, a "compound of the present disclosure" may refer to a compound of any one of formulas I-XIIIb or a pharmaceutically acceptable salt thereof. Similarly, the phrase "compound of formula (la)," means a compound of formula (la), and pharmaceutically acceptable salts thereof.
Prefix "C u- C v "meansThe following groups are shown having u to v carbon atoms. For example, "C 1-8 Alkyl "indicates that the alkyl group has 1 to 8 carbon atoms.
"alkyl" refers to an unbranched or branched saturated hydrocarbon chain. For example, the alkyl group may have 1 to 20 carbon atoms (i.e., C 1 -C 20 Alkyl), 1 to 8 carbon atoms (i.e., C 1 -C 8 Alkyl), 1 to 6 carbon atoms (i.e., C 1 -C 6 Alkyl) or 1 to 3 carbon atoms (i.e., C 1 -C 3 Alkyl). Examples of suitable alkyl groups include, but are not limited to, methyl (Me, -CH 3 ) Ethyl (Et, -CH) 2 CH 3 ) 1-propyl (n-Pr, n-propyl, -CH) 2 CH 2 CH 3 ) 2-propyl (i-Pr, isopropyl, -CH (CH) 3 ) 2 ) 1-butyl (n-Bu, n-butyl, -CH) 2 CH 2 CH 2 CH 3 ) 2-methyl-1-propyl (i-Bu, isobutyl, -CH) 2 CH(CH 3 ) 2 ) 2-butyl (s-Bu, sec-butyl, -CH (CH) 3 )CH 2 CH 3 ) 2-methyl-2-propyl (t-Bu, t-butyl, -C (CH) 3 ) 3 ) 1-pentyl (n-pentyl, -CH) 2 CH 2 CH 2 CH 2 CH 3 ) 2-pentyl (-CH (CH) 3 )CH 2 CH 2 CH 3 ) 3-pentyl (-CH (CH) 2 CH 3 ) 2 ) 2-methyl-2-butyl (-C (CH) 3 ) 2 CH 2 CH 3 ) 3-methyl-2-butyl (-CH (CH) 3 )CH(CH 3 ) 2 ) 3-methyl-1-butyl (-CH) 2 CH 2 CH(CH 3 ) 2 ) 2-methyl-1-butyl (-CH) 2 CH(CH 3 )CH 2 CH 3 ) 1-hexyl (-CH) 2 CH 2 CH 2 CH 2 CH 2 CH 3 ) 2-hexyl (-CH (CH) 3 )CH 2 CH 2 CH 2 CH 3 ) 3-hexyl (-CH (CH) 2 CH 3 )(CH 2 CH 2 CH 3 ) 2-methyl-2-pentyl (-C (CH) 3 ) 2 CH 2 CH 2 CH 3 ) 3-methyl-2-pentyl (-CH (CH) 3 )CH(CH 3 )CH 2 CH 3 ) 4-methyl-2-pentyl (-CH (CH) 3 )CH 2 CH(CH 3 ) 2 ) 3-methyl-3-pentyl (-C (CH) 3 )(CH 2 CH 3 ) 2 ) 2-methyl-3-pentyl (-CH (CH) 2 CH 3 )CH(CH 3 ) 2 ) 2, 3-dimethyl-2-butyl (-C (CH) 3 ) 2 CH(CH 3 ) 2 ) And 3, 3-dimethyl-2-butyl (-CH (CH) 3 )C(CH 3 ) 3 ). Other alkyl groups include, but are not limited to, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, pentadecyl, hexadecyl, heptadecyl, and octadecyl.
"alkylene" refers to unbranched and branched divalent saturated hydrocarbon chains. As used herein, alkylene groups have 1 to 20 carbon atoms (i.e., C 1-20 Alkylene), 1 to 12 carbon atoms (i.e., C 1-12 Alkylene), 1 to 8 carbon atoms (i.e., C 1-8 Alkylene), 1 to 6 carbon atoms (i.e., C 1-6 Alkylene), 1 to 4 carbon atoms (i.e., C 1-4 Alkylene), 1 to 3 carbon atoms (i.e., C 1-3 Alkylene) or 1 to 2 carbon atoms (i.e., C 1-2 An alkylene group). Examples of alkyl groups include, but are not limited to: methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, pentyl, 2-pentyl, isopentyl, neopentyl, hexyl, 2-hexyl, 3-hexyl and 3-methylpentyl. When an alkyl residue having a particular carbon number is named by chemical name or identified by molecular formula, all positional isomers having that carbon number are contemplated; thus, for example, a "butyl" includes n-butyl (i.e., - (CH) 2 ) 3 CH 3 ) Sec-butyl (i.e. -CH (CH) 3 )CH 2 CH 3 ) Isobutyl (i.e. -CH) 2 CH(CH 3 ) 2 ) And tert-butyl (i.e. -C (CH) 3 ) 3 ) The method comprises the steps of carrying out a first treatment on the surface of the And "propyl" includes n-propyl (i.e. (CH) 2 ) 2 CH 3 ) And isopropyl (i.e. -CH (CH) 3 ) 2 )。
"alkenyl" refers to a straight or branched hydrocarbon chain containing at least two carbon atoms and at least one carbon-carbon double bond. As used herein, alkenyl groups may have 2 to 20 carbon atomsSon (i.e. C 2-20 Alkenyl), 2 to 8 carbon atoms (i.e., C 2-8 Alkenyl), 2 to 6 carbon atoms (i.e., C 2-6 Alkenyl) or 2 to 4 carbon atoms (i.e., C 2-4 Alkenyl). Alkenyl groups may include any number of carbons, such as C 2 、C 3 、C 4 、C 5 、C 6 、C 7 、C 8 、C 9 、C 10 、C 11 、C 12 、C 13 、C 14 、C 15 、C 16 、C 17 、C 18 、C 19 、C 20 Or any range therein. Alkenyl groups may have any suitable number of double bonds including, but not limited to, 1, 2, 3, 4, 5, or more. Examples of alkenyl groups include, but are not limited to, vinyl (vinyl/ethyl), propenyl, isopropenyl, 1-butenyl, 2-butenyl, isobutenyl, butadienyl, 1-pentenyl, 2-pentenyl, isopentenyl, 1, 3-pentadienyl, 1, 4-pentadienyl, 1-hexenyl, 2-hexenyl, 3-hexenyl, 1, 3-hexadienyl, 1, 4-hexadienyl, 1, 5-hexadienyl, 2, 4-hexadienyl, or 1,3, 5-hexatrienyl. Alkenyl groups may be substituted or unsubstituted.
"alkoxy" means an alkyl group having the formula-O-, wherein the alkyl group as defined above is attached to the parent molecule via an oxygen atom. The alkyl portion of the alkoxy group may have 1 to 20 carbon atoms (i.e., C 1 -C 20 Alkoxy), 1 to 12 carbon atoms (i.e., C 1 -C 12 Alkoxy), 1 to 8 carbon atoms (i.e., C 1 -C 8 Alkoxy), 1 to 6 carbon atoms (i.e., C 1 -C 6 Alkoxy) or 1 to 3 carbon atoms (i.e., C 1 -C 3 An alkoxy group). Examples of suitable alkoxy groups include, but are not limited to, methoxy (-O-CH) 3 or-OMe), ethoxy (-OCH) 2 CH 3 or-OEt), isopropoxy (-O-CH (CH) 3 ) 2 ) T-butoxy (-O-C (CH) 3 ) 3 or-OtBu), etc. Other examples of suitable alkoxy groups include, but are not limited to, sec-butoxy, tert-butoxy, pentoxy, hexoxy, and the like. The alkoxy group may be substituted or unsubstituted.
"haloAn alkyl "is an alkyl group as defined above wherein one or more hydrogen atoms of the alkyl group are replaced by halogen atoms. The alkyl portion of the haloalkyl group can have 1 to 20 carbon atoms (i.e., C 1 -C 20 Haloalkyl), 1 to 12 carbon atoms (i.e., C 1 -C 12 Haloalkyl), 1 to 8 carbon atoms (i.e., C 1 -C 8 Haloalkyl), 1 to 6 carbon atoms (i.e., C 1 -C 6 Alkyl) or 1 to 3 carbon atoms (i.e., C 1 -C 3 Alkyl). Examples of suitable haloalkyl groups include, but are not limited to, -CF 3 、-CHF 2 、-CFH 2 、-CH 2 CF 3 Fluoro chloromethyl, difluoro chloromethyl, 1-trifluoroethyl and pentafluoroethyl. .
As used herein, "halo" or "halogen" refers to fluorine (-F), chlorine (-Cl), bromine (-Br), and iodine (-I).
"haloalkoxy" is an alkoxy group as defined above wherein one or more hydrogen atoms of the alkoxy group are replaced with halogen atoms. The alkoxy portion of the haloalkoxy group may have 1 to 20 carbon atoms (i.e., C 1 -C 20 Haloalkoxy), 1 to 12 carbon atoms (i.e., C 1 -C 12 Haloalkoxy), 1 to 8 carbon atoms (i.e., C 1 -C 8 Haloalkoxy), 1 to 6 carbon atoms (i.e., C 1 -C 6 Alkoxy) or 1 to 3 carbon atoms (i.e., C 1 -C 3 An alkoxy group). Examples of suitable haloalkoxy groups include, but are not limited to, -OCF 3 、-OCHF 2 、-OCFH 2 、-OCH 2 CF 3 Etc.
"hydroxy" refers to-OH.
"aryl" means an aromatic hydrocarbon group derived by the removal of one hydrogen atom from a single carbon atom of the parent aromatic ring system. For example, an aryl group may have 6 to 20 carbon atoms, 6 to 14 carbon atoms, or 6 to 10 carbon atoms. Exemplary aryl groups include, but are not limited to, groups derived from benzene (e.g., phenyl), naphthalene, anthracene, biphenyl, and the like.
"cycloalkyl" refers to a saturated or partially saturated cyclic alkyl group having a single ring or multiple rings including fused, bridged and spiro ring systemsA group. As used herein, cycloalkyl groups have 3 to 20 ring carbon atoms (i.e., C 3-20 Cycloalkyl), 3 to 12 ring carbon atoms (i.e., C 3-12 Cycloalkyl), 3 to 10 ring carbon atoms (i.e., C 3-10 Cycloalkyl), 3 to 8 ring carbon atoms (i.e., C 3-8 Cycloalkyl) or 3 to 6 ring carbon atoms (i.e., C 3-6 Cycloalkyl). Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Cycloalkyl also includes partially unsaturated ring systems containing one or more double bonds, including fused ring systems having one aromatic ring and one non-aromatic ring, but not fully aromatic ring systems.
"heteroaryl" refers to an aromatic group, including groups having an aromatic tautomer or resonance structure, having a single, multiple, or multiple fused rings, which have at least one heteroatom in the ring, i.e., one or more ring heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein either nitrogen or sulfur may be oxidized. Thus, the term includes a ring having one or more of O, N, S, S (O), S (O) 2 And a ring of N-oxide groups. The term includes rings having one or more cyclic C (O) groups. As used herein, heteroaryl includes 5 to 20 ring atoms (i.e., 5 to 20 membered heteroaryl), 5 to 12 ring atoms (i.e., 5 to 12 membered heteroaryl), or 5 to 10 ring atoms (i.e., 5-10 membered heteroaryl) and 1 to 5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, as well as oxidized forms of the heteroatoms. Examples of heteroaryl groups include, but are not limited to, pyridin-2 (1H) -one, pyridazin-3 (2H) -one, pyrimidin-4 (3H) -one, quinolin-2 (1H) -one, pyrimidinyl, purinyl, pyridinyl, pyridazinyl, benzothiazolyl, and pyrazolyl. Heteroaryl does not encompass or overlap with aryl as defined above.
"heterocycle" or "heterocyclyl" refers to a saturated or unsaturated cyclic alkyl group in which one or more ring heteroatoms are independently selected from nitrogen, oxygen, and sulfur. The heterocyclyl may be a single ring or multiple rings, wherein the multiple rings may be fused, bridged or spiro. As used herein, a heterocyclyl has 3 to 20 ring atoms (i.e., 3 to 20 membered heterocyclyl), 3 to 12 ring atoms (i.e., 3 to 12 membered heterocyclyl), 3 to 10 ring atoms (i.e., 3 to 10 membered heterocyclyl), 3 to 8 ring atoms (i.e., 3 to 8 membered heterocyclyl), 4 to 12 ring carbon atoms (i.e., 4 to 12 membered heterocyclyl), 4 to 8 ring atoms (i.e., 4 to 8 membered heterocyclyl), or 4 to 6 ring atoms (i.e., 4 to 6 membered heterocyclyl). Examples of heterocyclyl groups include pyrrolidinyl, piperidinyl, piperazinyl, oxetanyl, dioxolanyl, azetidinyl, and morpholinyl.
The term "optionally substituted" with respect to a particular moiety (e.g., an optionally substituted aryl group) of a compound disclosed herein refers to moieties in which all substituents are hydrogen or in which one or more hydrogens of the moiety may be replaced with a listed substituent.
Pharmaceutically acceptable salts, hydrates, solvates, tautomeric forms, polymorphs, and prodrugs of the compounds described herein are also provided. By "pharmaceutically acceptable" or "physiologically acceptable" is meant compounds, salts, formulations, dosage forms, and other materials that are useful in preparing pharmaceutical formulations for suitable veterinary or human pharmaceutical use.
The compounds described herein may be prepared and/or formulated as pharmaceutically acceptable salts, or as the free base, as appropriate. Pharmaceutically acceptable salts are non-toxic salts of the free base form of the compound, which salts possess the desired pharmacological activity of the free base. These salts may be derived from inorganic acids, organic acids or bases. For example, a compound containing basic nitrogen may be prepared as a pharmaceutically acceptable salt by contacting the compound with an inorganic or organic acid. Non-limiting examples of pharmaceutically acceptable salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, iodide, acetate, propionate, decanoate, octanoate, acrylate, formate, isobutyrate, hexanoate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyne-1, 4-dioate, hexyne-1, 6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, sulfonate, methylsulfonate, propylsulfonate, benzenesulfonate, xylenesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, γ -hydroxybutyrate, glycolate, tartrate and mandelate. A list of other suitable pharmaceutically acceptable salts can be found in Remington, the Science and Practice of Pharmacy, 21 st edition, lippincott Wiliams and Wilkins, philiadelphia, pa., 2006.
Examples of "pharmaceutically acceptable salts" of the compounds disclosed herein also include those derived from suitable bases such as alkali metals (e.g., sodium, potassium), alkaline earth metals (e.g., magnesium), ammonium, and NX 4 + (wherein X is C 1 -C 4 Alkyl). Also included are base addition salts such as sodium or potassium salts.
Also provided are compounds described herein, or pharmaceutically acceptable salts, isomers, or mixtures thereof, wherein 1 to n hydrogen atoms attached to a carbon atom can be substituted with a deuterium atom or D, wherein n is the number of hydrogen atoms in the molecule. As known in the art, deuterium atoms are nonradioactive isotopes of hydrogen atoms. Such compounds may increase resistance to metabolism and thus may be useful in increasing the half-life of a compound described herein, or a pharmaceutically acceptable salt, isomer, or mixture thereof, when administered to a mammal. See, e.g., foster, "Deuterium Isotope Effects in Studies of Drug Metabolism", trends pharmacol.sci., volume 5, 12, pages 524-527, 1984. Such compounds are synthesized by methods well known in the art, for example by employing starting materials in which one or more hydrogen atoms have been replaced by deuterium. The compounds disclosed herein may be deuterated at various positions including (but not limited to) the following positions:
Examples of isotopes that can be incorporated into the disclosed compounds also include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, chlorine, and iodine, such as, respectively 2 H、 3 H、 11 C、 13 C、 14 C、 13 N、 15 N、 15 O、 17 O、 18 O、 31 P、 32 P、 35 S、 18 F、 36 Cl、 123 I and 125 I. using positron-emitting isotopes such as 11 C、 18 F、 15 O and 13 n substitution can be used in Positron Emission Tomography (PET) studies to examine occupancy of substrate receptors. Isotopically-labeled compounds of formulas I-XIIIb can generally be prepared by conventional techniques known to those skilled in the art or by methods analogous to those described in the examples set forth below using an appropriate isotopically-labeled reagent in place of the non-labeled reagent previously employed.
The compounds of the embodiments disclosed herein or their pharmaceutically acceptable salts may include one or more asymmetric centers and thus may produce enantiomers, diastereomers and other stereoisomeric forms which may be defined as (R) -or (S) -or (D) -or (L) -for amino acids, depending on the absolute stereochemistry. The present disclosure is intended to include all such possible isomers and their racemic and optically pure forms. Optically active (+) and (-), (R) -and (S) -or (D) -and (L) -isomers can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, such as chromatography and fractional crystallization. Conventional techniques for preparing/separating the individual enantiomers include chiral synthesis from suitable optically pure precursors or resolution of the racemate (or of a salt or derivative) using, for example, chiral High Pressure Liquid Chromatography (HPLC). When a compound described herein contains an olefinic double bond or other geometric asymmetric center, and unless specified otherwise, it is intended that the compound include both E and Z geometric isomers. Also, all tautomeric forms are intended to be included. Where a compound is represented in its chiral form, it is to be understood that this embodiment encompasses, but is not limited to, a particular diastereomeric or enantiomerically enriched form. When chirality is not specified but is present, it is understood that this embodiment relates to a particular diastereomeric or enantiomerically enriched form; or a racemic or non-racemic mixture of such compounds. As used herein, a "non-racemic mixture" is a mixture of stereoisomers in a ratio other than 1:1.
The term "preventing" means any treatment of any disease or disorder that results in the clinical symptoms of the disease or disorder not developing. The term "preventing" also encompasses the administration of a compound or composition according to embodiments disclosed herein after a subject is exposed to a virus but before the occurrence of a disease symptom and/or before the detection of a virus in the blood, to prevent the occurrence of a disease symptom and/or to prevent the virus from reaching a detectable level in the blood, and to prevent perinatal transmission of a viral infection from the mother to the infant by administration of a compound or composition according to embodiments disclosed herein to the mother prior to delivery and within the first few days of life to the child.
"racemate" refers to a mixture of enantiomers. The mixture may contain equal or unequal amounts of each enantiomer.
One or more "stereoisomers" refers to compounds having one or more stereocenters with different chirality. Stereoisomers include enantiomers and diastereomers. If a compound has one or more asymmetric centers or has an asymmetrically substituted double bond, the compound may exist in stereoisomeric forms and thus may be prepared as individual stereoisomers or as a mixture. Unless otherwise indicated, the present specification is intended to include individual stereoisomers as well as mixtures. Methods for determining stereochemistry and isolating stereoisomers are well known in the art (see, e.g., chapter 4 of Advanced Organic Chemistry, 4 th edition, j. March, john Wiley and Sons, new York, 1992).
By "subject" or "patient" is meant a human or vertebrate animal, including dogs, cats, bagged pets, marmosets, horses, cattle, pigs, sheep, goats, elephants, giraffes, chickens, lions, monkeys, owls, rats, squirrels, barrens, and lazy monkeys. "bagged pet" refers to a group of vertebrates capable of being packed into a stool pocket, such as hamsters, chestnut (chinchillas), ferrets, rats, guinea pigs, gerbils, rabbits, and honey-bagged shrubs (sugar gliders).
"tautomer" refers to alternative forms of compounds having different proton positions, such as enol-ketone and imine-enamine tautomers, or tautomeric forms of heteroaryl groups containing ring atoms attached to both ring-NH-and ring = N-, such as pyrazole, imidazole, benzimidazole, triazole, and tetrazole.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Dashes at the front or end of the chemical group are for convenience; chemical groups can be depicted without one or more dashes without losing their ordinary meaning. Wavy lines drawn through lines in the structure indicate attachment points of the groups. The dashed lines represent optional bonds. Unless chemically or structurally required, the order of writing of chemical groups or their point of attachment to the rest of the molecule does not indicate or imply directionality. For example, a group "-SO 2 CH 2 - "is equivalent to" -CH 2 SO 2 - ", and both may be connected in either direction. Similarly, an "arylalkyl" group may be attached to the remainder of the molecule, for example, at the aryl or alkyl portion of the group. Prefix such as "C u-v Or (C) u -C v ) The latter groups are represented as having u to v carbon atoms. For example, "C 1-6 Alkyl "and" C 1 -C 6 Alkyl "each means that the alkyl group has 1 to 6 carbon atoms. Likewise, the term "x-y membered" ring (where x and y are a range of values, such as "3-to 12-membered heterocyclyl") refers to a ring containing x-y atoms (e.g., 3-12), of which up to 80% may be heteroatoms, such as N, O, S, and the remaining atoms are carbon.
Unless otherwise indicated, the carbon atoms of the compounds of formulae I to XIIIb are intended to have tetravalent values. If in some chemical structural representations the carbon atoms are not attached to a sufficient number of variables to produce tetravalent, then the remaining carbon substituents required to provide tetravalent should be assumed to be hydrogen.
The term "treating" as used herein is intended to mean administration of a compound or composition according to embodiments disclosed herein to reduce or eliminate symptoms of a viral infection and/or reduce viral load in a subject.
As used herein, the term "therapeutically effective amount" is the amount of a compound disclosed herein that is present in a formulation described herein that is required to provide a desired level of drug in secretions and tissues of the airways and lungs, or alternatively, to produce a desired physiological response or a desired biological effect in the blood stream of a subject to be treated upon administration of such a formulation by a selected route of administration. The exact amount will depend on many factors, such as the particular compound disclosed herein, the specific activity of the formulation, the delivery device employed, the physical characteristics of the formulation and its intended use, as well as subject considerations such as the severity of the disease, subject coordination, etc., and can be readily determined by one of skill in the art based on the information provided herein. The term "therapeutically effective amount" or "effective amount" also refers to an amount that eliminates or reduces viral load and/or viral pool in a subject.
The term "adjacent carbon" as used herein refers to consecutive carbon atoms that are directly connected to each other. For example, inIn C 1 And C 2 Is adjacent carbon, C 2 And C 3 Is adjacent carbon, C 3 And C 4 Is adjacent carbon, and C 4 And C 5 Is adjacent carbon. Similarly, in->In C 1 And C 2 Is adjacent carbon, C 2 And C 3 Is adjacent carbon, C 3 And C 4 Is adjacent carbon, and C 4 And C 5 Is adjacent carbon, C 5 And C 6 Is adjacent carbon, and C 6 And C 1 Is adjacent carbon.
As used herein, "solvate" refers to the result of the interaction of a solvent and a compound. Solvates of salts of the compounds described herein are also provided. Hydrates of the compounds described herein are also provided.
As used herein, a "prodrug" is a derivative of a drug that is converted to the parent drug upon administration to the human body according to some chemical or enzymatic pathway.
As used herein, "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" includes, but is not limited to, any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and combinations thereof. Pharmaceutically acceptable carriers and pharmaceutically acceptable excipients for pharmaceutically active substances are well known in the art. Except insofar as any conventional medium or agent is incompatible with the active ingredient, its use in therapeutic formulations is contemplated. Supplementary active ingredients may also be incorporated into the formulation. The carrier must be "acceptable", i.e., compatible with the other ingredients of the formulation and physiologically harmless to its recipient.
III. Compounds
Provided herein are compounds of formula I:
or a pharmaceutically acceptable salt thereof, wherein:
R 1 is C 3 -C 10 Cycloalkyl, C 6 -C 10 Aryl or a 5-10 membered heteroaryl containing one, two or three N; wherein R is 1 Optionally one, two or three are independently selected from R 1A and-NR 13A R 14A Is substituted by a group of (2);
wherein each R is 1A Independently is halogen, cyano, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy or a 5-10 membered heteroaryl group containing one, two or three heteroatoms selected from N and O;
wherein each R is 13A Independently H or C 1 -C 3 An alkyl group; and is also provided with
Wherein each R is 14A Independent and independentWith the ground being H or C 1 -C 3 An alkyl group;
R 2 is H or C 1 -C 3 An alkyl group;
R 3 is C 1 -C 3 An alkyl group;
each R 4 Independently is a bond, H, halogen, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl or C 3 -C 6 A cycloalkyl group,
each R 5 Independently of which is a bond or H,
wherein two or more adjacent (CR) 4 R 5 ) The groups are optionally linked by double bonds;
R 6 is H or-C (O) C 1 -C 6 An alkyl group;
R 7 is H or-C (O) C 1 -C 6 An alkyl group;
m is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21;
l is-O- (CR) 12A R 12B ) n -、-O(CR 12A R 12B ) n -、-(CR 12A R 12B ) n -O-, or- (CR) 12A R 12B ) n -O-(CR 12A R 12B ) n -；
Wherein the method comprises the steps of
Each R 12A Independently H or C 1 -C 6 An alkyl group;
each R 12B Independently H or C 1 -C 6 An alkyl group; and is also provided with
n is 1 or 2;
q is a bond or phenylene;
t is a bond or-O-;
X is a bond or C 1 -C 3 An alkylene group; and is also provided with
Z is-O-, -O- (C) 1 -C 6 ) Alkylene or NR 15 -(C 1 -C 6 ) -an alkylene group;
wherein R is 15 Is H or C 1 -C 3 An alkyl group.
In some embodimentsIn the scheme, when R 1 Is C 6 -C 10 Aryl, R 2 Is H, R 3 Is methyl, each R 4 Is H, each R 5 Is H, L is-O-or-O (CR) 12A R 12B ) n X is-CH 2 -, T is-O-, and Q is a bond, then R 1 Is one to three R 1A And (3) group substitution. In some embodiments, the compounds disclosed herein and pharmaceutically acceptable salts thereof exclude the following compounds and pharmaceutically acceptable salts thereof:
R 1 may be C 3 -C 10 Cycloalkyl, C 6 -C 10 Aryl or a 5-10 membered heteroaryl containing one or two N. R is R 1 Optionally one, two or three are independently selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, R 1 Is unsubstituted. In some embodiments, R 1 Is one selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, R 1 Is covered by one R 1A And (3) group substitution. In some embodiments, R 1 Is covered by a-NR 13A R 14A And (3) group substitution. In some embodiments, R 1 Is independently selected from R 1A and-NR 13A R 14A Two groups are substituted. In some embodiments, R 1 Is independently selected from R 1A Is substituted by two groups of (a). In some embodiments, R 1 Is independently selected from-NR 13A R 14A Two groups are substituted. In some embodiments, R 1 Is independently selected from R 1A and-NR 13A R 14A Three groups are substituted. In some embodiments, R 1 Is independently selected from R 1A Is substituted by three groups. In some embodiments, R 1 Is independently selected from-NR 13A R 14A Three groups are substituted. In some embodiments, R 1 Is covered by one R 1A And one-NR 13A R 14A Substitution. In some embodiments, R 1 Is covered by one R 1A And two-NR 13A R 14A Substitution. In some embodiments, R 1 Is covered by two R 1A And one-NR 13A R 14A Substitution. In some embodiments, R 1 Is one, two or three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, R 1 Is one, two or three R 1A And (3) substitution. Wherein each R is 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 (e.g., 5, 6, 7, 8, 9, or 10) membered heteroaryl containing one, two, or three heteroatoms selected from N and O. In some embodiments, R 1 Is one, two or three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-6 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, R 1 Is one, two or three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, R 1 By one R selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl 1A And (3) substitution. In some embodiments, R 1 Is covered by two R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, R 1 Is covered by three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl andoxadiazolyl. In some embodiments, R 1 Cycloalkyl, aryl or heteroaryl of (a) is substituted with two R's selected from halogen and cyano 1A And (3) substitution. In some embodiments, R 1 Cycloalkyl, aryl or heteroaryl of (a) is substituted with two R's selected from chloro and cyano 1A And (3) substitution. In some embodiments, R 1 Is substituted by two R's selected from fluorine and cyano 1A And (3) substitution.
In some embodiments, R 1 Is C 3 -C 10 (e.g., C 3 -C 4 、C 3 -C 5 、C3-C 6 、C 3 -C 7 、C 3 -C 8 、C 3 -C 9 、C 4 -C 5 、C 4 -C 6 、C 4 -C 7 、C 4 -C 8 、C 4 -C 9 、C 4 -C 10 、C 5 -C 6 、C 5 -C 7 、C 5 -C 8 、C 5 -C 9 、C 5 -C 10 、C 6 -C 7 、C 6 -C 8 、C 6 -C 9 、C 6 -C 10 、C 7 -C 8 、C 7 -C 9 、C 7 -C 10 、C 8 -C 9 、C 8 -C 10 Or C 9 -C 10 ) Cycloalkyl groups. In some embodiments, R 1 Is C 3 Cycloalkyl, C 4 Cycloalkyl, C 5 Cycloalkyl, C 6 Cycloalkyl, C 7 Cycloalkyl, C 8 Cycloalkyl, C 9 Cycloalkyl or C 10 Cycloalkyl groups. In some embodiments, C 3-10 Cycloalkyl groups are saturated. In some embodiments, C 3-10 Cycloalkyl groups are partially saturated. In some embodiments, C 3 -C 10 Cycloalkyl has a single ring (i.e., cycloalkyl is a monocyclic cycloalkyl). In some embodiments, C 3 -C 10 Cycloalkyl groups have multiple rings (e.g., two rings, three rings, four rings, five rings, or six rings). In some embodiments, C 3 -C 10 Cycloalkyl groups have multipleIndividual rings, including fused rings, bridged rings, spiro rings, or combinations of ring systems thereof. In some embodiments, C 3 -C 10 Cycloalkyl groups have two fused rings. In some embodiments, C 3 -C 10 Cycloalkyl includes partially unsaturated ring systems containing one or more (e.g., one, two, three, or four) double bonds. In some embodiments, C 3 -C 10 Cycloalkyl includes fused ring systems having one aromatic ring and one non-aromatic ring, C 3 -C 10 Cycloalkyl does not include a full aromatic ring system. In some embodiments, R 1 Is cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl or cyclooctyl.
C 3 -C 10 Cycloalkyl groups are optionally substituted with one, two or three groups independently selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, C 3 -C 10 Cycloalkyl groups are unsubstituted. In some embodiments, C 3 -C 10 Cycloalkyl is substituted with one member selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, C 3 -C 10 Cycloalkyl is substituted with one R 1A And (3) substitution. In some embodiments, C 3 -C 10 Cycloalkyl is substituted by one-NR 13A R 14A And (3) substitution. In some embodiments, C 3 -C 10 Cycloalkyl groups are independently selected from R 1A and-NR 13A R 14A Two groups are substituted. In some embodiments, C 3 -C 10 Cycloalkyl groups are independently selected from R 1A Substitution of groups. In some embodiments, C 3 -C 10 Cycloalkyl groups are independently selected from the group consisting of-NR 13A R 14A Substitution of groups. In some embodiments, C 3 -C 10 Cycloalkyl groups are independently selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, C 3 -C 10 Cycloalkyl groups are independently selected from R 1A Substitution of groups. In some embodiments, C 3 -C 10 Cycloalkyl groups are independently selected from the group consisting of-NR 13A R 14A Is substituted with a group of (a). In some embodiments, C 3 -C 10 Cycloalkyl is unsubstituted cyclopropyl, unsubstituted cyclobutyl, unsubstituted cyclopentyl, unsubstituted cyclohexyl, unsubstituted cycloheptyl or unsubstituted cyclooctyl. In some embodiments, C 3 -C 10 Cycloalkyl groups are independently selected from one, two or three of R 1A and-NR 13A R 14A Cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl or cyclooctyl substituted by a group of (a). In some embodiments, C 3 -C 10 Cycloalkyl groups are independently selected from one, two or three of R 1A Cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl or cyclooctyl substituted by a group of (a).
In some embodiments, R 1 Is one, two or three R 1A Substituted C 3 -C 10 (e.g., C 3 、C 4 、C 5 、C 6 、C 7 、C 8 、C 9 、C 10 ) Cycloalkyl, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, R 1 Is one, two or three R 1A Substituted C 3 -C 10 (e.g., C 3 、C 4 、C 5 、C 6 、C 7 、C 8 、C 9 、C 10 ) Cycloalkyl, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 (e.g., 5, 6, 7, 8, 9, or 10) membered heteroaryl containing one, two, or three heteroatoms selected from N and O. In some embodiments, R 1 Is one, two or three R 1A Substituted C 3 -C 10 (e.g., C 3 、C 4 、C 5 、C 6 、C 7 、C 8 、C 9 、C 10 ) Cycloalkyl, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-6 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, R 1 Is one, two or three R 1A Substituted C 3 -C 10 (e.g., C 3 、C 4 、C 5 、C 6 、C 7 、C 8 、C 9 、C 10 ) Cycloalkyl, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, R 1 Is substituted with one R selected from halogen, cyano, methoxy, isopropoxy, triazolyl and diazolyl 1A Substituted C 3 -C 10 (e.g. C 3 、C 4 、C 5 、C 6 、C 7 、C 8 、C 9 、C 10 ) Cycloalkyl groups. In some embodiments, R 1 Is formed by two R 1A Substituted C 3 -C 10 (e.g. C 3 、C 4 、C 5 、C 6 、C 7 、C 8 、C 9 、C 10 ) Cycloalkyl, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, R 1 Is covered by three R 1A Substituted C 3 -C 10 (e.g. C 3 、C 4 、C 5 、C 6 、C 7 、C 8 、C 9 、C 10 ) Cycloalkyl, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl.
In some embodiments, R 1 Is C 6 -C 10 Aryl groups. In some embodiments, R 1 Is C 6 Aryl (e.g. phenyl) or C 10 Aryl (e.g., naphthyl). In some embodiments, R 1 Is phenyl. In some embodiments, C 6-10 Aryl is phenyl. At the position of In some embodiments, C 6-10 Aryl is naphthyl.
R 1 C of (2) 6 -C 10 Aryl is optionally substituted with one, two or three groups independently selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, C 6 -C 10 Aryl is unsubstituted. In some embodiments, C 6 -C 10 Aryl is selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, C 6 -C 10 Aryl is substituted with one R 1A Substitution. In some embodiments, C 6 -C 10 Aryl is substituted by one-NR 13A R 14A And (3) substitution. In some embodiments, C 6 -C 10 Aryl groups are independently selected from R 1A and-NR 13A R 14A Two groups are substituted. In some embodiments, C 6 -C 10 Aryl groups are independently selected from R 1A Two groups are substituted. In some embodiments, C 6 -C 10 Aryl groups are independently selected from-NR 13A R 14A Two groups are substituted. In some embodiments, C 6 -C 10 Aryl groups are independently selected from R 1A and-NR 13A R 14A Three groups are substituted. In some embodiments, C 6 -C 10 Aryl groups are independently selected from R 1A Three groups are substituted. In some embodiments, C 6 -C 10 Aryl groups are independently selected from-NR 13A R 14A Three groups are substituted. In some embodiments, R 1 Is unsubstituted C 6 Aryl (e.g. phenyl) or unsubstituted C 10 Aryl (e.g., naphthyl). In some embodiments, R 1 Is selected from one, two or three independently from R 1A and-NR 13A R 14A Radical-substituted C 6 Aryl (e.g. phenyl) or C 10 Aryl (e.g., naphthyl). In some embodiments, C 6 -C 10 Aryl is unsubstituted phenyl. In some embodiments, C 6 -C 10 Aryl radicals being independently substituted by one or twoSelected from R 1A and-NR 13A R 14A Phenyl substituted by a group of (a). In some embodiments, C 6 -C 10 Aryl groups being independently selected from one or two of R 1A Phenyl substituted by a group of (a). In some embodiments, C 6 -C 10 Aryl is substituted with one R 1A And one-NR 13A R 14A Substituted phenyl. In some embodiments, C 6 -C 10 Aryl is substituted with one R 1A And two-NR 13A R 14A Substituted phenyl. In some embodiments, C 6 -C 10 Aryl is substituted by two R 1A And one-NR 13A R 14A Substituted phenyl.
In some embodiments, R 1 Is one, two or three R 1A Substituted C 6 -C 10 Aryl, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, R 1 Is one, two or three R 1A Substituted C 6 -C 10 Aryl, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, R 1 Is one, two or three R 1A Substituted C 6 -C 10 Aryl, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-6 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, R 1 Is one, two or three R 1A Substituted C 6 -C 10 Aryl, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxaDiazolyl. In some embodiments, R 1 Is substituted with one R selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl 1A Substituted C 6 -C 10 Aryl groups. In some embodiments, R 1 Is formed by two R 1A Substituted C 6 -C 10 Aryl, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, R 1 C 6 -C 10 Aryl is surrounded by three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl.
In some embodiments, R 1 Is a 5-10 membered heteroaryl group containing one or two N. In some embodiments, the 5-10 membered heteroaryl contains one N. In some embodiments, the 5-10 membered heteroaryl contains two N. In some embodiments, the 5-10 membered heteroaryl has one ring (i.e., the 5-10 membered heteroaryl is a monocyclic heteroaryl). In some embodiments, the 5-10 membered heteroaryl has more than one ring (e.g., two rings, three rings, or four rings). In some embodiments, the 5-10 membered heteroaryl comprises two fused rings. In some embodiments, the 5-10 membered heteroaryl is pyridinyl. In some embodiments, the 5-10 membered heteroaryl is pyrimidinyl.
R 1 May be a 5-10 membered heteroaryl group containing one or two N, optionally one, two or three independently selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, 5-10 membered heteroaryl groups containing one or two N are unsubstituted. In some embodiments, a 5-10 membered heteroaryl containing one or two N is substituted with one member selected from R 1A and-NR 13A R 14A Is substituted with a group of (a). In some embodiments, a 5-10 (e.g., 5, 6, 7, 8, 9, 10) membered heteroaryl containing one or two N groups is substituted with one R 1A Substitution. In some embodiments, a 5-10 membered heteroaryl containing one or two N is substituted with one-NR 13A R 14A And (3) substitution. In some embodiments, 5-10 membered containing one or two NHeteroaryl is independently selected from R 1A and-NR 13A R 14A Two groups are substituted. In some embodiments, 5-10 membered heteroaryl groups containing one or two N are independently selected from R 1A Two groups are substituted. In some embodiments, 5-10 membered heteroaryl groups containing one or two N are independently selected from the group consisting of-NR 13A R 14A Two groups are substituted. In some embodiments, 5-10 membered heteroaryl groups containing one or two N are independently selected from R 1A and-NR 13A R 14A Is substituted by three groups. In some embodiments, 5-10 membered heteroaryl groups containing one or two N are independently selected from R 1A Three groups are substituted. In some embodiments, 5-10 membered heteroaryl groups containing one or two N are independently selected from the group consisting of-NR 13A R 14A Three groups are substituted. In some embodiments, a 5-10 membered heteroaryl containing one or two N groups is independently selected from one or two R 1A Is substituted with a group of (a). In some embodiments, a 5-10 membered heteroaryl containing one or two N is substituted with one R 1A And one-NR 13A R 14A And (3) substitution. In some embodiments, a 5-10 membered heteroaryl containing one or two N is substituted with one R 1A And two-NR 13A R 14A And (3) substitution. In some embodiments, a 5-10 membered heteroaryl containing one or two N is substituted with two R 1A And one-NR 13A R 14A And (3) substitution.
In some embodiments, R 1 Is a 5-10 membered heteroaryl group containing one or two N groups, which are substituted with one, two or three R groups 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, R 1 Is a 5-10 membered heteroaryl group containing one or two N groups, which are substituted with one, two or three R groups 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 (e.g., 5, 6, 7, 8, 9, or 10) membered heteroaryl containing one, two, or three heteroatoms selected from N and O. In some embodiments, R 1 Is a 5-10 membered heteroaryl group containing one or two N groups, which are substituted with one, two or three R groups 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-6 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, R 1 Is a 5-10 membered heteroaryl group containing one or two N groups, which are substituted with one, two or three R groups 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, R 1 Is a 5-10 membered heteroaryl group containing one or two N groups, which is substituted with one R selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl 1A And (3) substitution. In some embodiments, R 1 Is a 5-10 membered heteroaryl containing one or two N groups, which are substituted with two R groups 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, R 1 Is a 5-10 membered heteroaryl containing one or two N groups, which are substituted with three R groups 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl.
R 1 May be a 5-10 membered heteroaryl group containing one N, optionally one, two or three independently selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, the 5-10 membered heteroaryl containing one N is unsubstituted. In some embodiments, a 5-10 membered heteroaryl containing one N is substituted with one member selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, a 5-10 membered heteroaryl containing one N is substituted with one R 1A And (3) substitution. In some embodiments, a 5-10 membered heteroaryl containing one N is substituted with one-NR 13A R 14A And (3) substitution. In some embodiments, a 5-10 membered heteroaryl containing one N is independently selected from R 1A and-NR 13A R 14A Two groups are substituted. In some embodiments, a 5-10 membered heteroaryl containing one N is independently selected from R 1A Two groups are substituted. In some embodiments, 5-10 membered heteroaryl groups containing one N are independently selected from the group consisting of-NR 13A R 14A Two groups are substituted. In some embodiments, a 5-10 membered heteroaryl containing one N is independently selected from R 1A and-NR 13A R 14A Three groups are substituted. In some embodiments, a 5-10 membered heteroaryl containing one N is independently selected from R 1A Three groups are substituted. In some embodiments, 5-10 membered heteroaryl groups containing one N are independently selected from the group consisting of-NR 13A R 14A Three groups are substituted.
R 1 May be a 5-10 membered heteroaryl group containing two N, optionally one, two or three independently selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, the 5-10 membered heteroaryl containing one N is unsubstituted. In some embodiments, a 5-10 membered heteroaryl containing two N groups is substituted with one group selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, a 5-10 membered heteroaryl containing two N groups is substituted with one R 1A And (3) substitution. In some embodiments, a 5-10 membered heteroaryl containing two N is substituted with one-NR 13A R 14A And (3) substitution. In some embodiments, a 5-10 membered heteroaryl containing two N is independently selected from R 1A and-NR 13A R 14A Two groups are substituted. In some embodiments, a 5-10 membered heteroaryl containing two N is independently selected from R 1A Two groups are substituted. In some embodiments, the 5-10 membered heteroaryl containing two N is independently selected from-NR 13A R 14A Two groups are substituted. In some embodiments, a 5-10 membered heteroaryl containing two N is independently selected from R 1A and-NR 13A R 14A Three groups are substituted. In some embodiments, two are includedN5-10 membered heteroaryl groups are independently selected from R 1A Three groups are substituted. In some embodiments, the 5-10 membered heteroaryl containing two N is independently selected from-NR 13A R 14A Three groups are substituted.
In some embodiments, the 5-10 membered heteroaryl is pyridinyl. Pyridyl is optionally substituted with one, two or three groups independently selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, the pyridinyl is unsubstituted. In some embodiments, the pyridyl is substituted with one or more substituents selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, the pyridyl is substituted with one R 1A And (3) substitution. In some embodiments, the pyridyl group is substituted with one-NR 13A R 14A And (3) substitution. In some embodiments, the pyridinyl groups are independently selected from R 1A and-NR 13A R 14A Two groups are substituted. In some embodiments, the pyridinyl groups are selected from R by two independently 1A Substitution of groups. In some embodiments, the pyridinyl groups are two independently selected from-NR 13A R 14A Substitution of groups. In some embodiments, the pyridinyl groups are independently selected from R 1A and-NR 13A R 14A Three groups are substituted. In some embodiments, the pyridinyl groups are selected from three independently R 1A Substitution of groups. In some embodiments, the pyridinyl groups are selected from the group consisting of-NR independently 13A R 14A Substitution of groups. In some embodiments, the pyridyl is substituted with one R 1A And one-NR 13A R 14A And (3) substitution. In some embodiments, the pyridyl is substituted with one R 1A And two-NR 13A R 14A Substitution. In some embodiments, the pyridinyl is substituted with two R 1A And one-NR 13A R 14A Substitution.
In some embodiments, R 1 Is one, two or three R 1A Substituted pyridinyl, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, the pyridinyl is substituted with one, two, or three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 (e.g., 5, 6, 7, 8, 9, or 10) membered heteroaryl containing one, two, or three heteroatoms selected from N and O. In some embodiments, the pyridinyl is substituted with one, two, or three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-6 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, the pyridinyl is substituted with one, two, or three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, the pyridyl is substituted with one R selected from halo, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl 1A And (3) substitution. In some embodiments, the pyridinyl is substituted with two R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, the pyridinyl is substituted with three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl.
In some embodiments, the 5-10 membered heteroaryl is pyridin-2-yl. Pyridin-2-yl is optionally substituted with one, two or three groups independently selected from R 1A and-NR 13A R 14A Is substituted with a group of (a). In some embodiments, pyridin-2-yl is unsubstituted. In some embodiments, pyridin-2-yl is substituted with one member selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, pyridin-2-yl is substituted with one R 1A And (3) group substitution. In some embodiments, pyridin-2-yl is substituted with one-NR 13A R 14A And (3) substitution. In some embodiments, pyridin-2-yl is independently selected from R 1A and-NR 13A R 14A Two groups are substituted. In some embodiments, pyridin-2-yl is independently selected from R 1A Two groups are substituted. In some embodiments, pyridin-2-yl is independently selected from-NR 13A R 14A Two groups are substituted. In some embodiments, pyridin-2-yl is independently selected from R 1A and-NR 13A R 14A Three groups are substituted. In some embodiments, pyridin-2-yl is independently selected from R 1A Three groups are substituted. In some embodiments, pyridin-2-yl is independently selected from-NR 13A R 14A Three groups are substituted. In some embodiments, pyridin-2-yl is substituted with one R 1A And one-NR 13A R 14A Substitution. In some embodiments, pyridin-2-yl is substituted with one R 1A And two-NR 13A R 14A Substitution. In some embodiments, pyridin-2-yl is substituted with two R 1A And one-NR 13A R 14A Substitution.
In some embodiments, R 1 Is one, two or three R 1A Substituted pyridin-2-yl, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, pyridin-2-yl is substituted with one, two or three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 (e.g., 5, 6, 7, 8, 9, or 10) membered heteroaryl containing one, two, or three heteroatoms selected from N and O. In some embodiments, pyridin-2-yl is substituted with one, two or three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and containOne, two or three hetero atoms selected from N and O. In some embodiments, pyridin-2-yl is substituted with one, two or three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, pyridin-2-yl is substituted with one R selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl 1A And (3) substitution. In some embodiments, pyridin-2-yl is substituted with two R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, pyridin-2-yl is substituted with three R 1A Substitution, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl.
In some embodiments, the 5-10 membered heteroaryl is pyridin-3-yl. Pyridin-3-yl is optionally substituted with one, two or three groups independently selected from R 1A and-NR 13A R 14A Is substituted with a group of (a). In some embodiments, pyridin-3-yl is unsubstituted. In some embodiments, pyridin-3-yl is substituted with one member selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, pyridin-3-yl is substituted with one R 1A And (3) substitution. In some embodiments, the pyridyl group is substituted with one-NR 13A R 14A And (3) substitution. In some embodiments, pyridin-3-yl is independently selected from R 1A and-NR 13A R 14A Two groups are substituted. In some embodiments, pyridin-3-yl is independently selected from R 1A Two groups are substituted. In some embodiments, pyridin-3-yl is independently selected from-NR 13A R 14A Two groups are substituted. In some embodiments, pyridin-3-yl is independently selected from R 1A and-NR 13A R 14A Three groups are substituted. In some embodiments, pyridin-3-yl is independently selected from R 1A Three groups are substituted. In some embodiments, pyridin-3-yl is independently selected from-NR 13A R 14A Three groups are substituted. In some embodimentsIn which the pyridin-3-yl group is substituted with one R 1A And one-NR 13A R 14A Substitution. In some embodiments, pyridin-3-yl is substituted with one R 1A And two-NR 13A R 14A Substitution. In some embodiments, pyridin-3-yl is substituted with two R 1A And one-NR 13A R 14A Substitution.
In some embodiments, the 5-10 membered heteroaryl is pyrimidinyl. Pyrimidinyl groups are optionally substituted with one, two or three groups independently selected from R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, pyrimidinyl is unsubstituted. In some embodiments, the pyrimidinyl group is substituted with one member selected from the group consisting of R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, pyrimidinyl is substituted with one R 1A And (3) group substitution. In some embodiments, pyrimidinyl is substituted with one-NR 13A R 14A And (3) substitution. In some embodiments, pyrimidinyl is independently selected from R 1A and-NR 13A R 14A Two groups are substituted. In some embodiments, pyrimidinyl is independently selected from R 1A Two groups are substituted. In some embodiments, pyrimidinyl groups are two independently selected from-NR 13A R 14A Substitution of groups. In some embodiments, pyrimidinyl groups are selected from three independently R 1A and-NR 13A R 14A Substitution of groups. In some embodiments, pyrimidinyl groups are selected from three independently R 1A Substitution of groups. In some embodiments, pyrimidinyl groups are selected from the group consisting of-NR independently 13A R 14A Substitution of groups. In some embodiments, pyrimidinyl is substituted with one R 1A And one-NR 13A R 14A Substitution. In some embodiments, pyrimidinyl is substituted with one R 1A And two-NR 13A R 14A Substitution. In some embodiments, pyrimidinyl is substituted with two R 1A And one-NR 13A R 14A Substitution.
In some embodiments, R 1 Is one, two or three R 1A Substituted pyrimidinyl wherein each R 1A Independently selected fromHalogen, cyano, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, R 1 Is one, two or three R 1A Substituted pyrimidinyl wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 (e.g., 5, 6, 7, 8, 9, or 10) membered heteroaryl containing one, two, or three heteroatoms selected from N and O. In some embodiments, R 1 Is one, two or three R 1A Substituted pyrimidinyl wherein each R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-6 membered heteroaryl containing one, two or three heteroatoms selected from N and O. In some embodiments, R 1 Is one, two or three R 1A Substituted pyrimidinyl wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, R 1 Is substituted with one R selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl 1A Substituted pyrimidinyl. In some embodiments, R 1 Is formed by two R 1A Substituted pyrimidinyl wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl. In some embodiments, R 1 Is covered by three R 1A Substituted pyrimidinyl wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl.
R 1 Optionally one, two or three are independently selected from R 1A and-NR 13A R 14A Radical substitution in some embodiments, at least one R 1A Is halogen. In some embodiments, at least one R 1A Is fluorine. In some embodiments, at least one R 1A Is chlorine. In some embodiments, at least one R 1A Is bromine. In some embodiments, the halogen is iodine. In some embodiments, at least one R 1A Is cyano.
In some embodiments, at least one R 1A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl).
In some embodiments, at least one R 1A Is C 1 -C 3 Alkoxy (e.g., methoxy, ethoxy, n-propoxy, isopropoxy).
In some embodiments, at least one R 1A Is C 1 -C 3 Haloalkoxy groups. In some embodiments, at least one R 1A Is C 1 -C 3 Fluoroalkoxy (e.g., fluoromethoxy, difluoromethoxy, trifluoromethoxy, fluoroethoxy, difluoroethoxy, trifluoroethoxy, tetrafluoroethoxy, pentafluoroethoxy, fluoro-n-propoxy, difluoro-n-propoxy, trifluoro-n-propoxy, tetrafluoro-n-propoxy, pentafluoro-n-propoxy, hexafluoro-n-propoxy, heptafluoro-n-propoxy, fluoroisopropoxy, difluoroisopropoxy, trifluoroisopropoxy, tetrafluoroisopropoxy, heptafluoroisopropoxy, hexafluoroisopropoxy, or heptafluoroisopropoxy). In some embodiments, at least one R 1A Is C 1 -C 3 Chloroalkoxy (e.g., chloromethoxy, dichloromethoxy, trichloromethoxy, chloroethoxy, dichloroethoxy, trichloroethoxy, tetrachloroethoxy, pentachloroethoxy, chloro-n-propoxy, dichloro-n-propoxy, trichloro-n-propoxy, tetrachloro-n-propoxy, pentachloron-propoxy, hexachloro-n-propoxy, heptachloro-n-propoxy, chloroisopropoxy, dichloroisopropoxy, trichloroisopropoxy, tetrachloroisopropoxy, heptachloroisopropoxy, hexachloroisopropoxy, or heptachloroisopropoxy). In some embodiments, at least one R 1A Is C 1 -C 3 Bromoalkoxy (e.g., bromomethoxy, dibromomethoxy, tribromomethoxy, bromoethoxy, dibromoethoxy, tribromoethoxy, tetrabromoethoxy, pentabromoethoxy, bromo-n-propoxy, dibromo-n-propoxy),Tribromo-n-propoxy, tetrabromo-n-propoxy, pentabromo-n-propoxy, hexabromo-n-propoxy, heptabromo-n-propoxy, bromoisopropoxy, dibromoisopropoxy, tribromoisopropoxy, tetrabromoisopropoxy, heptabromoisopropoxy, hexabromoisopropoxy, or heptabromoisopropoxy. In some embodiments, at least one R 1A Is C 1 -C 3 Iodoalkoxy (e.g., iodomethoxy, diiodomethoxy, triiodomethoxy, iodoethoxy, diiodoethoxy, triiodoethoxy, tetraiodoethoxy, pentaiodoethoxy, iodo-n-propoxy, diiodo-n-propoxy, triiodo-n-propoxy, tetraiodo-n-propoxy, pentaiodo-n-propoxy, hexaiodo-n-propoxy, heptaiodo-n-propoxy, iodoisopropoxy, diiodoisopropoxy, triiodoisopropoxy, tetraiodoisopropoxy, heptaiodoisopropoxy, hexaiodoisopropoxy, or heptaiodoisopropoxy).
In some embodiments, at least one R 1A Is a 5-10 membered heteroaryl group containing one, two or three heteroatoms selected from N and O. In some embodiments, at least one R 1A Is a 5-10 membered heteroaryl group containing one, two or three heteroatoms selected from N and O. In some embodiments, at least one R 1A Is a 5-10 membered heteroaryl group containing one N. In some embodiments, at least one R 1A Is a 5-10 membered heteroaryl group containing two N. In some embodiments, at least one R 1A Is a 5-10 membered heteroaryl group containing three N. In some embodiments, at least one R 1A Is a 5-10 membered heteroaryl group containing one O. In some embodiments, at least one R 1A Is a 5-10 membered heteroaryl group containing two O's. In some embodiments, at least one R 1A Is a 5-10 membered heteroaryl group containing three O's. In some embodiments, at least one R 1A Is a 5-10 membered heteroaryl group containing one N and one O. In some embodiments, at least one R 1A Is a 5-6 membered heteroaryl group containing one N. In some embodiments, at least one R 1A Is a 5-6 membered heteroaryl group containing two N. In some embodiments, at least one R 1A Is a 5-6 membered heteroaryl group containing three N. In some embodiments, at least one R 1A Is a 5-6 membered heteroaryl group containing one O. In some embodiments, at least one R 1A Is a 5-6 membered heteroaryl group containing one N and one O. In some embodiments, at least one R 1A Is a 5-6 membered heteroaryl group containing two N and one O. In some embodiments, at least one R 1A Is a 5-6 membered heteroaryl having one ring (i.e., a 5-10 membered heteroaryl is a monocyclic heteroaryl). In some embodiments, at least one R 1A Is a 5-10 membered heteroaryl having more than one ring (e.g., two rings, three rings, or four rings). In some embodiments, at least one R 1A Is a 5-10 membered heteroaryl group containing two fused rings. In some embodiments, the 5-10 membered heteroaryl is triazolyl. In some embodiments, the 5-10 membered heteroaryl is oxadiazolyl.
R 1 Can be one, two or three NR 13A R 14A Substitution, wherein each R 13A Independently H or C 1 -C 3 Alkyl, and each R 14A Independently H or C 1 -C 3 An alkyl group. In some embodiments, at least one R 13A Is H. In some embodiments, at least one R 13A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl). In some embodiments, at least two R 13A Is H. In some embodiments, at least two R 13A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl). In some embodiments, three R 13A Is H. In some embodiments, three R 13A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl). In some embodiments, at least one R 14A Is H. In some embodiments, at least one R 14A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl). In some embodiments, at least two R 14A Is H. In some embodiments, at least two R 14A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl). In some embodiments, threeR 14A Is H. In some embodiments, three R 14A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl). In some embodiments, at least one NR 13A R 14A With R 13A Is H and R 14A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl). In some embodiments, at least two NR' s 13A R 14A With R 13A Is H and R 14A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl). In some embodiments, three NRs 13A R 14A With R 13A Is H and R 14A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl). In some embodiments, at least one NR 13A R 14A With R 13A Is H and R 14A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl) and at least one NR 13A R 14A Is NH 2 . In some embodiments, one NR 13A R 14A With R 13A Is H and R 14A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl) and two NR 13A R 14A Is NH 2 . In some embodiments, two NRs 13A R 14A With R 13A Is H and R 14A Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl) and one NR 13A R 14A Is NH 2 . In some embodiments, at least one NR 13A R 14A Is NH 2 . In some embodiments, at least two NR' s 13A R 14A Is NH 2 . In some embodiments, three NRs 13A R 14A Is NH 2 。
In some embodiments, R 1 Is C 3 -C 10 Cycloalkyl, C 6 -C 10 Aryl or a 5-10 membered heteroaryl containing one, two or three N; wherein R is 1 Optionally cycloalkyl and heteroaryl groups of (C)Is one, two or three independently selected from R 1A and-NR 13A R 14A And aryl is substituted with one, two or three groups independently selected from R 1A and-NR 13A R 14A Is substituted with a group of (a). In some embodiments, R 1 Is selected from one, two or three independently from R 1A and-NR 13A R 14A Phenyl substituted by a group of (a). In some embodiments, R 1 Is covered by one R 1A Phenyl substituted by a group. In some embodiments, R 1 Is covered by two R 1A Phenyl substituted by a group. In some embodiments, R 1A Is halogen or cyano. In some embodiments, R 1A Is chlorine or cyano. In some embodiments, R 1A Is fluorine or cyano.
In some embodiments, R 1 Is unsubstituted cyclohexyl; unsubstituted phenyl; phenyl substituted with one, two or three substituents independently selected from cyano, halogen, methoxy, isopropoxy, trifluoromethoxy, triazolyl and oxadiazolyl; pyridyl substituted with one, two or three substituents independently selected from cyano and halogen; or pyrimidinyl substituted with cyano. In some embodiments, R 1 Is cyclohexyl, phenyl substituted with cyano and fluoro, phenyl substituted with cyano and chloro, phenyl substituted with cyano and methoxy, phenyl substituted with cyano and isopropoxy, phenyl substituted with cyano and trifluoromethoxy, phenyl substituted with cyano and two methoxy, phenyl substituted with cyano and triazolyl, phenyl substituted with cyano and diazolyl, pyridinyl substituted with cyano, pyridinyl substituted with chloro or pyrimidinyl substituted with cyano. In some embodiments, R 1 Is that
In some embodiments, R 1 Is that
In some embodiments, R 1 Is->
R 2 May be H or C 1 -C 3 An alkyl group. In some embodiments, R 2 Is H. In some embodiments, R 2 Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl).
R 3 May be C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl).
After (CR) 4 R 5 ) m M is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21. In some embodiments, m is 16. In some embodiments, m is 17. In some embodiments, m is 18. In some embodiments, m is 19, in some embodiments, m is 20. In some embodiments, m is 21. In some embodiments, (CR) 4 R 5 ) m Is C 10 -C 21 An alkylene group. In some embodiments, (CR) 4 R 5 ) m Is unsubstituted C 10 -C 21 An alkylene group. In some embodiments, (CR) 4 R 5 ) m Is straight-chain C 10 -C 21 An alkylene group. In some embodiments, (CR) 4 R 5 ) m Is unsubstituted straight chain C 10 -C 21 An alkylene group. In some embodiments, (CR) 4 R 5 ) m Is branched C 10 -C 21 An alkylene group. In some embodiments, (CR) 4 R 5 ) m Is C 10 -C 21 Alkenyl groups. In some embodiments, (CR) 4 R 5 ) m Is unsubstituted C 10 -C 21 Alkenyl groups. In some embodiments, (CR) 4 R 5 ) m Is straight-chain C 10 -C 21 Alkenyl groups. In some embodiments, (CR) 4 R 5 ) m Is unsubstituted straight chain C 10 -C 21 Alkenyl groups. In some embodiments, (CR) 4 R 5 ) m Is branched C 10 -C 21 Alkenyl groups. In some embodiments, R 3 (CR 4 R 5 ) m Is C 11 -C 24 An alkyl group. In some embodiments, R 3 (CR 4 R 5 ) m Is unsubstituted C 11 -C 24 An alkyl group. In some embodiments, R 3 (CR 4 R 5 ) m Is substituted C 11 -C 24 An alkyl group. In some embodiments, R 3 (CR 4 R 5 ) m Is branched C 11 -C 24 An alkyl group. In some embodiments, R 3 (CR 4 R 5 ) m Is straight chain C 11 -C 24 An alkyl group. In some embodiments, R 3 (CR 4 R 5 ) m Is unsubstituted straight-chain C 11 -C 24 An alkyl group. In some embodiments, R 3 (CR 4 R 5 ) m Is octadecyl. In some embodiments, R 3 (CR 4 R 5 ) m Is a nineteen alkyl group. In some embodiments, R 3 (CR 4 R 5 ) m Is eicosyl. In some embodiments, R 3 (CR 4 R 5 ) m Is a heneicosyl group.
Each R 4 Can be independently a bond, H, halogen, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl or C 3 -C 6 Cycloalkyl, in some embodiments, at least one R 4 Is a key. In some embodiments, 10 to 21 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21) R 4 Is H. In some embodiments, at least one R 4 Is halogen (e.g., chlorine, bromine, fluorine or iodine). In some embodiments, at least one R 4 Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl). In some embodiments, 10 to 21(e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21) R 4 Is C 1 -C 3 Alkyl (e.g., methyl, ethyl, n-propyl, isopropyl). In some embodiments, at least one R 4 Is C 1 -C 3 Haloalkyl (e.g., halomethyl, haloethyl, halo-n-propyl, and haloisopropyl). In some embodiments, 10 to 21 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21) R 4 Is C 1 -C 3 Haloalkyl (e.g., methyl, ethyl, n-propyl, isopropyl). Exemplary C 1 -C 3 Haloalkyl includes fluoromethyl, fluoroethyl, fluoro-n-propyl, fluoroisopropyl, chloromethyl, chloroethyl, chloro-n-propyl, chloroisopropyl, bromomethyl, bromoethyl, bromo-n-propyl, bromoisopropyl, iodomethyl, iodoethyl, iodo-n-propyl or iodoisopropyl.
Each R 5 May independently be a bond or H. In some embodiments, at least one R 5 Is a key. In some embodiments, there is only one R 5 Is a key. In some embodiments, 10 to 21 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21) R 5 Is H. In some embodiments, each R 5 Is H.
In some embodiments, each R 4 And each R 5 Is H. In some embodiments, two or more adjacent (CR 4 R 5 ) The groups are optionally linked by double bonds. In some embodiments, (CR) 4 R 5 ) m Having one double bond. In some embodiments, (CR) 4 R 5 ) m Having at least one double bond (e.g., 2,3, 4, or 5 double bonds).
R 6 Can be H or-C (O) C 1 -C 6 An alkyl group. In some embodiments, R 6 Is H. In some embodiments, R 6 is-C (O) C 1 -C 6 (e.g. -C (O) C) 1 、-C(O)C 2 、-C(O)C 3 、-C(O)C 4 、-C(O)C 5 、-C(O)C 6 ) Alkyl, -C (O) methyl, -C (O) ethyl-C (O) -n-propyl, -C (O) isopropyl, -C (O) -n-butyl, -C (O) -isobutyl, -C (O) -s-butyl, -C (O) -t-butyl, -C (O) -n-pentyl, -C (O) -2-pentyl, -C (O) -3-pentyl, -C (O) -2-methyl-2-butyl, -C (O) -3-methyl-1-butyl, -C (O) -2-methyl-1-butyl, -C (O) -1-hexyl, -C (O) -2-hexyl, -C (O) -3-hexyl, -C (O) -2-methyl-2-pentyl, -C (O) -3-methyl-2-pentyl, -C (O) -4-methyl-2-pentyl, -C (O) -3-methyl-3-pentyl, -C (O) -2-methyl-3-pentyl, -C (O) -2, 3-dimethyl-2-butyl or-C (O) -3, 3-dimethyl-2-butyl.
R 7 Can be H or-C (O) C 1 -C 6 An alkyl group. In some embodiments, R 7 Is H. In some embodiments, R 7 is-C (O) C 1 -C 6 (e.g. -C (O) C) 1 、-C(O)C 2 、-C(O)C 3 、-C(O)C 4 、-C(O)C 5 、-C(O)C 6 ) Alkyl, -C (O) methyl, -C (O) ethyl, -C (O) -n-propyl, -C (O) isopropyl, -C (O) -n-butyl, -C (O) isobutyl, -C (O) -s-butyl, -C (O) -t-butyl, -C (O) -n-pentyl, -C (O) -2-pentyl, -C (O) -3-pentyl, -C (O) -2-methyl-2-butyl, -C (O) -3-methyl-1-butyl, -C (O) -2-methyl-1-butyl, -C (O) -1-hexyl, -C (O) -2-hexyl, -C (O) -3-hexyl, -C (O) -2-methyl-2-pentyl, -C (O) -3-methyl-2-pentyl, -C (O) -4-methyl-2-pentyl, -C (O) -3-methyl-3-pentyl, -C (O) -2-methyl-3-pentyl, -C (O) -2, 3-dimethyl-2-butyl or-C (O) -3, 3-dimethyl-2-butyl.
In some embodiments, R 6 And R is 7 Are all H. In some embodiments, R 6 Is H and R 7 is-C (O) C 1 -C 6 An alkyl group. In some embodiments, R 6 Is H and R 7 is-C (O) methyl, -C (O) ethyl, -C (O) -n-propyl, -C (O) isopropyl-C (O) -n-butyl, -C (O) isobutyl, -C (O) -s-butyl or-C (O) -t-butyl. In some embodiments, R 6 is-C (O) C 1 -C 6 Alkyl and R 7 Is H. In some embodiments, R 6 is-C (O) methyl, -C (O) ethyl, -C (O) -n-propyl-C (O) isopropyl, -C (O) -n-butyl, -C (O) isobutyl, -C (O) isopropyl- s-butyl, or-C (O) -t-butyl, and R 7 Is H. In some embodiments, R 6 And R is 7 Each independently selected from the group consisting of-C (O) methyl, -C (O) ethyl, -C (O) -n-propyl, -C (O) isopropyl-C (O) -n-butyl, -C (O) isobutyl, -C (O) -s-butyl and-C (O) -t-butyl. In some embodiments, R 6 ＝R 7 . In some embodiments, R 6 And R is 7 Are all-C (O) isopropyl groups.
L may be-O-, - (CR) 12A R 12B ) n -、-O-(CR 12A R 12B ) n -、-(CR 12A R 12B ) n -O-or- (CR) 12A R 12B ) n -O-(CR 12A R 12B ) n Wherein n is 1 or 2. In some embodiments, L is-O-. In some embodiments, L is- (CR) 12A R 12B ) -or- (CR) 12A R 12B )-(CR 12A R 12B ) -. In some embodiments, L is-O- (CR) 12A R 12B ) -or-O- (CR) 12A R 12B )(CR 12A R 12B ) -. In some embodiments, L is- (CR) 12A R 12B ) -O-or- (CR) 12A R 12B )(CR 12A R 12B ) -. In some embodiments, L is- (CR) 12A R 12B )-O-(CR 12A R 12B ) -or- (CR) 12A R 12B )(CR 12A R 12B )-O-(CR 12A R 12B )(CR 12A R 12B )-。
Each R 12A Can be independently selected from H and C 1-6 An alkyl group. In some embodiments, at least one R 12A Is H. In some embodiments, at least one R 12A Is C 1 -C 6 (e.g., C 1 、C 2 、C 3 、C 4 、C 5 Or C 6 ) Alkyl is methyl, ethyl, -n-propyl, isopropyl, -n-butyl, isobutyl, -s-butyl, -t-butyl, -n-pentyl, -2-pentyl, -3-pentyl, -2-methyl-2-butyl, -3-methyl-1-butyl, -2-methyl-1-butyl, -1-hexyl, -2-hexyl, -3-hexyl, -2-methyl -2-pentyl, -3-methyl-2-pentyl, -4-methyl-2-pentyl, -3-methyl-3-pentyl, -2, 3-dimethyl-2-butyl or-3, 3-dimethyl-2-butyl.
Each R 12B Can be independently selected from H and C 1-6 An alkyl group. In some embodiments, at least one R 12B Is H. In some embodiments, at least one R 12B Is C 1 -C 6 (e.g., C 1 、C 2 、C 3 、C 4 、C 5 Or C 6 ) Alkyl is methyl, ethyl, -n-propyl, isopropyl, -n-butyl, isobutyl, -s-butyl, -t-butyl, -n-pentyl, -2-pentyl, -3-pentyl, -2-methyl-2-butyl, -3-methyl-1-butyl, -2-methyl-1-butyl, -1-hexyl, -2-hexyl, -3-hexyl, -2-methyl-2-pentyl, -3-methyl-2-pentyl, -4-methyl-2-pentyl, -3-methyl-3-pentyl, -2, 3-dimethyl-2-butyl or-3, 3-dimethyl-2-butyl.
In some embodiments, R 12A ＝R 12B . In some embodiments, each R 12A And each R 12B Is H. In some embodiments, R 12A And R is 12B Each independently selected from C 1 -C 6 An alkyl group. In some embodiments, L is-O-, -O-CH 2 -、-CH 2 -O-、-CH 2 -O-CH 2 -、-O-CH 2 -CH 2 -、-CH 2 -CH 2 -O-or-CH 2 -CH 2 -. In some embodiments, L is O. In some embodiments, L is-O-CH 2 -or-CH 2 -O-。
Q may be a bond or phenylene. In some embodiments, Q is a bond. In some embodiments, Q is phenylene. In some embodiments, Q is
T may be a bond or-O-. In some embodiments, T is a bond. In some embodiments, T is-O-.
X may be a bond or C 1 -C 3 An alkylene group. In some embodiments, X is a bond. In some embodiments, X is methylene, ethylene, n-propylene or isopropylene.
In some embodiments, R 3 (CR 4 R 5 ) m -Q-T-X-is
In some embodiments, R 3 (CR 4 R 5 ) m -Q-T-X-isIn some embodiments, R 3 (CR 4 R 5 ) m -Q-T-X-is +.>In some embodiments, R 3 (CR 4 R 5 ) m -Q-T-X-is +.>In some embodiments, R 3 (CR 4 R 5 ) m -Q-T-X-is +.>In some embodiments, R 3 (CR 4 R 5 ) m -Q-T-X-is +.>
In some embodiments, R 3 (CR 4 R 5 ) m -Q-T-X-is
Z may be-O-, -O- (C) 1 -C 6 ) Alkylene or NR 15 -(C 1 -C 6 ) -alkylene, wherein R 15 Is H or C 1 -C 3 An alkyl group. In some embodiments, Z is-O-. In some embodiments, Z is-O- (C) 1 -C 6 ) Alkylene group, wherein (C 1 -C 6 ) -alkylene is methylene, ethylene, -n-propylene, isopropene, -n-butylene, isobutylene, -s-butylene, -t-butylene, -n-pentylene, -2-pentylene, -3-pentylene, -2-methyl-2-butylene, -3-methyl-1-butylene, -2-methyl-1-butylene, -1-hexylene, -2-methyl-2-pentylene, -3-methyl-2-pentylene, -4-methyl-2-pentylene, -3-methyl-3-pentylene, -2, 3-dimethyl-2-butylene or-3, 3-dimethyl-2-butylene.
In some embodiments, Z is NH- (C) 1 -C 6 ) -alkylene, N-methyl- (C) 1 -C 6 ) -alkylene, N-ethyl- (C) 1 -C 6 ) -alkylene, N-N-propyl- (C) 1 -C 6 ) Alkylene or N-isopropyl- (C) 1 -C 6 ) Alkylene group, wherein (C 1 -C 6 ) -alkylene is methylene, ethylene, -n-propylene, isopropene, -n-butylene, isobutylene, -s-butylene, -t-butylene, -n-pentylene, -2-pentylene, -3-pentylene, -2-methyl-2-butylene, -3-methyl-1-butylene, -2-methyl-1-butylene, -1-hexylene, -2-methyl-2-pentylene, -3-methyl-2-pentylene, -4-methyl-2-pentylene, -3-methyl-3-pentylene, -2, 3-dimethyl-2-butylene or-3, 3-dimethyl-2-butylene. In some embodiments, Z is-O-CH 2 -、-NH-CH 2 -or-N (CH) 3 )-CH 2 -。
In some embodiments, R 1 Is cyclohexyl, phenyl substituted with cyano and fluoro, phenyl substituted with cyano and chloro, phenyl substituted with cyano and methoxy, phenyl substituted with cyano and isopropoxy, phenyl substituted with cyano and trifluoromethoxy, phenyl substituted with cyano and two methoxy, phenyl substituted with cyano and triazolyl, phenyl substituted with fluoro and diazolyl, pyridinyl substituted with cyano, pyridinyl substituted with chloro or pyrimidinyl substituted with cyano; r is R 2 Is H or methyl; r is R 3 Methyl, ethyl or n-propyl; each R 4 And R is 5 Independently H or a bond; r is R 6 Is H; r is R 7 Is H; m is 11, 12, 13, 14, 15, 16, 17 or 18; l is-O-, -O-CH 2 -、-CH 2 -O-、-CH 2 -O-CH 2 -、-O-CH 2 -CH 2 -、-CH 2 -CH 2 -O-or-CH 2 -CH 2 -; q is a bond or phenylene; t is a bond or-O-; x is a bond, -CH 2 -、-CH 2 -CH 2 -or-CH (CH) 3 ) -; and Z is-O-CH 2 -、-NH-CH 2 -or-N (CH) 3 )-CH 2 -。
In some embodiments, R 1 Is unsubstituted cyclohexyl; unsubstituted phenyl; phenyl substituted with one, two or three substituents independently selected from cyano, halogen, methoxy, isopropoxy, trifluoromethoxy, triazolyl and oxadiazolyl; pyridyl substituted with one, two or three substituents independently selected from cyano and halogen; or pyrimidinyl substituted with cyano; r is R 2 Is H or methyl; r is R 3 Methyl, ethyl or n-propyl; each R 4 And R is 5 Independently H or a bond; r is R 6 Is H; r is R 7 Is H; m is 11, 12, 13, 14, 15, 16, 17 or 18; l is-O-, -O-CH 2 -、-CH 2 -O-、-CH 2 -O-CH 2 -、-O-CH 2 -CH 2 -、-CH 2 -CH 2 -O-or-CH 2 -CH 2 -; q is a bond or phenylene; t is a bond or-O-; x is a bond, -CH 2 -、-CH 2 -CH 2 -or-CH (CH) 3 ) -; and Z is-O-CH 2 -、-NH-CH 2 -or-N (CH) 3 )-CH 2 -. In some embodiments, R 1 -L is
Those of skill in the art will recognize that the groups disclosed herein (e.g., R 1 ) May be associated with the remaining groups (e.g., R 2 、R 3 、R 4 、R 5 、R 6 Etc.) to produce the complete compound of formula (I) or any formula described herein or a pharmaceutically acceptable salt, stereoisomer mixture, or tautomer thereof, each of which is considered within the scope of the disclosure.
In some embodiments, the compounds of formula I and pharmaceutically acceptable salts include the compounds in table 1 and pharmaceutically acceptable salts thereof. In some embodiments, the compounds of formula I and pharmaceutically acceptable salts include the compounds in table 1A and pharmaceutically acceptable salts thereof. Tables 1 and 1A provide some of the compounds disclosed herein as well as the compound numbers and corresponding structures.
TABLE 1 some of the Compounds of formula I
/>
/>
/>
/>
/>
/>
/>
Table 1A some of the compounds of formula I (Compounds # and Structure)
/>
/>
In some embodiments, the compound of formula I has formula Ia:
description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, T, X, Z, L and m) are suitable for use in formula Ia.
In some embodiments, the compounds of formula Ia and pharmaceutically acceptable salts include the compounds in table 2 and pharmaceutically acceptable salts thereof.
TABLE 2 some of the Compounds of formula Ia
/>
/>
/>
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula Ib:
Description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, T, X, Z, L and m) are suitable for use in formula Ib. In some embodiments, the compounds of formula Ib and pharmaceutically acceptable salts include the compounds in table 3 and pharmaceutically acceptable salts thereof.
TABLE 3 some of the Compounds of formula Ib
/>
/>
In some embodiments, the compound of formula I has formula II:
description of substituents of formula I (e.g. R 1 、R 6 、R 7 L and m) are suitable for use in formula II. In some embodiments, the compounds of formula II and pharmaceutically acceptable salts include the compounds in table 4 and pharmaceutically acceptable salts thereof.
TABLE 4 some of the Compounds of formula II
/>
/>
/>
In some embodiments, the compound of formula I has formula IIa:
description of substituents of formula I (e.g. R 1 、R 6 、R 7 L and m) are suitable for the formula IIa.
In some embodiments, the compounds of formula IIa and pharmaceutically acceptable salts include the compounds in table 5 and pharmaceutically acceptable salts thereof.
TABLE 5 some of the compounds of formula IIa
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula IIb:
description of substituents of formula I (e.g. R 1 、R 6 、R 7 L and m) are suitable for the formula IIb. In some embodiments, the compounds of formula IIb and pharmaceutically acceptable salts include the compounds in table 6 and pharmaceutically acceptable salts thereof.
TABLE 6 some of the Compounds of formula IIb
In some embodiments, the compound of formula I has formula III:
/>
description of substituents of formula I (e.g. R 1A 、R 6 、R 7 M and n) are suitable for formula III.
In some embodiments, the compounds of formula III and pharmaceutically acceptable salts include the compounds in table 7 and pharmaceutically acceptable salts thereof.
TABLE 7 some of the Compounds of formula III
/>
/>
/>
In some embodiments, the compound of formula I has formula IIIa:
description of substituents of formula I (e.g. R 1A 、R 6 、R 7 M and n) are suitable for formula IIIa. In some embodiments, the compounds of formula IIIa and pharmaceutically acceptable salts include the compounds in table 8 and pharmaceutically acceptable salts thereof.
TABLE 8 some of the Compounds of formula IIIa
/>
/>
In some embodiments, the compound of formula I has formula IIIb:
description of substituents of formula I (e.g. R 1A 、R 6 、R 7 M and n) are suitable for formula IIIb. In some embodiments, the compounds of formula IIIb and pharmaceutically acceptable salts include the compounds in table 9 and pharmaceutically acceptable salts thereof.
TABLE 9 some of the compounds of formula IIIb
/>
In some embodiments, the compound of formula I has formula IV:
description of substituents of formula I (e.g. R 1 、R 6 、R 7 L and m) are suitable for use in formula IV. In some embodiments, the compounds of formula IV and pharmaceutically acceptable salts include the compounds in table 10 and pharmaceutically acceptable salts thereof.
TABLE 10 some compounds of formula IV
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula IVa:
description of substituents of formula I (e.g. R 1 、R 6 、R 7 L and m) are suitable for formula IVa. In some embodiments, the compounds of formula IVa and pharmaceutically acceptable salts include the compounds in table 11 and pharmaceutically acceptable salts thereof.
TABLE 11 some compounds of formula IVa
/>
/>
/>
In some embodiments, the compound of formula I has formula IVb:
description of substituents of formula I (e.g. R 1 、R 6 、R 7 L and m) are suitable for formula IVb. In some embodiments, the compounds of formula IVb and pharmaceutically acceptable salts include the compounds in table 12 and pharmaceutically acceptable salts thereof.
TABLE 12 Compounds of formula IVb
In some embodiments, the compound of formula I has formula V:
description of substituents of formula I (e.g. R 1A 、R 6 、R 7 M and n) are suitable for formula V. In some embodiments, the compounds of formula V and pharmaceutically acceptable salts include the compounds in table 13 and pharmaceutically acceptable salts thereof.
TABLE 13 Compounds of formula V
/>
/>
/>
In some embodiments, the compound of formula I has formula Va:
formula Va.
Description of substituents of formula I (e.g. R 1A 、R 6 、R 7 M and n) are applicable to formula Va. In some embodiments, the compounds of formula Va and pharmaceutically acceptable salts include the compounds in table 14 and pharmaceutically acceptable salts thereof A salt.
TABLE 14 Compounds of formula Va
/>
/>
In some embodiments, the compound of formula I has formula Vb:
description of substituents of formula I (e.g. R 1A 、R 6 、R 7 M and n) apply to formula Vb. In some embodiments, the compounds of formula Vb and pharmaceutically acceptable salts include the compounds in table 15 and pharmaceutically acceptable salts thereof.
TABLE 15 Compounds of formula Vb
In some embodiments, the compound of formula I has formula VI:
description of substituents of formula I (e.g. R 1A 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, T, X, Z, L, m and n) are suitable for use in formula VI. In some embodiments, the chemistry of formula VIThe compounds and pharmaceutically acceptable salts include the compounds in table 16 and pharmaceutically acceptable salts thereof.
TABLE 16 some compounds of formula VI
/>
/>
/>
/>
/>
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula VIa:
description of substituents of formula I (e.g. R 1A 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, T, X, Z, L, m and n) are applicable to formula VIa. In some embodiments, the compounds of formula VIa and pharmaceutically acceptable salts include the compounds in table 17 and pharmaceutically acceptable salts thereof.
TABLE 17 some compounds of formula VIa
/>
/>
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula VIb:
description of substituents of formula I (e.g. R 1A 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, T, X, Z, L, m and n) are applicable to formula VIb.
In some embodiments, the compounds of formula VIb and pharmaceutically acceptable salts thereof include the compounds in table 18 and pharmaceutically acceptable salts thereof.
TABLE 18 some compounds of formula VIb
/>
/>
In some embodiments, the compound of formula I has formula VII:
description of substituents of formula I (e.g. R 1A 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, X, L, m and n) are suitable for use in formula VII.
In some embodiments, the compounds of formula VII and pharmaceutically acceptable salts include the compounds in table 19 and pharmaceutically acceptable salts thereof.
TABLE 19 some compounds of formula VII
/>
/>
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula VIIa:
description of substituents of formula I (e.g. R 1A 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, X, L, m and n) are suitable for use in formula VIIa. In some embodiments, the compounds of formula VIIa and pharmaceutically acceptable salts include the compounds in table 20 and pharmaceutically acceptable salts thereof.
TABLE 20 some of the compounds of formula VIIa
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula VIIb:
description of substituents of formula I (e.g. R 1A 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, X, L, m and n) are suitable for use in formula VIIb. In some embodiments, the compounds of formula VIIb and pharmaceutically acceptable salts include the compounds in table 21 and pharmaceutically acceptable salts thereof.
TABLE 21 some compounds of formula VIIb
In some embodiments, the compound of formula I has formula VIIc:
description of substituents of formula I (e.g. R 1A 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, X, L, m and n) are suitable for use in formula VIIc. In some embodiments, the compounds of formula VIIc and pharmaceutically acceptable salts include the compounds in table 22 and pharmaceutically acceptable salts thereof.
TABLE 22 some compounds of formula VIIc
In some embodiments, the compound of formula I has formula VIII:
description of substituents of formula I (e.g. R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, T, X, Z, L and m) are suitable for formula VIII.
In some embodiments, the compounds of formula VIII and pharmaceutically acceptable salts include the compounds in table 23 and pharmaceutically acceptable salts thereof.
TABLE 23 some compounds of formula VIII
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula VIIIa:
description of substituents of formula I (e.g. R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, T, X, Z, L and m) are suitable for use in formula VIIIa.
In some embodiments, the compounds of formula VIIIa and pharmaceutically acceptable salts include the compounds in table 24 and pharmaceutically acceptable salts thereof.
TABLE 24 some compounds of formula VIIIa
/>
/>
/>
In some embodiments, the compound of formula I has formula VIIIb:
description of substituents of formula I (e.g. R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, T, X, Z, L and m) are suitable for use in formula VIIIb.
In some embodiments, the compounds of formula VIIIb and pharmaceutically acceptable salts include the compounds in table 25 and pharmaceutically acceptable salts thereof.
TABLE 25 some compounds of formula VIIIb
In some embodiments, the compound of formula I has formula VIIIc:
description of substituents of formula I (e.g. R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, T, X, Z, L and m) are suitable for use in formula VIIIc.
In some embodiments, the compounds of formula VIIIc and pharmaceutically acceptable salts include the compounds in table 26 and pharmaceutically acceptable salts thereof.
TABLE 26 Compounds of formula VIIIc
In some embodiments, the compound of formula I has formula IX:
description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, X, L and m) are suitable for the formula IX.
In some embodiments, the compounds of formula IX and pharmaceutically acceptable salts include the compounds in table 27 and pharmaceutically acceptable salts thereof.
TABLE 27 some compounds of formula IX
/>
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula IXa:
description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, X, L and m) are suitable for use in formula IXa.
In some embodiments, the compounds and pharmaceutically acceptable salts of formula IXa include the compounds in table 28 and pharmaceutically acceptable salts thereof.
TABLE 28 some of the compounds of formula IXa
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula IXb:
description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, X, L and m) are suitable for the formula IXb.
In some embodiments, the compounds of formula IXb and pharmaceutically acceptable salts include the compounds in table 29 and pharmaceutically acceptable salts thereof.
TABLE 29 some compounds of formula IXb
/>
In some embodiments, the compound of formula I has formula IXc:
description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, X, L and m) are suitable for use with formula IXc.
In some embodiments, the compounds of formula IXc and pharmaceutically acceptable salts include the compounds in table 30 and pharmaceutically acceptable salts thereof.
TABLE 30 some of the compounds of formula IXc
In some embodiments, the compound of formula I has formula X:
description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 And m) applies to formula X. In some embodiments, the compounds of formula X and pharmaceutically acceptable salts include the compounds in table 31 and pharmaceutically acceptable salts thereof.
TABLE 31 Compounds of formula X
/>
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula Xa:
description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 And m) adaptationsFor formula Xa.
In some embodiments, the compounds of formula Xa and pharmaceutically acceptable salts include the compounds in table 32 and pharmaceutically acceptable salts thereof.
TABLE 32 Compounds of formula Xa
/>
/>
/>
In some embodiments, the compound of formula I has formula Xb:
description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 And m) applies to formula Xb.
In some embodiments, the compounds of formula Xb and pharmaceutically acceptable salts include the compounds in table 33 and pharmaceutically acceptable salts thereof.
TABLE 33 Compounds of formula Xb
In some embodiments, the compound of formula I has formula XI:
description of substituents of formula I (e.g. R 1 、R 3 、R 4 And R is 5 ) Is suitable for formula XI. In some embodiments, the compounds of formula XI and pharmaceutically acceptable salts include the compounds in table 34 and pharmaceutically acceptable salts thereof.
TABLE 34 some of the compounds of formula XI
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula XIa:
description of substituents of formula I (e.g. R 1 、R 3 、R 4 And R is 5 ) Is suitable for formula XIa.
In some embodiments, the compounds of formula XIa and pharmaceutically acceptable salts include the compounds in table 35 and pharmaceutically acceptable salts thereof.
TABLE 35 some compounds of formula XIa
/>
/>
In some embodiments, the compound of formula I has formula XIb:
description of substituents of formula I (e.g. R 1 、R 3 、R 4 And R is 5 ) Suitable for use with formula XIb.
In some embodiments, the compounds of formula XIb and pharmaceutically acceptable salts include the compounds in table 36 and pharmaceutically acceptable salts thereof.
TABLE 36 Compounds of formula XIb
In some embodiments, the compound of formula I has formula XII:
wherein w+v is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19.
Description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q and L) are suitable for the formula XII.
In some embodiments, the compounds of formula XII and pharmaceutically acceptable salts include the compounds in table 37 and pharmaceutically acceptable salts thereof.
TABLE 37 some compounds of formula XII
In some embodiments, the compound of formula I has formula XIIa:
wherein w+v is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19.
Description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q and L) are suitable for use in formula XIIa.
In some embodiments, the compounds of formula XIIa and pharmaceutically acceptable salts include the compounds in table 37 above and pharmaceutically acceptable salts thereof.
In some embodiments, the compound of formula I has formula XIIb:
wherein w+v is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19.
Description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q and L) are suitable for use in formula XIIb.
In some embodiments, the compound of formula I has formula XIII:
description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, X, Z, L and m) are suitable for use in formula XIII.
In some embodiments, the compounds of formula XIII and pharmaceutically acceptable salts include the compounds in table 38 and pharmaceutically acceptable salts thereof.
TABLE 38 some compounds of formula XIII
/>
/>
/>
/>
In some embodiments, the compound of formula I has formula XIIIa:
description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, X, Z, L and m) are suitable for use in formula XIIIa. In some embodiments, the compounds of formula XIIIa and pharmaceutically acceptable salts include the compounds in table 39 and pharmaceutically acceptable salts thereof.
TABLE 39 some compounds of formula XIIIa
/>
/>
/>
In some embodiments, the compound of formula I has formula XIIIb:
description of substituents of formula I (e.g. R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 Q, X, Z, L and m) are suitable for use in formula XIIIb.
In some embodiments, the compounds of formula XIIIb and pharmaceutically acceptable salts include the compounds in table 40 and pharmaceutically acceptable salts thereof.
TABLE 40 Compounds of formula XIIIb
/>
In vivo metabolites of the compounds described herein also fall within the scope herein, to the extent such products are novel and unobvious relative to the prior art. Such products may result, for example, from oxidation, reduction, hydrolysis, amidation, esterification, etc., of the applied compounds, primarily due to enzymatic processes. Thus, the production of novel and non-obvious compounds by a method comprising contacting a compound with a mammal for a period of time sufficient to produce its metabolites is encompassed. Such products are typically identified by the following steps: the preparation of a radiolabel (e.g., 14 C or 3 H) A compound, parenterally administering a detectable dose (e.g., greater than about 0.5 mg/kg) of the radiolabeled compound to an animal (such as a rat, mouse, guinea pig, monkey, or human), allowing sufficient time for metabolism (typically about 30 seconds to 30 hours) and separating its conversion products from urine, blood, or other biological samples. These products are easy to separate because they are labeled (other products are separated by using antibodies that bind to epitopes that survive in the metabolite). The metabolite structures are determined in a conventional manner (e.g., by MS or NMR analysis). In general, analysis of metabolites proceeds in the same manner as conventional drug metabolism studies. The conversion products can be used for the compounds as long as they are not otherwise found in vivo, even if they do not themselves have HSV antiviral activityDiagnostic assay of therapeutic dose.
Formulations and methods for determining the stability of compounds in alternative gastrointestinal secretions are known. A compound is defined herein as stable in the gastrointestinal tract, wherein less than about 50 mole% of the protecting groups are deprotected in alternative intestinal or gastric fluids after incubation at 37 ℃ for 1 hour. Simply because the compounds are stable to the gastrointestinal tract does not mean that they cannot hydrolyze in vivo. Prodrugs are generally stable in the digestive system but can be substantially hydrolyzed to the parent drug in the digestive cavity, liver, lung, or other metabolic organs or generally intracellular. As used herein, a prodrug is understood to be a compound that is chemically designed to effectively release the parent drug upon overcoming the biological barrier of oral delivery.
IV pharmaceutical preparation
Also disclosed herein are pharmaceutical formulations comprising a pharmaceutically effective amount of a compound of the present disclosure (e.g., a compound of formula I, ia, ib, II, III, IV, V, VI, VII, VIII, IX, X, XI, XIa, XIb, XII, XIII, XIIIa or XIIIb), or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient. Also provided herein is a pharmaceutical formulation comprising a pharmaceutically effective amount of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient.
The compounds disclosed herein may be formulated with conventional carriers and excipients. The tablet may contain, for example, excipients, glidants, fillers, binders, or combinations thereof. Aqueous formulations are prepared in sterile form and will typically be isotonic when intended for delivery by non-oral administration. Exemplary excipients include, but are not limited to, "H ANDBOOK OF P HARMACEUTICAL E XCIPIENTS "(1986). Excipients may include, for example, ascorbic acid and other antioxidants, chelating agents such as EDTA, carbohydrates such as dextran, hydroxyalkyl cellulose, hydroxyalkyl methylcellulose, stearic acid, and combinations thereof. In some embodiments, the formulation is alkaline. In some embodiments, the formulation is acidic. In some embodiments, the formulation has a neutral p H. In some embodiments, the formulation has a pH of 2 to 11 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 4-5, 4-6, 4-7, 4-8, 4-9, 4-10, 4-11, 5-6, 5-7, 5-8, 5-9, 5-10, 5-11, 6-7, 6-8, 6-9, 6-10, 6-11, 7-8, 7-9, 7-10, 7-11, 8-9, 8-10, 8-11, 9-10, or 9-11).
In some embodiments, the compounds disclosed herein have pharmacokinetic properties (e.g., oral bioavailability) suitable for oral administration of the compounds. Formulations suitable for oral administration may be presented, for example, in discrete units such as capsules, sachets or tablets each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The active ingredient may also be administered, for example, as a pill, granule, or paste.
Tablets may be prepared by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as, for example, powder or granules, optionally mixed with a binder, lubricant, inert diluent, preservative, surfactant, dispersing agent or combination thereof. Molded tablets may be made by molding in a suitable machine a mixture of the powdered active ingredient moistened with an inert liquid diluent. The tablets may optionally be coated or scored and optionally formulated so as to provide slow or controlled release of the active ingredient therein.
For infections of the eye or other external tissues (e.g. oral cavity and skin), the formulation may be applied as a topical ointment or cream containing the active ingredients in an amount of, for example, 0.075 to 20% w/w (including active ingredients in the range between 0.1% and 20% in 0.1% w/w, such as 0.6% w/w,0.7% w/w, etc.), 0.2% to 15% w/w, or 0.5% to 10% w/w. When formulated as an ointment, the active ingredients may be used in some embodiments with a paraffin base or a water-miscible ointment base. Alternatively, the active ingredient may be formulated as a cream with an oil-in-water cream base.
In some embodiments, the aqueous phase of the cream base may comprise, for example, 30% to 90% (e.g., 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%) w/w of a polyol, i.e., an alcohol having two or more hydroxyl groups such as propylene glycol, butane 1, 3-diol, mannitol, sorbitol, glycerol, and polyethylene glycol (including PEG 400), and mixtures thereof. In some embodiments, the cream base may comprise, for example, a compound that enhances absorption or penetration of the active ingredient through the skin or other affected area. Examples of such skin permeation enhancers include, but are not limited to, dimethyl sulfoxide and related analogs. In some embodiments, the cream or emulsion does not include water.
The oil phase of the emulsion may be composed of known ingredients in a known manner. In some embodiments, the phase comprises only an emulsifier (otherwise referred to as an emulsifier). In some embodiments, the phase comprises a mixture of at least one emulsifier with a fat, oil, or combination thereof. In some embodiments, hydrophilic emulsifiers are included along with lipophilic emulsifiers that act as stabilizers. Emulsifiers with or without stabilizers may together form a so-called emulsifying wax, and waxes together with oils and fats form a so-called emulsifying ointment base, which may form the oily dispersed phase of the cream formulation.
Emulsifying agents and emulsion stabilizers suitable for use in the formulation may include, but are not limited to60、/>80、/>80. Cetostearyl alcohol, benzyl alcohol, myristyl alcohol, glycerol monostearate, sodium lauryl sulfate, and combinations thereof. />
Based on achieving the desired make-upThe product property may be selected to be an appropriate oil or fat for the formulation. In some embodiments, the cream may be a non-greasy, non-staining, and washable product, having a suitable consistency to avoid leakage from tubes or other containers. In some embodiments, esters may be included, for example, linear or branched mono-or dialkyl esters may be used, such as diisoadipate, isocetyl stearate, propylene glycol diester of coconut fatty acids, isopropyl myristate, decyl oleate, isopropyl palmitate, butyl stearate, 2-ethylhexyl palmitate, known as Mixtures of branched esters of CAP or combinations thereof. In some embodiments, high melting point lipids may be included, such as white soft paraffin and/or liquid paraffin or other mineral oils.
In some embodiments, the compounds disclosed herein are administered alone. In some embodiments, the compounds disclosed herein are administered in a pharmaceutical formulation. In some embodiments, the pharmaceutical formulation is for veterinary use. In some embodiments, the pharmaceutical formulation is for human use. In some embodiments, the pharmaceutical formulations disclosed herein comprise at least one additional therapeutic agent.
The pharmaceutical formulations disclosed herein may be in any form suitable for the intended method of administration. The pharmaceutical formulations disclosed herein may be presented in unit dosage form and may be prepared by any of the methods well known in the pharmaceutical arts. Exemplary techniques and formulations can be found, for example, in "Remington' sPharmaceutical Sciences" (Mack Publishing co., easton, PA). Such methods may include the step of associating a compound disclosed herein with a carrier that constitutes one or more accessory ingredients. Generally, formulations can be prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
For example, when used for oral purposes, tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, solutions, syrups or elixirs may be prepared. Formulations intended for oral use may be prepared according to any method known in the art for manufacturing pharmaceutical formulations, and such formulations may contain one or more agents, including sweeteners, flavoring agents, coloring agents, and preservatives, in order to provide a palatable preparation. Tablets containing the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets are acceptable. These excipients may be, for example, inert diluents such as calcium or sodium carbonate, lactose, calcium or sodium phosphate; granulating and disintegrating agents, such as corn starch or alginic acid; a binder such as starch, gelatin or gum arabic; and lubricants such as magnesium stearate, stearic acid or talc. The tablets may be uncoated or may be coated by known techniques including microencapsulation to delay disintegration and adsorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be employed alone or with a wax.
Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, such as peanut oil, liquid paraffin or olive oil.
The aqueous suspension may contain the active substance in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients may include, for example, suspending agents such as sodium carboxymethyl cellulose, methyl cellulose, hydroxypropyl methyl cellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; and dispersants or wetting agents such as naturally occurring phospholipids (e.g., lecithin), condensation products of alkylene oxides with fatty acids (e.g., polyoxyethylene stearate), condensation products of ethylene oxide with long chain fatty alcohols (e.g., heptadecaethyleneoxycetyl alcohol), condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides (e.g., polyoxyethylene sorbitan monooleate). The aqueous suspension may also contain, for example, one or more preservatives, such as ethyl or n-propyl p-hydroxybenzoate, mono One or more colorants, one or more flavoring agents, one or more sweeteners (such as sucrose or saccharin), or combinations thereof. Other non-limiting examples of suspending agents include cyclodextrins. In some embodiments, the suspending agent is sulfobutyl ether beta-cyclodextrin (SEB-beta-CD), e.g./>
Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil or a combination of these, in a mineral oil such as liquid paraffin or in a combination of these. Oral suspensions may contain, for example, a thickening agent, such as beeswax, hard paraffin, cetyl alcohol or a combination thereof. In some embodiments, sweeteners (such as those described above) and/or flavoring agents are added to provide a palatable oral preparation. In some embodiments, the formulations disclosed herein are preserved by the addition of an antioxidant such as ascorbic acid.
Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water may provide the active ingredient in admixture with dispersing or wetting agents, suspending agents, preservatives and combinations thereof. Suitable dispersing or wetting agents and suspending agents are exemplified by those disclosed above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present.
The pharmaceutical formulation may also be in the form of an oil-in-water emulsion. The oily phase may be a vegetable oil (such as olive oil or arachis oil), a mineral oil (such as liquid paraffin) or a mixture of these. Suitable emulsifying agents include naturally-occurring gums, such as gum acacia and gum tragacanth; naturally occurring phospholipids, such as soybean lecithin; esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan monooleate; and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan monooleate. The emulsion may also contain sweeteners and flavoring agents. Syrups and elixirs may be formulated with sweetening agents, such as for example glycerol, sorbitol or sucrose. Such formulations may also contain, for example, a demulcent, a preservative, a flavoring agent, a coloring agent, or a combination thereof.
The pharmaceutical formulation may be in the form of a sterile injectable preparation or an intravenous formulation, such as a sterile injectable aqueous or oleaginous suspension. The suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents such as those already mentioned above. The sterile injectable preparation or the intravenous preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, such as a solution in 1, 3-butanediol, or as a lyophilized powder. Acceptable vehicles and solvents that may be employed are water, ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono-or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. Acceptable vehicles and solvents that may be employed include, but are not limited to, water, ringer's solution, isotonic sodium chloride solution, and hypertonic sodium chloride solution.
The amount of active ingredient that can be combined with the carrier material to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. For example, a sustained release formulation intended for oral administration to the human mouth may contain about 1mg to 1000mg of active material compounded with a suitable and convenient amount of carrier material, which may vary from 5% to 95% (weight: weight) of the total formulation. Pharmaceutical formulations may be prepared to provide easily measured amounts of administration. For example, an aqueous solution intended for intravenous infusion may contain 3 μg to 500 μg of active ingredient per milliliter of solution, so that a suitable volume is infused at a rate of 30 mL/hr.
Formulations suitable for topical application to the eye also include eye drops wherein the active ingredient is dissolved or suspended in a suitable carrier, particularly an aqueous solvent for the active ingredient. In some embodiments, the compounds disclosed herein are included in the pharmaceutical formulations disclosed herein at a concentration of 0.5% to 20% (e.g., 0.5% to 10%,1.5% w/w).
Formulations suitable for topical administration in the mouth include lozenges which may comprise the active ingredient (i.e. a compound disclosed herein and/or an additional therapeutic agent) in a flavored basis, typically sucrose and acacia or tragacanth; lozenges comprising inert active ingredients such as gelatin and glycerin, or sucrose and acacia; and mouthwashes comprising the active ingredient in a suitable liquid carrier.
Formulations for rectal administration may be presented as suppositories with a suitable base including, for example, cocoa butter or a salicylate.
Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray formulations containing in addition to the active ingredient such carriers as are known in the art to be appropriate.
Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain antioxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may contain suspending agents and thickening agents.
The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions are prepared from sterile powders, granules and tablets of the kind previously described. Preferred unit dosage formulations are those containing a daily dose or unit daily sub-dose, or an appropriate fraction thereof, of the active ingredient as hereinbefore described.
It will be appreciated that in addition to the ingredients specifically mentioned above, the formulations may contain other agents conventional in the art, such as those suitable for oral administration, which may contain flavoring agents, in view of the type of formulation in question.
Also provided are veterinary formulations comprising the compounds disclosed herein and veterinary carriers therefor.
Veterinary carriers are materials useful for administration of the formulations and may be solid, liquid or gaseous materials which are otherwise inert or acceptable in the veterinary arts and compatible with the active ingredient. These veterinary formulations may be administered orally, parenterally or any other desired route.
The compounds herein are useful for providing controlled release pharmaceutical formulations ("controlled release formulations") comprising one or more of the compounds as an active ingredient, wherein the release of the active ingredient may be controlled and regulated to allow for less frequent administration or to improve the pharmacokinetic or toxicity profile of a given active ingredient.
The effective dose of the active ingredient will depend at least on the nature of the condition being treated, toxicity, whether the compound is used prophylactically (lower dose) or against active viral infection, the method of delivery and the pharmaceutical formulation, and will be determined by the clinician using routine dose escalation studies. In some embodiments, 0.0001 to 100mg/kg body weight per day; for example, 0.01 to 10mg/kg body weight per day; 0.01 to 5mg/kg body weight per day; 0.05 to 0.5mg/kg body weight per day. For example, a daily candidate dose for an adult weighing about 70kg may range from 1mg to 1000mg (e.g., 5mg to 500 mg), and may take the form of a single dose or multiple doses.
V. kit
Also provided herein are kits comprising a compound disclosed herein, or a pharmaceutically acceptable salt thereof. In some embodiments, a kit described herein may comprise a label and/or instructions for using the compound to treat a disease or disorder in a subject (e.g., a human) in need thereof. In some embodiments, the disease or disorder is a viral infection.
In some embodiments, the kit may further comprise one or more additional therapeutic agents and/or instructions for using the additional therapeutic agents in combination with a compound disclosed herein to treat a disease or disorder in a subject (e.g., a human) in need thereof.
In some embodiments, the kits provided herein comprise individual dosage units of a compound as described herein, or a pharmaceutically acceptable salt, racemate, enantiomer, diastereomer, tautomer, polymorph, pseudopolymorph, amorphous form, hydrate, or solvate thereof. Examples of individual dosage units may include pills, tablets, capsules, pre-filled syringes or cartridges, IV bags, inhalers, nebulizers, etc., each comprising a therapeutically effective amount of the compound in question or a pharmaceutically acceptable salt, racemate, enantiomer, diastereomer, tautomer, polymorph, pseudopolymorph, amorphous form, hydrate or solvate thereof. In some embodiments, the kit may contain a single dosage unit, and in other embodiments there are multiple dosage units, such as the number of dosage units required for a given regimen or cycle.
Also provided is an article comprising: a compound disclosed herein, or a pharmaceutically acceptable salt, stereoisomer, mixture of stereoisomers, or tautomer thereof; a container. In some embodiments, the container of the article is a vial, a can, an ampoule, a pre-filled syringe, a blister pack, a can, a tin, a bottle, a box, an intravenous bag, an inhaler, or a nebulizer.
VI application of
The one or more compounds of the present disclosure are administered by any route suitable for the condition to be treated. Suitable routes include oral, rectal, inhalation, pulmonary, topical (including buccal and sublingual), vaginal and parenteral (including subcutaneous, intramuscular, intravenous, intradermal, intrathecal and epidural), and the like. In some embodiments, the compounds disclosed herein are administered by inhalation or intravenously. It should be understood that the pathway may vary depending on, for example, the recipient's conditions.
In the methods of treating viral infections of the present disclosure, the compounds of the present disclosure may be administered at any time to a subject that is able to contact a virus or has had a viral infection. In some embodiments, the compounds of the present disclosure may be administered prophylactically to a subject, such as a healthcare provider, who is in contact with a subject having a viral infection or is at risk of being in contact with a person having a viral infection. In some embodiments, administration of a compound of the disclosure may be to a subject that is positive for a viral infection test but has not yet displayed symptoms of the viral infection. In the methods of treating viral infections of the present invention, the compounds of the present invention may be administered at any time to a person who may be in contact with a virus or already suffering from a viral infection. In some embodiments, the compounds of the present disclosure may be administered prophylactically to a person in contact with or at risk of contacting a person having a viral infection, e.g., a healthcare provider. In some embodiments, the administration of a compound of the present disclosure may be to a person who tests positive for a viral infection but has not yet displayed symptoms of the viral infection. In some embodiments, the compounds of the present disclosure may be administered to a human at the onset of symptoms of a viral infection.
In some embodiments, the methods disclosed herein comprise event-driven administration of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, to a subject.
As used herein, the term "event-driven" or "event-driven administration" refers to administration of any of the compounds of formulas I-XIIIb, or a pharmaceutically acceptable salt thereof (1) prior to (e.g., 2 hours, 1 day, 2 days, 5 days, or 7 days or more prior to) an event that would expose the subject to virus (or would otherwise increase the risk of the subject acquiring a viral infection); and/or (2) during an event (or more than one repeat event) that would expose the subject to a virus (or would otherwise increase the risk of the subject acquiring a viral infection); and/or (3) after an event that would expose the subject to a virus (or would otherwise increase the risk of the subject acquiring a viral infection) (or after a final event in a series of repeated events). In some embodiments, event driven administration is performed prior to exposure of the subject to the virus. In some embodiments, event driven administration occurs after exposure of the subject to the virus. In some embodiments, event driven administration occurs before and after exposure of the subject to the virus.
In certain embodiments, the methods disclosed herein relate to administration prior to and/or after an event that would expose a subject (e.g., a human) to a virus or otherwise increase the risk of the subject (e.g., a human) acquiring a viral infection, e.g., as pre-exposure prevention (prip) and/or as post-exposure prevention (PEP). In some embodiments, the methods disclosed herein comprise pre-exposure prophylaxis (prip). In some embodiments, the methods disclosed herein comprise Post Exposure Prevention (PEP).
In some embodiments, the compounds disclosed herein or pharmaceutically acceptable salts thereof are administered prior to exposure of the subject to the virus.
In some embodiments, the compound of formula I or a pharmaceutically acceptable salt thereof is administered before and after exposure of the subject to the virus.
In some embodiments, the compound of formula I or a pharmaceutically acceptable salt thereof is administered after the subject is exposed to the virus.
Examples of event driven dosing regimens include administration of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, within 24 to 2 hours prior to the virus, followed by administration of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, every 24 hours during exposure, followed by further administration of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, after the last exposure, and the last administration of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, after 24 hours.
Another example of an event driven dosing regimen includes administration of any of the compounds of formulas I-XIIIb, or a pharmaceutically acceptable salt thereof, within 24 hours prior to viral exposure, then daily during exposure, then last administration (which may be an increased dose, such as a double dose) about 24 hours after the last exposure.
The effective dose of the active ingredient will depend at least on the nature, toxicity of the condition being treated, whether the compound is to be used prophylactically or against active viral infection, the method of delivery and the pharmaceutical formulation, and will be determined by the clinician using routine dose escalation studies. It is contemplated that 0.0001mg/kg to 100mg/kg body weight per day (e.g., 0.01mg/kg to 10mg/kg body weight per day); from 0.01mg/kg to 5mg/kg body weight per day; from 0.05mg/kg to 0.5mg/kg body weight per day). In some embodiments, a daily candidate dose for an adult of about 70kg body weight is 1mg to 2000mg (e.g., 5mg to 500mg, 500mg to 1000mg, 1000mg to 1500mg, 1500mg to 2000 mg) and may take the form of a single or multiple dose (e.g., 2 doses per day, 3 doses per day). For example, a daily candidate dose for an adult weighing about 70kg may range from 1mg to 1000mg (e.g., 5mg to 500 mg), and may take the form of a single dose or multiple doses.
Any suitable period of time for administration of the compounds of the present disclosure is contemplated. For example, administration may last from 1 day to 100 days, including 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, or 90 days. Administration may also last from 1 week to 15 weeks, including 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks. Longer application times are also contemplated.
In some embodiments, the compounds disclosed herein are administered once daily. In some embodiments, the compounds disclosed herein are administered twice daily. In some embodiments, the compounds disclosed herein are administered once every other day. In some embodiments, the compounds disclosed herein are administered once a week. In some embodiments, the compounds disclosed herein are administered twice weekly.
In some embodiments, one or more compounds disclosed herein are administered once daily. The once daily dose may be administered as desired, for example, up to 5 days, up to 7 days, up to 10 days, up to 15 days, up to 20 days, up to 25 days, up to one month or more. In some embodiments, a daily dose is administered for up to 20 days, up to 15 days, up to 14 days, up to 13 days, up to 12 days, up to 10 days, up to 8 days, up to 6 days, up to 4 days, up to 3 days, up to 2 days, or 1 day.
In some embodiments, one or more compounds disclosed herein are administered once daily for 6 to 12 days, e.g., for 8 to 10 days. In some embodiments, the one or more compounds are administered once daily for 9 days. In some embodiments, the one or more compounds are administered once daily for 10 days. In some embodiments, 50-150mg of one or more compounds disclosed herein is administered once daily for 5-12 days, e.g., for 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, or 12 days. In some embodiments, 100mg of one or more compounds disclosed herein is administered once daily for 5-12 days, e.g., for 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, or 12 days. In some embodiments, 500-2000mg (e.g., 500-1000mg, 1000-1500 mg) of one or more compounds disclosed herein are administered once daily for 5-12 days, e.g., for 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, or 12 days.
In some embodiments, one or more compounds disclosed herein are administered 2 times per day. The 2 daily doses may be administered as desired, for example up to 5 days, up to 7 days, up to 10 days, up to 15 days, up to 20 days, up to 25 days, up to one month or more. In some embodiments, the 2 daily doses are administered for up to 20 days, up to 15 days, up to 14 days, up to 13 days, up to 12 days, up to 10 days, up to 8 days, up to 6 days, up to 4 days, up to 3 days, up to 2 days, or 1 day.
In some embodiments, one or more compounds disclosed herein are administered 2 times daily for about 6 days to 12 days, for example, for about 8 days to 10 days. In some embodiments, the one or more compounds are administered 2 times daily for 9 days. In some embodiments, the one or more compounds are administered 2 times daily for 10 days. In some embodiments, 1-1000mg of one or more compounds disclosed herein is administered 2 times daily for 5-12 days, e.g., for 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, or 12 days. In some embodiments, 500-1500mg (e.g., 500-1000mg, 1000-1500 mg) of one or more compounds disclosed herein are administered twice daily for 5 to 12 days, such as 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, or 12 days.
VII methods of use
The present disclosure also provides methods of treating or preventing a viral infection in a subject (e.g., human) in need thereof, the method comprising administering to the subject a compound described herein.
In some embodiments, the present disclosure provides methods of treating a viral infection in a subject (e.g., human) in need thereof, the methods comprising administering to the subject in need thereof a compound described herein.
In some embodiments, the present disclosure provides methods of treating or preventing a viral infection in a subject (e.g., human) in need thereof, the method comprising administering to the subject a compound disclosed herein and at least one additional active therapeutic or prophylactic agent.
In some embodiments, the present disclosure provides methods of treating a viral infection in a subject (e.g., human) in need thereof, the methods comprising administering to the subject a compound disclosed herein and at least one additional active therapeutic agent.
In some embodiments, the present disclosure provides methods of inhibiting a viral polymerase in a cell, the methods comprising contacting a cell infected with a virus with a compound disclosed herein, thereby inhibiting the viral polymerase.
In some embodiments, the present disclosure provides methods of inhibiting a viral polymerase in a cell, the methods comprising contacting a cell infected with a virus with a compound disclosed herein and at least one additional active therapeutic agent, thereby inhibiting the viral polymerase.
Also provided herein is the use of a compound disclosed herein for treating or preventing a viral infection in a subject in need thereof. For example, provided herein is the use of a compound disclosed herein for treating a viral infection in a subject in need thereof.
A. Paramyxoviridae (Paramyxoviridae)
In some embodiments, the viral infection is a paramyxoviridae viral infection. Thus, in some embodiments, the present disclosure provides methods for treating a paramyxoviridae infection in a subject (e.g., human) in need thereof, the methods comprising administering to the subject a compound disclosed herein. In some embodiments, the paramyxoviridae virus comprises a BSL4 pathogen. Paramyxoviridae viruses include, but are not limited to, nipah virus, hendra virus, measles, mumps, and parainfluenza virus.
In some embodiments, the present disclosure provides a method of treating a paramyxoviridae viral infection in a subject (e.g., human) in need thereof, comprising administering to the subject a compound of the present disclosure or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides the use of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for treating a paramyxoviridae viral infection in a subject (e.g., a human).
In some embodiments, the present disclosure provides a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, for use in treating a paramyxoviridae infection in a subject (e.g., human) in need thereof.
B. Pneumoviridae family
In some embodiments, the viral infection is a pneumoviridae viral infection. In some embodiments, the present disclosure provides a method of treating a pneumovirinae virus infection in a subject (e.g., a human) in need thereof, the method comprising administering to the human a therapeutically effective amount of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof. Pneumoviridae viruses include, but are not limited to, respiratory Syncytial Virus (RSV) and human metapneumovirus. In some embodiments, the pneumoviridae virus infection is a Respiratory Syncytial Virus (RSV) infection. In some embodiments, the pneumoviridae virus infection is a human metapneumovirus infection.
In some embodiments, the present disclosure provides a method of treating a pneumovirinae virus infection in a subject (e.g., human) in need thereof, characterized by using a compound of the present disclosure or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides the use of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for treating a pneumovirinae virus infection in a subject (e.g., a human). In some embodiments, the pneumoviridae viral infection is a respiratory syncytial virus infection. In some embodiments, the pneumoviridae virus infection is a human metapneumovirus infection.
In some embodiments, the present disclosure provides a method of treating a pneumoviridae virus infection in a human in need thereof, characterized by using a compound of the present disclosure or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides the use of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for treating a pneumoviridae viral infection in a human. In some embodiments, the pneumoviridae viral infection is a respiratory syncytial virus infection. In some embodiments, the pneumoviridae virus infection is a human metapneumovirus infection.
In some embodiments, the present disclosure provides a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, for use in treating a pneumoviridae viral infection in a human in need thereof. In some embodiments, the pneumoviridae virus infection is a Respiratory Syncytial Virus (RSV) infection. In some embodiments, the pneumoviridae virus infection is a human metapneumovirus infection.
In certain embodiments, the present disclosure provides methods for treating RSV infection comprising administering to a subject (e.g., human) infected with respiratory syncytial virus a therapeutically effective amount of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof. In some embodiments, the human is suffering from a chronic respiratory syncytial virus infection. In some embodiments, the human is acutely infected with RSV.
In certain embodiments, a method of inhibiting RSV replication is provided that includes administering to a subject (e.g., a human) a compound of the disclosure, or a pharmaceutically acceptable salt thereof.
In certain embodiments, the present disclosure provides a method for reducing viral load associated with RSV infection, wherein the method comprises administering to a subject (e.g., human) infected with RSV a therapeutically effective amount of a compound of the disclosure, or a pharmaceutically acceptable salt thereof, wherein the therapeutically effective amount is sufficient to reduce the RSV viral load of the subject.
As described more fully herein, the compounds of the present disclosure may be administered to a subject (e.g., a human) infected with RSV along with one or more additional therapeutic agents. The additional therapeutic agent may be administered to the infected subject (e.g., a human) concurrently with or before or after the compounds of the present disclosure.
In certain embodiments, compounds of the present disclosure, or pharmaceutically acceptable salts thereof, are provided for use in the treatment or prevention of RSV infection. In certain embodiments, compounds of the present disclosure (e.g., compounds of formulas I-XIIIb) or pharmaceutically acceptable salts thereof are provided for the manufacture of a medicament for treating or preventing an RSV infection.
In some embodiments, methods of inhibiting RSV replication are provided, wherein the methods comprise administering a compound disclosed herein to a subject (e.g., human) in need thereof, wherein administration is by inhalation.
In some embodiments, the present disclosure provides methods for reducing viral load associated with RSV infection, wherein the methods comprise administering a compound disclosed herein to a person infected with RSV.
C. Picornaviridae family
In some embodiments, the viral infection is a picornaviridae (picornaviridae) viral infection. In some embodiments, the present disclosure provides a method of treating picornaviridae virus infection in a human in need thereof, the method comprising administering to a subject (e.g., a human) a therapeutically effective amount of a compound of the present disclosure or a pharmaceutically acceptable salt thereof. Picornaviridae are enteroviruses that cause heterogeneous infections including herpangina, aseptic meningitis, common cold-like syndrome (human rhinovirus infection), nonparalytic poliomyelitis-like syndrome, epidemic chest muscle pain (acute, febrile, infectious diseases that typically occur in epidemic diseases), hand-foot-and-mouth syndrome, pediatric and adult pancreatitis and severe myocarditis. In some embodiments, the picornaviridae viral infection is a human rhinovirus infection. In some embodiments, the picornaviridae viral infection is an enteroviral infection. In some embodiments, the picornaviridae virus infection is selected from the group consisting of: coxsackie a virus infection, enterovirus D68 infection, enterovirus B69 infection, enterovirus D70 infection, enterovirus a71 infection, and poliovirus infection. In some embodiments, the picornaviridae virus is Foot and Mouth Disease Virus (FMDV).
In some embodiments, the present disclosure provides a method of treating picornaviridae virus infection in a subject (e.g., human) in need thereof, characterized by using a compound of the present disclosure or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides the use of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for treating a picornaviridae virus infection in a subject (e.g., a human). In some embodiments, the picornaviridae viral infection is a human rhinovirus infection.
In some embodiments, the present disclosure provides compounds of the present disclosure, or pharmaceutically acceptable salts thereof, for use in treating picornaviridae virus infections in a subject (e.g., human) in need thereof. In some embodiments, the picornaviridae viral infection is a human rhinovirus infection.
D. Flaviviridae family
In some embodiments, the viral infection is a flaviviridae viral infection. In some embodiments, the present disclosure provides a method of treating a flaviviridae virus infection in a subject (e.g., a human) in need thereof, the method comprising administering to the subject (e.g., a human) a therapeutically effective amount of a compound of the present disclosure or a pharmaceutically acceptable salt thereof. Representative flaviviridae viruses include, but are not limited to, dengue fever, yellow fever, west nile, zika, japanese encephalitis virus, tick-borne encephalitis virus (TBEV), and Hepatitis C Virus (HCV). In some embodiments, the flaviviridae viral infection is a dengue viral infection. In some embodiments, the flaviviridae viral infection is a yellow fever viral infection. In some embodiments, the flaviviridae viral infection is a west nile virus infection. In some embodiments, the flaviviridae virus infection is a zika virus infection. In some embodiments, the flaviviridae viral infection is a japanese encephalitis viral infection. In some embodiments, the flaviviridae virus infection is a Tick Borne Encephalitis Virus (TBEV) infection. In some embodiments, the flaviviridae viral infection is a hepatitis c viral infection. In some embodiments, the flaviviridae virus infection is Bovine Viral Diarrhea Virus (BVDV). In some embodiments, the flaviviridae virus infection is Swine Fever Virus (SFV).
In some embodiments, the present disclosure provides a method of treating a flaviviridae virus infection in a subject (e.g., human) in need thereof, characterized by using a compound of the present disclosure or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides the use of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for treating a flaviviridae virus infection in a subject (e.g., a human). In some embodiments, the flaviviridae viral infection is a dengue viral infection. In some embodiments, the flaviviridae viral infection is a yellow fever viral infection. In some embodiments, the flaviviridae viral infection is a west nile virus infection. In some embodiments, the flaviviridae virus infection is a zika virus infection. In some embodiments, the flaviviridae viral infection is a hepatitis c viral infection.
In some embodiments, the present disclosure provides a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, for use in treating a flaviviridae viral infection in a human in need thereof. In some embodiments, the flaviviridae viral infection is a dengue viral infection. In some embodiments, the flaviviridae viral infection is a yellow fever viral infection. In some embodiments, the flaviviridae viral infection is a west nile virus infection. In some embodiments, the flaviviridae virus infection is a zika virus infection. In some embodiments, the flaviviridae viral infection is a hepatitis c viral infection.
E. Filoviridae family
In some embodiments, the viral infection is a filoviridae viral infection. In some embodiments, the present disclosure provides a method of treating a filoviridae infection in a subject (e.g., a human) in need thereof, the method comprising administering to the subject (e.g., a human) a therapeutically effective amount of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof. Representative filoviridae viruses include, but are not limited to, ebola virus (variant Zaire, bundibugio, sudan, tai Forest, or Reston) and marburg virus. In some embodiments, the filoviridae infection is an ebola virus infection. In some embodiments, the filoviridae infection is a marburg infection.
In some embodiments, the present disclosure provides a method of treating a filoviridae infection in a human in need thereof, characterized by using a compound of the present disclosure or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides the use of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for treating a filoviridae viral infection in a human. In some embodiments, the filoviridae infection is an ebola virus infection.
In some embodiments, the present disclosure provides a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, for use in treating a filoviridae infection in a subject (e.g., a human) in need thereof. In some embodiments, the filoviridae infection is an ebola virus infection. In some embodiments, the filoviridae infection is a marburg infection.
Combination therapy
The compounds described herein may also be used in combination with one or more additional therapeutic or prophylactic agents. Accordingly, also provided herein are methods for treating a viral infection in a subject in need thereof, wherein the methods comprise administering to the subject a compound disclosed herein and a therapeutically effective amount of one or more additional therapeutic or prophylactic agents. In some embodiments, the methods comprise administering to a subject a compound disclosed herein and a therapeutically effective amount of one or more additional therapeutic agents. In some embodiments, the compounds disclosed herein are combined with at least one other active therapeutic agent, wherein the combination is for treating a viral infection in a subject in need thereof. In some embodiments, the combination can be used to treat multiple individual viral infections (e.g., RSV and HIV) in one subject. In some embodiments, the compounds disclosed herein are combined with at least one other active therapeutic agent to cover a broader spectrum of respiratory viruses in one treatment without requiring diagnosis.
In some embodiments, the combination can be used to treat the same virus (e.g., RSV) in one subject. Active therapeutic agents include, but are not limited to, approved drugs, therapeutic agents currently in clinical trials, therapeutic agents that have demonstrated efficacy in animal models, therapeutic agents that have demonstrated efficacy in vitro assays, or any of the above.
In some embodiments, the additional therapeutic agent is an antiviral agent. Any suitable antiviral agent can be used in the methods described herein. In some embodiments, the antiviral agent is selected from the group consisting of: 5-substituted 2' -deoxyuridine analogs, nucleoside analogs, pyrophosphate analogs, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, integrase inhibitors, entry inhibitors, acycloguanosine analogs, acyclonucleoside phosphonate analogs, HCV NS5A/NS5B inhibitors, influenza virus inhibitors, interferons, immunostimulants, oligonucleotides, antimitotic inhibitors, and combinations thereof.
In some embodiments, the additional therapeutic agent is a 5-substituted 2' -deoxyuridine analog. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: iodouridine, trifluorouridine, brivudine [ BVDU ], and combinations thereof.
In some embodiments, the additional therapeutic agent is a nucleoside analog. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: vidarabine, entecavir (ETV), telmisartan, lamivudine, adefovir dipivoxil, tenofovir Disoproxil Fumarate (TDF), and combinations thereof. In some embodiments, the additional therapeutic agent is fapirat Weili bavin, ganciclovir, β -D-N4-hydroxycytidine, or a combination thereof.
In some embodiments, the additional therapeutic agent is a pyrophosphate analog. For example, in some embodiments, the additional therapeutic agent is foscarnet or phosphonoacetic acid. In some embodiments, the additional therapeutic agent is foscarnet.
In some embodiments, the additional therapeutic agent is a nucleoside reverse transcriptase inhibitor. In some embodiments, the antiviral agent is zidovudine, didanosine, zalcitabine, stavudine, lamivudine, abacavir, emtricitabine, and combinations thereof.
In some embodiments, the additional therapeutic agent is a non-nucleoside reverse transcriptase inhibitor. In some embodiments, the antiviral agent is selected from the group consisting of: nevirapine, delavirdine, efavirenz, itraconazole, rilpivirine, and combinations thereof.
In some embodiments, the additional therapeutic agent is a protease inhibitor. In some embodiments, the protease inhibitor is an HIV protease inhibitor. For example, in some embodiments, the antiviral agent is selected from: saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir, atazanavir, fosamprenavir, darinavir, telanavir, cobicistat, and combinations thereof. In some embodiments, the antiviral agent is selected from: saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir, atazanavir, fosamprenavir, darinavir, telanavir, and combinations thereof. In some embodiments, the protease inhibitor is an HCV NS3/4A protease inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: fu Xirui, anapivir, boceprevir, paraprevir, cimirar, telaprevir, valacyclovir, glazopivir, ribavirin, danorevir, famprivir, videprevir, sovaprevir, darifer, naraprevir, and combinations thereof. In some embodiments, the additional therapeutic agent is selected from the group consisting of: fu Xirui, anapiri, boceprevir, paraprevir, cimirar, telaprevir, valacyclovir, glazoprevir, and combinations thereof.
In some embodiments, the additional therapeutic agent is an integrase inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: raltegravir, dolutegravir, etiravir, abacavir, lamivudine, and combinations thereof. In some embodiments, the additional therapeutic agent is selected from the group consisting of: bicagrelor, raltegravir, dolutegravir, cabozavir, etiravir, and combinations thereof. In some embodiments, the additional therapeutic agent is selected from the group consisting of: bicaglivir, dolutegravir He Kabo tewei, and combinations thereof. In some embodiments, the additional therapeutic agent is bicalundum.
In some embodiments, the additional therapeutic agent is an entry inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: behenyl alcohol, enfuvirtide, maraviroc, ibalizumab, futidine Sha Wei, leronelimab, ibalizumab, futidine Sha Wei, leronelimab, palivizumab, intravenous respiratory syncytial virus immunoglobulin [ RSV-IGIV ], varicella zoster immunoglobulin [ VariZIG ], varicella zoster immunoglobulin [ VZIG ]), and combinations thereof.
In some embodiments, the additional therapeutic agent is an acyclovir analog. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: acyclovir, ganciclovir, valacyclovir (also known as valacyclovir), valganciclovir, penciclovir, famciclovir, and combinations thereof.
In some embodiments, the additional therapeutic agent is an acyclic nucleoside phosphonate analog. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: cidofovir, adefovir dipivoxil, tenofovir, TDF, emtricitabine, efavirenz, rilpivirine, etiracer, and combinations thereof. In some embodiments, the additional therapeutic agent is selected from the group consisting of: cidofovir, adefovir dipivoxil, tenofovir, TDF, and combinations thereof. In some embodiments, the additional therapeutic agent is selected from the group consisting of: cidofovir, adefovir dipivoxil, tenofovir, TDF, and combinations thereof.
In some embodiments, the additional therapeutic agent is an HCV NS5A/NS5B inhibitor. In some embodiments, the additional therapeutic agent is an NS3/4A protease inhibitor. In some embodiments, the additional therapeutic agent is an NS5A protease inhibitor. In some embodiments, the additional therapeutic agent is a nucleoside/nucleotide type NS5B polymerase inhibitor. In some embodiments, the additional therapeutic agent is a non-nucleoside type NS5B polymerase inhibitor. In some embodiments, the additional therapeutic agent is selected from the group consisting of: dacarbazine, ledipasvir, velpatavir, obetavir, elbavir, sofosbuvir, dasabacavir, ribavirin, atazanavir, cimiravir, parvovir, ritonavir, elbavir, glazopinvir, and combinations thereof. In some embodiments, the additional therapeutic agent is selected from the group consisting of: dacarbavir, ledipasvir, velpatasvir, obetavir, elbavir, sofosbuvir, dasabavir, and combinations thereof.
In some embodiments, the additional therapeutic agent is an influenza virus inhibitor. In some embodiments, the additional therapeutic agent is a matrix 2 inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: amantadine, rimantadine, and combinations thereof. In some embodiments, the additional therapeutic agent is a neuraminidase inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: zanamivir, oseltamivir, peramivir, ranimivir octanoate, and combinations thereof. In some embodiments, the additional therapeutic agent is a polymerase inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: ribavirin, fampicvir, and combinations thereof. In some embodiments, the additional therapeutic agent is selected from the group consisting of: amantadine, rimantadine, arbidol (Wu Minuo-well), balo Sha Weima-Boxib, oseltamivir, peramivir, ingavirin, ranimivir octanoate, zanamivir, fapira Weili bar Wei Linyi, and combinations thereof. In some embodiments, the additional therapeutic agent is selected from the group consisting of: amantadine, rimantadine, zanamivir, oseltamivir, peramivir, ranimivir octanoate, ribavirin, fampicvir, and combinations thereof.
In some embodiments, the additional therapeutic agent is an interferon. In some embodiments, the additional therapeutic agent is selected from the group consisting of: interferon alfacon 1, interferon alfacon 1b, interferon alfacon 2a, interferon alfacon 2b, pegylated interferon alfacon 1b, pegylated interferon alfacon 2a (pegfnα -2 a) and pegfnα -2b. In some embodiments, the additional therapeutic agent is selected from the group consisting of: interferon alfacon 1, interferon alpha 1b, interferon alpha 2a, interferon alpha 2b, pegylated interferon alpha 2a (pegfnα -2 a) and pegfnα -2b. In some embodiments, the additional therapeutic agent is selected from the group consisting of: interferon alfacon 1, pegylated interferon alpha 2a (pegfnα -2 a), pegfnα -2b and ribavirin. In some embodiments, the additional therapeutic agent is pegylated interferon alfa-2 a, pegylated interferon alfa-2 b, or a combination thereof.
In some embodiments, the additional therapeutic agent is an immunostimulant. In some embodiments, the additional therapeutic agent is an oligonucleotide. In some embodiments, the additional therapeutic agent is an anti-mitotic inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: fumivirgen, pradafil, imiquimod, feverine, and combinations thereof.
In some embodiments, the additional therapeutic agent is selected from the group consisting of: bei Xifu, nitazoxanide, REGN2222, doravirine, sofosbuvir, valpatavir, daclatavir, atazanavir, bei Kabu, FV100 and letrozole, and combinations thereof.
In some embodiments, the additional therapeutic agent is an agent for treating RSV. For example, in some embodiments, the antiviral agent is ribavirin, ALS-8112, or pregovir. For example, in some embodiments, the antiviral agent is ALS-8112 or Primatolvir.
In some embodiments, the additional therapeutic agent is an agent for treating picornavirus. In some embodiments, the additional therapeutic agent is selected from the group consisting of hydantoin, guanidine hydrochloride, L-butylsulfanilide, py-11, and combinations thereof. In some embodiments, the additional therapeutic agent is a picornavirus polymerase inhibitor. In some embodiments, the additional therapeutic agent is rupintrovir.
In some embodiments, the additional therapeutic agent is an agent for treating malaria. In some embodiments, the additional therapeutic agent is chloroquine.
In some embodiments, the additional therapeutic agent is selected from the group consisting of: hydroxychloroquine, chloroquine, artemether, lumefantrine, chloroguanidine, tafenoquine, flunaridine, arteannuin, dihydroartemisinin, piperaquine, arteannuin, amodiaquine, flunaridine, arteannuin, halofantrine, quinine sulfate, mefloquine, solimycin, ethylpyrimidine, MMV-390048, ferrocene chloroquine, artemisinin mesylate, ganaplacide, DSM-265, pepademine, artemisinin, and combinations thereof.
In some embodiments, the additional therapeutic agent is an agent for treating coronavirus. In some embodiments, the additional therapeutic agent is an agent for treating covd-19 (coronavirus disease 2019, a disease caused by a virus designated SARS-CoV-2). In some embodiments, the additional therapeutic agent is selected from the group consisting of: IFX-1, FM-201, CYNK-001, DPP4-Fc, ranpirnase, nafamostat, LB-2, AM-1, anti-viral porin, redeSivir, VV116, GS-441524, GS-5245, and combinations thereof.
In some embodiments, the additional therapeutic agent is an agent for treating ebola virus. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: ribavirin, palivizumab, motavizumab (motavizumab), RSV-IGIVMEDI-557, A-60444, MDT-637, BMS-433771, amiodarone, dronedarone, verapamil, ebola Convalescence Plasma (ECP), TKM-100201, BCX4430 ((2S, 3S,4R, 5R) -2- (4-amino-5H-pyrrolo [3, 2-d)]Pyrimidine-7-yl) -5- (hydroxymethyl) pyrrolidine-3, 4-diol), fampicvir (also known as T-705 or Avigan), T-705 monophosphate, T-705 diphosphate, T-705 triphosphate, FGI-106 (1-N, 7-N-bis [3- (dimethylamino) propyl) ]-3, 9-dimethylquinoline [8,7-h]Quinolone-1, 7-diamine), JK-05, TKM-Ebola, ZMapp, rNAPc, VRC-EBOADC076-00-VP, OS-2966, MVA-BN filo, bromocidofovir, ebola vaccine based on Vaxart adenovirus vector 5, ad26-ZEBOV, filoVax vaccine, GOVX-E301, GOVX-E302, ebola virus entry inhibitor (NPC 1 inhibitor), rVSV-EBOV, and combinations thereof. In some embodiments, the additional therapeutic agent is ZMapp, mAB114, REGEN-EB3, and a combination thereof.
In some embodiments, the additional therapeutic agent is an agent for treating HCV. In some embodiments, the additional therapeutic agent is an HCV polymerase inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: sofosbuvir, GS-6620, PSI-938, ribavirin, tegobuvir, ruidabuvir, MK-0608, and combinations thereof. In some embodiments, the additional therapeutic agent is an HCV protease inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: such as GS-9256, vidoprovir, fu Xirui, and combinations thereof.
In some embodiments, the additional therapeutic agent is an NS5A inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: ledipasvir, velpatasvir, and combinations thereof.
In some embodiments, the additional therapeutic agent is an anti-HBV agent. For example, in some embodiments, the additional therapeutic agent is tenofovir disoproxil fumarate and emtricitabine, or a combination thereof. Examples of additional anti-HBV agents include, but are not limited to, AIC-649, alpha-hydroxy-tolhenone, amadoravir, an Zhuokui nool, beta-hydroxy-cytidine, ARB-199, CCC-0975, CCC-R08, elvucitabine, ezetimibe, cyclosporin a, gentiopicroside, HH-003, grappla peptide, JNJ-56136379, CV-431, nitazoxanide, bianappa, NJK14047, NOV-205 (molixan, BAM-205), oligonucleotides, mi Fu-t, feron, GST-HG-131, levamisole, ka Shu Ning, alloferon, WS-007, Y-101 (Ti Fen Tai), rSIFN-co, PEG-IIFNm, KW-3, BP-Inter-014, caryophyllin, hepB-nRNA, cTP-5 (rTP-5), HSK-II-2, HEISCO-106-1, HEISCO-106, hepbarna, IBPB-006IA, hepuyinfen, dasKloster 0014-01, ISA-204, jiangantai (Ganxikang), MIV-210, OB-AI-004, PF-06, picroside, dasKlopter-0039, hepulantai, IMB-2613, TCM-800B, reduced glutathione, RO-6864018, RG-7834, QL-007 sofosbuvir, leepadi-551, UB and ZH-2N, and US20150210682 (Roche), US 2016/012344 (Roche), WO2015173164, WO2016023877, US2015252057A (Roche), WO16128335A1 (Roche), WO16120186A1 (Roche), US2016237090A (Roche), WO16107833A1 (Roche), WO16107832A1 (Roche), US2016176899A (Roche), WO16102438A1 (Roche), WO, WO16012470A1 (Roche), US2016220586A (Roche) and US2015031687a (Roche). In some embodiments, the additional therapeutic agent is an HBV polymerase inhibitor. Examples of HBV DNA polymerase inhibitors include, but are not limited to, adefovirEmtricitabine->Tenofovir disoproxil fumarate +.>Tenofovir alafenamide, tenofovir disoproxil fumarate, tenofovir alafenamide hemifumarate, tenofovir dipivoxil fumarate, tenofovir Wei Shiba alkoxyethyl ester, CMX-157, tenofovir exalide, bei Xifu, entecavir @, and>entecavir maleate, telbivudine +.>Fluoxetine Weipu adefovir, clavulanate, ribavirin, lamivudine Azidothalamine, famciclovir, fusarin (fusolin), metacavir, SNC-019754, FMCA, AGX-1009, AR-II-04-26, HIP-1302, tenofovir disoproxil aspartate, tenofovir disoproxil orotate and HS-10234. In some embodiments, the additional therapeutic agent is an HBV capsid inhibitor.
In some embodiments, the additional therapeutic agent is an agent for treating HIV. In some embodiments, the additional therapeutic agent is selected from the group consisting of: HIV protease inhibitors, HIV integrase inhibitors, entry inhibitors, HIV nucleoside reverse transcriptase inhibitors, HIV non-nucleoside reverse transcriptase inhibitors, acyclic nucleoside phosphonate analogs, and combinations thereof.
In some embodiments, the additional therapeutic agent is selected from the group consisting of: HIV protease inhibitors, HIV non-nucleoside or non-nucleotide reverse transcriptase inhibitors, HIV nucleoside or nucleotide reverse transcriptase inhibitors, HIV integrase inhibitors, HIV non-catalytic site (or allosteric) integrase inhibitors, HIV entry inhibitors, HIV maturation inhibitors, immunomodulators, immunotherapeutic agents, antibody-drug conjugates, gene modifiers, gene editing agents (such as CRISPR/Cas9, zinc finger nucleases, homing nucleases, synthetic nucleases, TALENs) and cell therapies (such as chimeric antigen receptor T cells, CAR-T and engineered T cell receptors, TCR-T, autologous T cell therapies).
In some embodiments, the additional therapeutic agent is selected from the group consisting of: combination drugs for HIV, other drugs for the treatment of HIV, HIV protease inhibitors, HIV reverse transcriptase inhibitors, HIV integrase inhibitors, HIV non-catalytic site (or allosteric) integrase inhibitors, HIV entry (fusion) inhibitors, HIV maturation inhibitors, latency reversers, capsid inhibitors, immune based therapies, PI3K inhibitors, HIV antibodies and bispecific antibodies and "antibody-like" therapeutic proteins, and combinations thereof.
In some embodiments, the additional therapeutic agent is an HIV combination. Examples of HIV combination drugs include, but are not limited to(efavirenz, tenofovir disoproxil fumarate and emtricitabine); />(bicalundvir, emtricitabine, and tenofovir alafenamide); />(/>Rilpivirine, tenofovir disoproxil fumarate and emtricitabine); />(eptifibatide, cobicistat, tenofovir disoproxil fumarate, and emtricitabine); />(tenofovir disoproxil fumarate and emtricitabine; TDF+FTC);(tenofovir alafenamide and emtricitabine); />(tenofovir alafenamide, emtricitabine, and rilpivirine); />(tenofovir alafenamide, emtricitabine, cobicistat, and etiracer);(darunavir, tenofovir alafenamide hemifumarate, emtricitabine, and cobalastat); SYMFI TM (efavirenz, lamivudine, and tenofovir disoproxil fumarate); CIMDU (common information management Unit) TM (lamivudine and tenofovir disoproxil fumarate); tenofovir and lamivudine; tenofovir alafenamide and emtricitabine; tenofovir alafenamide hemifumarate and emtricitabine; tenofovir alafenamide hemifumarate, emtricitabine and rilpivirine; tenofovir alafenamide hemifumarate, emtricitabine, cobicistat and eptifibatide; / >(zidovudine and lamivudine; azt+3tc);(/>abacavir sulfate and lamivudine; abc+3tc); />(Lopinavir and ritonavir); />(dolutegravir, abacavir, and lamivudine); />(abacavir sulfate, zidovudine, and lamivudine; abc+azt+3tc); atazanavir and cobalastat; atazanavir sulfate and cobalastat; atazanavir sulfate and ritonavir; darunavir and cobalastat; dolutegravir and rilpivirine; dolutegravir and rilpivirine hydrochloride; dolutegravir, abacavir sulfate, and lamivudine; lamivudine, nevirapine and zidovudine; raltegravir and lamivudine; doravirine, lamivudine, and tenofovir disoproxil fumarate; doravirine, lamivudine and tenofovir disoproxil; dapivirine+levonorgestrel, dulutetravir+lamivudine, dulutetravir+emtricitabine+tenofovir alafenamide, ai Fawei lin+emtricitabine+tenofovir disoproxil, lamivudine+abacavir+zidovudine, lamivudine+abacavir, lamivudine+tenofovir disoproxil fumarate, lamivudine+zidovudine+nevirapine, lopinavir+ritonavir, lopinavir+ritonavir+abacavir+lamivudine, lopinavir+zidovudine+lamivudine, tenofovir dipivoxil fumarate+emtricitabine+rilpivirine hydrochloride, lopinavir, ritonavir, zidovudine and lamivudine.
In some embodiments, the additional therapeutic agent is an HIV capsid inhibitor (e.g., lynacapavir).
In some embodiments, the additional therapeutic agent is an HIV protease inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir, atazanavir, fosamprenavir, darinavir, telanavir, cobalastat, ASC-09, AEBL-2, MK-8718, GS-9500, GS-1156, and combinations thereof. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir, atazanavir, fosamprenavir, darinavir, telanavir, and cobalastat. In some embodiments, the additional therapeutic agent is selected from the group consisting of: amprenavir, atazanavir, bei Kana (brecanavir), darunavir, fosamprenavir calcium, indinavir sulfate, lopinavir, nelfinavir mesylate, ritonavir, saquinavir mesylate, telanavir, DG-17, TMB-657 (PPL-100), T-169, BL-008, MK-8122, TMB-607, TMC-310911, and combinations thereof.
In some embodiments, the additional therapeutic agent is an HIV integrase inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: raltegravir, etiravir, dolutegravir, abacavir, lamivudine, bicavir, and combinations thereof. In some embodiments, the additional therapeutic agent is bicalundum. In some embodiments, the additional therapeutic agent is selected from the group consisting of: bicagrelor, eptifibred, curcumin, derivatives of curcumin, chicoric acid, derivatives of 3, 5-dicaffeoylquinic acid, aurintricarboxylic acid, derivatives of aurintricarboxylic acid, phenethyl caffeate, derivatives of phenethyl caffeate, tyrosine kinase inhibitors, derivatives of tyrosine kinase inhibitors, quercetin, derivatives of quercetin, raltegravir, dolutegravir, JTK-351, bicagrel, AVX-15567, BMS-986197, cabspecific (long-acting injection), dikeoquinoline-4-1 derivatives, integrase-LEDGF inhibitors, ledgins, M-522, M-532, NSC-310217, NSC-371056, NSC-48240, NSC-642710, NSC-699171, NSC-699172, NSC-699173, NSC-699174, stilbenedisulfonic acid, T-169, kaposi, and combinations thereof.
In some embodiments, the additional therapeutic agent is an HIV entry inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: enfuvirtide, malavir Luo Yi, and combinations thereof. Additional examples of HIV entry inhibitors include, but are not limited to, cenicriviroc (cenicriviroc), CCR5 inhibitors, gp41 inhibitors, CD4 ligation inhibitors, DS-003 (BMS-599793), gp120 inhibitors, and CXCR4 inhibitors. Examples of CCR5 inhibitors include alavir, valvirrol, maravirrol, cenicriviroc, leronelimab (PRO-140), adatavir (RAP-101), nifevirol (TD-0232), anti-GP 120/CD4 or CCR5 bispecific antibodies, B-07, MB-66, polypeptide C25P, TD-0680 and vMIP (haiminipu). Examples of CXCR4 inhibitors include pleshafu, ALT-1188, N15 peptide and vMIP (Haimipu).
In some embodiments, the additional therapeutic agent is an HIV nucleoside reverse transcriptase inhibitor. In some embodiments, the additional therapeutic agent is an HIV non-nucleoside reverse transcriptase inhibitor. In some embodiments, the additional therapeutic agent is an acyclic nucleoside phosphonate analog. In some embodiments, the additional therapeutic agent is an HIV capsid inhibitor.
In some embodiments, the additional therapeutic agent is an HIV nucleoside or nucleotide reverse transcriptase inhibitor. For example, the additional therapeutic agent is selected from: adefovir, adefovir dipivoxil, alfudine, emtricitabine, tenofovir alafenamide fumarate, tenofovir alafenamide hemifumarate, tenofovir disoproxil fumarate, tenofovir disoproxil hemifumarate, tenofovir disoproxil fumarate, enofovir disoproxil fumarate, and other drugs, And->(Dedanosin, d)dl), abacavir sulfate, alovudine, aliscitabine, cinacadine, didanosine, elvucitabine, festinavir (festinavir), fosfutidine (fosalvudine tidoxil), CMX-157, dapivirine, doravirine, itravirverine, OCR-5753, tenofovir disoproxil orotate, fozidine, islatavir, lamivudine, azidothiazid (phosphozid), stavudine, zalcitabine, zidovudine, luo Wafu, and-etafenamide (GS-9131), GS-9148, MK-8504, MK-8591, MK-858, VM-2500, KP-1461, and combinations thereof.
In some embodiments, the additional therapeutic agent is an HIV non-nucleoside or non-nucleotide reverse transcriptase inhibitor. For example, the additional agent is selected from: dapivudine, delavirdine mesylate, efavirenz, itravirenz, lentinan, MK-8583, nevirapine, rilpivirine, TMC-278LA, ACC-007, AIC-292, KM-023, PC-1005, ai Fawei linrilp (VM-1500), and combinations thereof.
In some embodiments, the additional therapeutic agent is selected from(efavirenz, tenofovir disoproxil fumarate and emtricitabine); / >(/>Rilpivirine, tenofovir disoproxil fumarate and emtricitabine); />(eptifibatide, cobicistat, tenofovir disoproxil fumarate, and emtricitabine); />(tenofovir disoproxil fumarate and emtricitabine; TDF+FTC); />(tenofovir alafenamide and emtricitabine); />(tenofovir alafenamide, emtricitabine, and rilpivirine);(tenofovir alafenamide, emtricitabine, cobicistat, and etiracer); adefovir; adefovir dipivoxil; cocoa butter; emtricitabine; tenofovir; tenofovir disoproxil; tenofovir disoproxil fumarate; tenofovir alafenamide; tenofovir alafenamide hemifumarate; />(dolutegravir, abacavir, and lamivudine); dolutegravir, abacavir sulfate, and lamivudine; raltegravir; raltegravir and lamivudine; maraviroc; enfuwei peptide; />(/>Lopinavir and ritonavir); />(zidovudine and lamivudine; azt+3tc); />(/>Abacavir sulfate and lamivudine; abc+3tc);(Abacavir sulfate, zidovudine and lamivudine; AB)C+azt+3tc); rilpivirine; rilpivirine hydrochloride; atazanavir sulfate and cobalastat; atazanavir and cobalastat; darunavir and cobalastat; atazanavir; atazanavir sulfate; dolutegravir; entecavir; ritonavir; atazanavir sulfate and ritonavir; darunavir is used; lamivudine; pravastatin; fosamprenavir; fosamprenavir calcium efavirenz; itravirin; nelfinavir is used; nelfinavir mesylate; an interferon; didanosine; stavudine; indinavir; indinavir sulfate; tenofovir and lamivudine; zidovudine; nevirapine; saquinavir; saquinavir mesylate; aldesleukin; zalcitabine; telanavir; amprenavir; delavirdine; delavirdine mesylate; radha-108 (acceptor alcohol); lamivudine and tenofovir disoproxil fumarate; efavirenz, lamivudine and tenofovir disoproxil fumarate; azido phosphine; lamivudine, nevirapine and zidovudine; abacavir; and abacavir sulfate.
In some embodiments, the additional therapeutic agent is selected from the group consisting of: colistin, valrubicin, antipobate, bepotastine, epirubicin, epothilone, vaptan, aprepitant, caspofungin, perphenazine, atazanavir, efavirenz, ritonavir, acyclovir, ganciclovir, penciclovir, prulifloxacin, bicangevir, nelfinavir, tegobuvi, nelfinavir, praziquantel, pitavastatin, pirrenaphthalene, eszopiclone and zopiclone.
In some embodiments, the additional therapeutic agent is an inhibitor of Bruton's tyrosine kinase (BTK, AGMX1, AT, ATK, BPK, IGHD, IMD1, PSCTK1, XLA; NCBI GeneID: 695). For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: (S) -6-amino-9- (1- (but-2-ynyl) pyrrolidin-3-yl) -7- (4-phenoxyphenyl) -7H-purin-8 (9H) -one, acartinib (ACP-196), BGB-3111, CB988, HM71224, ibrutinib (Imbruvica), M-2951 (E Wu Buti Ni (Evobrutinib)), M7583, tiratrinib (ONO-4059), PRN-1008, capetinib (CC-292), TAK-020, vicabobutrinib (vecabotinib), ARQ-531, SHR-1459, DTRMWXHS-12, TAS-5315, AZD6738, acartinib, danfacide, and combinations thereof. In some embodiments, the additional therapeutic agent is selected from the group consisting of: tiraminib, ibrutinib, acartinib, and combinations thereof. In some embodiments, the additional therapeutic agent is selected from the group consisting of: telapride, ibrutinib, and combinations thereof. In some embodiments, the additional therapeutic agent is tyrosine kinase inhibitor A9 (A9).
In some embodiments, the additional therapeutic agent is a KRAS inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: AMG-510, COTI-219, MRTX-1257, ARS-3248, ARS-853, WDB-178, BI-3406, BI-1701963, ARS-1620 (G12C), SML-8-73-1 (G12C), compound 3144 (G12D), kobe0065/2602 (Ras GTP), rotor temperature11, MRTX-849 (G12C), and KRAS (G12D) selective inhibitory peptides, including KRPep-2 (Ac-RRCPLYISYDPVCRR-NH 2), KRPep-2D (Ac-RRRRCPLYISYDPVCRRRR-NH 2), and combinations thereof.
In some embodiments, the additional therapeutic agent is a proteasome inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: i Sha Zuomi, carfilzomib, malizomib, bortezomib, and combinations thereof. In some embodiments, the additional therapeutic agent is carfilzomib.
In some embodiments, the additional therapeutic agent is a vaccine. For example, in some embodiments, the additional therapeutic agent is a DNA vaccine, an RNA vaccine, an attenuated live vaccine, a therapeutic vaccine, a prophylactic vaccine, a protein-based vaccine, or a combination thereof. In some embodiments, the additional therapeutic agent is mRNA-1273. In some embodiments, the additional therapeutic agent is INO-4800 or INO-4700. In some embodiments, the additional therapeutic agent is an attenuated live RSV vaccine MEDI-559, an anti-RSV human monoclonal antibody REGN2222, palivizumab, respiratory syncytial virus immunoglobulin, intravenous respiratory syncytial virus immunoglobulin [ RSV-IGIV ], and combinations thereof. In some embodiments, the additional therapeutic agent is an HBV vaccine, such as pediarix, engerix-B and recombivax HB. In some embodiments, the additional therapeutic agent is a VZV vaccine, such as zostavax and varivax. In some embodiments, the additional therapeutic agent is an HPV vaccine, e.g., cervarix, gardasil 9 and gardasil. In some embodiments, the additional therapeutic agent is an influenza virus vaccine. For example, (i) influenza a monovalent vaccines (e.g., influenza a [ H5N1] monovalent vaccines and influenza a [ H1N1]2009 monovalent vaccines), (ii) influenza a and b trivalent vaccines (e.g., afluria, agriflu, fluad, fluarix, flublok, flucelvax, fluLaval, fluvirin and Fluzone), and (iii) influenza a and b tetravalent vaccines (FluMist, fluarix, fluzone and FluLaval). In some embodiments, the additional therapeutic agent is a human adenovirus vaccine (e.g., adenovirus type 4 and type 7 vaccines, live, oral). In some embodiments, the additional therapeutic agent is a rotavirus vaccine (e.g., rotarix of rotavirus serotype G1, G3, G4, or G9 and RotaTeq of rotavirus serotype G1, G2, G3, or G4). In some embodiments, the additional therapeutic agent is a hepatitis a virus vaccine (e.g., havrix and Vaqta). In some embodiments, the additional therapeutic agent is a poliovirus vaccine (e.g., kinrix, quadracel and Ipol). In some embodiments, the additional therapeutic agent is a yellow fever virus vaccine (e.g., YF-Vax). In some embodiments, the additional therapeutic agent is a Japanese encephalitis virus vaccine (e.g., ixiaro and JE-Vax). In some embodiments, the additional therapeutic agent is a measles vaccine (e.g., M-M-R II and ProQuad). In some embodiments, the additional therapeutic agent is a mumps vaccine (e.g., M-M-R II and ProQuad). In some embodiments, the additional therapeutic agent is a rubella vaccine (e.g., M-M-R II and ProQuad). In some embodiments, the additional therapeutic agent is a varicella vaccine (e.g., proQuad). In some embodiments, the additional therapeutic agent is a rabies vaccine (e.g., imovax and RabAvert). In some embodiments, the additional therapeutic agent is a smallpox virus (smallpox) vaccine (ACAM 2000). In some embodiments, the additional therapeutic agent is a Hepatitis E Virus (HEV) vaccine (e.g., HEV 239). In some embodiments, the additional therapeutic agent is a SARS-COV-2 vaccine.
In some embodiments, the additional therapeutic agent is an antibody, e.g., a monoclonal antibody. For example, the additional therapeutic agent is selected from anti-SARS-COV-2 antibodies: regeneron antibodies, wuxi antibodies, vir Biotechnology antibodies, antibodies targeting SARS-CoV-2 spike protein, antibodies that neutralize SARS-CoV-2 (SARS-CoV-2 neutralizing antibodies), and combinations thereof. In some embodiments, the additional therapeutic agent is an anti-SARS CoV antibody CR-3022. In some embodiments, the additional therapeutic agent is an aPD-1 antibody.
In some embodiments, the additional therapeutic agent is a recombinant cytokine gene-derived protein injection.
In some embodiments, the additional therapeutic agent is a polymerase inhibitor. In some embodiments, the additional therapeutic agent is a DNA polymerase inhibitor. For example, in some embodiments, the additional therapeutic agent is cidofovir. In some embodiments, the additional therapeutic agent is an RNA polymerase inhibitor. For example, in some embodiments, the additional therapeutic agent is selected from the group consisting of: ribavirin, fampicvir, lamivudine, p Mo Diwei, and combinations thereof.
In some embodiments, the additional therapeutic agent is selected from the group consisting of: lopinavir, ritonavir, interferon alpha-2 b, ritonavir, arbidol, hydroxychloroquine, darunavir and cobalastat, arbidol hydrochloride, oseltamivir, litonavir, emtricitabine, tenofovir alafenamide fumarate, balo Sha Weima bosch ester, lu Suoti ni, and combinations thereof.
In some embodiments, the additional therapeutic agent is selected from the group consisting of: 6' -fluorinated analogs of mango Lei Su, acyclovir flexim, disulfiram, thiopurine analogs, ASC09F, GC376, GC813, phenylisoserine derivatives, neuraminidase inhibitor analogs, pyrithione derivatives, banning and 5-hydroxyprimary ketone derivatives, SSYA10-001, griffithsin, HR2P-M1, HR2P-M2, P21S10, dihydrotanshinone E-64-C and E-64-D, OC43-HR2P, MERS-5HB, 229E-HR1P, 229E-HR2P, resveratrol, 1-thiophene-4-azaspiro [4.5] decan-3-one derivatives, gemcitabine hydrochloride, loperamide, recombinant interferons, cyclosporin a, alisporivir, imatinib mesylate, dasatinib, settinib, trimeteib, rapamycin, celemetinib, chlorpromazine, trifluorpropazine, fluphenazine, ethionine, promethazine, cycloprotene, 22, cycloprotic acid, and derivatives thereof, 30, and combinations thereof.
In some embodiments, the additional therapeutic agent is an antibody. In some embodiments, the additional therapeutic agent is an antibody that binds to a coronavirus, e.g., an antibody that binds to SARS or MERS. In some embodiments, the additional therapeutic agent is an antibody to SARS-COV-2 virus.
The formulations of the present disclosure are also used in combination with other active ingredients. For the treatment of SARS-COV-2 virus infection, in some embodiments, the other active therapeutic agent has activity against coronavirus infection, e.g., activity against SARS-COV-2 virus infection. The compounds and formulations of the present disclosure are also intended for general care provided for subjects with SARS-COV-2 virus infection, including parenteral fluids (including dextrose saline and ringer's lactate) and nutrients, antibiotics (including metronidazole and cephalosporin antibiotics such as ceftriaxone and cefuroxime) and/or antifungals, fever and pain medications, antiemetics (such as mechlorperamide) and/or antidiarrheal agents, vitamins and mineral supplements (including vitamin K and zinc sulfate), anti-inflammatory agents (such as ibuprofen or steroids), corticosteroids such as methylprednisolone, immunomodulatory drugs (e.g., interferons), other small molecule or biologic antiviral agents targeting SARS-COV-2 (such as but not limited to lopinavir, EIDD-1931, famprin Weili bavin, neutralizing antibodies, and the like), vaccines, pain medications and medications for other common diseases in the subject population such as antimalarial agents (including artemether and artemia), ben-fluorenone-in combination therapies such as ciclovir, such as the antibiotic, such as the cephalosporins, such as the penicillin, or the antibiotic such as the penicillin, the antibiotic, or the antibiotic such as the penicillin. In some embodiments, the additional therapeutic agent is dihydroartemisinin/piperaquine.
In some embodiments, the additional therapeutic agent is an immunomodulatory agent. Examples of immune-based therapies include toll-like receptor modulators such as tlr1, tlr2, tlr3, tlr4, tlr5, tlr6, tlr7, tlr8, tlr9, tlr10, tlr11, tlr12, and tlr13; a regulator of apoptosis protein 1 (Pd-1); a programmed death ligand 1 (Pd-L1) modulator; IL-15 modulators; dermaVir; interleukin-7; plaquenil (hydroxychloroquine); prometryne (aldinterleukin, IL-2); interferon alpha; interferon alpha-2 b; interferon alpha-n 3; pegylated interferon alpha; interferon gamma; hydroxyurea; mycophenolate Mofetil (MPA) and its ester derivative Mycophenolate Mofetil (MMF); ribavirin; polymeric Polyethylenimine (PEI); a gepon; IL-12; WF-10; VGV-1; MOR-22; BMS-936559; CYT-107, interleukin-15/Fc fusion protein, AM-0015, ALT-803, NIZ-985, NKTR-255, NKTR-262, NKTR-214, novolone, pegylated interferon alpha-2 a, pegylated interferon alpha-2 b, recombinant interleukin-15, xmab-24306, RPI-MN, STING modulator, RIG-I modulator, NOD2 modulator, SB-9200 and IR-103. In some embodiments, the additional therapeutic agent is fingolimod, leflunomide, or a combination thereof. In some embodiments, the additional therapeutic agent is thalidomide.
In some embodiments, the additional therapeutic agent is an IL-6 inhibitor, such as tolizumab, sha Lilu mab, or a combination thereof.
In some embodiments, the additional therapeutic agent is an anti-TNF inhibitor. For example, the additional therapeutic agent is adalimumab, etanercept, golimumab, infliximab, or a combination thereof.
In some embodiments, the additional therapeutic agent is a JAK inhibitor, e.g., the additional therapeutic agent is barytani, regatinib, barytani, or a combination thereof.
In some embodiments, the additional therapeutic agent is an inflammation inhibitor, such as pirfenidone.
In some embodiments, the additional therapeutic agent is an antibiotic for secondary bacterial pneumonia. For example, the additional therapeutic agent is a macrolide antibiotic (e.g., azithromycin, clarithromycin, and mycoplasma pneumoniae (mycoplasma pneumoniae)), a fluoroquinolone (e.g., ciprofloxacin and levofloxacin), a tetracycline (e.g., doxycycline and tetracycline), or a combination thereof.
In some embodiments, the compounds disclosed herein are used in combination with a standard of care for pneumonia (see, e.g., pediatric Community Pneumonia Guidelines, CID 2011:53 (day 10 month 1)). Treatment of pneumonia generally involves curing infections and preventing complications. The particular treatment will depend on several factors including the type and severity of the pneumonia, the age and general health of the subject. Options include: (i) antibiotics, (ii) cough drugs, and (iii) antipyretics/analgesics (e.g., aspirin, ibuprofen (Advil, motin IB, etc.), and acetaminophen (tenor, etc.)). In some embodiments, the additional therapeutic agent is bromhexine cough suppressant.
In some embodiments, the compounds disclosed herein are used in combination with immunoglobulins from a cured covd-19 subject. In some embodiments, the compounds disclosed herein are used in combination with plasma infusion. In some embodiments, the compounds disclosed herein are used in combination with stem cells.
In some embodiments, the additional therapeutic agent is a TLR agonist. Examples of TLR agonists include, but are not limited to, vitamin Sha Mode (GS-9620), GS-986, IR-103, diphenhydramod, telxotimmod (tilsmotimmod), ritalimod (ritalimod), DSP-0509, AL-034, G-100, cobitlimmod (cobitlimmod), AST-008, mo Tuo mod (motolimod), GSK-1795091, GSK-2245035, VTX-1463, GS-9688, LHC-165, BDB-001, RG-7854, telratolimod.
In some embodiments, the additional therapeutic agent is selected from the group consisting of: bortezomib, fluoazepam, pranoptinib, sorafenib, perasone, lorcortolone, flucloxacillin, sertindole, clevidipine, atorvastatin, cinnolazepam, clofazimine, fosaprepitant, and combinations thereof.
In some embodiments, the additional therapeutic agent is a calicheamicin, suramin, triazoline, dipyridamole, bevacizumab, meprobamate, GD31 (rhizobia), NLRP inflammation small inhibitor, or alpha-ketoamine. In some embodiments, the additional therapeutic agent is recombinant human angiotensin converting enzyme 2 (rhACE 2). In some embodiments, the additional therapeutic agent is a viral macrophage inflammatory protein (vMIP).
In some embodiments, the additional therapeutic agent is an antiviral porin therapeutic agent. For example, the additional therapeutic agent is BIT-314 or BIT-225. In some embodiments, the additional therapeutic agent is a coronavirus E protein inhibitor. For example, the additional therapeutic agent is BIT-009. Further examples of additional therapeutic agents include those described in WO-2004112687, WO-2006135978, WO-2018145148 and WO-2009018609.
Any of the compounds of the present disclosure can also be combined with one or more additional active therapeutic agents in a single dosage form for simultaneous or sequential administration to a subject. The combination therapy may be administered as a simultaneous or sequential regimen. When administered sequentially, the combination may be administered in two or more administrations.
Co-administration of a compound of the present disclosure with one or more other active therapeutic agents generally refers to simultaneous or sequential administration of the compound of the present disclosure and one or more other active therapeutic agents such that a therapeutically effective amount of both the compound of the present disclosure and the one or more other active therapeutic agents are present in the subject.
Co-administration includes administering a unit dose of a compound of the present disclosure before or after administering a unit dose of one or more other active therapeutic agents, e.g., within seconds, minutes, or hours of administering one or more other active therapeutic agents. For example, a unit dose of a compound of the present disclosure may be administered first, followed by a unit dose of one or more other active therapeutic agents within seconds or minutes. Alternatively, a unit dose of one or more other therapeutic agents may be administered first, followed by a unit dose of a compound of the present disclosure within seconds or minutes. In some cases, it may be desirable to first administer a unit dose of a compound of the present disclosure, followed by administration of the unit dose of one or more other active therapeutic agents after several hours (e.g., 1 to 12 hours). In other cases, it may be desirable to administer a unit dose of one or more other active therapeutic agents first, then administer the unit dose of a compound of the present disclosure after several hours (e.g., 1 to 12 hours).
Combination therapy may provide "synergy" and "synergy," i.e., an effect achieved when the active ingredients are used together that is greater than the sum of the effects produced by the compounds alone. A synergistic effect is obtained when the active ingredients are in the following conditions: (1) Co-formulation and administration or simultaneous delivery in a combined formulation; (2) alternatively or in parallel delivery as separate formulations; or (3) by some other scheme. When delivered in alternating therapy, a synergistic effect may be obtained when the compounds are administered or delivered, for example, in separate tablets, pills or capsules or by different injection sequences in separate syringes. Generally, during alternating therapy, an effective dose of each active ingredient is administered sequentially (i.e., consecutively), while in combination therapy, an effective dose of two or more active ingredients are administered together. Synergistic antiviral effects mean that the antiviral effect is greater than the predicted net additive effect of each compound in the combination.
A. Combination therapy for the treatment of pneumoviridae virus infections
The compounds disclosed herein and pharmaceutically acceptable salts thereof may be used in combination with any of the active therapeutic agents discussed in section VIII herein and/or with other active therapeutic agents specifically discussed in section viii.a herein for use in the treatment of pneumoviridae virus infections. In some embodiments, the other active therapeutic agent has activity against a pneumoviridae virus infection, particularly a respiratory syncytial virus infection and/or a metapneumovirus infection. As described more fully herein, the compounds of the present disclosure may be administered to a subject (e.g., a human) infected with RSV along with one or more additional therapeutic agents. In addition, in some embodiments, when used to treat or prevent RSV, the compounds of the disclosure may be administered with one or more (e.g., one, two, three, four, or more) additional therapeutic agents selected from the group consisting of RSV combination drugs, RSV vaccine, RSV RNA polymerase inhibitor, immunomodulator toll-like receptor (TLR) modulator, interferon alpha receptor ligand, hyaluronidase inhibitor, respiratory syncytial surface antigen inhibitor, cytotoxic T lymphocyte-associated protein 4 (ipi 4) inhibitor, cyclophilin inhibitor, RSV virus entry inhibitor, antisense oligonucleotide targeting viral mRNA, short interfering RNA (siRNA) and ddRNAi endonuclease modulator, ribonucleotide reductase inhibitor, farnesol X receptor agonist, antibody, CCR2 chemokine antagonist, chest agonist, cytokine, nucleoprotein modulator, retinoic acid-induced gene 1 stimulator, NOD2 stimulator, phosphatidylinositol 3-kinase (PI 3K) inhibitor, indoleamine-2, dioxygenase (pdo) inhibitor, d 3-dioxygenase inhibitor, d 1, a inhibitors of the replication of the RSV-1 pathway, a recombinant protein, a inhibitors of the RSV-1, a tyrosine kinase, a inhibitors of the other pathway.
Non-limiting examples of such other active therapeutic agents active on RSV include active monoclonal and nanobody therapeutic agents, active agents against RSV infection, respiratory syncytial virus protein F inhibitors, viral replication inhibitors, RNA polymerase inhibitors, siRNA-based therapies, and combinations thereof. Non-limiting examples of active monoclonal and nanobody therapeutics include palivizumab, RSV-IGIVMEDI-557 (Movezumab), MEDI8897 (nirsevelimab), MK-1654, ALX-0171, A-60444 (also referred to as RSV 604), anti-RSV G protein antibodies and mixtures thereof. Other non-limiting examples of other active therapeutic agents having anti-respiratory syncytial virus infection activity include respiratory syncytial virus protein F inhibitors such as MDT-637, BMS-433771, AK-0529, RV-521 (sisunavir), JNJ-53718678 (rileatovir), BTA-585 and ordinary Sha Tuowei; RNA polymerase inhibitors such as ribavirin, A-60444 (also known as RSV 604), JNJ-64417184, ALS-8112 (JNJ-64041575; rumicitabine) and ALS-8112 (parent nucleus of rumicitabine); inhibitors of viral replication such as EDP-938 and nitazoxanide; siRNA-based therapies, such as ALN-RSV01; and combinations thereof.
In some embodiments, the additional active therapeutic agent may be a vaccine for the treatment or prevention of RSV, including, but not limited to, MVA-BN RSV, RSV-F, MEDI-8897, JNJ-64400141, DPX-RSV, synGEM, GSK-3389245A, GSK-300389-1A, RSV-MEDI deltaM2-2 vaccine, VRC-RSVRGP084-00VP, ad35-RSV-FA2, ad26-RSV-FA2, and RSV fusion glycoprotein subunit vaccine.
Non-limiting examples of other active therapeutic agents active on metapneumoviral infections include sialidase modulators, such as DAS-181; RNA polymerase inhibitors such as ALS-8112; and antibodies, such as EV-046113, for use in the treatment of metapneumoviral infections.
In some embodiments, the additional active therapeutic agent may be a vaccine for treating or preventing metapneumovirus infection, including but not limited to mRNA-1653 and rhpv-Pa vaccines.
B. Combination therapy for the treatment of picornaviridae virus infections
The compounds disclosed herein and pharmaceutically acceptable salts thereof can be used in combination with any of the active therapeutic agents discussed in section VIII herein and/or with other active therapeutic agents specifically discussed in section viii.b herein for use in treating picornaviridae virus infections. In some embodiments, the additional active therapeutic agent is active against picornaviridae virus infections, particularly enterovirus infections. Non-limiting examples of such other active therapeutic agents are capsid binding inhibitors such as praecox, BTA-798 (valpradavir) and other compounds disclosed by Wu et al (US 7,078,403) and Watson (US 7,166,604); fusion sialidase proteins, such as DAS-181; capsid protein VP1 inhibitors such as VVX-003 and AZN-001; viral protease inhibitors such as CW-33; phosphatidylinositol 4 kinase beta inhibitors such as GSK-480 and GSK-533; anti-EV 71 antibody.
In some embodiments, the additional active therapeutic agent may be a vaccine for treating or preventing picornaviridae virus infection, including but not limited to EV71 vaccine, TAK-021, and EV-D68 adenovirus vector-based vaccine.
C. Combination therapy for the treatment of respiratory viral infections
The compounds disclosed herein, and pharmaceutically acceptable salts thereof, may be used in combination with any of the active therapeutic agents discussed in section VIII herein and/or other active therapeutic agents specifically discussed in section viii.c herein. Many infections with viruses of the pneumoviridae and picornaviridae families are respiratory tract infections. Thus, additional active therapeutic agents for the treatment of respiratory symptoms and infection sequelae may be used in combination with the compounds provided herein. The additional therapeutic agent may be administered orally or by direct inhalation. For example, other additional therapeutic agents for use in combination with the compounds provided herein in the treatment of viral respiratory infections include, but are not limited to, bronchodilators and corticosteroids.
Glucocorticoid
Glucocorticoids (Carryer, journal of Allergy,21,282-287,1950) introduced for the first time as asthma therapies in 1950 remain the most effective and sustained effective therapies for this disease, but their mechanism of action is not fully understood (Morris, j. Allergy clin. Immunol.,75 (1 Pt) 1-13,1985). Unfortunately, oral glucocorticoid therapy is associated with serious adverse side effects such as trunk obesity, hypertension, glaucoma, glucose intolerance, accelerated cataract formation, bone mineral loss, and psychological effects, all of which limit its use as a long-term therapeutic agent (Goodman and Gilman, 10 th edition, 2001). A solution to systemic side effects is the direct delivery of steroid drugs to the site of inflammation. Inhaled Corticosteroids (ICS) have been developed to alleviate the serious side effects of oral steroids. Non-limiting examples of corticosteroids that may be used in combination with the compounds provided herein are dexamethasone, dexamethasone sodium phosphate, fluoromethalone acetate, loteprednol etabonate, prednisolone, fludrocortisone, triamcinolone acetonide, betamethasone, beclomethasone dipropionate, methylprednisolone, fluocinolone acetonide, flunisolide, flucortin-21-butyrate, fluocinolone acetonide, budesonide, halobetasol propionate, mometasone furoate, fludexamethasone, AZD-7594, ciclesonide; or a pharmaceutically acceptable salt thereof.
Anti-inflammatory agent
Other anti-inflammatory agents that act through an anti-inflammatory cascade mechanism may also be used as additional therapeutic agents in combination with the compounds provided herein for the treatment of viral respiratory tract infections. The use of "anti-inflammatory signal transduction modulators" (referred to as AISTM in this text), such as phosphodiesterase inhibitors (e.g., PDE-4, PDE-5 or PDE-7 specific), transcription factor inhibitors (e.g., blocking NF κB by IKK inhibition), or kinase inhibitors (e.g., blocking P38 MAP, JNK, PI3K, EGFR or Syk) is a logical approach to shutting off inflammation, as these small molecules target a limited number of common intracellular pathways-those signal transduction pathways that are key points for anti-inflammatory therapeutic intervention (see review of P.J. Barnes, 2006). These non-limiting additional therapeutic agents include: 5- (2, 4-difluoro-phenoxy) -1-isobutyl-1H-indazole-6-carboxylic acid (2-dimethylamino-ethyl) -amide (P38 Map kinase inhibitor ARRY-797); 3-cyclopropylmethoxy-N- (3, 5-dichloro-pyridin-4-yl) -4-difluoromethoxy-benzamide (PDE-4 inhibitor roflumilast); 4- [2- (3-cyclopentyloxy-4-methoxyphenyl) -2-phenyl-ethyl ] -pyridine (PDE-4 inhibitor CDP-840); n- (3, 5-dichloro-4-pyridinyl) -4-difluoromethoxy-8- [ (methylsulfonyl) amino ] -1-dibenzofuran carboxamide (PDE-4 inhibitor Oglemulast); n- (3, 5-dichloro-pyridin-4-yl) -2- [1- (4-fluorobenzyl) -5-hydroxy-1H-indol-3-yl ] -2-oxo-acetamide (PDE-4 inhibitor AWD 12-281); 8-methoxy-2-trifluoromethyl-quinoline-5-carboxylic acid (3, 5-dichloro-1-oxy-pyridin-4-yl) -amide (PDE-4 inhibitor Sch 351591); 4- [5- (4-fluorophenyl) -2- (4-methanesulfonyl-phenyl) -1H-imidazol-4-yl ] -pyridine (P38 inhibitor SB-203850); 4- [4- (4-fluorophenyl) -1- (3-phenylpropyl) -5-pyridin-4-yl-1H-imidazol-2-yl ] -but-3-yn-1-ol (P38 inhibitor RWJ-67657); 4-cyano-4- (3-cyclopentyloxy-4-methoxy-phenyl) -cyclohexanecarboxylic acid 2-diethylamino-ethyl ester (2-diethyl-ethyl ester prodrug of cilomilast, PDE-4 inhibitor); (3-chloro-4-fluorophenyl) - [ 7-methoxy-6- (3-morpholin-4-yl-propoxy) -quinazolin-4-yl ] -amine (gefitinib, EGFR inhibitor); 4- (4-methyl-piperazin-1-ylmethyl) -N- [ 4-methyl-3- (4-pyridin-3-yl-pyrimidin-2-ylamino) -phenyl ] -benzamide (imatinib, an EGFR inhibitor).
Beta 2-adrenoreceptor agonist bronchodilators
Combinations comprising an inhaled β2-adrenoreceptor agonist bronchodilator such as formoterol, salbutamol or salmeterol with a compound provided herein are also suitable but non-limiting combinations that can be used to treat respiratory viral infections.
Inhaled beta 2-adrenoreceptor agonist bronchodilators such as formoterol or salmeterol in combination with ICS can be used to treat bronchoconstriction and inflammation (respectivelyAnd->). Combinations comprising these ICS and a β2-adrenoreceptor agonist combination, and the compounds provided herein, are also suitable but non-limiting combinations useful for treating respiratory viral infections.
Other examples of beta 2 adrenergic receptor agonists include, but are not limited to, bedoradrine, vilantriol, indacaterol, odaterol, tolterol, formoterol, abiraterone, salbutamol, arformoterol, levosalbutamol, fenoterol, and TD-5471.
Anticholinergic agents
Anticholinergic agents have potential use for the treatment or prevention of pulmonary bronchoconstriction, and thus can be used as an additional therapeutic agent in combination with the compounds provided herein for the treatment of viral respiratory infections. These anticholinergic agents include, but are not limited to, antagonists of muscarinic receptors (particularly subtype M3), which have been demonstrated for therapeutic efficacy in controlling cholinergic tone of COPD in humans (Witek, 1999); 1- { 4-hydroxy-1- [3, 3-tris- (4-fluorophenyl) -propionyl ] -pyrrolidine-2-carbonyl } -pyrrolidine-2-carboxylic acid (1-methyl-piperidin-4-ylmethyl) -amide; 3- [3- (2-diethylamino-acetoxy) -2-phenyl-propionyloxy ] -8-isopropyl-8-methyl-8-azonia-bicyclo [3.2.1] octane (ipratropium-N, N-diethylglycinate); 1-cyclohexyl-3, 4-dihydro-1H-isoquinoline-2-carboxylic acid 1-aza-bicyclo [2.2.2] oct-3-yl ester (solifenacin); 2-hydroxymethyl-4-methanesulfonyl-2-phenyl-butyric acid 1-aza-bicyclo [2.2.2] oct-3-yl ester (revapride); 2- {1- [2- (2, 3-dihydro-benzofuran-5-yl) -ethyl ] -pyrrolidin-3-yl } -2, 2-diphenyl-acetamide (darifenacin); 4-azepan-1-yl-2, 2-diphenyl-butyramide (Buzepide); 7- [3- (2-diethylamino-acetoxy) -2-phenyl-propionyloxy ] -9-ethyl-9-methyl-3-oxa-9-azonia-tricyclo [3.3.1.02,4] nonane (oxotropine-N, N-diethylglycinate); 7- [2- (2-diethylamino-acetoxy) -2, 2-di-thiophen-2-yl-acetoxy ] -9, 9-dimethyl-3-oxa-9-azonia-tricyclo [3.3.1.02,4] nonane (tiotropium-N, N-diethylglycinate); dimethylamino-acetic acid 2- (3-diisopropylamino-1-phenyl-propyl) -4-methyl-phenyl ester (tolterodine-N, N-dimethylglycine ester); 3- [4, 4-bis- (4-fluorophenyl) -2-oxo-imidazolidin-1-yl ] -1-methyl-1- (2-oxo-2-pyridin-2-yl-ethyl) -pyrrolidinium; 1- [1- (3-fluorobenzyl) -piperidin-4-yl ] -4, 4-bis- (4-fluorophenyl) -imidazolidin-2-one; 1-cyclooctyl-3- (3-methoxy-1-aza-bicyclo [2.2.2] oct-3-yl) -1-phenyl-prop-2-yn-1-ol; 3- [2- (2-diethylamino-acetoxy) -2, 2-dithien-2-yl-acetoxy ] -1- (3-phenoxy-propyl) -1-azonia-bicyclo [2.2.2] octane (aclidinium bromide-N, N-diethylglycinate); or (2-diethylamino-acetoxy) -dithiophene-2-yl-acetic acid 1-methyl-1- (2-phenoxy-ethyl) -piperidin-4-yl ester; lei Fen Nacine, ganluo Bromide, turtelluronium Bromide, tiotropium Bromide, aldrinium Bromide and Benziquizalofom Bromide.
Mucolytic agent
The compounds provided herein may also be combined with mucolytics to treat symptoms of infections and respiratory tract infections. A non-limiting example of a mucolytic agent is ambroxol. Similarly, these compounds may be combined with expectorants to treat symptoms of infection and respiratory tract infections. A non-limiting example of an expectorant is guaifenesin.
Atomized hypertonic saline is used to improve the immediate and long-term clearance of the small airways of subjects with pulmonary disease (Kuzik, j.pediatrics 2007,266). Thus, the compounds provided herein may also be combined with nebulized hypertonic saline, particularly when viral infection is complicated by bronchiolitis. The combination of the compounds provided herein with hypertonic saline may also comprise any of the additional agents discussed above. In some embodiments, 3% hypertonic saline is used.
D. Combination therapy for the treatment of COPD
The compounds disclosed herein and pharmaceutically acceptable salts thereof may be used in combination with any of the active therapeutic agents discussed in section VIII herein and/or with other active therapeutic agents specifically discussed in section viii.d herein for use in treating respiratory exacerbations of COPD. In some embodiments, the additional active therapeutic agent comprises an additional active agent against COPD. Non-limiting examples of such other active therapeutic agents include anti-IL 5 antibodies, such as benralizumab, meperiab; dipeptidyl peptidase I (DPP 1) inhibitors such as AZD-7986 (INS-1007); DNA gyrase inhibitors/topoisomerase IV inhibitors such as ciprofloxacin hydrochloride; MDR-associated protein 4/Phosphodiesterase (PDE) 3 and 4 inhibitors, such as RPL-554; CFTR stimulators such as ivacaine, QBW-251; MMP-9/MMP-12 inhibitors, such as RBx-10017609; adenosine A1 receptor antagonists, such as PBF-680; GATA 3 transcription factor inhibitors such as SB-010; muscarinic receptor modulators/nicotinic acetylcholine receptor agonists such as ASM-024; MARCKS protein inhibitors, such as BIO-11006; kit tyrosine kinase/PDGF inhibitors such as masitinib; phosphodiesterase (PDE) 4 inhibitors such as roflumilast, CHF-6001; phosphoinositide-3 kinase delta inhibitors such as, for example, ne Mi Lisai (nemiralisib); 5-lipoxygenase inhibitors such as TA-270; muscarinic receptor antagonists/β2 adrenergic receptor agonists such as Bei Tefen tertiol succinate, AZD-887, ipratropium bromide; TRN-157; elastase inhibitors such as erdosteine; metalloproteinase-12 inhibitors such as FP-025; interleukin 18 ligand inhibitors such as tadekinigα; skeletal muscle troponin activators such as CK-2127107; p38 MAP kinase inhibitors such as acemapimod; IL-17 receptor modulators, such as CNTO-6785; CXCR2 chemokine antagonists such as danirixin; leukocyte elastase inhibitors such as POL-6014; epoxide hydrolase inhibitors such as GSK-2256294; HNE inhibitors such as CHF-6333; VIP agonists such as alpidil; phosphoinositide-3 kinase delta/gamma inhibitors such as RV-1729; complement C3 inhibitors such as APL-1; and G-protein coupled receptor-44 antagonists, such as AM-211.
Other non-limiting examples of active therapeutic agents also include, but are not limited to, budesonide, adiocell, nitric oxide, PUR-1800, YLP-001, LT-4001, azithromycin, gamunex, QBKPN, sodium pyruvate, MUL-1867, mannitol, MV-130, MEDI-3506, BI-443651, VR-096, OPK-0018, TEV-48107, doxofylline, TEV-46017, oligoG-COPD-5/20,ZP-051 and lysine acetylsalicylic acid.
In some embodiments, the other active therapeutic agent may be a vaccine with anti-COPD activity, including but not limited to MV-130 and GSK-2838497a.
Combination therapy for the treatment of flaviviridae virus infections
The compounds disclosed herein and pharmaceutically acceptable salts thereof can be used in combination with any of the active therapeutic agents discussed in section VIII herein and/or with other active therapeutic agents specifically discussed in section viii.a herein for use in the treatment of flaviviridae viral infections. In some embodiments, the additional active therapeutic agent is active against a flaviviridae virus infection.
For the treatment of flaviviridae virus infections, non-limiting examples of other active therapeutic agents are host cytokine modulators, such as GBV-006; fenretinide ABX-220, BRM-211; alpha-glucosidase 1 inhibitors such as celgosivir (celgosivir); platelet Activating Factor Receptor (PAFR) antagonists, such as modafinil; cadherin-5/factor Ia modulators, such as FX-06; NS4B inhibitors such as JNJ-8359; viral RNA splice regulators such as ABX-202; NS5 polymerase inhibitors; NS3 protease inhibitors; TLR modulators.
In some embodiments, the other active therapeutic agent may be a vaccine for the treatment or prevention of dengue fever, including but not limited to TETRAVAX-DV,DPIV-001, TAK-003, live attenuated dengue vaccine, tetravalent DNA vaccine, rDEN2delta30-7169 and DENV-1PIV.
Combination therapy for the treatment of infections with viruses of the family filoviridae
The compounds disclosed herein and pharmaceutically acceptable salts thereof can be used in combination with any of the active therapeutic agents discussed in section VIII herein and/or with other active therapeutic agents specifically discussed in section viii.f herein for use in treating a filoviridae viral infection. In some embodiments, the other active therapeutic agent is active against a filoviridae infection (e.g., marburg, ebola, sudan, and kuwa virus infections). Non-limiting examples of such other active therapeutic agents include: MR186-YTE, redexivir, ribavirin, palivizumab, movebanab, RSV-IGIVMEDI-557, A-60444, MDT-637, BMS-433771, amiodarone, dronedarone, verapamil, ebola Convalescence Plasma (ECP), TKM-100201, BCX4430 ((2S, 3S,4R, 5R) -2- (4-amino-5H-pyrrolo [3, 2-d) ]Pyrimidin-7-yl) -5- (hydroxymethyl) pyrrolidine-3, 4-diol), TKM-Ebola, T-705 monophosphate, T-705 diphosphate, T-705 triphosphate, FGI-106 (1-N, 7-N-bis [3- (dimethylamino) propyl)]-3, 9-dimethylquinolino [8,7-h]Quinolone-1, 7-diamine), rNAPc2, OS-2966, brinzdofovir Weirui desipram; RNA polymerase inhibitors such as ganciclovir, fampicvir (also known as T-705 or Avigan), JK-05; host cytokine modulators such as GMV-006; cadherin-5/factor Ia modulators, such as FX-06; and antibodies for use in the treatment of ebola, such as inamazeb (atizumab, macti Wei Shankang, and oxaziclomex Wei Shankang), ZMapp, and mAb114 (EBANGA).
Other non-limiting active therapeutic agents having anti-ebola activity include, but are not limited to, alpha-glucosidase 1 inhibitors, cathepsin B inhibitors, CD29 antagonists, dendritic ICAM-3 grasping non-integrin 1 inhibitors, estrogen receptor antagonists, factor VII antagonists, HLA class II antigen modulators, host cytokine modulators, interferon alpha ligands, neutral alpha glucosidase AB inhibitors, niemann-pick C1 protein inhibitors, nucleoprotein inhibitors, polymerase cofactor VP35 inhibitors, serine protease inhibitors, tissue factor inhibitors, TLR-3 agonists, viral envelope glycoprotein inhibitors, and ebola virus entry inhibitors (NPC 1 inhibitors).
In some embodiments, the other active therapeutic agent may be a vaccine for the treatment or prevention of ebola, including but not limited to VRC-ebooadc 076-00-VP, adenovirus-based ebola vaccine, rVSV-EBOV, rVSVN4CT 1-eboovgp, MVA-BN filo+ad26-ZEBOV regimen, INO-4212, VRC-eboodna 023-00-VP, VRC-ebooadc 069-00-VP, gamEvac-combi vaccine, SRC VB vector, HPIV3/EboGP vaccine, MVA-ebooz, ebola recombinant glycoprotein vaccine, ebola vaccine based on Vaxart adenovirus vector 5, filoVax vaccine, GOVX-E301, and GOVX-E302.
The compounds provided herein can also be used in combination with Phosphoroamidate Morpholino Oligomers (PMOs), which are synthetic antisense oligonucleotide analogs designed to interfere with the translation process by forming base pair duplex with a particular RNA sequence. Examples of PMOs include, but are not limited to, AVI-7287, AVI-7288, AVI-7537, AVI-7539, AVI-6002, and AVI-6003.
The compounds provided herein are also intended for use with general care provided for subjects infected with a filoviridae virus, including parenteral fluids (including dextrose saline and ringer's lactate) and nutrients, antibiotics (including metronidazole and cephalosporin antibiotics such as ceftriaxone and cefuroxime) and/or antifungal preventative agents, fever and pain medications, antiemetics (such as metoclopramide) and/or antidiarrheal agents, vitamins and mineral supplements (including vitamin K and zinc sulfate), anti-inflammatory agents (such as ibuprofen), pain medications and medications for other common diseases in the subject population, such as antimalarial agents (including artemether and arteannuin-lumnol combination therapies), typhoid vaccines (including quinolone antibiotics such as ciprofloxacin, macrolide antibiotics such as azithromycin, cephalosporin antibiotics such as ceftriaxone, or aminopenicillins such as ampicillin) or shigella vaccines.
Combination therapy for treating influenza
The compounds disclosed herein and pharmaceutically acceptable salts thereof can be used in combination with any of the active therapeutic agents discussed in section VIII herein and/or with other active therapeutic agents specifically discussed in section viii.g herein for use in treating influenza virus infection. In some embodiments, the compounds provided herein are also used in combination with other active therapeutic agents for treating influenza virus infection. The compounds and compositions provided herein are also used in combination with other active therapeutic agents. In some embodiments, the compounds provided herein may also be combined with influenza treatment. In some embodiments, the compounds provided herein are used with influenza treatment when treating influenza virus. In some embodiments, the compounds provided herein are used with influenza treatment to treat a broader spectrum of respiratory viruses, such as those disclosed herein. In some embodiments, the influenza treatment is a Neuraminidase (NA) inhibitor. In some embodiments, the influenza treatment is an M2 inhibitor. Examples of influenza treatments include, but are not limited to, AB-5080, ALS-1, amantadineAV-001, AV-5124, AVM-0703, mabalo Sha Wei ∈ >CB-012, CC-42344, CD-388, CT-P27, codivir, DAS-181, DNK-651, ENOB-FL-01, ENOB-FL-11, fapilavir, GP-584, GP-681, H-015, HC-imAb, HEC-116094 HCl.3H O, HNC-042, histamine glutarimide, IFV-PA, yingjialine, INI-2004, INNA-051, KYAH01-2019-121, ranitivir, mo Nupi, niclosamide, nitazoxanide, norketotifen, NX-2016, oseltamivir phosphate @ or>Peramivir->REVTx-99, rimantadine, S-416, SAB-176, STP-702, T-705IV, TG-1000, TJ-27, TSR-066, 7HP-349, VIR-2482, VIS-410, VIS-FLX, XC-221, zanamivir->Zanamivir-dinitrophenyl conjugate, ZSP-1273 and ZX-7101A.
IX. preparation of Compounds
In some embodiments, the present disclosure provides methods and intermediates useful for preparing the compounds disclosed herein or pharmaceutically acceptable salts thereof.
The compounds as disclosed herein may be purified by any method known in the art, including chromatographic methods, including but not limited to High Performance Liquid Chromatography (HPLC), preparative thin layer chromatography, flash column chromatography, and ion exchange chromatography. Any suitable stationary phase may be used, including but not limited to normal and reverse phases, and ion resins. In some embodiments, the disclosed compounds are purified by silica gel and/or alumina chromatography.
During any of the methods for preparing the compounds provided herein, it may be necessary and/or desirable to protect sensitive or reactive groups on any molecule of interest. This can be achieved by conventional protecting groups as described in standard works such as T.W.Greene and P.G.M.Wuts, "Protective Groups in Organic Synthesis", 4 th edition, wiley, new York 2006. The protecting groups may be removed at a convenient subsequent stage using methods known in the art.
Exemplary chemical entities useful in the methods of embodiments will now be described by reference to the general preparations herein and the specific examples of illustrative synthetic schemes below. The skilled artisan will recognize that in order to obtain the various compounds herein, the starting materials may be appropriately selected such that the final desired substituents will be carried through the reaction scheme with or without protection as appropriate to yield the desired product. Alternatively, it may be necessary or desirable to replace the final desired substituent with a suitable group that can be subjected to the reaction scheme and optionally substituted with the desired substituent. Furthermore, one of skill in the art will recognize that the transformations shown in the schemes below may be performed in any order compatible with the functionality of the particular pendant group.
The methods of the present disclosure generally provide a particular enantiomer or diastereomer as a desired product, although stereochemistry of the enantiomer or diastereomer is not established in all cases. When the stereochemistry of a particular stereocenter in an enantiomer or diastereomer is not determined, the compound is depicted without the particular stereocenter exhibiting any stereochemistry, even though the compound may be substantially enantiomerically or diastereomerically pure.
Representative syntheses of the compounds of the present disclosure are described in the following schemes and in the specific examples that follow.
Scheme 1
Scheme 1 shows a general synthesis of compounds starting from the addition of an alcohol S1a1 under basic conditions (e.g. KOtBu or NaH) to an epoxide S1b1 with PG (e.g. Tr, TBDPS) to give an alcohol S1c. Alternatively, the alcohol S1b2 is added to the haloalkane S1a2 (e.g., br) under basic conditions (e.g., naH), followed by removal of the acetonide under acidic conditions (e.g., HCl) and protection of the primary alcohol under basic conditions (e.g., TBDPSCl, TEA) to give S1c. Substitution reaction with halide S1d (e.g., br) under basic conditions (e.g., KOtBu or NaH) results in removal of PG (e.g., HCl or TBAF) to yield alcohol S1e. Alcohol S1e and nucleoside S1f with 2-chloro-phenyl phosphorus dichloride under basic conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine or THF) to provide S1g. Removal of 2-Cl-phenol (e.g., csF, DMAP) and acetonide (e.g., HCl) gives the final compound in S1h form (e.g., compounds 1, 3-10, 12-20, 22, 53, 55, 61, 63, 66, 67, 68, 73 and 75 in Table 1).
Scheme 2
Scheme 2 shows a general synthesis of compounds starting with the addition of an alkyl grignard reagent S2a to an epoxide S2b with PG (e.g., tr, TBDPS) to give an alcohol S2c. Substitution reaction with halide S2d (e.g., br) under basic conditions (e.g., KOtBu) and removal of PG (e.g., HCl or TBAF) yields alcohol S2e. Alcohol S2e and nucleoside S2f with 2-chloro-phenyl phosphorus dichloride under basic conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine or THF) to provide S2g. Removal of 2-Cl-phenol (e.g., csF DMAP) and acetonide (e.g., HCl) gives the final compounds in form S2h (e.g., compounds 2,11,25-37, 56, 62, 70, 74 and 76 in Table 1).
Scheme 3
Scheme 3 shows a general synthesis of compounds starting with the addition of an alcohol S3a to an epoxide S3b with PG (e.g. Tr, TBDPS) under basic conditions (e.g. KOtBu) to give an alcohol S3c. Substitution reactions under alkaline conditions (e.g. KOTBu) or Ullmann C-O (e.g. CuI, cs 2 CO 3 、Me 4 Phen) is coupled with a halide S3d (e.g., br) followed by removal of PG (e.g., HCl or TBAF) to give alcohol S3e. Alcohol S3e and nucleoside S3f are combined with 2-chloro-phenyl phosphorus dichloride under basic conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine) to provide S3g. Removal of 2-Cl-phenol (e.g., csF DMAP) and acetonide (e.g., HCl) gives the final compound in the form S3g (e.g., compounds 21,23,2450, 59, 69, 71, 72 and 77 in Table 1).
Scheme 4
Scheme 4 shows a general synthesis of compounds starting from the addition of an alkyl grignard reagent S4a1 onto an epoxide S4b (e.g. Tr, TBDPS) with PG under basic conditions (e.g. KOtBu) to give an alcohol S4c. Alternatively, dihydroxylation of terminal alkene S4a2 (wherein CR 4 R 5 The groups are not linked by a double bond) followed by protection of the primary alcohol (e.g. TrCl or TBDPSCl) to give alcohol S4c. Substitution reactions under alkaline conditions (e.g. KOTBu) or Ullmann C-O (e.g. CuI, cs 2 CO 3 、Me 4 Phen) is coupled with a halide S4d (e.g., br) followed by removal of PG (e.g., HCl or TBAF) to give alcohol S4e. Alcohol S4e and nucleoside S4f are coupled with 2-chloro-phenyl phosphorus dichloride under basic conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH CN, pyridine, or THF) to provide S4g. Removal of 2-Cl-phenol (e.g., csF DMAP) and acetonide (e.g., HCl) gives the final compound in the form of S4g (e.g., compounds 38-40, 51 and 60 in Table 1).
Scheme 5
Scheme 5 shows a general synthesis of a compound starting with a substitution reaction of an alcohol S5a to a halide S5b under basic conditions (e.g. NaH), followed by cleavage of the acetonide under acidic conditions (e.g. HCl) and protection of the alcohol (e.g. TBDPSCl) to provide alcohol S5c. Substitution reaction with alkyl halides S5d (e.g., br) under basic conditions (e.g., naH) followed by removal of the protecting group (e.g., TBAF) affords alcohol S5e. Alcohol S4e and nucleoside S4f with 2-chloro-phenyl phosphorus dichloride under basic conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine or THF) to provide S5g. Removal of 2-Cl-phenol (e.g., csF DMAP) and acetonide (e.g., HCl) gives the final compound in S5h form (e.g., compounds 41 and 42 in Table 1).
Scheme 6
Scheme 6 shows a general synthesis of compounds starting from a substitution reaction under basic conditions (e.g., naH) or Ullmann C-O coupling of alcohol S6a (e.g., cuI, cs 2 CO 3 、Me 4 Phen) to a halide S6b (e.g., br), followed by acetonide cleavage under acidic conditions (e.g., HCl) and protection of the alcohol (e.g., TBDPSCl) to provide alcohol S6c. Substitution reaction with alkyl halides S6d (e.g., br) under basic conditions (e.g., naH) followed by removal of the protecting group (e.g., TBAF) affords alcohols S6e. Alcohol S6e and nucleoside S6f with 2-chloro-phenyl phosphorus dichloride under basic conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine or THF) to afford S6g. Removal of 2-Cl-phenol (e.g., csF DMAP) and acetonide (e.g., HCl) gives the final compound in S6h form (e.g., compounds 43 and 65 in Table 1).
Scheme 7
Scheme 7 shows a general synthesis of compounds starting with a substitution reaction of alkyl halide S7b under basic conditions (e.g., naH) followed by acetonide cleavage under acidic conditions (e.g., HCl) and protection of the alcohol (e.g., TBDPSCl) to provide alcohol S7c. Substitution reactions under basic conditions (e.g. NaH) or Ullmann C-O coupling with halides S7d (e.g. Br) (e.g. CuI, cs 2 CO 3 、Me 4 Phen) and subsequently removing the protecting group (e.g., TBAF) to give alcohol S7e. Alcohol S7e and nucleoside S7f with 2-chloro-phenyl phosphorus dichloride under basic conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine or THF) to afford S7g. Removal of 2-Cl-phenol (e.g., csF DMAP) and acetonide (e.g., HCl) gives the final compound in S7h form (e.g., compound 44 in Table 1).
Scheme 8
Scheme 8 shows a general synthesis of compounds starting with tosylation of alcohols (e.g., S1e or S2 e), followed by substitution with sodium azide and treatment with triphenylphosphine to afford amine S8a. Amine S8a and nucleoside S8b are combined with 2-chloro-phenyl phosphorus dichloride under basic conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine or THF) to afford S8c. Removal of 2-Cl-phenol (e.g., csF DMAP) and acetonide (e.g., HCl) gives the final compound in form S8d (e.g., compounds 45 and 46 in Table 1).
Scheme 9
Scheme 9 shows the general synthesis of compounds from amines S8a (e.g., x=o or CH 2 ) Is started by sulfonylation (e.g., 2-nitrobenzenesulfonyl chloride) followed by Mitsunobu reaction (e.g., meOH, PPh3, DEAD) and desulfonylation (e.g., phSH) to afford amine S9a. Amine S9a and nucleoside S9b are reacted with 2-chloro-phenyl phosphorus dichloride under basic conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine or THF) to afford S9c. Removal of 2-Cl-phenol (e.g., csF DMAP) and acetonide (e.g., HCl) gives the final compound in S9d form (e.g., compounds 57 and 58 in Table 1).
Scheme 10
Scheme 10 shows the general synthesis of compounds from Grignard reagents S10a and S10b (e.g., [1, 1-bis (diphenylphosphino) ferrocene)]Nickel (II) dichloride) coupling begins to give S10c. The addition of the aryl halide S10c metalization (e.g., mg; cuI) and epoxide S10d with PG (e.g., tr, TBDPS) provides alcohol S10e. Substitution with halide S10f (e.g., br) under basic conditions (e.g., KOTBu) and removal of PG (e.g., HCl or TBAF) yields alcohol S10g. Alcohol S10g and nucleoside S10h under alkaline conditions with 2-chloro-phenyl phosphorus dichloride (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine or THF) to afford S10i. Removal of 2-Cl-phenol (e.g., csF DMAP) and acetonide (e.g., HCl) gives the final compound in form S10j (e.g., compound 54 in Table 1).
Scheme 11
Scheme 11 shows the general synthesis of compounds starting from a protected primary alcohol S11a (e.g., trCl) to afford S11b. S11b is then reacted with a catalyst having a metal (e.g., [1, 1-bis (diphenylphosphino) ferrocene)]Nickel (II) dichloride) grignard reagent S11c cross-coupled to provide S11d. Substitution reaction with halide S11e (e.g., br) under basic conditions (e.g., KOtBu) and removal of the protecting group under acidic conditions (e.g., HCl) yields alcohol S11f. Alcohol S11f and nucleoside S11g with 2-chloro-phenyl phosphorus dichloride under basic conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine or THF) to afford S11h. Removal of 2-Cl-phenol (e.g., csF DMAP) and acetonide (e.g., HCl) gives the final compound of form S11i (e.g., compound 47 of Table 1).
Scheme 12
Scheme 12 shows a general synthesis of compounds under acidic conditions (e.g., tsOH, mgSO 4 Servi, s.j.org.) starts with the addition of alcohols S12b to S12 a. Chem.1985, 50, 5865) to provide alcohol S12c. Substitution reaction with S12d under acidic conditions (e.g., tsOH) and esters (e.g., liAlH) 4 ) The reduction reaction of (2) to give alcohol S12e. Alcohol S12e and nucleoside S1f with 2-chloro-phenyl phosphorus dichloride under basic conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine or THF) to afford S12g. Removal of 2-Cl-phenol (e.g. CsF DMAP) and acetonationThe compound (e.g., HCl) gives the final compound in S12h form (e.g., compound 64 in table 1).
Scheme 13
Scheme 13 shows the general synthesis of compounds starting with allylation of alcohol S13a followed by dihydroxylation (e.g., osO4, NMNO) and cleavage of vinorelbl (e.g., naIO) 4 ) To provide aldehyde S13b. Grignard reagent is added to the aldehyde to give a deoxygenated secondary alcohol (e.g., br) 2 PPh 3 、Bu 3 SnH、AIBN、Bu 4 NF), followed by removal of the protecting group (e.g., TBAF) to give S13c. Alcohol S13c and nucleoside S13d with 2-chloro-phenyl phosphorus dichloride under basic conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine or THF) to afford S13e. Removal of 2-Cl-phenol (e.g., csF DMAP) and acetonide (e.g., HCl) gives the final compound (e.g., compound 48 or compound 49 in Table 1) in form S13 f.
Scheme 14
Scheme 14 shows a general synthesis of compounds starting with substitution of malonate S14b to alkyl halide S14a under basic conditions (e.g., naH) followed by reduction of the ester (e.g., liAlH 4 ) To provide S14c. Substitution of alcohol S14c with an alkyl halide (e.g., br) S14d under basic conditions (e.g., naH) gives S14E (Subba Reddy et al, E) UR .J.O RG .C HEM 2013,10,1993-1999) alcohols S14e and nucleosides S14f with 2-chloro-phenyl phosphorus dichloride under alkaline conditions (e.g., 1,2, 4-triazole, TEA, NMI, CH) 3 CN, pyridine or THF) to afford S14e. Removal of 2-Cl-phenol (e.g., csF DMAP) and acetonide (e.g., HCl) gives the final compound in form S14f (e.g., compound 52 in Table 1).
Scheme 15
Scheme 15 shows a general synthesis of compounds starting with acetonide cleavage under acidic conditions (e.g., HCl) followed by esterification of 2 '-and 3' -ribitol with anhydride reagent under basic conditions (e.g., DMAP). Removal of 2-Cl-phenol (e.g., csF, DMAP) gives the final S15b form of the compound.
Examples
A. Abbreviations (abbreviations)
Certain abbreviations and acronyms are used to describe experimental details. Although most of these abbreviations and acronyms may be understood by those skilled in the art, table 41 contains a list of many of these abbreviations and acronyms.
TABLE 41 list of abbreviations and acronyms。
/>
/>
B. Intermediate products
Intermediate I-1 (S) -1-O-trityl-3- (heptadecyloxy) propane-1, 2-diol
Potassium tert-butoxide (18.7 mmol) and cetyl alcohol (8.42 mmol) were added to (S)In a solution of-O-trityloxyhexane-2-yl-methanol (4.68 mmol) in DMF (40 mL). The resulting mixture was stirred at 100 ℃ for 2 hours, cooled to room temperature, diluted with diethyl ether (300 mL), washed with brine (100 ml×2), dried over sodium sulfate, and purified by silica gel column chromatography (0% to 20% etoac in hexanes) to give intermediate I-1. 1 H NMR(400MHz,DMSO-d6)δ7.50–7.10(m,15H),4.86(d,J＝5.4Hz,1H),3.76(q,J＝5.4Hz,1H),3.38(m,2H),3.33(s,2H),2.95(m,2H),1.41(m,2H),1.22(d,J＝11.2Hz,28H),0.89–0.79(m,3H).
Intermediate I-2- (R) -3-fluoro-5- (((1- (heptadecyloxy) -3- (triphenylmethoxy) prop-2-yloxy) methyl) Radical) benzonitrile
To a solution of intermediate I-1 (1.52 mmol) in THF (8 mL) was added potassium tert-butoxide (3.04 mL,1.0M,3.04 mmol). The mixture was stirred for 20 minutes, and 3- (bromomethyl) -5-fluoro-benzonitrile (3.04 mmol) was added. The resulting mixture was stirred at room temperature for 4h, then diluted with water (50 mL) and extracted with EtOAc (3×50 mL). The organic portions were combined, washed with brine (50 mL), dried over sodium sulfate, filtered, concentrated in vacuo, and purified by silica gel chromatography (0% to 10% ethyl acetate/hexanes) to give intermediate I-2. 1 H NMR (400 mhz, dmso-d 6) delta 7.77 (d, j=8.9 hz, 1H), 7.66 (s, 1H), 7.58 (d, j=9.6 hz, 1H), 7.43-7.16 (m, 15H), 4.68 (s, 2H), 3.77-3.66 (m, 1H), 3.50 (m, 2H), 3.32 (m, 2H), masked by solvent peaks, 3.15 (dd, j=10.1, 3.8hz, 1H), 3.07 (dd, j=10.1, 5.7hz, 1H), 1.42 (s, 2H), 1.34-1.00 (m, 28H), 0.85 (t, j=6.6 hz, 3H).
Intermediate I-3: (S) -3-fluoro-5- (((1- (heptadecyloxy) -3-hydroxyprop-2-yl) oxy) methyl) benzonitrile
To intermediate I-2 (1.42 mmol) THF-iPrOH-MeOH (1.4:1.4:1.4 mL) of 25% HCl (0.7 mL) was added. The resulting mixture was heated at 65℃for 45 minutes, cooled and saturated NaHCO was added 3 (10 mL). After stirring for 5 min, the mixture was extracted with EtOAc (100 mL. Times.2). The aqueous layer was extracted with EtOAc (50 mL. Times.2). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0 to 40% EtOAc/hexanes) to give intermediate I-3. 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.61 (s, 1H), 7.50 (dd, j=9.6, 2.4hz, 1H), 7.44 (dt, j=8.5, 1.8hz, 1H), 4.73 (s, 2H), 3.68-3.50 (m, 5H), 3.43 (m, 2H), 2.84 (t, j=5.7 hz, 1H), 1.55 (m, 2H), 1.39-1.21 (m, 28H), 0.91 (t, j=6.7 hz, 3H).
Intermediate I-3a1: (3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4- (((tert-Butyldimethylsilyl) oxy) methyl) -2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Meta-dioxanes Pentene-4-carbonitrile
Intermediate I-3a1 was prepared according to WO 2015/069939. For example, pages 127-138 of WO2015/069939 provide a process for preparing this compound (identified as compound 14k in WO 2015/069939).
Intermediate I-3a: (3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxole-4-carbonitriles
Intermediate I-3a1 (18.87 mmol) was dissolved in THF (100 mL). TBAF 1.0M (28.31 mmol) in THF was added in one portion at ambient temperature. Stirring is carried out for 10min at ambient temperature. Reaction completion was determined by LCMS. The reaction mixture was quenched with water and the organics removed under reduced pressure. The crude product was partitioned between EtOAc and water. Separating the layers and using Ethe aqueous phase was washed with taac. The organics were combined and dried over sodium sulfate. The solid was filtered off and the solvent was removed under reduced pressure. The crude product was purified by silica gel chromatography (120 g column, 0% -10% CH 3 CH of OH 2 Cl 2 Solution) to give intermediate I-3a. LC/MS:t R ＝0.76min,MS m/z＝332.14[M+1]The method comprises the steps of carrying out a first treatment on the surface of the LC system: thermo Accela1250UHPLC. MS system: thermo LCQ Fleet; chromatographic column: kineex 2.6 μXB-C18100A,50×3.00mm. Solvent: acetonitrile containing 0.1% formic acid, water containing 0.1% formic acid. Gradient: 0min-2.4min 2% -100% ACN,2.4min-2.80min 100% ACN,2.8min-2.85min100% -2% ACN,2.85min-3.0min 2% ACN, and the rate is 1.8mL/min. 1 H NMR(400MHz,DMSO-d6)δ7.87-7.80(m,3H),6.85(d,J＝4.5Hz,1H),6.82(d,J＝4.5Hz,1H),5.74(t,J＝5.8Hz,1H),5.52(d,J＝4.2Hz,1H),5.24(dd,J＝6.8,4.2Hz,1H),4.92(d,J＝6.8Hz,1H),3.65(dd,J＝6.1,1.7Hz,2H),1.61(s,3H),1.33(s,3H)。
Intermediate I-4: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) -6- Cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) -2-) ((3-cyano-5-fluorobenzyl) oxy) -3- (heptadecyloxy) propyl) phosphate
/>
To a solution of 1H-1,2, 4-triazole (0.844 mmol) and TEA (0.118 mL,0.844 mmol) in ACN (0.5 mL) -pyridine (0.2 mL) was added 2-chlorophenyl phosphorus dichloride (0.065 mL, 0.3992 mmol) at room temperature. The reaction mixture was stirred at room temperature for 30 min, intermediate I-3a (0.392 mmol) was added followed by 1-methylimidazole (0.0631 mL,0.792 mmol). The resulting mixture was stirred at room temperature for 1 hour and intermediate I-3 (0.430 mmol) was added. The reaction mixture was stirred for 2 hours 30 minutes, concentrated in vacuo and purified by silica gel column chromatography (0% to 100% meoh in DCM) to give intermediate I-4. 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.86 (d, J=3.5 Hz, 1H), 7.54-7.29 (m, 5H), 7.26-7.05(m,2H),6.83–6.63(m,2H),6.26(s,2H),5.67(m,1H),5.34–5.22(m,1H),5.14–5.06(m,1H),4.67–4.42(m,4H),4.41–4.28(m,1H),4.27–4.16(m,1H),3.75(m,1H),3.53–3.42(m,2H),3.42–3.28(m,2H),1.72(s,3H),1.58–1.44(m,2H),1.38(s,3H),1.35–1.17(m,28H),0.90(m,3H). 19 F NMR (376 MHz, acetonitrile-d 3) delta-112.78, -112.79. 31 P NMR (162 MHz, acetonitrile-d 3) delta-7.31, -7.36.MS M/z [ M+1 ]]＝967
Intermediate I-5: (R) -3- ((1-hydroxy-3- (octadecyloxy) propan-2-yl) oxy) benzonitrile
To a solution of intermediate I-128 (1.14 mmol) in DMF (10 mL) was added NaH (60% mineral oil solution) at room temperature. The mixture was stirred at room temperature for 1 hour and 3-fluorobenzonitrile (115 mg,0.950 mmol) was added. The resulting mixture was then heated at 60 ℃ for 30 minutes, diluted with EtOAc (100 mL) and the reaction quenched by the addition of water (10 mL). The organic phase was dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0 to 10% EtOAc/hexanes) to give intermediate I-5.1H NMR (400 MHz, DMSO-d 6) delta 7.77 (d, J=8.9 Hz, 1H), 7.66 (s, 1H), 7.58 (d, J=9.6 Hz, 1H), 7.43-7.16 (m, 16H), 4.68 (s, 2H), 3.77-3.66 (m, 1H), 3.56-3.43 (m, 2H), 3.15 (dd, J=10.1, 3.8Hz, 1H), 3.07 (dd, J=10.1, 5.7Hz, 1H), 1.42 (s, 2H), 1.34-1.00 (m, 30H), 0.85 (t, J=6.6 Hz, 3H).
Intermediate I-6: (S) -3- ((1-hydroxy-3- (octadecyloxy) propan-2-yl) oxy) benzonitrile
To a solution of intermediate I-5 (0.469 mmol) prepared as described above in THF-iPrOH-MeOH (1.5:1.5:1.5 mL) was added 25% HCl (0.3 mL). The resulting mixture was heated at 65℃for 45 minutes, cooled and saturated NaHCO was added 3 (10 mL). After stirring for 5 min, extract with EtOAc (50 mL. Times.2). The water layer is removedExtracted with EtOAc (20 mL. Times.2). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0 to 40% EtOAc/hexanes) to give intermediate I-6. 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.48-7.42 (m, 1H), 7.37 (m, 1H), 7.34-7.27 (m, 2H), 4.51 (ddd, J=10.1, 5.7,4.3Hz, 1H), 3.78-3.54 (m, 4H), 3.44 (m, 2H), 2.98 (t, J=6.1 Hz, 1H), 1.51 (m, 2H), 1.38-1.19 (m, 30H), 0.91 (m, 3H).
Intermediate I-7: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -6- Cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) -2-) (3-cyanophenoxy) -3- (octadecyl) propyl) phosphate
To a solution of 1H-1,2, 4-triazole (1.00 mmol) in THF (2 mL) was added TEA (0.139 mL,1.00 mmol) and 2-chlorophenyl phosphorus dichloride (0.0807 mL,0.49 mmol) at room temperature and stirred for 30 min. To the mixture was added intermediate I-3a (0.38 mmol) in one portion followed by 1-methylimidazole (0.0391 mL,0.49 mmol). The resulting mixture was stirred for 30 min, then intermediate I-6 (0.38 mmol) in THF (2 mL) was added dropwise. After stirring at room temperature for 15 hours, the mixture was concentrated in vacuo and purified by silica gel column chromatography (0% to 10% meoh in DCM) to give intermediate I-7. 1 H NMR (400 MHz, methanol-d 4) delta 7.83 (m, 1H), 7.55-7.05 (m, 8H), 6.83-6.72 (m, 2H), 5.68 (m, 1H), 5.33-5.29 (m, 1H), 5.16 (d, j=6.6 hz, 0.5H), 5.11 (d, j=6.6 hz, 0.5H), 4.71-4.64 (m, 1H), 4.60-4.37 (m, 4H), 3.63-3.51 (m, 2H), 3.46-3.34 (m, 2H), 1.73 (s, 3H), 1.53-1.42 (m, 2H), 1.38 (s, 3H), 1.34-1.17 (m, 30H), 0.89 (t, j=6.7, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-6.46, -6.48.MS M/z [ M+1]]＝949
Intermediate I-8: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -6- Cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxol-4-yl)Methyl ((R) -2- (3-cyanophenoxy) Phenyl) -3- (octadecyl) propyl) hydrogen phosphate
Intermediate I-7 (0.179 mmol) was dissolved in a solution of THF-ACN (2:1 mL) and CsF (1.55 mmol) in water (0.2 mL) and DMAP (0.66 mmol) was added. The resulting mixture was heated at 80℃for 3.5h. After dilution with PBS buffer (10 mL) at pH 7, the mixture was partitioned between brine (20 mL) and EtOAc (40 mL). The aqueous layer was extracted with EtOAc (20 mL. Times.3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0% -50% MeOH/DCM) to give intermediate I-8.MS M/z [ m+1] =839.
Intermediate I-9 (R) -2-chloro-4- (((1- (octadecyloxy) -3- (triphenylmethoxy) propan-2-yl) oxy) methyl) Radical) benzonitrile
To a solution of intermediate I-128 (2.56 mmol) in THF (20 mL) was added sodium tert-butoxide powder (5.11 mmol). The solution was then stirred at room temperature for 40 minutes. A solution of 4- (bromomethyl) -2-chloro-benzonitrile (5.11 mmol) in THF (5 mL) was added dropwise and the mixture stirred at room temperature for 7 hours. The reaction mixture was diluted with water (50 mL) and extracted with EtOAc (3 x 50 mL). The organic portions were combined, washed with brine (50 mL), dried over sodium sulfate, filtered, concentrated in vacuo, and purified by silica gel chromatography (0% to 10% ethyl acetate/hexanes) to give intermediate I-9. 1 H NMR (400 MHz, chloroform-d) delta 7.62 (d, j=8.0 hz, 1H), 7.58 (d, j=1.4 hz, 1H), 7.49-7.42 (m, 6H), 7.37-7.24 (m, 10H), 4.73 (s, 2H), 3.74 (m, 1H), 3.60 (d, j=5.2 hz, 2H), 3.44 (t, j=6.6 hz, 2H), 3.26 (m, 2H), 1.64-1.52 (m, 2H), 1.43-1.06 (s, 30H), 0.91 (t, j=6.7 hz, 3H).
Intermediate I-10: (S) -2-chloro-4- (((1-hydroxy-3- (octadecyloxy) propan-2-yl) oxy) methyl) benzyl Nitrile (II)
To a solution of intermediate I-9 (0.815 mmol) in THF-iPrOH-MeOH (3:3:3 mL) was added 25% HCl (0.5 mL). The resulting mixture was heated at 65℃for 45 minutes, cooled and 10mL of saturated NaHCO was added 3 . After stirring for 5 min, extraction was performed with EtOAc (40 mLx 3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0 to 40% EtOAc/hexanes) to give intermediate I-10.1H NMR (400 MHz, acetonitrile-d 3) delta 7.77 (d, J=8.0 Hz, 1H), 7.69 (d, J=1.4 Hz, 1H), 7.47 (dd, J=8.0, 1.4Hz, 1H), 4.75 (s, 2H), 3.67-3.48 (m, 5H), 3.42 (m, 2H), 2.83 (t, J=5.7 Hz, 1H), 1.54 (m, 2H), 1.40-1.22 (m, 30H), 0.96-0.86 (m, 3H).
Intermediate I-11: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-chloro-4-) Cyanobenzyl) oxy) -3- (octadecyl) propyl) (2-chlorophenyl) phosphate
1H-1,2, 4-triazole (0.664 mmol) was dissolved in THF (2 mL) and TEA (0.09 mL,0.664 mmol) was added at room temperature. To the mixture was added dropwise 2-chlorophenyl phosphorus dichloride (0.081 mL,0.501 mmol). The reaction mixture was stirred at room temperature for 30 minutes, intermediate I-3a (0.251 mmol) was added in one portion and the mixture was stirred at room temperature for 15 minutes. To this mixture was added a solution of intermediate I-10 (0.275 mmol) in THF (2 mL) and 1-methylimidazole (0.04 mL,0.506 mmol) was added at room temperature. The resulting mixture was stirred for 1 hour, concentrated in vacuo, and purified by silica gel (0% to 10% meoh in DCM) to give intermediate I-11. 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.86 (s, 1H), 7.66 (d, j=7.9 hz, 1H), 7.54 (d, j=6.1)Hz,1H),7.48–7.40(m,1H),7.39–7.29(m,2H),7.24–7.12(m,2H),6.80–6.67(m,2H),6.38(s,2H),5.69-5.65(m,1H),5.32-5.24(m,1H),5.13–5.01(m,1H),4.65(s,1H),4.60(s,1H),4.58–4.44(m,2H),4.40-4.30(m,1H),4.29-4.17(m,1H),3.76(m,1H),3.51-3.41(m,2H),3.42-3.30(m,2H),1.72(s,3H),1.49(m,2H),1.37(s,3H),1.34-1.06(m,30H),0.89(t,J＝6.7Hz,3H). 31 P NMR (162 MHz, acetonitrile-d 3) delta-7.32, -7.38.MS M/z [ M+1 ]]＝997
Intermediate I-12: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ] ][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-chloro-4-) Cyanobenzyl) oxy) -3- (octadecyloxy) propyl hydrogen phosphate
Intermediate I-11 (0.179 mmol) was dissolved in a solution of THF-ACN (2:1 mL) and CsF (1.46 mmol) in water (0.2 mL) and DMAP (0.621 mmol) was added. The resulting mixture was heated at 80℃for 4h. After dilution with citric acid NaOH buffer (pH 4,10 mL), the mixture was partitioned between brine (20 mL) and EtOAc (40 mL). The aqueous layer was extracted with EtOAc (20 mL. Times.3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0% 50% meoh/DCM) to give intermediate I-12.MS M/z [ m+1] =887
Intermediate I-14 (R) -behene-1, 2-diol
AD-mix- β (28 g) was dissolved in t-butanol (100 mL) -water (100 mL) and cooled to 0deg.C. A solution of 1-eicosadiene (6.2 g,20.1 mmol) in THF (100 mL) was then added dropwise at 0deg.C. The resulting mixture was stirred at room temperature for 48 hours, and Na was added 2 SO 3 (30g) A. The invention relates to a method for producing a fibre-reinforced plastic composite The mixture was extracted with EtOAc (150 ml×3) and the extracts were extracted with brine (100)mL), dried over sodium sulfate, and concentrated in vacuo. The residue obtained was purified by silica gel column chromatography (0% to 50% EtOAc in hexanes) to give intermediate I-14. 1 H NMR(400MHz,DMSO-d6)δ4.39(t,J＝5.7Hz,1H),4.31(d,J＝4.9Hz,1H),3.41–3.33(m,1H),3.23(m,2H),1.39(m,2H),1.24(s,36H),0.92–0.79(m,3H).
Intermediate I-15 (R) -1- (trityl) behene-2-ol
Intermediate I-14 (60% purity, 4.3 mmol) was dissolved in DCM (20 mL) and TEA (1.5 mL,10.8 mmol) was added. The resulting mixture was stirred for 5 min and TrCl (4.30 mmol) in DCM (10 mL) was added dropwise at room temperature. The resulting mixture was stirred for 20 hours, and hexane (20 mL) was added. The solid was filtered off, the filtrate was concentrated in vacuo and purified by silica gel column chromatography (0% to 20% etoac in hexanes) to give intermediate I-15. 1 H NMR (400 MHz, chloroform-d) delta 7.46 (dd, j=7.7, 1.8hz, 6H), 7.33 (dd, j=8.4, 6.6hz, 6H), 7.29-7.23 (m, 2H), 3.78 (m, 1H), 3.20 (dd, j=9.4, 3.2hz, 1H), 3.04 (dd, j=9.3, 7.6hz, 1H), 1.56 (s, 1H), 1.48-1.19 (m, 36H), 0.90 (t, j=6.7 hz, 3H).
Intermediate I-16 (R) -3- ((1- (triphenyll 4-oxyalkylene) behen-2-yl) oxy) benzonitrile
To a solution of intermediate I-15 (75% purity, 1.71 mmol) in DMF (15 mL) -toluene (10 mL) was added NaH (60%, 2.85mmol in mineral oil) at room temperature. The mixture was stirred at room temperature for 1 hour and 3-fluorobenzonitrile (0.238 mL,2.22 mmol) was added. The resulting mixture was then heated at 60℃for 18 hours, cooled to room temperature, and treated with NH 4 Cl solution (20 mL), diluted with EtOAc (200 mL), washed with water (100 mL), dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography The reaction was quenched (0% to 10% EtOAc in hexane) to afford intermediate I-16. 1 HNMR (400 MHz, chloroform-d) delta 7.42 (d, j=7.4 hz, 6H), 7.38-7.14 (m, 13H), 4.46-4.27 (m, 1H), 3.36 (dd, j=10.2, 6.0hz, 1H), 3.26 (dd, j=10.1, 4.1hz, 1H), 1.70 (q, j=6.9 hz, 2H), 1.47-1.04 (m, 36H), 0.91 (t, j=6.7 hz, 3H).
Intermediate I-17 (R) -3- ((1-hydroxy-behen-2-yl) oxy) benzonitrile
To a solution of intermediate I-16 (1.71 mmol) in toluene-MeOH (10:6 mL) was added 25% HCl (1.0 mL). The resulting mixture was heated at 65℃for 90 minutes, cooled and saturated NaHCO was added 3 (50 mL). After stirring for 5 min, extraction was performed with EtOAc (150 mLx 2). The aqueous layer was extracted with EtOAc (100 mL). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0 to 40% EtOAc/hexanes) to give intermediate I-17. 1 H NMR (400 MHz, chloroform-d) delta 7.39 (t, J=7.9 Hz, 1H), 7.29-7.25 (m, 1H), 7.24-7.17 (m, 2H), 4.39 (m, 1H), 3.92-3.72 (m, 2H), 1.75-1.61 (m, 2H), 1.56 (s, 1H), 1.49-1.21 (m, 36H), 0.98-0.83 (m, 3H).
Intermediate I-18: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- (3-cyanophenoxy) behenyl) phosphate
1H-1,2, 4-triazole (0.664 mmol) was dissolved in THF (2 mL) and TEA (0.09 mL,0.664 mmol) was added at room temperature. To the mixture was added dropwise 2-chlorophenyl phosphorus dichloride (0.081 mL,0.501 mmol). The reaction mixture was stirred at room temperature for 30 minutes. Intermediate I-3a (0.251 mmol) was added in one portion and the mixture was allowed to stand at room temperatureStirring for 15 minutes. To this mixture was added a solution of intermediate I-17 (0.275 mmol) in THF (2 mL) and 1-methylimidazole (0.04 mL,0.506 mmol) was added at room temperature. The resulting mixture was stirred for 1 hour, concentrated in vacuo, and purified by silica gel (0% to 10% meoh in DCM) to give intermediate I-18. 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.87 (m, 1H), 7.52-7.09 (m, 8H), 6.79 (m, 1H), 6.77-6.68 (m, 1H), 6.31 (s, 2H), 5.68 (m, 1H), 5.34-5.26 (m, 1H), 5.15-5.06 (m, 1H), 4.59-4.42 (m, 3H), 4.40-4.17 (m, 2H), 1.72 (m, 3H), 1.59 (m, 2H), 1.40-1.18 (m, 39H), 0.96-0.84 (m, 3H). 31 P NMR (162 MHz, acetonitrile-d 3) delta-7.54, -7.60.MS M/z [ M+1 ]]＝948
Intermediate I-19 ((2R, 3S,4R, 5S) -5- (4-aminopyrrolo [2, 1-f)][1，2，4]Triazin-7-yl) -2- Cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((R) -2- (3-cyanophenoxy) behenyl) phosphate hydrogen salt
Intermediate I-18 (0.179 mmol) was dissolved in a solution of THF-ACN (2:1 mL), csF (1.46 mmol) in water (0.2 mL) and DMAP (0.621 mmol) was added. The resulting mixture was heated at 80℃for 4h. After dilution with citric acid NaOH buffer (pH 4,10 mL), the mixture was partitioned between brine (20 mL) and EtOAc (40 mL). The aqueous layer was extracted with EtOAc (20 mL. Times.3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0% 50% meoh/DCM) to give intermediate I-19.MS M/z [ m+1] =837.
Intermediate I-21: (2R) -1- [ tert-butyl (dimethyl) silyl]Oxy-3-octadecyloxy-propan-2-ol
A solution of tert-butyldimethylsilyl chloride (2.32 mmol) in methylene chloride (2 mL) was added to (2S) -3-octadecyloxypropyl (2S) -at 0deg.C over 1 minIn a solution of alkane-1, 2-diol (1.45 mmol) and imidazole (2.90 mmol) in dichloromethane (5 mL). After 2 hours, the ice bath was removed. After 3 hours, the reaction was washed with water (5 mL). The aqueous phase was extracted with dichloromethane (10 mL). The combined organic phases were dried over sodium sulfate and the solvent was removed under reduced pressure. Flash chromatography (0-30% ethyl acetate/hexane) of the residue was performed. The product containing fractions were combined and the solvent removed under reduced pressure to give intermediate I-21. 1 H NMR (400 MHz, chloroform-d) delta 3.83 (p, j=5.4 hz, 1H), 3.74-3.62 (m, 2H), 3.50-3.42 (m, 4H), 1.58 (q, j=7.0 hz, 2H), 1.27 (m, 30H), 0.91 (m, 12H), 0.09 (s, 6H).
Intermediate I-22:3- [ [ (1R) -1- [ [ tert-butyl (dimethyl) silyl ]]Oxymethyl group]-2-octadecyl-ethyl Oxy group]Methyl group]-5-fluorobenzonitrile
A60% dispersion of sodium hydride in mineral oil (1.31 mmol) was suspended in tetrahydrofuran (5 mL) and cooled to 0deg.C. A solution of intermediate I-21 (0.654 mmol) in tetrahydrofuran (2 mL) was added over 30 seconds. After 30 minutes, a solution of 3- (bromomethyl) -5-difluoro-benzonitrile (1.44 mmol) in tetrahydrofuran (2 mL) was added. The ice bath was removed. After 16 hours, quench the reaction with water (10 mL) at 0deg.C. Gas evolution was observed. The mixture was extracted with ethyl acetate (3X 10 mL). The combined organic phases were dried over sodium sulfate and the solvent was removed under reduced pressure. Flash chromatography (0-20% ethyl acetate/hexanes, detection using ELSD) was performed on the residue. The product containing fractions were combined and the solvent removed under reduced pressure to give intermediate I-22. 1 H NMR (400 MHz, chloroform-d) delta 7.48 (s, 1H), 7.41 (m, 1H), 7.28-7.23 (m, 1H), 4.77 (s, 2H), 3.73 (d, j=4.9 hz, 2H), 3.66 (qd, j=5.7, 4.1hz, 1H), 3.55 (qd, j=10.3, 5.0hz, 2H), 3.46 (td, j=6.7, 1.2hz, 2H), 1.65-1.52 (m, 2H), 1.28 (s, 30H), 0.91 (d, j=7.1 hz, 13H), 0.09 (s, 6H). 19 F NMR (376 MHz, chloroform-d) delta-110.67- -110.85 (m).
Intermediate I-23:3-fluoro-5- [ [ (1S) -1- (hydroxymethyl) -2-octadecyl-ethoxy [ (1S) -y]Methyl group]Benzonitrile
A solution of tetrabutylammonium fluoride in tetrahydrofuran (1.71 mL,1.71 mmol) was added to a solution of intermediate I-22 (0.569 mmol) in tetrahydrofuran (5 mL). After 45 min, the reaction was diluted with ethyl acetate (20 mL). The organic phase was washed with water (3X 5 mL) and brine (5 mL). The organic phase was dried over sodium sulfate and the solvent was removed under reduced pressure. Flash chromatography of the residue (0-20% ethyl acetate/hexanes, ELSD used). The product containing fractions were combined and the solvent removed under reduced pressure to give intermediate I-23.1H NMR (400 MHz, chloroform-d) delta 7.48 (s, 1H), 7.41-7.35 (m, 1H), 7.33-7.29 (m, 1H), 4.83-4.68 (m, 2H), 3.86-3.78 (m, 1H), 3.78-3.68 (m, 2H), 3.68-3.56 (m, 2H), 3.47 (td, J=6.6, 2.2Hz, 2H), 1.66-1.50 (m, 2H), 1.40-1.23 (m, 30H), 0.90 (t, J=6.8 Hz, 3H) 19F NMR (376 MHz, chloroform-d) delta-110.36 (t, J=8.4 Hz).
Intermediate I-24: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((3-cyano-5-fluorobenzyl) oxy) -3- (octadecyloxy) propyl) phosphate
To 1H-1,2, 4-triazole (1.62 mmol) and TEA (0.226 mL,1.62 mmol) at room temperature in CH 3 To a solution of CN (2.5 mL) and pyridine (2.5 mL), 2-chlorophenyl phosphorus dichloride (0.124 mL,0.755 mmol) was added dropwise. The reaction mixture was stirred at room temperature for 30 minutes. To the reaction solution was added a solution of intermediate I-23 (0.755 mmol) in MeCN (2.5 mL) and pyridine (/ 2.5 mL) at one time under Ar atmosphere, and the mixture was vigorously stirred for 90 minutes. To the mixture was added intermediate I-3a (0.755 mmol), followed by 1-methylimidazole (0.1 mL,1.26 mmol) and stirred overnight. The mixture was concentrated to remove pyridine and purified with toluene (30 mL) co-evaporating once. To this mixture was added 10% citric acid (43 mL), followed by 1N NaOH (7 mL) and water (20 mL) to complete the transfer. The aqueous layer was extracted with EtOAc (3X 100 mL). The organic fractions were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-20% meoh in DCM) to afford intermediate I-24.MS M/z [ M+1 ]]＝981.2.
Intermediate I-25: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- ((3-cyano-) 5-fluorobenzyl) oxy) -3- (octadecyl) propyl hydrogen phosphate
Intermediate I-24 (0.458 mmol) was dissolved in 2:1 THF: ACN (6:3 mL). To this solution was added cesium fluoride (1.83 mmol) in water (0.578 mL), followed by 4- (dimethylamino) pyridine (1.6 mmol). The reaction mixture was heated to 80 ℃ and stirred for 3 hours. The reaction was cooled to room temperature, 10% aqueous citric acid (20 mL) was added, followed by pH 3-4 adjusted by 2M NaOH. Extraction with EtOAc (50 ml×2) and confirmation, no desired product was detected in the aqueous layer by LCMS. The combined organic layers were washed once with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% to 50% meoh in DCM) to afford intermediate I-25.MS M/z [ M+1]]＝871.3.
Intermediate I-26 (S) -5- (((1-hydroxy-3- (octadecyl) propan-2-yl) oxy) methyl) -2-methoxybenzene Carbonitrile
Intermediate I-26 was synthesized in a similar manner to intermediate I-23 using 5- (bromomethyl) -2-methoxybenzonitrile instead of 3- (bromomethyl) -5-fluorobenzonitrile. MS M/z [ m+1] =490.
Intermediate I-27: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyanides 1-2, 2-dimethyltetrahydrofurano [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) phosphate hydrogen salt
To a 200mL round bottom flask with a stirring bar was added 1,2, 4-triazole (26.2 mmol), THF (60 mL, 15V), TEA (3.65 mL,26.2 mmol). Cooled to 0℃and 2-chlorophenyl phosphorus dichloride (1.96 mL,12.1 mmol) (white precipitated form) was added dropwise over about 20 minutes. The reaction mixture was allowed to warm to room temperature and stirred for 1h. To the mixture was added dry intermediate I-3a (12.1 mmol) in one portion, and the viscous solid around the flask was brought into the reaction mixture with THF (30 mL) and stirred for 1 hour. The slurry was filtered and Et rinsed with THF 3 The filter cake of N-HCl (3-5 volumes, 160 mL) was concentrated under reduced pressure (25 mL,3 volumes). To the mixture was added EtOAc (10 v,250 ml), water (10 v,250 ml) and transferred to a separatory funnel (using EtOAc/water-1 v,100 ml) to complete the transfer. By addition of saturated Na 2 CO 3 The solution is brought to a pH of 8-9 (if the pH of the solution is already 8, na need not be added 2 CO 4 ). The aqueous layer contains the product and the organic layer consists of organic impurities with trace amounts of the desired product. The aqueous layer was collected in a 500mL RB-flask, charged to a stirring bar and 5% aqueous HCl was added dropwise over 30-40 minutes to reach pH 3 (keeping the addition until no more precipitate formed) and the slurry formed a solid. The solid formation took place and disappeared and was allowed to stand for 1 hour, forming oily pale yellow droplets (pure product). Transfer to a separatory funnel, extract with EtOAc (200 mL. Times.3), extract once with DCM/IPA (4:1, 100 mL). The combined organic layers were purified by Na 2 SO 4 Drying, concentrating the solvent and drying to give intermediate I-27. 1 H NMR(400MHz,DMSO-d 6 )δ8.77(d,J＝91.2Hz,2H),8.40(s,1H),8.07(s,1H),7.50(dd,J＝19.3,8.1Hz,2H),7.29–7.20(m,1H),7.15(d,J＝4.5Hz,1H),7.10(t,J＝7.7Hz,1H),6.98(d,J＝4.5Hz,1H),5.66(d,J＝3.6Hz,1H),5.32(dd,J＝6.6,3.8Hz,1H),5.12(d,J＝6.6Hz,1H),4.31–4.13(m,2H),1.69(s,3H),1.39(s,3H).MS m/z[M+1]＝522.0.
Intermediate I-28: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((3-cyano-4-methoxybenzyl alcohol) oxy) -3- (octadecyloxy) propyl) phosphate
Intermediate I-26 (0.041 mmol), intermediate I-27 (0.061 mmol) were placed in a 20mL vial, dried in vacuo (1 hour), DCM (2 mL) was added, NMI (13.4 uL,0.163 mmol), TEA (11.5 uL,0.081 mmol) and then Bop-Cl (10.4 mg,0.04 mmol) was added. The reaction was stirred at room temperature for 2h. The solvent was concentrated under reduced pressure. The crude product was dissolved in DCM, loaded onto a 24g column, eluted with 100% hex for 4 min, 0% -100% etoac for 6 min, and 100% etoac for 6 min. The product was eluted in 100% etoac and fractions containing pure product were combined and pooled to provide intermediate I-28. 1 H NMR (400 MHz, chloroform-d) delta 7.93 (d, j=6.5 hz, 1H), 7.58-7.32 (M, 4H), 7.23-7.02 (M, 2H), 6.90 (dd, j=8.6, 5.0hz, 1H), 6.72 (d, j=4.5 hz, 1H), 6.60 (dd, j=6.8, 4.5hz, 1H), 5.77-5.61 (M, 2H), 5.28 (td, j=6.5, 3.1hz, 1H), 5.13 (dd, j=15.1, 6.6hz, 1H), 4.68-4.41 (M, 5H), 4.40-4.22 (M, 1H), 3.91 (s, 3H), 3.79 (j=22.7, 5.1hz, 1H), 3.51 (dd, j=6.8, 4.5hz, 1H), 5.77-5.61 (M, 2H), 5.28 (dd, j=6.5, 3.1hz, 1H), 5.13 (dd, j=15.1, 6.6.6 hz, 1H), 4.68-4.41 (M, 5H), 4.40-4.22 (M, 1H), 3.51 (dd, 3.51, 3H), 3.51 (d, 3.6 hz, 3.1H), 4.7-4H)]＝993.3.
Intermediate I-29: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- (. About.3-cyano-) 4-methoxybenzyl) oxy) -3- (octadecyl) propyl hydrogen phosphate
Intermediate I-28 (0.02 mmol) was dissolved in 2:1 THF: ACN (1:0.5 mL). To this solution was added a solution of cesium fluoride (0.101 mmol) in water (0.026 mL), followed by 4- (dimethylamino) pyridine (0.08 mmol). The reaction mixture was stirred at 80℃for 3 hours. The reaction was cooled to room temperature, 10% aqueous citric acid (20 mL) was added, followed by pH 3-4 adjusted by 2M NaOH. Extraction with EtOAc (50 ml×2) confirmed no desired product in the aqueous layer by LCMS. The combined organic layers were washed once with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% to 50% meoh in DCM) to afford intermediate I-29. 1 HNMR (400 MHz, methanol-d) 4 ) Delta 7.85 (s, 1H), 7.62-7.53 (M, 2H), 7.11-7.00 (M, 1H), 6.87 (d, j=4.5 hz, 1H), 6.81 (d, j=4.5 hz, 1H), 5.65 (d, j=3.6 hz, 1H), 5.26 (dd, j=6.6, 3.7hz, 1H), 5.15 (d, j=6.6 hz, 1H), 4.66-4.49 (M, 2H), 4.20-4.08 (M, 2H), 3.95 (t, j=5.4 hz, 2H), 3.92 (s, 3H), 3.72 (dt, j=9.1, 4.7hz, 1H), 3.56-3.36 (M, 4H), 2.91-2.72 (M, 6H,1.5 eq), 1.71 (s, 54, 3H), 4.92 (M, 3H), 3.92 (s, 3H), 3.29 (M, 3H), 3.7hz, 3.30 (M, 3H) ]＝883.2.
Intermediate I-30 (S) -6- ((1-hydroxy-3- (octadecyl) propan-2-yl) oxy) pyridine carbonitrile
Intermediate I-30 was synthesized in a similar manner to intermediate I-16 using 6-fluorovaleronitrile-2-carbonitrile instead of 3-fluorobenzonitrile. MS M/z [ m+1] = 447.2.
Intermediate I-31: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethylTetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((6-cyanopyridin-2-yl) oxy) -3- (octadecyloxy) propyl) phosphate
Intermediate I-30 (0.119 mmol), intermediate I-27 (0.178 mmol) were placed in a 20mL vial and dried in vacuo (1 h), DCM (3 mL), NMI (38 uL,0.476 mmol), TEA (33 uL,0.238 mmol) were added followed by Bop-Cl (0.143 mmol). The reaction was stirred at room temperature for 2 hours. After 2 hours, excess NMI (38. Mu.L, 4 eq) and TEA (35. Mu.L, 2 eq) were added and the solution was clarified, followed by Bop-Cl (36 mg,4 eq) and stirred overnight at room temperature. The solvent was concentrated under reduced pressure. The crude product was dissolved in DCM, loaded onto a 24g column, eluted with 100% hex for 3 min, 0% to 100% etoac for 6 min, and 100% etoac for 6 min. The product was eluted in 100% etoac and fractions containing pure product were combined and pooled to provide intermediate I-31. 1 H NMR (400 MHz, chloroform-d) delta 7.98-7.86 (M, 1H), 7.61 (dt, j=21.6, 8.0hz, 1H), 7.44-7.22 (M, 3H), 7.20-7.00 (M, 2H), 6.98-6.88 (M, 1H), 6.72 (dd, j=4.5, 2.5hz, 1H), 6.64-6.57 (M, 1H), 5.78 (s, 2H), 5.68 (dt, j=8.0, 3.2hz, 1H), 5.48 (dt, j=28.2, 4.8hz, 1H), 5.27 (d, j=12.0, 6.8,3.1hz, 1H), 5.14 (ddd, j=19.1, 11.5,6.6hz, 1H), 4.72-4.36 (M, 4H), 3.61 (s, 2H), 3.33.7 hz, 1H), 5.48 (dt, j=28.2, 4.8hz, 1H), 5.27 (d, 3.3.3 hz, 1H), 3.33 (j=2H), 3.33 (j=2.0, 3 hz, 1H)]＝950.1.
Intermediate I-32: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxol-4-yl) methyl ((R) -2- ((6-cyano) Pyridin-2-yl) oxy) -3- (octadecyloxy) propyl) hydrogen phosphate
Intermediate I-31 (0.062 mmol) was dissolved in 2:1 THF: ACN (2:1 mL). To this solution was added cesium fluoride (0.311 mmol) in water (0.078 mL), followed by 4- (dimethylamino) pyridine (0.249 mmol). The reaction mixture was stirred at 80℃for 3 hours. The reaction was cooled to room temperature, 10% aqueous citric acid (20 mL) was added, followed by pH 3-4 adjusted by 2M NaOH. Extraction with MeTHF/EtOAc (3:2, 50 mL. Times.2) confirmed by LCMS that the aqueous layer had no desired product. The combined organic layers were washed once with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% to 50% meoh in DCM) to afford intermediate I-32. 1 H NMR (400 MHz, chloroform-d) delta 7.85 (d, j=6.6 hz, 1H), 7.73 (q, j=8.0 hz, 1H), 7.38 (t, j=7.6 hz, 1H), 7.04 (dd, j=14.6, 8.6hz, 1H), 6.83 (dt, j=12.9, 5.0hz, 2H), 5.69-5.58 (M, 1H), 5.44 (t, j=5.1 hz, 1H), 5.27 (td, j=8.1, 7.5,3.8hz, 1H), 5.16 (t, j=5.4 hz, 1H), 4.66-4.32 (M, 1H), 4.22-4.03 (M, 3H), 3.70-3.57 (M, 2H), 3.51-3.34 (M, 2H), 1.69 (s, 3H), 1.52 (M, 1.52), 1.9 hz, 1.30 hz, 5.30 hz, 5.3.38 (t, j=5.6 hz, 1H), 5.30.30 hz, 1H)]＝840.1.
Intermediate I-33 (S) -5- (((1-hydroxy-3- (octadecyl) propan-2-yl) oxy) methyl) pyridinium nitrile
Intermediate I-33 was synthesized in a similar manner to intermediate I-23 using 5- (bromomethyl) pyridine nitrile instead of 3- (bromomethyl) -5-fluorobenzonitrile. MS M/z [ m+1] = 461.4.
Intermediate I-34: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((6-cyanopyridin-3-yl) methoxy) -3- (octadecyloxy) propyl) phosphate
Intermediate I-33 (0.119 mmol), intermediate I-27 (0.178 mmol) were placed in a 20mL vial and dried in vacuo (1 h), DCM (3 mL), NMI (38 uL,0.476 mmol), TEA (33 uL,0.238 mmol) were added followed by Bop-Cl (0.143 mmol). The reaction was stirred at room temperature for 2 hours. After 2 hours, excess NMI (38. Mu.L, 4 eq) and TEA (35. Mu.L, 2 eq) were added and the solution was clarified, followed by Bop-Cl (36 mg,4 eq) and stirred overnight at room temperature. The solvent was concentrated under reduced pressure. The crude product was dissolved in DCM, loaded onto a 24g column, eluted with 100% hex for 3 min, 0% to 100% etoac for 6 min, and 100% etoac for 6 min. The product was eluted in 100% etoac and fractions containing pure product were combined and pooled to provide intermediate I-34. 1 H NMR (400 MHz, chloroform-d) δ8.60 (dd, j=19.4, 2.0hz, 1H), 7.91 (d, j=7.6 hz, 1H), 7.83 (ddd, j=14.0, 8.0,2.1hz, 1H), 7.58 (t, j=8.4 hz, 1H), 7.47-7.31 (M, 2H), 7.22-7.00 (M, 2H), 6.71 (dd, j=4.5, 3.2hz, 1H), 6.60 (dd, j=11.2, 4.5hz, 1H), 5.80 (s, 2H), 5.66 (t, j=2.3 hz, 1H), 5.34-5.24 (M, 1H), 5.12 (dd, j=20.0, 6.6hz, 1H), 4.86-4.65 (M, 2H), 4.62 (dd), 4.18-4.2 hz, 3.5hz, 1H), 6.60 (dd, j=11.2, 4.5hz, 1H), 5.80 (s, 2H), 5.66 (t, j=2.3 hz, 1H), 5.34-5.24 (M, 1H), 5.12 (dd, j=20.0, 6.6hz, 1H), 4.86-4.65 (M, 2H), 4.62 (2H), 4.32.1H), 4.60 (dd, 3.1H), 3.60 (J, 3.1H), 4.60 (j=1H), 1H (1H), 1.1H (1H), 3.1H)]＝964.8.
Intermediate I-35: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxol-4-yl) methyl ((R) -2- ((6-cyano) Pyridin-3-yl) methoxy) -3- (octadecyloxy) propyl) phosphate dibasic
Intermediate I-34 (0.068 mmol) was dissolved in 2:1 THF: ACN (2:1 mL). A solution of cesium fluoride (0.342 mmol) in water (0.092 mL) was added to theTo the solution, 4- (dimethylamino) pyridine (0.342 mmol) was then added. The reaction mixture was stirred at 80℃for 3 hours. The reaction was cooled to room temperature, 10% aqueous citric acid (8.5 mL) was added, followed by 2M NaOH to adjust pH 3-4. Extraction with MeTHF/EtOAc (3:2, 50 mL. Times.2) confirmed by LCMS that the aqueous layer had no desired product. The combined organic layers were washed once with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% to 50% meoh in DCM) to afford intermediate I-35. 1 H NMR (400 MHz, chloroform-d) delta 7.85 (d, j=6.6 hz, 1H), 7.73 (q, j=8.0 hz, 1H), 7.38 (t, j=7.6 hz, 1H), 7.04 (dd, j=14.6, 8.6hz, 1H), 6.83 (dt, j=12.9, 5.0hz, 2H), 5.67-5.55 (M, 1H), 5.44 (t, j=5.1 hz, 1H), 5.27 (td, j=8.1, 7.5,3.8hz, 1H), 5.16 (t, j=5.4 hz, 1H), 4.67-4.32 (M, 2H), 4.24-3.99 (M, 3H), 3.76-3.53 (M, 2H), 3.50-3.35 (M, 3H), 1.69 (s, 3H), 1.67-5.1 hz, 1H), 5.27 (t, j=8.1, 7.5,3.8hz, 1H), 5.16 (t, j=5.4 hz, 1H), 4.67-4.32 (M, 3.24H), 3.24 (t, 3H), 3.76-3.53 (M, 3H), 1.50 (2H), 1.35 (v, 3H), 1.38 (J, 1hz, 1H), 1.38 (J, 3H) and 1.38 (J, 1 hz)]＝854.3.
Intermediate I-36 (R) -1- (trityloxy) nonadecan-2-ol
A solution of (R) -2- ((trityloxy) methyl) oxirane (6.32 mmol,1 eq.) and copper (I) iodide (1.81 mmol,0.286 eq.) in THF (20 mL) was cooled in an ice bath. Hexadecyl magnesium bromide (24 ml,0.4m,1.52 eq.) was added gradually over 35 minutes. The solution was stirred for 4 hours while gradually reaching room temperature in an ice bath. The reaction mixture was quenched with saturated ammonium chloride (50 mL) and water (50 mL). The aqueous layer was extracted with EtOAc (3X 100 mL). The organic fraction was taken up in Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified twice by silica gel chromatography (0% to 15% etoac/hexanes) to afford intermediate I-36. 1 H NMR (400 MHz, chloroform-d) delta 7.50-7.20 (m, 15H), 3.80-3.71 (m, 1H), 3.21-3.13 (m, 1H), 3.06-2.98 (m, 1H), 2.29 (d, J=3.4 Hz, 1H), 1.46-1.16 (m, 32H), 0.92-0.84 (m, 3H).
Intermediate I-37 (R) -3-fluoro-5-(((1- (tritoxy) nonadec-2-yl) oxy) methyl) benzonitrile
To a solution of intermediate I-36 (2.08 mmol,1 eq.) in THF (10 mL) was added sodium tert-butoxide (2.08 mL,2.0M in THF, 2 eq.). The solution was stirred at room temperature for 20 minutes, then 3- (bromomethyl) -5-fluorobenzonitrile (4.05 mmol,1.94 eq.) was added. The solution was stirred at room temperature for 7 hours. The reaction mixture was diluted with water (50 mL) and extracted with EtOAc (3 x 50 mL). The organic fractions were combined, washed with brine (50 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% to 10% etoac in hexanes) to afford intermediate I-37. 1 H NMR (400 MHz, chloroform-d) delta 7.48-7.20 (m, 18H), 4.71 (d, J=12.8 Hz, 1H), 4.55 (d, J=12.8 Hz, 1H), 3.56-3.47 (m, 1H), 3.23-3.17 (m, 2H), 1.57-1.47 (m, 2H), 1.34-1.18 (m, 30H), 0.92-0.83 (m, 3H). 19 F NMR (376 MHz, chloroform-d) delta-110.57- -110.69 (m).
Intermediate I-38 (R) -3-fluoro-5- (((1-hydroxynonadec-2-yl) oxy) methyl) benzonitrile
To a solution of intermediate I-37 (1.66 mmol,1 eq.) in 1:1:1 THF:iPrOH:MeOH (21 mL total) was added concentrated HCl (0.53 mL,6.37mmol,3.85 eq.). The reaction mixture was heated to 65 ℃ and stirred for 1 hour 30 minutes. The solution was quenched with saturated sodium bicarbonate (50 mL) and water (50 mL). The aqueous layer was extracted with EtOAc (3X 50 mL). The organic extracts were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% to 100% etoac in hexanes) to afford intermediate I-38. 1 H NMR (400 MHz, chloroform-d) delta 7.46-7.43 (m, 1H), 7.36-7.31 (m, 1H), 7.30-7.24 (m, 1H), 4.64-4.62 (m, 2H), 3.80-3.70%m,1H),3.66–3.48(m,2H),1.79–1.71(m,1H),1.68–1.45(m,2H),1.40–1.16(m,30H),0.91–0.84(m,3H). 19 F NMR (376 MHz, chloroform-d) delta-110.27- -110.40 (m).
Intermediate I-39: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((3-cyano-5-fluorobenzyl) oxy) nonadecyl) phosphate
To the oven dried round bottom flask was added 1H-1,2, 4-triazole (0.744 mmol,2.15 eq). Triazole was dissolved in ACN (5.0 mL) and pyridine (5.0 mL). Triethylamine (0.104 mL,0.744mmol,2.15 eq.) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.06 mL, 0.348 mmol,1 eq.). The reaction mixture was stirred at room temperature for 24 minutes, then intermediate I-3a (0.348 mmol,1 eq.) was added in one portion followed by 1-methylimidazole (0.06 mL,0.698mmol,2.02 eq.). The solution was stirred for one hour. Intermediate I-38 (0.380 mmol,1.1 eq.) was added and the reaction mixture was stirred for an additional 2 hours 30 minutes. The reaction was quenched with 4:1 citric acid (20% in water) to 1M NaOH (19 mL) buffer. The aqueous layer was extracted with EtOAc (3X 50 mL). The organic fractions were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% to 20% meoh in DCM) to afford intermediate I-39.MS M/z [ M+1 ]]＝937.27.
Intermediate I-40: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- ((3-cyano-) 5-fluorobenzyl) oxy) nonadecyl hydrogen phosphate
Intermediate I-39 (0.244 mmol,1 eq.) was dissolved in 2:1 THF: ACN (4.5 mL total). Cesium fluoride (2.12 mmol,8.68 eq.) dissolved in water (0.30 mL) was added to the solution followed by 4- (dimethylamino) pyridine (0.900 mmol,3.69 eq.). The reaction mixture was heated to 80 ℃ and stirred for 5 hours 30 minutes. The reaction was quenched with 20mL of water containing citric acid (2.86 mmol,11.7 eq.) and NaOH (0.29 mL,2M,2.34 eq.). The aqueous layer was extracted with EtOAc (2X 50 mL). The organic fractions were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% to 50% meoh in DCM) to afford intermediate I-40. 1 H NMR (400 MHz, methanol-d 4) delta 7.82 (s, 1H), 7.51-7.47 (m, 1H), 7.43-7.34 (m, 2H), 6.86-6.77 (m, 2H), 5.63 (d, J=3.6 Hz, 1H), 5.29-5.23 (m, 1H), 5.13 (d, J=6.6 Hz, 1H), 4.73 (d, J=13.1 Hz, 1H), 4.54-4.46 (m, 1H), 4.16-4.07 (m, 2H), 3.94-3.82 (m, 2H), 3.60-3.49 (m, 1H), 1.69 (s, 3H), 1.47-1.20 (m, 35H), 0.93-0.86 (m, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.67- -113.35 (m). 31 P NMR (162 MHz, methanol-d 4) delta-0.12- -0.64 (m). MS M/z [ M+1 ]]＝827.24.
Intermediate I-41 (R) -2-methoxy-4- (((1- (trityloxy) eicosan-2-yl) oxy) methyl) benzyl Nitrile (II)
To a solution of intermediate I-112 (1.88 mmol,1.0 eq.) in THF (6.0 mL) cooled in an ice-bath was added sodium tert-butoxide (2.0 mL,2.0M in THF, 2.12 eq.). 4- (bromomethyl) -2-methoxybenzonitrile (2.57 mmol,1.36 eq.) was added in one portion. The solution was stirred at room temperature overnight. The reaction mixture was heated to 60 ℃ and stirred for 5 hours 30 minutes, then stirred at room temperature overnight. The solution was cooled in an ice bath and sodium tert-butoxide (1.00 mL,2.0M in THF, 1.06 eq.) was added followed by additional additions4- (bromomethyl) -2-methoxybenzonitrile (0.792 mmol,0.420 eq.). After stirring for 7 hours 30 minutes, additional 4- (bromomethyl) -2-methoxybenzonitrile (1.08 mmol,0.575 eq.) was added and the solution was stirred at room temperature overnight. Quench the reaction mixture with water (100 mL) and extract with EtOAc (3X 100 mL). The organic fractions were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified twice by silica gel chromatography (0-75% etoac in hexanes then 0% to 15% etoac in hexanes) to afford intermediate I-41. 1 H NMR (400 MHz, chloroform-d) delta 7.49 (d, 1H), 7.47-7.41 (m, 6H), 7.35-7.20 (m, 9H), 7.02-6.99 (m, 1H), 6.96-6.92 (m, 1H), 4.72 (d, J=13.0 Hz, 1H), 4.59 (d, J=13.0 Hz, 1H), 3.84 (s, 3H), 3.57-3.48 (m, 1H), 3.24-3.14 (m, 2H), 1.58-1.48 (m, 2H), 1.37-1.15 (m, 34H), 0.91-0.84 (m, 3H).
Intermediate I-42 (R) -4- (((1-hydroxy-di-undec-2-yl) oxy) methyl) -2-methoxybenzonitrile
To a solution of intermediate I-41 (1.02 mmol,1 eq.) in 1:1:1 THF:iPrOH:MeOH (18.0 mL total) was added concentrated HCl (0.33 mL,3.91mmol,3.85 eq.). The reaction mixture was heated to 65 ℃ and stirred for 4 hours 30 minutes. The solution was quenched with saturated sodium bicarbonate (50 mL) and water (50 mL). The aqueous layer was extracted with EtOAc (3X 50 mL). The organic extracts were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% to 20% etoac/hexanes, then 0% to 100% etoac/hexanes) to afford intermediate I-42. 1 H NMR (400 MHz, chloroform-d) delta 7.55-7.50 (m, 1H), 7.02-6.99 (m, 1H), 6.99-6.94 (m, 1H), 4.69-4.59 (m, 2H), 3.96-3.93 (m, 3H), 3.78-3.70 (m, 1H), 3.64-3.47 (m, 2H), 1.85-1.74 (m, 1H), 1.69-1.17 (m, 36H), 0.92-0.84 (m, 3H).
Intermediate I-43 ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1，2，4]Triazin-7-yl) -4-cyanides Base-2, 2-dimethyltetrahydrofurano [3,4-d ]][1，3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) -2-) ((4-cyano-3-methoxybenzyl) oxy) eicosyl) phosphate
To a solution of intermediate I-42 (0.192 mmol,1 eq), intermediate I-27 (0.192 mmol,1 eq), triethylamine (0.04 mL,0.287mmol,1.5 eq) and 1-methylimidazole (0.04 mL,0.502mmol,2.62 eq) in DCM (2.0 mL) was added BOP-Cl (0.611 mmol,3.22 eq). The solution was stirred at room temperature for 4 hours. An additional 5mg of ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) are added][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) phosphate (0.00958 mmol,0.05 eq.) and the solution was stirred at room temperature for 6 days. The reaction mixture was treated with 2:1 Et 2 O: etOAc (60 mL) dilution with 4:1 water: saturated NaHCO 3 (50 mL) quenching. Separating the layers, and using 2:1 Et for the aqueous layer 2 O: etOAc (60 mL) was extracted once more with EtOAc (50 mL). The organic extracts were combined, taken over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified on silica gel (0% -10% meoh in DCM) to afford intermediate I-43.MS M/z [ M+1 ] ]＝977.4.
Intermediate I-44, ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1，2，4]Triazin-7-yl) -4-cyanides 1-methyl-2, 2-dimethyltetrahydrofuran [3,4-d ]][1，3]Dioxol-4-yl) methyl ((R) -2- ((4-cyano-3-methoxy) Monobenzyl) oxy) eicosyl) hydrogen phosphate
Intermediate I-430 (0.102 mmol,1.0 eq.) was dissolved in 2:1 THF: ACN (4.5 mL total). Cesium fluoride (1.45 mmol,14.2 eq.) in water (0.70 mL)) To this solution was added 4- (dimethylamino) pyridine (0.409 mmol,4 eq.) followed by the addition. The reaction mixture was heated to 80 ℃ and stirred for 5 hours 30 minutes. The reaction was quenched with a buffer solution containing citric acid (4.65 ml,0.22m,10 eq) and NaOH (0.10 ml,2m,2 eq). The aqueous layer was extracted with EtOAc (2×). The organic fractions were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% -50% meoh in DCM) to afford intermediate I-44.MS M/z [ M+1 ]]＝867.4.
Intermediate I-45 (S) -eicosane-1, 2-diol
To a solution of tBuOH (50 mL) and water (50 mL) was added AD-mix- α (1.32 g/mmol olefin). The mixture was vigorously stirred for 5 minutes and then cooled in an ice bath for 10 minutes. Eicosene (8.77 mol,1 eq.) was added in one portion and the reaction mixture was stirred at room temperature overnight. Sodium sulfite (15.0 g,0.119mol,13.6 eq.) was added and the solution was stirred at room temperature for 1 hour. The mixture was filtered through celite and the filtrate was concentrated in vacuo to remove tBuOH. The combined filtrates were diluted with water (25 mL) and extracted with EtOAc (3X 75 mL). The organic extracts were washed with brine, over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified on silica gel (0% to 100% etoac in hexanes) followed by further elution of the product with 0% -40% meoh in DCM to afford intermediate I-45. 1 H NMR (400 MHz, chloroform-d) delta 3.78-3.62 (m, 2H), 3.50-3.40 (m, 1H), 2.04-1.19 (m, 36H), 0.92-0.85 (m, 3H).
Intermediate I-46 (S) -1- (trityloxy) eicosan-2-ol
To intermediate I-45 (1.08 mmol,1 eq.) and 4- (dimethylamino)) To a solution of pyridine (0.426 mmol,0.394 eq.) in DCM (10 mL) was added triethylamine (0.17 mL,1.24mmol,1.15 eq.). Trityl chloride (1.10 mmol,1.02 eq.) was then added. The reaction mixture was stirred at room temperature overnight. An additional 25mg of trityl chloride (0.090 mmol,0.083 eq.) was added and the solution stirred at room temperature for an additional 6 hours. The reaction mixture was diluted with DCM (50 mL) and poured into ice water (50 mL). The layers were separated and the aqueous layer extracted with another 50mL DCM. The organic extracts were combined, washed with brine (50 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified on silica gel (0% -90% dcm in hexanes) to afford intermediate I-46.H NMR (400 MHz, chloroform-d) delta 7.46-7.20 (m, 15H), 3.80-3.71 (m, 1H), 3.18 (dd, J=9.3, 3.3Hz, 1H), 3.02 (dd, J=9.4, 7.6Hz, 1H), 2.29 (s, 1H), 1.47-1.15 (m, 34H), 0.91-0.84 (m, 3H).
Intermediate I-47 (S) -3-fluoro-5- (((1- (trityl) icosane-2-yl) oxy) methyl) benzonitrile
To a solution of intermediate I-46 (0.254 mmol,1 eq.) in THF (3.0 mL) was added sodium tert-butoxide (0.29 mL,2.0M in THF, 2 eq.). The solution was stirred at room temperature for 5 minutes, then 3- (bromomethyl) -5-fluorobenzonitrile (0.784 mmol,2.67 eq.) was added. The solution was stirred at room temperature overnight. The reaction mixture was diluted with water (25 mL) and extracted with EtOAc (3×25 mL). The organic fractions were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% to 10% etoac in hexanes) to afford intermediate I-47. 1 H NMR (400 MHz, chloroform-d) delta 7.52-7.21 (m, 18H), 4.71 (d, j=12.8 hz, 1H), 4.55 (d, j=12.8 hz, 1H), 3.55-3.48 (m, 1H), 3.23-3.18 (m, 2H), 1.64-1.44 (m, 2H), 1.34-1.20 (m, 32H), 0.91-0.85 (m, 3H). 19 F NMR (376 MHz, chloroform-d) delta-110.57- -110.72 (m).
Intermediate I-48 (S) -3-fluoro-5- (((1-hydroxyeicosan-2-yl) oxy) methyl) benzonitrile
To a solution of intermediate I-47 (0.284 mmol,1 eq.) in 1:1:1 THF: iPrOH: meOH (6 mL total) was added concentrated HCl (0.10 mL,1.20mmol,4.19 eq.). The reaction mixture was heated to 65 ℃ and stirred for 1 hour 30 minutes. The solution was quenched with saturated sodium bicarbonate (50 mL) and water (50 mL). The aqueous layer was extracted with EtOAc (2X 50 mL). The organic extracts were combined, taken over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% to 100% etoac in hexanes) to afford intermediate I-48. 1 H NMR (400 MHz, chloroform-d) delta 7.45 (s, 1H), 7.37-7.31 (m, 1H), 7.29-7.24 (m, 1H), 4.65-4.61 (m, 2H), 3.78-3.70 (m, 1H), 3.65-3.56 (m, 1H), 3.56-3.48 (m, 1H), 1.88-1.45 (m, 3H), 1.41-1.19 (m, 32H), 0.88 (t, J=6.7 Hz, 3H). 10 F NMR (376 MHz, chloroform-d) delta-110.26- -110.38 (m).
Intermediate I-49: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -6-cyanides 1-2, 2-dimethyltetrahydrofurano [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((S) -2-) ((3-cyano-5-fluorobenzyl) oxy) eicosanyl) phosphate
To a solution of intermediate I-48 (0.148 mmol,1 eq.), intermediate I-27 (0.134 mmol,1 eq.), triethylamine (0.07 mL,0.537mmol,4 eq.) and 1-methylimidazole (0.02 mL,0.268mmol,2 eq.) in DCM (5.0 mL) was added BOPCl (0.537 mmol,4 eq.). The solution was stirred at room temperature overnight. Another 140mg of BOP-Cl (0.550 mmol,4.1 eq.) and 0.05mL of 1-methylimidazole (0.627 mmol,4.68 eq.) were added and the solution was stirred at room temperature for 3 hours. Another 54mg of BOP-Cl (0.212 mmol,1.58 eq.) was added and the reaction mixture was stirred for 1 hour. The solution was diluted with EtOAc (20 mL) Releasing and using 4:1 water to saturated NaHCO 3 (20 mL) quenching. The layers were separated and the aqueous layer was extracted with EtOAc (2X 20 mL). The organic extracts were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel (0% to 10% meoh in DCM) to afford intermediate-49. MS M/z [ M+1 ]]＝951.33.
Intermediate I-50: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyanides 1-2, 2-dimethyltetrahydrofurano [3,4-d ]][1,3]Dioxol-4-yl) methyl ((S) -2- ((3-cyano-5-fluoro) Benzyl) oxy) eicosyl) hydrogen phosphate
/>
Intermediate I-49 (0.0851 mmol,1.0 eq.) was dissolved in 2:1 THF: ACN (4.5 mL total). Cesium fluoride (0.829 mmol,9.74 eq.) dissolved in water (0.50 mL) was added to the solution followed by 4-dimethylaminopyridine (0.3411 mmol,4.0 eq.). The reaction mixture was heated to 80 ℃ and stirred for 2 hours, then stirred for another 40 minutes. The reaction was quenched with a buffer solution of citric acid (20 mL,0.22M,51.7 eq.) and NaOH (0.44 mL,2M,10.3 eq.). The aqueous layer was extracted with EtOAc (3X 30 mL). The organic fractions were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% -40% meoh in DCM) to afford intermediate I-50. 1 H NMR (400 MHz, methanol-d) 4 )δ7.87–7.80(m,1H),7.52–7.31(m,3H),6.89–6.76(m,2H),5.67–5.59(m,1H),5.30–5.22(m,1H),5.17–5.08(m,1H),4.77–4.69(m,1H),4.54–4.45(m,1H),4.16–4.06(m,2H),3.95–3.80(m,2H),3.62–3.51(m,1H),1.73–1.65(m,3H),1.52–1.16(m,37H),0.93–0.86(m,3H).MS m/z[M+1]＝841.34.
Intermediate I-51a: (S) -2- ((5-bromopyridin-3-yl) methoxy) -3- (octadecyloxy) propan-1-ol
Intermediate I-51a was prepared in a similar manner to intermediate I-23 using 3-bromo-5- (bromomethyl) pyridine instead of intermediate 3- (bromomethyl) -5-fluorobenzonitrile. 1 H NMR (400 MHz, chloroform-d) δ8.66 (d, J=2.1 Hz, 1H), 8.62-8.50 (M, 1H), 8.13-7.97 (M, 1H), 4.88-4.70 (M, 2H), 3.84-3.77 (M, 1H), 3.77-3.69 (M, 2H), 3.64-3.55 (M, 2H), 3.47 (td, J=6.7, 1.6Hz, 2H), 1.66-1.52 (M, 2H), 1.40-1.20 (M, 30H), 0.98-0.84 (M, 3H) MS M/z [ M+1]]＝514.3.
Intermediate I-51 (S) -5- (((1-hydroxy-3- (octadecyl) propan-2-yl) oxy) methyl) nicotinonitrile
Tetrakis (triphenylphosphine) palladium (0) (15.3. Mu. Mol) was added to a vigorously stirred mixture of intermediate I-51a (146. Mu. Mol), zinc (II) cyanide (35.9 mg, 309. Mu. Mol) and N, N-dimethylformamide (2.0 mL) at room temperature, and the resulting mixture was heated to 100 ℃. After 3 hours, the resulting mixture was cooled to room temperature, and diethyl ether (40 mL), ethyl acetate (20 mL), sodium bicarbonate solution (10 mL) and saturated aqueous sodium carbonate solution (5 mL) were added in this order. The organic layer was washed with water (2×80 mL), dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (0 to 50% ethyl acetate in hexanes) to give intermediate I-51.MS M/z [ m+1] = 461.4
Intermediate I-52: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -6-cyanides 1-2, 2-dimethyltetrahydrofurano [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) -2-) ((5-cyanopyridin-3-yl) methoxy) -3- (octadecyloxy) propyl) phosphate
To a solution of intermediate I-51 (0.0918 mmol,1 eq), intermediate I-27 (0.0918 mmol,1 eq), triethylamine (0.02 mL,0.143mmol,1.56 eq) and 1-methylimidazole (0.02 mL,0.251mmol,2.73 eq) in DCM (2.0 mL) was added BOP-Cl (0.255 mmol,2.78 eq). The solution was stirred at room temperature overnight. The solution was left at room temperature for 2 days. An additional 70mg of BOP-Cl (0.275 mmol,2.99 eq.) and 0.03mL of 1-methylimidazole (0.376 mmol,4.1 eq.) were added and the solution was stirred overnight at room temperature. The solution was diluted with EtOAc (20 mL) and saturated with 4:1 water:saturated NaHCO 3 (20 mL) quenching. The layers were separated and the aqueous layer was extracted with EtOAc (2X 20 mL). The organic extracts were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified on silica gel (0% to 10% meoh in DCM) to afford intermediate-52. MS M/z [ M+1 ]]＝964.33.
Intermediate I-53: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) -4-cyanides 1-2, 2-dimethyltetrahydrofurano [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- ((5-cyanopyridine) 3-yl) methoxy) -3- (octadecyloxy) propyl) hydrogen phosphate
/>
Intermediate I-52 (0.0649 mmol,1 eq.) was dissolved in 2:1 THF: ACN (4.5 mL total). Cesium fluoride (0.876 mmol,13.5 eq.) dissolved in water (0.50 mL) was added to the solution followed by 4- (dimethylamino) pyridine (0.260 mmol,4 eq.). The reaction mixture was heated to 80 ℃ and stirred for 2 hours 30 minutes. The reaction was quenched with a buffer solution of citric acid (20 mL,0.22M,67.8 eq.) and NaOH (0.44 mL,2M,13.6 eq.). The aqueous layer was extracted with EtOAc (3X 30 mL). The organic fractions were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% -40% meoh in DCM) to afford intermediate I-53. 1 H NMR (400 MHz, meOH-d 4) delta8.75–8.71(m,2H),8.19–8.16(m,1H),7.84(s,1H),6.84–6.78(m,2H),5.63(d,J＝3.6Hz,1H),5.26(dd,J＝6.6,3.6Hz,1H),5.14(d,J＝6.6Hz,1H),4.81–4.64(m,2H),4.16–4.08(m,2H),3.99–3.90(m,2H),3.79–3.71(m,1H),3.53–3.36(m,4H),1.69(s,3H),1.59–1.48(m,2H),1.41–1.21(m,33H),0.92–0.87(m,3H).MS m/z[M+1]＝854.28.
Intermediate I-54 (R) -3-fluoro-5- (((1- (trityl) di-undec-2-yl) oxy) methyl) benzonitrile
To a solution of intermediate I-112 (2.24 mmol,1.0 eq.) in THF (10.0 mL) cooled in an ice-bath was gradually added NaH (60% dispersed in mineral oil) (9.79 mmol,4.37 eq.). The solution was stirred vigorously for 5 minutes, and 3- (bromomethyl) -5-fluorobenzonitrile (3.00 mmol,1.34 eq.) was added in one portion. The reaction mixture was heated to 80 ℃ and stirred under nitrogen for 2 hours, then stirred for an additional 15 minutes. The solution was stirred at 60 ℃ overnight. The reaction mixture was quenched with saturated ammonium chloride until evolution of gas ceased. The solution was diluted with water (100 mL) and the aqueous layer was extracted with ethyl acetate (3X 100 mL). The organic fractions were combined, washed with brine (100 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% -10% etoac in hexanes) to afford intermediate I-54. 1 H NMR (400 MHz, chloroform-d) delta 7.47-7.21 (m, 18H), 4.71 (d, J=12.9 Hz, 1H), 4.55 (d, J=12.8 Hz, 1H), 3.55-3.47 (m, 1H), 3.23-3.17 (m, 2H), 1.58-1.46 (m, 2H), 1.35-1.18 (m, 34H), 0.92-0.84 (m, 3H). 19 F NMR (376 MHz, chloroform-d) delta-110.60- -110.67 (m).
Intermediate I-55 (R) -3-fluoro-5- (((1-hydroxy-di-undec-2-yl) oxy) methyl) benzonitrile
To intermediatesTo a solution of I-54 (1.27 mmol,1 eq.) in 1:1:1 THF: iPrOH: meOH (21 mL total) was added concentrated HCl (0.41 mL,12.0M,3.85 eq.). The reaction mixture was heated to 65 ℃ and stirred for 2 hours. The solution was quenched with saturated sodium bicarbonate and water (50 mL) until gas evolution ceased. The pH of the aqueous layer was adjusted to 7 using saturated sodium bicarbonate. The aqueous layer was extracted with EtOAc (2X 75 mL). The organic extracts were combined, washed with brine (50 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% -100% etoac in hexanes) to afford intermediate I-55. 1 H NMR (400 MHz, chloroform-d) delta 7.46-7.43 (m, 1H), 7.37-7.31 (m, 1H), 7.30-7.24 (m, 1H), 4.65-4.61 (m, 2H), 3.79-3.70 (m, 1H), 3.65-3.48 (m, 2H), 1.76 (s, 1H), 1.68-1.47 (m, 2H), 1.45-1.17 (m, 34H), 0.93-0.83 (m, 3H). 19 F NMR (376 MHz, chloroform-d) delta-110.27- -110.37 (m).
Intermediate I-56: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((3-cyano-5-fluorobenzyl) oxy) heneicosyl) phosphate
To the oven dried round bottom flask was added 1H-1,2, 4-triazole (2.60 mmol,2.15 eq). Triazole was dissolved in ACN (10.0 mL) and pyridine (10.0 mL). Triethylamine (0.36 mL,2.60mmol,2.15 eq.) was added to the solution under argon followed by 2-chlorophenyl phosphorus dichloride (0.20 mL,1.21mmol,1 eq.). The reaction mixture was stirred at room temperature for 27 min, then intermediate I-3a (1.21 mmol,1 eq.) was added in one portion followed by 1-methylimidazole (0.16 mL,2.02mmol,1.67 eq.). The solution was stirred for about 1 hour. Intermediate I-55 (1.33 mmol,1.1 eq.) was added and the reaction mixture stirred under argon for an additional 2 hours. The reaction was quenched with 4:1 citric acid (20% in water) to 1M NaOH (50 mL) buffer. The aqueous layer was extracted with EtOAc (4X 50 mL).The organic fractions were combined, washed with brine (50 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-20% meoh in DCM) to afford intermediate I-56.MS M/z [ M+1 ] ]＝965.24.
Intermediate I-57: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- ((3-cyano-) 5-fluorobenzyl) oxy) heneicosyl) hydrogen phosphate
Intermediate I-56 (1.22 mmol,1.0 eq.) was dissolved in 2:1 THF: ACN (13.5 mL total). Cesium fluoride (3.65 mmol,3 eq.) dissolved in water (1.5 mL) was added to the solution followed by 4-dimethylaminopyridine (4.09 mmol,3.37 eq.). The reaction mixture was heated to 80 ℃ and stirred for 1 hour 30 minutes, then stirred for another 30 minutes. The reaction was quenched with a buffer of citric acid (12.2 mmol,10 eq.) and NaOH (1.22 mL,2m,2 eq.) in water (60 mL). The aqueous layer was extracted with EtOAc (3X 100 mL). The organic fractions were combined, washed with 3:2 water: brine (50 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% -50% meoh in DCM) to afford intermediate I-57.MS M/z [ M+1 ]]＝855.25.
Intermediate I-58 ((2R, 3S,4R, 5S) -5- (4-aminopyrrolo [2, 1-f)][1，2，4]Triazin-7-yl) -2- Cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl (2-chlorophenyl) ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) -3-) (heptadecyloxy) propyl) phosphate
Intermediate I-4 (0.0724 mmol) was dissolved in an aqueous solution (0.1 mL) of THF-ACN (1:0.5 mL) and CsF (95.4 mg, 0.6278 mmol) and DMAP (0.267 mmol) was added. The resulting mixture was heated at 80℃for 3.5h. After dilution with PBS buffer (5 mL) at pH 7, the mixture was partitioned between brine (10 mL) and EtOAc (20 mL). The aqueous layer was extracted with EtOAc (10 mL. Times.3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0% 50% meoh/DCM) to give intermediate I-58.MS M/z [ m+1] =857.
Intermediate I-59 (S) -1- (trityloxy) di-undecan-2-ol
(S) -2- ((tritoxy) methyl) oxirane (7.11 mmol) was dissolved in 2-MeTHF (7.0 mL). Copper (I) iodide (0.777 mmol) was added thereto. The white slurry was cooled in an ice bath. Octadecyl magnesium bromide (42 ml,0.213 m) was gradually added over 45 minutes while maintaining the internal temperature no higher than 11.4 ℃. The solution was stirred for 3 hours 15 minutes while gradually reaching room temperature in an ice bath. The reaction mixture was quenched with saturated ammonium chloride (50 mL) and water (50 mL). The organic layer was separated. The aqueous layer was extracted with EtOAc (2X 75 mL). The organic fraction was washed with 1:1 brine: water, over Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude material was dry loaded onto silica and purified twice by silica gel chromatography (0-100% etoac in hexanes then 0-20% etoac in hexanes) to afford intermediate I-59. 1 H NMR (400 MHz, chloroform-d) delta 7.47-7.41 (m, 6H), 7.34-7.22 (m, 9H), 3.81-3.72 (m, 1H), 3.18 (dd, j=9.4, 3.3hz, 1H), 3.03 (dd, j=9.3, 7.5hz, 1H), 2.31 (s, 1H), 1.50-1.16 (m, 36H), 0.89 (t, j=6.7 hz, 3H).
Intermediate I-60 (S) -3-fluoro-5- (((1- (tritoxy) di-undec-2-yl) oxy) methyl) benzonitrile
To a solution of intermediate I-59 (2.72 mmol) in THF (15 mL) was added sodium tert-butoxide (2.7 mL,2.0M in THF). The solution was stirred at room temperature for 5 minutes, then 3- (bromomethyl) -5-fluorobenzonitrile (5.05 mmol) was added. The solution was stirred at room temperature overnight. The reaction mixture was diluted with water (75 mL) and extracted with EtOAc (3 x 50 mL). The organic fractions were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% to 10% etoac in hexanes) to afford intermediate I-60. 1 H NMR (400 MHz, chloroform-d) delta 7.48-7.19 (m, 18H), 4.71 (d, J=12.8 Hz, 1H), 4.55 (d, J=12.9 Hz, 1H), 3.55-3.47 (m, 1H), 3.23-3.18 (m, 2H), 1.58-1.47 (m, 2H), 1.34-1.18 (m, 34H), 0.91-0.85 (m, 3H). 19 F NMR (376 MHz, chloroform-d) delta-110.59- -110.68 (m).
Intermediate I-61 (S) -3-fluoro-5- (((1-hydroxy-di-undec-2-yl) oxy) methyl) benzonitrile
To a solution of intermediate I-60 (2.03 mmol) in 1:1:1 THF: meOH: iPrOH (21.0 mL total) was added concentrated HCl (0.65 mL). The reaction mixture was gradually heated to 65 ℃ and stirred for 3 hours 45 minutes. The solution was allowed to stand at room temperature overnight, then saturated NaHCO 3 (50 mL) and water (50 mL). The aqueous layer was extracted with EtOAc (3X 100 mL). The combined organic layers were washed with brine, dried over Na 2 SO 4 Dried, filtered and purified by silica gel chromatography (0-60% ethyl acetate in hexane) to give intermediate I-61. 1 H NMR (400 MHz, chloroform-d) delta 7.46-7.43 (m, 1H), 7.36-7.31 (m, 1H), 7.30-7.25 (m, 1H), 4.65-4.61 (m, 2H), 3.79-3.69 (m, 1H), 3.66-3.56 (m, 1H), 3.56-3.48 (m, 1H), 1.83-1.73 (m, 1H), 1.68-1.46 (m, 2H), 1.44-1.18 (m, 34H), 0.88 (t, J=6.7 Hz, 3H). 19 F NMR (376 MHz, chloroform-d) delta-110.27- -110.38 (m).
Intermediate I-62: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -6-cyanides 1-methyl-2, 2-dimethylPolytetrahydrofurano [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((S) -2-) (3-cyano-5-fluorobenzyl) oxy) heneicosyl phosphate
To a solution of intermediate I-61 (0.369 mmol), intermediate I-27 (0.369 mmol), triethylamine (0.10 mL,0.738 mmol) and 1-methylimidazole (0.09 mL,1.11 mmol) in DCM (5.0 mL) was added BOP-Cl (1.03 mmol). The solution was stirred at room temperature overnight. The solution was diluted with EtOAc (50 mL) and saturated with 4:1 water:saturated NaHCO 3 (50 mL) quenching. The layers were separated and the aqueous layer was extracted with EtOAc (2X 50 mL). The organic extracts were combined, washed with 1:1 water: brine (40 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified on silica gel (0-10% MeOH in DCM) to afford intermediate I-62.MS M/z [ M+1 ]]＝965.3.
Intermediate I-63: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyanides 1-2, 2-dimethyltetrahydrofurano [3,4-d ]][1,3]Dioxol-4-yl) methyl ((S) -2- ((3-cyano-5-fluoro) Benzyl) oxy) heneicosyl) hydrogen phosphate
Intermediate I-62 (0.303 mmol) was dissolved in 2:1 THF: ACN (4.5 mL total). Cesium fluoride (1.24 mmol) dissolved in water (0.50 mL) was added to the solution followed by 4-dimethylaminopyridine (0.910 mmol). The reaction mixture was heated to 80 ℃ and stirred for 5 hours. The reaction was quenched with a buffer of citric acid (20 mL, 0.22M) and NaOH (0.44 mL, 2M). The aqueous layer was extracted with EtOAc (3X 30 mL). The organic fractions were combined, washed with brine (20 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-40% meoh in DCM) to afford the intermediateBody I-63.MS M/z [ M+1 ]]＝855.3.
Intermediate I-64 (((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1，2，4]Triazin-7-yl) -4-cyanides 1-2, 2-dimethyltetrahydrofurano [3,3-d ]][1，3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) -2-) ((3-cyano-4- (1H-1, 2, 4-triazol-1-yl) benzyl) oxy) heneicosyl) phosphate
To a solution of intermediate I-123 (0.575 mmol), intermediate I-27 (0.575 mmol), triethylamine (0.16 mL,1.15 mmol) and 1-methylimidazole (0.14 mL,1.72 mmol) in DCM (5.0 mL) was added BOP-Cl (1.96 mmol). The solution was stirred at room temperature for 2 hours, then diluted with EtOAc (50 mL) and saturated with 4:1 water:saturated NaHCO 3 (50 mL) quenching. The layers were separated and the aqueous layer was extracted with EtOAc (2X 50 mL). The organic extracts were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified on silica gel (0-10% MeOH in DCM) to afford intermediate I-64.MS M/z [ M+1 ]]＝1014.3.
Intermediate I-65 ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1，2，4]Triazin-7-yl) -4-cyanides 1-2, 2-dimethyltetrahydrofurano [3,3-d ]][1，3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-cyano-4-) (1H-1, 2, 4-triazol-1-yl) benzyl) oxy) heneicosyl hydrogen phosphate
Intermediate I-64 (0.519 mmol) was dissolved in 2:1 THF: ACN (6.0 mL total). Cesium fluoride (2.25 mmol) dissolved in water (1.0 mL) was added to the solution followed by 4- (dimethylamino) pyridine (2.05 mmol). The reaction mixture was heated to 80 ℃ and stirred for about 6 hours. With citric acid (24 mL, 0.22M)The reaction was quenched with a buffer solution of NaOH (0.52 mL,2M,2 eq.). The aqueous layer was extracted with EtOAc (3X 30 mL). The organic fractions were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-40% meoh in DCM) to afford intermediate I-65.MS M/z [ M+1 ]]＝904.2
Intermediate I-66 (((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) phosphate Decade ester
1H-1,2, 4-triazole (2.40 mmol) was dissolved in THF (4 mL). TEA (0.33 mL,2.40 mmol) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.16 mL,0.996 mmol). The reaction mixture was stirred at room temperature for 17 min, intermediate I-3a (0.905 mmol) was added in one portion followed by 1-methylimidazole (0.09 mL,1.18 mmol). The solution was stirred for 18 minutes, then 1-eicosanol (0.905 mmol) was added followed by a further 4mL of THF. The reaction mixture was stirred for 1 hour 30 minutes then saturated NaHCO with 4:1 water 3 (50 mL) dilution. The aqueous layer was extracted with EtOAc (3X 50 mL). The organic fractions were combined, washed with 1:1 brine: water (50 mL), and dried over Na 2 SO 4 Dried, filtered and purified by silica gel chromatography (0-100% etoac in hexanes) to afford intermediate I-66 as a diastereomeric mixture. 1 HNMR (400 MHz, methanol-d 4) delta 7.82-7.79 (m, 1H), 7.48-7.40 (m, 1H), 7.37-7.29 (m, 1H), 7.21-7.12 (m, 2H), 6.86-6.82 (m, 1H), 6.78-6.76 (m, 1H), 5.67-5.63 (m, 1H), 5.35-5.29 (m, 1H), 5.20-5.13 (m, 1H), 4.59-4.46 (m, 2H), 4.24-4.12 (m, 2H), 1.74-1.71 (m, 3H), 1.68-1.57 (m, 2H), 1.41-1.37 (m, 3H), 1.34-1.24 (m, 34H), 0.93-0.86 (m, 3H). 31 P NMR (162 MHz, methanol-d) 4 )δ-7.61--8.02(m)。MS m/z[M-1]＝800.2.
Intermediate I-67: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl eicosanyl hydrogen phosphate
To a solution of intermediate I-66 (0.428 mmol) in THF (5.0 mL) was added 1, 3-tetramethylguanidine (0.32 mL,2.57 mmol) and cis-2-pyridine aldoxime (4.28 mmol). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-40% meoh in DCM) to give intermediate I-67. 1 H NMR (400 MHz, methanol-d 4) delta 7.84 (s, 1H), 6.86 (d, j=4.5 hz, 1H), 6.80 (d, j=4.5 hz, 1H), 5.64 (d, j=3.6 hz, 1H), 5.28 (dd, j=6.6, 3.6hz, 1H), 5.14 (d, j=6.6 hz, 1H), 4.14-4.03 (m, 2H), 3.80 (q, j=6.5 hz, 2H), 1.70 (s, 3H), 1.57-1.46 (m, 2H), 1.39 (s, 3H), 1.36-1.20 (m, 34H), 0.92-0.87 (m, 3H). 31 P NMR (162 MHz, methanol-d 4) delta 0.08-0.68 (M). MS M/z [ M-1 ]]＝692.2.
Intermediate I-68 (R) -3-chloro-5- (((1- (trityloxy) nonadec-2-yl) oxy) methyl) benzonitrile
To a solution of intermediate I-36 (3.68 mmol) in THF (15 mL) was added sodium tert-butoxide (3.8 mL,2.0M in THF). The solution was stirred at room temperature for 5 minutes, then 3- (bromomethyl) -5-chlorobenzonitrile (4.25 mmol) was added. The solution was stirred at room temperature overnight. The reaction mixture was diluted with water (100 mL) and extracted with EtOAc (3 x 75 mL). The organic fractions were combined, washed with 1:1 brine: water (100 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-10% etoac in hexanes) to afford intermediate I-68. 1 H NMR (400 MHz, chloroform-d) delta 7.59-7.41 (m, 9H), 7.34-7.21 (m, 9H), 4.70 (d, J=12.8 Hz, 1H), 4.54 (d, J=12.7 Hz, 1H), 3.55-3.47 (m, 1)H),3.24–3.18(m,2H),1.57–1.48(m,2H),1.36–1.18(m,30H),0.88(t,J＝6.8Hz,3H).
Intermediate I-69 (R) -3-chloro-5- (((1-hydroxynonadec-2-yl) oxy) methyl) benzonitrile
To a solution of intermediate I-68 (2.01 mmol) in 1:1:1 THF: meOH: iPrOH (15.0 mL total) was added concentrated HCl (0.65 mL, 12M). The reaction mixture was gradually heated to 65 ℃ and stirred for 4 hours. With saturated NaHCO 3 The solution (50 mL) and water (50 mL) quench the solution. The aqueous layer was extracted with EtOAc (3X 60 mL). The combined organic layers were washed with brine, dried over Na 2 SO 4 Dried, filtered and purified by silica gel chromatography (0-50% ethyl acetate in hexane) to give intermediate I-69. 1 H NMR (400 MHz, chloroform-d) delta 7.60-7.57 (m, 1H), 7.57-7.52 (m, 2H), 4.63-4.60 (m, 2H), 3.79-3.69 (m, 1H), 3.66-3.56 (m, 1H), 3.56-3.47 (m, 1H), 1.82-1.73 (m, 1H), 1.67-1.46 (m, 2H), 1.43-1.16 (m, 30H), 0.88 (t, J=6.7 Hz, 3H).
Intermediate I-70: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-chloro-5-) Cyanobenzyl) oxy) nonadecyl (2-chlorophenyl) phosphate
1H-1,2, 4-triazole (1.40 mmol,3.16 eq.) was dissolved in THF (3.0 mL). TEA (0.16 mL,1.18 mmol) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.08 mL,0.49 mmol). The reaction mixture was stirred at room temperature for 7 minutes, then intermediate I-3a (0.49 mmol) was added in one portion followed by 1-methylimidazole (0.05 mL,0.58 mmol). The solution was stirred for an additional 15 minutes and then added to dissolve in THF (3.0 mL)Intermediate I-69 (0.44 mmol). After stirring at room temperature for 5 hours and 30 minutes, the solution was saturated with 4:1 water to NaHCO 3 (50 mL) dilution. The aqueous layer was extracted with EtOAc (3X 50 mL). The organic layers were combined, washed with brine (30 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% etoac in hexanes) to afford intermediate I-70 as a diastereomeric mixture. 1 H NMR (400 MHz, methanol-d) 4 )δ7.81–7.77(m,1H),7.64–7.50(m,3H),7.47–7.28(m,2H),7.21–7.07(m,2H),6.85–6.80(m,1H),6.78–6.74(m,1H),5.66–5.62(m,1H),5.33–5.27(m,1H),5.18–5.12(m,1H),4.63–4.42(m,4H),4.36–4.24(m,1H),4.24–4.08(m,1H),3.63–3.55(m,1H),1.72(s,3H),1.58–1.16(m,35H),0.93–0.85(m,3H). 31 P NMR (162 MHz, methanol-d) 4 )δ-7.44–-8.04(m).MS m/z[M-1]＝953.2.
Intermediate I-71: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-chloro-5-) Cyanobenzyl) oxy) nonadecyl hydrogen phosphate
To a solution of intermediate I-70 (0.147 mmol) in THF (5.0 mL) was added 1, 3-tetramethylguanidine (0.11 mL,0.881 mmol) and cis-2-pyridine aldoxime (147 mg,1.20 mmol). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-40% meoh in DCM) to give intermediate I-71. 1 H NMR (400 MHz, methanol-d 4) delta 7.82 (s, 1H), 7.64-7.57 (m, 3H), 6.83 (d, j=4.5 hz, 1H), 6.78 (d, j=4.5 hz, 1H), 5.63 (d, j=3.6 hz, 1H), 5.25 (dd, j=6.6, 3.6hz, 1H), 5.13 (d, j=6.6 hz, 1H), 4.72 (d, j=13.0 hz, 1H), 4.49 (d, j=13.0 hz, 1H), 4.19-4.07 (m, 2H), 3.97-3.79 (m, 2H), 3.58-3.49 (m, 1H), 1.69 (s, 3H), 1.48-1.20 (m, 35H), 0.89 (t, j=6.7 hz, 3H). 31 PNMR (162 MHz, methanol-d 4) delta-0.36-1.01 (M). MS M/z [ M-1 ] ]＝843.2
Intermediate I-72: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyanides 1-2, 2-dimethyltetrahydrofurano [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) -2-) ((6-cyanopyridin-3-yl) oxy) -3- (tetradecyloxy) propyl) phosphate
To a solution of intermediate I-77 (0.0666 mmol,1 eq.), intermediate I-27 (0.0666 mmol), triethylamine (0.02 mL,0.143 mmol) and 1-methylimidazole (0.02 mL,0.251 mmol) in DCM (2.0 mL) was added BOP-Cl (0.200 mmol). The solution was stirred at room temperature for 7 hours. After 7 hours, additional BOP-Cl (0.530 mmol) was added and the reaction mixture was stirred overnight. The reaction mixture was diluted with EtOAc (20 mL) and saturated with 4:1 water:saturated NaHCO 3 (20 mL) quenching. The layers were separated and the aqueous layer was extracted with EtOAc (2X 20 mL) twice more. The organic extracts were combined, washed with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified on silica gel (0-10% MeOH in DCM) to afford intermediate I-72.MS M/z [ M-1 ]]＝894.3.
Intermediate I-73: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyanides 1-2, 2-dimethyltetrahydrofurano [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- ((6-cyanopyridine) 3-yl) oxy) -3- (tetradecyloxy) propyl) hydrogen phosphate
Intermediate I-72 (0.0387 mmol) was dissolved in 2:1 THF: ACN (4.5 mL total). Cesium fluoride (0.790 mmol) dissolved in water (0.50 mL) was added to the solution followed by 4- (dimethylamino) pyridine (0.155 mmol). The reaction mixture was heated to 80 ℃ and stirred for 3.5 hours. With lemonThe reaction was quenched with a buffer of acid (20 mL,0.22M,114 eq.) and NaOH (0.44 mL,2M,22.8 eq.). The aqueous layer was extracted with EtOAc (3X 20 mL). The organic fractions were combined, washed with brine (20 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-40% meoh in DCM) to afford intermediate I-73. 1 H NMR (400 MHz, methanol-d 4) delta 8.33 (d, j=2.9 hz, 1H), 7.85 (s, 1H), 7.69 (d, j=8.7 hz, 1H), 7.55 (dd, j=8.7, 2.9hz, 1H), 6.86-6.84 (m, 1H), 6.80 (d, j=4.5 hz, 1H), 5.64 (d, j=3.6 hz, 1H), 5.28 (dd, j=6.6, 3.6hz, 1H), 5.13 (d, j=6.6 hz, 1H), 4.80-4.72 (m, 1H), 4.16-3.98 (m, 4H), 3.66-3.32 (m, 4H), 1.70 (s, 3H), 1.53-1.42 (m, 2H), 1.39 (s, 3H), 1.36-1.17 (m, 3.6hz, 1H), 5.13 (d, j=6.6 hz, 1H), 4.16-3.98 (m, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.48- -0.78 (m). MS M/z [ M-1 ]]＝784.3.
Intermediate I-74 (S) -3- (tetradecyloxy) propane-1, 2-diol
A mixture of (R) - (-) -2, 2-dimethyl-1, 3-dioxolane-4-methanol (64.9 mmol), powdered potassium hydroxide (229 mmol) and 1-bromooctadecane (64.9 mmol) in benzene (100 mL) was stirred at reflux for 15 hours while the water formed was removed by azeotropic distillation. The reaction mixture was then cooled to room temperature, filtered, and the volume of solvent was then reduced to half. Water (100 mL) was added and the mixture was extracted with diethyl ether (3X 100 mL), the combined organic phases were combined, taken up in Na 2 SO 4 Drying, filtration, and then removal of the solvent under reduced pressure gave the crude product. To a solution of the above crude intermediate (5 g) in methanol (80 mL) was added 2M HCl solution (13 mL,26 mmol) and the solution was heated to reflux for 4 hours. After cooling to room temperature, the mixture was poured into water, the organic layer was extracted with diethyl ether, and taken up in Na 2 SO 4 Drying and vacuum removal of the solvent to give a small volume, the product was crystallized from hexane to give intermediate I-74. 1 H NMR (400 MHz, methanol-d) 4 )δ3.84–3.72(m,1H),3.63–3.56(m,1H),3.56–3.40(m,6H),1.59(t,J＝7.0Hz,2H),1.31(s,22H),0.92(t,J＝6.8Hz,3H).
Intermediate I-75: (R) -1- ((tert-butyldimethylsilyl) oxy) -3- (tetradecyloxy) propan-2-ol：
Intermediate I-74 (9.78 mmol) and imidazole (2 mmol) in pyridine (52 mL), CH at 0deg.C 2 Cl 2 To a solution in a mixture of (6 mL) and DMF (6 mL) was added tert-butylchlorodimethylsilane (8.34 mmol) and stirred at room temperature for 5 hours. The reaction mixture was diluted with water (10 mL) and then with CH 2 Cl 2 Extracting with Na 2 SO 4 And (5) drying. The solvent was evaporated and the residue was purified by flash chromatography (0-30% EtOAc in hexanes) to give intermediate I-75.1H NMR (400 MHz, chloroform-d) delta 3.88-3.79 (m, 1H), 3.71-3.61 (m, 2H), 3.53-3.42 (m, 4H), 1.58 (m, 2H), 1.28 (s, 22H), 0.99-0.85 (m, 12H), 0.10 (s, 6H).
Intermediate I-76 (R) -5- ((1- ((tert-butyldimethylsilyl) oxy) -3- (tetradecyloxy) propan-2 ] Group) oxy) pyridine carbonitriles
/>
NaH (60% oil dispersion) (3.42 mmol,4.90 eq.) was suspended in THF (7.5 ml) and cooled to 0 ℃. A solution of intermediate I-75 (0.697 mmol,1.0 eq.) in THF (3 mL) was added over 30 seconds. After stirring at 0deg.C for 30 min, a solution of 5-fluoropyridine-2-carbonitrile (2.30 mmol,3.30 eq.) in THF (3 ml) was added. The ice bath was removed and the solution was stirred overnight. The reaction was quenched with water (15 mL) at 0 ℃. The mixture was extracted with EtOAc (3X 15 mL). The combined organic phases were dried over sodium sulfate and the solvent was removed under reduced pressure. Flash chromatography (0-20% ethyl acetate/hexanes) of the residue afforded intermediate I-76. 1 H NMR (400 MHz, chloroform-d) δ8.42 (d, j=2.9 hz, 1H), 7.60 (d, j=8.7 hz, 1H), 7.39 (dd, j=8.7, 2.9hz, 1H),4.62–4.53(m,1H),3.90–3.76(m,2H),3.71–3.56(m,2H),3.52–3.37(m,2H),1.59–1.48(m,2H),1.35–1.20(m,22H),0.91–0.83(m,12H),0.05(s,3H),0.01(s,3H).
Intermediate I-77 (S) -5- ((1-hydroxy-3- (tetradecyloxy) propan-2-yl) oxy) pyridine carbonitrile
To a solution of intermediate I-76 (0.264 mmol,1.0 eq) in anhydrous THF (3.3 mL) was added HF/pyridine ((HF 70%, pyridine 30%) 1.05mL,4.46mmol,6.7 eq)) at 0deg.C in a polyethylene vessel. After stirring at room temperature for 5 hours, the mixture was taken up in Et 2 Diluted with O and saturated NaHCO 3 And (5) neutralizing the aqueous solution. The combined organic layers were dried, evaporated, and purified by flash chromatography (EtOAc/hexanes, 1:1) to afford intermediate I-77. 1 H NMR (400 MHz, chloroform-d) δ8.39 (d, j=2.8 hz, 1H), 7.60 (d, j=8.6 hz, 1H), 7.41 (dd, j=8.7, 2.9hz, 1H), 4.65-4.54 (m, 1H), 3.98-3.82 (m, 2H), 3.72-3.61 (m, 2H), 3.50-3.36 (m, 2H), 2.65-2.55 (m, 1H), 1.59-1.45 (m, 2H), 1.42-1.14 (m, 22H), 0.91-0.79 (m, 3H).
Intermediate I-78: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((4-cyano-2-fluorobenzyl) oxy) -3- (tetradecyloxy) propyl) phosphate
1H-1,2, 4-triazole (0.664 mmol) was dissolved in THF (2 mL), then TEA (0.09 mL,0.664 mmol) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.061 mL,0.371 mmol). The reaction mixture was stirred at room temperature for 30 minutes. Intermediate I-3a (0.25 mmol) was added in one portion and the mixture stirred at room temperature for 15 min. At room temperatureTo the mixture was added intermediate I-110 (0.275 mmol) and 1-methylimidazole (0.04 mL,0.506 mmol) in THF (2 mL). The resulting mixture was stirred for 1 hour, concentrated in vacuo, and purified by silica gel (0 to 10% meoh/DCM) to give intermediate I-78. 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.86 (s, 1H), 7.59 (q, J=7.7 Hz, 1H), 7.50-7.40 (m, 3H), 7.39-7.28 (m, 1H), 7.24-7.11 (m, 2H), 6.80-6.68 (m, 2H), 6.38-6.25 (m, 2H), 5.67 (m, 1H), 5.29 (m, 1H), 5.11 (dd, J=6.6, 2.3Hz, 1H), 4.78-4.62 (m, 2H), 4.57-4.43 (m, 2H), 4.41-4.30 (m, 1H), 4.249-4.17 (m, 1H), 3.79 (m, 1H), 3.52-3.42 (m, 2H), 3.42-3.32 (m, 2H), 1.72 (m, 2H), 4.78-4.62 (m, 2H), 4.57-4.43 (m, 1H), 3.52-3.30 (m, 1H), 1.40-0.3 (m, 3H). 31 P NMR (162 MHz, acetonitrile-d 3) delta-7.38, -7.42.MS M/z [ M+1 ]]＝926.
Intermediate I-79: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- ((4-cyano-) 2-Fluorobenzyl) oxy) -3- (tetradecyloxy) propyl) hydrogen phosphate
Intermediate I-78 (0.151 mmol) was dissolved in THF and ACN (2:1 mL). A solution of CsF (1.31 mmol) in water (0.2 mL) and DMAP (0.558 mmol) were then added. The resulting mixture was heated at 80℃for 4h. After dilution with a buffer of citric acid-NaOH (4:1) (pH 3,10 mL), the mixture was partitioned between brine (20 mL) and EtOAc (40 mL). The aqueous layer was extracted three times with EtOAc (20 mL). The combined organic layers were dried over sodium sulfate and purified by silica gel chromatography (0% -50% meoh/DCM) to give intermediate I-79. 1 H NMR (400 MHz, methanol-d 4) delta 7.98 (s, 1H), 7.74 (t, j=7.5 hz, 1H), 7.49-7.40 (m, 2H), 7.21 (d, j=4.7 hz, 1H), 6.96 (d, j=4.7 hz, 1H), 5.64 (d, j=3.5 hz, 1H), 5.22 (dd, j=6.6, 3.6hz, 1H), 5.13 (d, j=6.6 hz, 1H), 4.82 (s, 2H), 4.20 (m, 2H), 4.06 (m, 2H), 3.85 (m, 1H), 3.65-3.53 (m, 2H), 3.50-3.39 (m, 2H), 1.70 (s, 3H), 1.53 (m, 2H), 1.39 (s, 3H), 1.36-1.20 (m, 22.8 hz, 1.91H). 19 F NMR(376MHzMethanol-d 4) delta-118.17. 31 PNMR (162 MHz, methanol-d 4) delta-0.55. MS M/z [ M+1 ]]＝815.
Intermediate I-80: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- (4-cyano-3-isopropoxyphenoxy) -3- (octadecyloxy) propyl) phosphate
1H-1,2, 4-triazole (0.800 mmol) and TEA (0.11 mL,0.800 mmol) were dissolved in THF (2.5 mL). To the resulting solution was added dropwise 2-chlorophenyl phosphorus dichloride (0.1 mL,0.604 mmol). The reaction mixture was stirred at room temperature for 30 min and filtered through a filter syringe. To the filtrate was added intermediate I-3a (0.302 mmol) in one portion, followed by dropwise addition of 1-methylimidazole (0.05 mL, 0.319 mmol). The resulting mixture was stirred for 20 min, then intermediate I-111 (0.322 mmol) in THF (2 mL) was added. The resulting mixture was stirred at room temperature for 2 hours, concentrated in vacuo, and purified by silica gel column chromatography (0 to 10% meoh in DCM) to give intermediate I-80. 1 H NMR (400 MHz, acetonitrile-d) 3 )δ7.88(d,J＝1.1Hz,1H),7.54–7.11(m,5H),6.84–6.68(m,2H),6.65–6.45(m,2H),6.29(s,2H),5.68(m,1H),5.30(m,1H),5.11(m,1H),4.71(m,1H),4.64(m,1H),4.57–4.31(m,4H),3.65–3.53(m,2H),3.41(m,2H),1.72(s,3H),1.49(m,2H),1.38(s,3H),1.35–1.19(m,36H),0.95–0.87(m,3H). 31 P NMR (162 MHz, acetonitrile-d 3) delta-7.52, -7.56.MS M/z [ M+1 ]]＝1007.
Intermediate I-81: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ] ][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- (4-cyano-) 3-isopropoxyphenoxy) -3- (octadecyl) propyl hydrogen phosphate
Intermediate I-800.0566 mmol) was dissolved in aqueous solution (0.1 mL) of THF and ACN (2:1 mL) and CsF (0.49 mmol), then DMAP (0.209 mmol) was added. The resulting mixture was heated at 80℃for 4h. After addition of a buffer of citric acid-NaOH (4:1) (pH 3,0.5 mL), the mixture was partitioned between brine and EtOAc. The aqueous layer was extracted 3 times with EtOAc. The combined organic layers were dried over sodium sulfate and purified by silica gel column chromatography (0-50% meoh in DCM) to give intermediate I-81. 1 H NMR (400 MHz, methanol-d 4) delta 7.86 (s, 1H), 7.41 (d, j=8.6 hz, 1H), 6.86 (d, j=4.5 hz, 1H), 6.81 (d, j=4.5 hz, 1H), 6.69 (d, j=2.2 hz, 1H), 6.64 (dd, j=8.6, 2.2hz, 1H), 5.66 (d, j=3.6 hz, 1H), 5.29 (dd, j=6.6, 3.6hz, 1H), 5.16 (d, j=6.6 hz, 1H), 4.75-4.59 (m, 2H), 4.28-3.89 (m, 4H), 3.66 (dd, j=10.9, 3.5hz, 1H), 3.56 (dd, j=10.9, 6.52-1H), 3.36 (m, 3.0 hz, 1H), 5.36 (m, 3.0H), 3.36 (m, 3.20H), 3.20.37-1H). 31 P NMR (162 MHz, methanol-d 4) delta-0.61. MS M/z [ M+1 ]]＝897.
Intermediate I-82:2-chlorophenyl di (1H-1, 2, 4-triazol-1-yl) phosphinate
1H-1,2, 4-triazole (10.3 mmol) and TEA (1.44 mL,10.3 mmol) were dissolved in THF (8 mL). To this solution was added dropwise 1-chloro-2-dichlorophosphoryloxy benzene (0.81 mL,4.92 mmol). The reaction mixture was stirred at room temperature for 30 min and filtered into a graduated plastic tube, the filter cake was washed with THF (8 mL) and additional THF was added to the filtrate to a total volume of 20mL, yielding about 0.246M of intermediate I-82 stock solution, which was used in the next reaction. 31PNMR (162 MHz, acetonitrile-d 3) delta-16.94.
Intermediate I-83: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenylRadical) ((R)/(R) materials) 2- ((4-cyano-3-isopropoxybenzyl) oxy) heneicosyl) phosphate
To a solution of intermediate I-82 (0,246M in THF, 1.47mL,0.362 mmol) was added in one portion intermediate I-3a (0.302 mmol) followed by dropwise addition of 1-methylimidazole (0.05 mL, 0.319 mmol). The resulting mixture was stirred for 20 min, then intermediate I-113 (0.322 mmol) in THF (2 mL) was added. The resulting mixture was stirred for 2 hours, concentrated in vacuo, and purified by silica gel column chromatography (0 to 10% meoh in DCM) to give intermediate I-83. 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.87 (s, 1H), 7.52-7.42 (m, 2H), 7.41-7.31 (m, 1H), 7.25-7.11 (m, 2H), 7.08 (d, J=5.4 Hz, 1H), 6.93 (m, 1H), 6.78 (m, 1H), 6.73 (m, 1H), 6.26 (s, 2H), 5.67 (m, 1H), 5.29 (m, 1H), 5.10 (m, 1H), 4.71 (m, 1H), 4.64-4.39 (m, 4H), 4.34-4.23 (m, 1H), 4.20-4.08 (m, 1H), 3.63-3.51 (m, 1H), 1.72 (s, 3H), 1.58-1.11 (m, 45H), 0.96-0.83 (m, 3H). 31 P NMR (162 MHz, acetonitrile-d 3) delta-7.28, -7.34.MS M/z [ M+1 ]]＝1005.
Intermediate I-84: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- ((4-cyano-) 3-isopropoxybenzyl) oxy) heneicosyl) phosphate hydrogen salt
Intermediate I-83 (0.0984 mmol) was dissolved in an aqueous solution (0.2 mL) of THF and ACN (3:1.5 mL) and CsF (130 mg,0.854 mmol) and DMAP (0.363 mmol) was added. The resulting mixture was heated at 80℃for 4h. After addition of a buffer of citric acid-NaOH (4:1) (pH 3,1.0 mL), the mixture was partitioned between brine and EtOAc. The aqueous layer was extracted 3 times with EtOAc. The combined organic layers were dried over sodium sulfateAnd purified by silica gel chromatography (0% -50% MeOH/DCM) to give intermediate I-84. 1 H NMR (400 MHz, methanol-d 4) delta 7.84 (s, 1H), 7.49 (dd, j=7.9, 1.7hz, 1H), 7.13 (d, j=1.3 hz, 1H), 6.98 (dd, j=7.9, 1.3hz, 1H), 6.89-6.84 (m, 1H), 6.83-6.76 (m, 1H), 5.65 (d, j=3.6 hz, 1H), 5.31-5.22 (m, 1H), 5.15 (d, j=6.6 hz, 1H), 4.80-4.68 (m, 2H), 4.52 (d, j=13.2 hz, 1H), 4.13 (m, 2H), 3.98-3.79 (m, 2H), 3.56 (m, 1H), 1.71 (s, 3H), 1.51-1.17 (m, 45H), 0.96-0.84 (m, 0H). 31 P NMR (162 MHz, methanol-d 4) delta-0.36. MS M/z [ M+1 ]]＝895.
Intermediate I-85: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- (4-cyano-3-isopropoxyphenoxy) heneicosyl) phosphate
To a solution of intermediate I-82 (0,246M in THF, 1.84mL, 0.457 mmol) was added intermediate I-3a (0.302 mmol) in one portion at room temperature followed by dropwise addition of 1-methylimidazole (0.05 mL, 0.319 mmol). The resulting mixture was stirred for 10 min, and intermediate I-127 (0.322 mmol) in THF (2 mL) was added. The resulting mixture was stirred for 2 hours, concentrated in vacuo, and purified by silica gel column chromatography (0 to 10% meoh in DCM) to give intermediate I-85. 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.88 (m, 1H), 7.49-7.34 (m, 2H), 7.34-7.24 (m, 1H), 7.24-7.01 (m, 2H), 6.82-6.64 (m, 2H), 6.61-6.39 (m, 2H), 6.26 (s, 2H), 5.67 (m, 1H), 5.30 (m, 1H), 5.11 (m, 1H), 4.71-4.37 (m, 4H), 4.36-4.14 (m, 2H), 1.72 (s, 3H), 1.57 (m, 2H), 1.42-1.11 (m, 43H), 0.90 (m, 3H). 31 P NMR (162 MHz, acetonitrile-d 3) delta-7.55, -7.59.MS M/z [ M+1 ]]＝991.
Intermediate I-86: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxol-4-yl) methyl ((R) -2- (4-cyano)- 3-isopropoxyphenoxy) heneicosyl) hydrogen phosphate
Intermediate I-85 (0.176 mmol) was dissolved in aqueous solution (0.2 mL) of THF and ACN (2:1 mL) and CsF (1.53 mmol), and DMAP (0.605 mmol) was added. The resulting mixture was heated at 80℃for 2h. After addition of a buffer solution (1 mL) of citric acid-NaOH (4:1, pH 3), the mixture was partitioned between brine and EtOAc. The aqueous layer was extracted 3 times with EtOAc. The combined organic layers were dried over sodium sulfate and purified by silica gel chromatography (0% -50% MeOH/DCM) to give intermediate I-86. 1 H NMR (400 MHz, methanol-d 4) delta 7.85 (s, 1H), 7.41 (dd, j=8.6, 2.8hz, 1H), 6.87 (d, j=4.5 hz, 1H), 6.81 (d, j=4.5 hz, 1H), 6.64 (d, j=2.2 hz, 1H), 6.60 (dd, j=8.7, 2.2hz, 1H), 5.66 (d, j=3.7 hz, 1H), 5.28 (dd, j=6.6, 3.7hz, 1H), 5.15 (d, j=6.6 hz, 1H), 4.66 (m, 1H), 4.58-4.48 (m, 1H), 4.11 (m, 2H), 4.02-3.85 (m, 2H), 1.77-1.51 (m, 5H), 1.45-1.13 (m, 43.7 hz, 1H), and 0.95-0.84. 31 P NMR (162 MHz, methanol-d 4) delta-0.54. MS M/z [ M+1 ]]＝882.
Intermediate I-87 ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1，2，4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [4,3-d ] ][1，3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((3-cyano-3- (1H-1, 2, 4-triazol-1-yl) benzyl) oxy) -3- (octadecyloxy) propyl) phosphate
To a solution of intermediate I-82 (0,246M in THF, 1.84mL, 0.457 mmol) was added intermediate I-3a (0.302 mmol) in one portion followed by dropwise addition of 1-methylimidazole (0.05 mL, 0.319 mmol). The resulting mixture was stirred for 10 min, and intermediate I-119 (0.322 mmol) in THF (2 mL) was added. The resulting mixture was stirred for 1 hour and concentrated in vacuoContracted and purified by silica gel (0 to 10% MeOH/DCM) to afford intermediate I-87. 1 H NMR (400 MHz, acetonitrile-d 3) delta 8.77 (s, 1H), 8.16 (d, j=2.2 hz, 1H), 7.85 (s, 1H), 7.79 (dd, j=8.0, 2.0hz, 1H), 7.71 (dd, j=7.8, 1.4hz, 1H), 7.55-7.29 (m, 3H), 7.21-7.04 (m, 2H), 6.77-6.66 (m, 2H), 6.55 (s, 2H), 5.66 (m, 1H), 5.29 (m, 1H), 5.11 (m, 1H), 4.73 (m, 1H), 4.69 (s, 1H), 4.61-4.45 (m, 2H), 4.37 (m, 1H), 4.26 (m, 1H), 3.80 (m, 1H), 3.54-3.48 (m, 2H), 3.44 (m, 3.30 (m, 1H), 3.34-3.30 (m, 3H), 3.37 (m, 1H), 3.34 (s, 1H). 31 P NMR (162 MHz, acetonitrile-d 3) delta-7.28, -7.34.MS M/z [ M+1 ]]＝1030.
Intermediate I-88 ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1，2，4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [4,3-d ]][1，3]Dioxolan-4-yl) methyl ((R) -2- ((3-cyano-) 3- (1H-1, 2, 4-triazol-1-yl) benzyl) oxy) -3- (octadecyloxy) propyl) hydrogen phosphate
Intermediate I-87 (0.194 mmol) was dissolved in aqueous solution of THF and ACN (3:1.5 mL) and CsF (2.11 mmol) (0.3 mL) and DMAP (0.819 mmol) was added. The resulting mixture was heated at 80℃for 2h. After addition of a buffer of citric acid-NaOH (4:1) (pH 3,1 mL), the mixture was partitioned between brine and EtOAc. The aqueous layer was extracted 3 times with EtOAc. The combined organic layers were dried over sodium sulfate and purified by silica gel chromatography (0% -50% MeOH/DCM) to give intermediate I-88. 1 H NMR (400 MHz, methanol-d 4) delta 9.03 (s, 1H), 8.24 (s, 1H), 7.85-7.80 (m, 3H), 7.63 (dd, j=8.0, 1.5hz, 1H), 6.84 (d, j=4.5 hz, 1H), 6.80 (d, j=4.5 hz, 1H), 5.62 (d, j=3.6 hz, 1H), 5.27 (dd, j=6.6, 3.6hz, 1H), 5.15 (d, j=6.6 hz, 1H), 4.83 (d, j=14.0 hz, 1H) partially masked by solvent peaks, 4.77 (d, j=14.0 hz, 1H), 4.20-4.05 (m, 2H), 4.04-3.91 (m, 2H), 3.78 (m, 1H), 3.58-3.35 (m, 1H), 5.15 (d, j=6.6, 3.6hz, 1H), 4.83 (d, j=6.6 hz, 1H), 4.77 (d, 1H), 1.33.0H, 3.32 (m, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.46. MS M/z [ M+1 ] ]＝920.
Intermediate I-89: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) 3- (3-cyano-5-fluorophenoxy) -2- ((octadecyloxy) methyl) propyl) phosphate
To a solution of intermediate I-82 (0,246M in THF, 1.84mL, 0.457 mmol) was added intermediate I-3a (0.302 mmol) in one portion followed by dropwise addition of 1-methylimidazole (0.05 mL, 0.319 mmol). The resulting mixture was stirred for 10 min, and intermediate I-121 (0.322 mmol) in THF (2 mL) was added. The resulting mixture was stirred for 2 hours, concentrated in vacuo, and purified by silica gel (0 to 10% meoh in DCM) to give intermediate I-89. 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.87 (m, 1H), 7.44 (m, 1H), 7.35 (m, 1H), 7.25-7.12 (m, 2H), 7.11-7.02 (m, 2H), 6.97 (m, 1H), 6.82-6.75 (m, 1H), 6.75-6.63 (m, 1H), 6.27 (s, 2H), 5.68 (m, 1H), 5.34-5.21 (m, 1H), 5.16-5.00 (m, 1H), 4.59-4.42 (m, 2H), 4.32 (m, 2H), 4.06-3.88 (m, 2H), 3.44 (m, 2H), 3.36 (m, 2H), 2.39 (m, 1H), 1.72 (s, 3H), 1.49 (m, 2H), 1.40-1.15 (m, 1H), and 0.33.82-0.82 (m, 3H). 31 P NMR (162 MHz, acetonitrile-d 3) delta-7.55, -7.57, -7.64, -7.66.MS M/z [ M+1 ]]＝982.
Intermediate I-90: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxol-4-yl) methyl (3- (3-cyano-5-fluoro) Phenoxy) -2- ((octadecyloxy) methyl) propyl) hydrogen phosphate
Intermediate I-89 (0.109 mmol) was dissolved in an aqueous solution (0.1 mL) of THF and ACN (3:1.5 mL) and CsF (1.12 mmol),DMAP (0.402 mmol) was then added. The resulting mixture was heated at 80℃for 4h. After addition of a buffer of citric acid-NaOH (4:1) (pH 3,1.0 mL), the mixture was partitioned between brine and EtOAc. The aqueous layer was extracted 3 times with EtOAc. The combined organic layers were dried over sodium sulfate and purified by silica gel chromatography (0% -50% MeOH/DCM) to give intermediate I-90. 1 H NMR (400 MHz, methanol-d 4) delta 7.86 (m, 1H), 7.16-6.98 (m, 3H), 6.92-6.86 (m, 1H), 6.84-6.72 (m, 1H), 5.66 (m, 1H), 5.30-5.23 (m, 1H), 5.15 (m, 1H), 4.14-3.94 (m, 6H), 3.54-3.34 (m, 4H), 1.72 (s, 3H), 1.58-1.46 (m, 2H), 1.43-1.11 (m, 33H), 0.99-0.76 (m, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-111.03. 31 P NMR (162 MHz, methanol-d 4) delta-0.42, -0.43.MS M/z [ M+1 ]]＝872.
Intermediate I-91: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -6-cyanides 1-2, 2-dimethyltetrahydrofurano [3,4-d ]][1,3]Dioxol-4-yl) methyl (2-chlorophenyl) (2- ((4-cyanogen) Phenyl-2-methoxybenzyl) oxy) -3- (octadecyloxy) propyl phosphate
Intermediate I-124 (0.204 mmol) and intermediate I-27 (0.306 mmol) were placed in a 20mL vial and dried under vacuum (1 hour). To the mixture was added DCM (4 mL), NMI (65 uL,0.81 mmol), TEA (56 uL,0.408 mmol), followed by Bop-Cl (0.817 mmol). The reaction was stirred at room temperature for 1 hour. The solvent was concentrated under reduced pressure. The crude product was dissolved in DCM, loaded onto a 24g column, eluted with 100% hex for 4 min, 0-100% etoac for 6 min, and 100% etoac for 6 min. The product was eluted at 100% EtOAc and the fractions containing the pure product were combined and pooled to provide intermediate I-91.MS M/z [ m+1] = 993.3.
Intermediate I-92: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyanides 1-2, 2-dimethyltetrahydrofurano [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2- ((4-cyano-2-)Methoxy group Benzyl) oxy) -3- (octadecyloxy) propyl) hydrogen phosphate
Intermediate I-91 (0.113 mmol) was dissolved in 2:1 THF: ACN (3:1.5 mL). To this solution was added cesium fluoride (0.56 mmol) in water (0.09 mL), followed by 4- (dimethylamino) pyridine (0.564 mmol). The reaction mixture was stirred at 80℃for 3 hours. The reaction was cooled to room temperature, 10% aqueous citric acid (15 mL) was added, followed by 1M NaOH to adjust the pH to 3-4. Extraction with a mixture of 2-MeTHF/EtOAc (3:2, 50 mL. Times.2) confirmed by LCMS that the aqueous layer had no desired product. The combined organic layers were washed once with brine and over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-60% meoh in DCM) to give the title intermediate I-92.MS M/z [ M+1]]＝883.3.
Intermediate I-93: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -6-cyanides 1-2, 2-dimethyltetrahydrofurano [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((S) 2- ((3 ] Cyano-5-fluorobenzyl) oxy) behenyl) phosphate
Intermediate I-27 (0.394 mmol) and 3-fluoro-5- (((1-hydroxybehen-2-yl) oxy) methyl) benzonitrile (0.394) were placed in a 20mL vial and DCM (4 mL), NMI (83 uL,1.05 mmol), TEA (73 uL,0.526 mmol) and Bop-Cl (1.05 mmol) were added sequentially. The reaction was stirred at room temperature for 4h. The solvent was concentrated under reduced pressure. The crude product was dissolved in DCM, loaded onto a 40g silica gel column, eluted with 100% hex for 3 min, 0-100% etoac for 6 min and 100% etoac for 6 min. The product was eluted at 100% etoac and fractions containing pure product were combined and pooled to provide intermediate I-93 as a mixture. 1H NMR (400 MHz, methanol-d 4) delta 7.84-7.78 (M, 1H), 7.51-7.44 (M, 2H), 7.43-7.29 (M, 3H), 7.22-7.16 (M, 1H), 7.15-7.08 (M, 1H), 6.84 (dd, j=9.9, 4.4hz, 1H), 6.80-6.75 (M, 1H), 5.66 (q, j=3.1 hz, 1H), 5.32 (M, 1H), 5.22-5.09 (M, 1H), 4.68-4.43 (M, 4H), 4.65-4.47 (M, 1H), 4.25-4.06 (M, 1H), 3.61 (s, 1H), 1.74 (d, j=3.3 hz, 3H), 1.40 (d, j=4.hz, 3H), 1.80-6.75 (M, 1H), 5.22-5.09 (M, 1H), 4.68-4.43 (M, 4.47 (M, 1H), 4.65-4.47 (M, 3H), 1.74 (j=3 hz, 3H), 1.38 (j=3H).
Intermediates I-94 and I-95, ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxol-4-yl) methyl ((R) -2- ((3- Cyano-5-fluorobenzyl) oxy) behenyl hydrogen phosphate (intermediate I-94) and ((3 aS,4R,6 aS) -6- (4-aminopyrazole) Pyrrolo [2,1-f][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclic ring Penten-4-yl) methyl ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) docosyl) phosphate (intermediate I-95)
Intermediate I-93 (0.153 mmol) was dissolved in 2:1 THF: ACN (4:2 mL). To this solution was added cesium fluoride (0.766 mmol) in water (0.21 mL), followed by 4- (dimethylamino) pyridine (0.766 mmol). The reaction mixture was stirred at 80℃for 3 hours. The reaction was cooled to room temperature, 10% aqueous citric acid (20 mL) was added, followed by 1M NaOH to adjust pH 3-4. Extraction with 2-MeTHF/EtOAc (3:2, 50 mL. Times.2) confirmed by LCMS that the aqueous layer had no desired product. The combined organic layers were washed once with brine solution, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-50% MeOH in DCM) to isolate compound intermediate I-94 (MS M/z [ M+1) ]= 869.2) and intermediate I-95 (MS M/z [ m+1)]＝869.2)。
Intermediate I-96: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- (4-cyano-3, 5-dimethoxyphenoxy) heneicosyl) phosphate
Intermediate I-125 (0.256 mmol) and intermediate I-27 (0.384 mmol) were placed in a 20mL vial and DCM (4 mL) was added sequentially, NMI (81 uL,1.02 mmol), TEA (71 uL,0.512 mmol) and Bop-Cl (1.02 mmol) was added. The reaction was stirred at room temperature overnight. The solvent was concentrated under reduced pressure. The crude product was dissolved in DCM, loaded onto a 40g silica gel column, eluted with 100% hexane for 3 min, 0-100% etoac for 6 min and 100% etoac for 6 min. The product was eluted at 100% EtOAc and fractions containing pure product were combined and pooled to provide intermediate I-96. (48%). MS M/z [ m+1] =993.2.
Intermediate I-97: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- (4-cyano-) 3, 5-Dimethoxyphenoxy) heneicosyl) phosphate dibasic salt
Intermediate I-96 (0.191 mmol) was dissolved in 2:1 THF: ACN (3:6 mL). To this solution was added cesium fluoride (0.95 mmol) in water (0.256 mL), followed by 4- (dimethylamino) pyridine (0.956 mmol). The reaction mixture was stirred at 80℃for 3 hours. The reaction was cooled to room temperature, 10% aqueous citric acid (10 mL) was added, and then 1M NaOH was added to adjust the pH to 3-4. Extraction with 2-MeTHF/EtOAc (3:2, 50 mL. Times.2) confirmed by LCMS that the aqueous layer had no desired product. The combined organic layers were washed once with brine, dried over Na2SO4, filtered and Concentrated in vacuo and then purified by silica gel chromatography (0-50% MeOH/DCM) to afford intermediate I-97. 1 H NMR (400 MHz, methanol-d 4) delta 7.99 (s, 1H), 7.23 (d, j=4.6 hz, 1H), 6.96 (d, j=4.7 hz, 1H), 6.29 (s, 2H), 5.65 (d, j=3.7 hz, 1H), 5.23 (dd, j=6.5, 3.8hz, 1H), 5.12 (d, j=6.4 hz, 1H), 4.69 (p, j=5.4 hz, 1H), 4.08 (d, j=4.7 hz, 2H), 4.02 (t, j=5.9 hz, 2H), 3.91 (s, 1H), 3.86 (s, 6H), 2.98-2.76 (m, 8H, citrate salt), 1.72 (d, j=8.8 hz, 6H), 1.39 (s, 2H), 1.29 (d, j=8.4 hz, 1H), 4.08 (d, j=4.7 hz, 2H), 3.91 (t, 3.9 hz, 3H).
MS m/z[M+1]＝883.3.
Intermediate I-98: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((5-cyanopyridin-2-yl) oxy) -3- (tetradecyloxy) propyl) phosphate
(R) -6- ((1-hydroxyoctadeca-2-yl) oxy) nicotinonitrile (0.041 mmol), intermediate I-27 (0.061 mmol) were placed in a 20mL vial, dried in vacuo (1 hour), DCM (2 mL) was added, NMI (13.4 uL,0.163 mmol), TEA (11.5 uL,0.081 mmol) was added followed by Bop-Cl (0.04 mmol). The reaction was stirred at room temperature for 2 hours. The solvent was concentrated under reduced pressure. The crude product was dissolved in DCM, loaded onto a 24g column, eluted with 100% hex for 4 min, 0-100% etoac for 6 min, and 100% etoac for 6 min. The product was eluted in 100% EtOAc and fractions containing pure product were combined to provide intermediate I-98.MS M/z [ m+1] = 894.1
Intermediate I-99: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxol-4-yl) methyl ((R) -2- ((5-cyano) Pyridin-2-yl) oxy) octadecyl) hydrogen phosphate
Intermediate I-98 (0.123 mmol) was dissolved in 2:1 THF: ACN (4.5 mL). To this solution was added cesium fluoride (0.615 mmol) in water (0.166 mL), followed by 4- (dimethylamino) pyridine (0.615 mmol). The reaction mixture was stirred at 80℃for 3 hours. The reaction was cooled to room temperature, 10% aqueous citric acid (15 mL) was added, followed by 1M NaOH to adjust the pH to 3-4. Extraction with 2-MeTHF/EtOAc (3:2, 50 mL. Times.2) confirmed by LCMS that the aqueous layer had no desired product. The combined organic layers were washed once with brine and over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-50% meoh in DCM) to afford intermediate I-99. 1 H NMR (400 MHz, methanol-d) 4 )δ8.47(d,J＝2.3Hz,1H),8.03–7.96(m,1H),7.94–7.83(m,1H),7.16(d,J＝4.7Hz,1H),7.01–6.92(m,2H),5.65(dd,J＝8.4,3.7Hz,1H),5.26(td,J＝7.0,3.7Hz,1H),5.22–5.14(m,2H),4.68–4.37(m,3H),4.21(d,J＝3.9Hz,2H),3.76–3.64(m,1H),3.52(dd,J＝13.0,6.6Hz,1H),3.44(t,J＝6.5Hz,1H),2.99–2.75(m,90H,citrate salt),1.72(d,J＝7.4Hz,3H),1.54(dp,J＝13.6,6.3Hz,2H),1.40(d,J＝5.6Hz,3H),1.35–1.19(m,22H),0.91(t,J＝6.6Hz,3H).MS m/z[M+1]＝784.1.
Intermediate I-100: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) (2- ((6-cyanopyridin-3-yl) oxy) -3- (octadecyloxy) propyl) phosphate
Intermediate I-126 (0.336 mmol, containing a small amount of R-isomer as an impurity), intermediate I-27 (0.061 mmol) were placed in a 20mL vial and dried in vacuo (1 hour) followed by the addition of DCM (2 mL), NMI (0.504 mmol), TEA (93. Mu.L, 0.672 mmol) and then Bop-Cl (1.34 mmol). The reaction was stirred at room temperature overnight. The solvent was concentrated under reduced pressure and the crude product was dissolved in DCM, loaded onto a 40g column, eluted with 100% hex for 2 min, 0-100% etoac for 6 min and 100% etoac for 6 min. The product was eluted at 100% etoac and fractions containing pure product were combined and concentrated to provide intermediate I-100 as a mixture of diastereomers. MS M/z [ m+1] = 950.3.
Intermediate I-101 and intermediate I-102, ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2, 4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxol-4-yl) methyl ((S) -2- ((6-cyanopyridin-3-yl) oxy) behenyl) phosphate (intermediate I-101) and ((3 aS,4R,6S, 6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4- ] d][1,3]Dioxolan-4-yl) methyl ((S) -2- ((6-cyanopyridin-3-yl) oxy) docosyl) phosphate hydrogen Salt (intermediate I-102)
Intermediate I-100 (0.263 mmol) was dissolved in 2:1 THF: ACN (4:2 mL). To this solution was added cesium fluoride (1.32 mmol) in water (0.355 mL), followed by 4- (dimethylamino) pyridine (1.32 mmol). The reaction mixture was stirred at 80℃for 3 hours. The reaction was cooled to room temperature, 10% aqueous citric acid (15 mL) was added, followed by 1M NaOH to adjust the pH to 3-4. Extraction with 2-MeTHF/EtOAc (3:2, 50 mL. Times.2) confirmed by LCMS that the aqueous layer had no desired product. The combined organic layers were washed once with brine, and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-50% MeOH in DCM) to afford intermediate I-101 and intermediate I-102.
Intermediate I-101: 1 h NMR (400 MHz, methanol-d) 4 )δ8.35(d,J＝2.9Hz,1H),7.87(s,1H),7.70(d,J＝8.7Hz,1H),7.57(dd,J＝8.7,2.9Hz,1H),6.86(d,J＝4.5Hz,1H),6.82(d,J＝4.5Hz,1H),5.66(d,J＝3.7Hz,1H),5.30(dd,J＝6.6,3.7Hz,1H),5.15(d,J＝6.6Hz,1H),4.78(s,1H),4.13(t,J＝4.7Hz,2H),4.04(t,J＝6.1Hz,2H),3.68–3.37(m,4H),2.93–2.72(m,3H,Citrate salt),1.72(s,3H),1.48(s,2H),1.41(s,3H),1.27(d,J＝24.9Hz,30H),0.92(t,J＝6.6Hz,3H).MS m/z[M+1]＝840.3.
Intermediate I-102: 1 h NMR (400 MHz, methanol-d) 4 )δ8.35(d,J＝2.8Hz,1H),7.87(s,1H),7.71(d,J＝8.7Hz,1H),7.57(dd,J＝8.8,2.9Hz,1H),6.87(d,J＝4.5Hz,1H),6.82(d,J＝4.5Hz,1H),5.66(d,J＝3.6Hz,1H),5.30(dd,J＝6.6,3.6Hz,1H),5.15(d,J＝6.6Hz,1H),4.79(qd,J＝5.5,3.1Hz,1H),4.14(h,J＝6.0,5.5Hz,2H),4.04(t,J＝6.2Hz,2H),3.64(dd,J＝10.9,3.2Hz,1H),3.55(dd,J＝11.0,6.7Hz,1H),3.49–3.36(m,2H),2.96–2.68(m,4H,Citrate salt),1.72(s,3H),1.49(p,J＝6.6Hz,2H),1.41(s,3H),1.27(d,J＝24.5Hz,30H),0.92(t,J＝6.8Hz,3H).MS m/z[M+1]＝840.3
Intermediate I-103 ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) (2- (3-cyano-5-fluorobenzyl) oxy) nonadecyl phosphate
/>
To a solution of 1H-1,2, 4-triazole (2.6 mmol) and TEA (0.362 mL,2.6 mmol) in acetonitrile (8 mL) pyridine (8 mL) was added 2-chlorophenyl phosphorus dichloride (0.199mL, 1.2 mmol) at room temperature, and the reaction mixture was stirred at room temperature for 30 min, intermediate I-3a (1.21 mmol) was added, followed by 1-methylimidazole (0.161 mL,2.02 mmol). The resulting mixture was stirred at room temperature for 1 hour and intermediate I-38 (1.21 mmol) was added. The resulting reaction mixture was stirred for 70 minutes, concentrated in vacuo and co-evaporated with toluene. The crude product was purified by silica gel column chromatography (0 to 100% meoh in DCM) to give a mixture as two isomers Intermediate I-103 of (A). 1 H NMR (400 MHz, methanol-d 4) delta 7.82 (d, j=6.0 hz, 1H), 7.50-7.31 (m, 5H), 7.24-7.08 (m, 2H), 6.85 (dd, j=6.3, 4.5hz, 1H), 6.79 (d, j=4.5 hz, 1H), 5.66 (d, j=2.8 hz, 1H), 5.32 (td, j=6.9, 3.0hz, 1H), 5.17 (dd, j=18.8, 6.5hz, 1H), 4.68-4.48 (m, 4H), 4.41-4.29 (m, 1H), 4.21-4.12 (m, 1H), 3.63 (H, j=6.1 hz, 1H), 1.74 (d, j=2.4 hz, 3H), 1.61-1.43 (m, 2.39, 3.0 hz), 4.41-4.29 (m, 1H), 3.41-4.29 (j=3H). 31 P NMR (162 MHz, methanol-d 4) delta-7.75 (d, J=48.9 Hz.) MS M/z [ M+1]＝937.2.
Intermediate I-104: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((S) -2- ((3-cyano-) 5-fluorobenzyl) oxy) nonadecyl hydrogen phosphate
To a solution of intermediate I-103 (0.587 mmol) in THF (20 mL) was added 1, 3-tetramethylguanidine (0.442 mL,3.52 mmol) and cis-2-pyridine aldoxime (4.81 mmol). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-40% meoh in DCM) to afford intermediate I-104 as the major isomer. 1 H NMR (400 MHz, methanol-d 4) delta 7.85 (s, 1H), 7.51 (s, 1H), 7.40 (dd, j=16.9, 8.9hz, 2H), 6.86 (d, j=4.5 hz, 1H), 6.82 (d, j=4.5 hz, 1H), 5.65 (d, j=3.7 hz, 1H), 5.29 (dd, j=6.6, 3.7hz, 1H), 5.15 (d, j=6.6 hz, 1H), 4.75 (d, j=13.0 hz, 1H), 4.50 (d, j=13.0 hz, 1H), 4.13 (d, j=4.3 hz, 2H), 3.90 (m, 2H), 3.59 (s, 1H), 1.71 (s, 3H), 1.44 (d, j=7.1 hz, 2H), 1.39 (d, j=6.6 hz, 1H), 4.75 (d, j=13.0 hz, 1H), 4.13 (d, 1H). 31 P NMR (162 MHz, methanol-d 4) delta-0.48. MS M/z [ M-1 ]]＝827.2.
Intermediate I-105: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -6- Cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) -2-) ((6-cyanopyridin-2-yl) methoxy) -3- (octadecyloxy) propyl) phosphate
To a solution of 6- [ [ (1S) -1- (hydroxymethyl) -2-octadecyloxy-ethoxy ] methyl ] pyridine-2-carbonitrile (0.109 mmol), intermediate I-27 (0.163 mmol), triethylamine (0.03 mL,0.21 mmol) and 1-methylimidazole (0.434 mmol) in DCM (4.0 mL) was added bis (2-oxo-3-oxazolidinyl) phosphinoyl chloride (0.130 mmol). After 1 hour LCMS showed 40% conversion to the desired product, the remainder being lipidol. A further portion of NMI and BOP-Cl was added and the reaction was stirred at room temperature overnight. The reaction mixture was concentrated in vacuo and the resulting crude product was purified by silica gel column chromatography (0-100% ethyl acetate/hexanes) to give intermediate I-105.MS M/z [ m+1] = 964.4.
Intermediate I-106: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4- Cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((6-cyanopyri-ne) Pyridin-2-yl) methoxy) -3- (octadecyloxy) propyl hydrogen phosphate
Intermediate I-105 (0.06 mmol) was dissolved in 2:1 THF: ACN (4.5 mL total). Cesium fluoride (0.30 mmol,5.0 eq.) dissolved in water (0.50 mL) was added to the solution followed by 4-dimethylaminopyridine (0.241 mmol). The reaction mixture was heated to 80 ℃ and stirred for 3.5 hours. The reaction was quenched with a buffer solution of citric acid (2.73 mL,0.22M,10 eq.) and NaOH (0.03 mL,2M,1.0 eq.). The aqueous layer was extracted with EtOAc (3X 5 mL). The organic fractions were combined, washed with brine (5 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-80% meoh in DCM) to afford intermediate I-106.MS M/z [ M+1]]＝854.3.
Intermediate I-107: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4- Cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) -2-) ((4-cyanopyridin-2-yl) oxy) -3- (tetradecyloxy) propyl) phosphate
To a solution of intermediate I-27 (0.199 mmol), 2- [ (1S) -1- (hydroxymethyl) -2-tetradecyloxy-ethoxy ] pyridine-4-carbonitrile (0.133 mmol), triethylamine (0.03 mL,0.266 mmol) and 1-methylimidazole (0.531 mmol) in DCM (4.0 mL) was added bis (2-oxo-3-oxazolidinyl) phosphinoyl chloride (0.159 mmol). The solution was stirred at room temperature overnight. The reaction mixture was concentrated in vacuo and the resulting crude product was purified by silica gel column chromatography (0-100% ethyl acetate/hexanes) to give intermediate I-107.MS M/z [ m+1] = 894.2.
Intermediate I-108: ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4- Cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((6-cyanopyri-ne) Pyridin-2-yl) methoxy) -3- (octadecyloxy) propyl hydrogen phosphate
Intermediate I-107 (0.101 mmol) was dissolved in 2:1 THF: ACN (6.0 mL total). Cesium fluoride (0.503 mmol) dissolved in water (0.50 mL) was added to the solution followed by 4-dimethylaminopyridine (0.403 mmol). The reaction mixture was heated to 80 ℃ and stirred for 3.5 hours. The reaction was quenched with a buffer of citric acid (4.57 mL,0.22M,10 eq.) and NaOH (0.05 mL,2M,1.0 eq.) and the aqueous layer extracted with EtOAc (3X 5 mL). The organic fractions were combined, washed with brine (5 mL), and dried over Na 2 SO 4 Drying, filtering and concentrating under vacuum, thenPurification by silica gel chromatography (0-80% MeOH in DCM) afforded intermediate I-108.MS M/z [ M+1 ]]＝784.1.
Intermediate I-110 (S) -3-fluoro-4- (((1-hydroxy-3- (tetradecyloxy) propan-2-yl) oxy) methyl) benzyl Nitrile (II)
NaH (60% oil dispersion, 2.29 mmol) was suspended in THF (6 mL) and cooled to 0 ℃. A solution of intermediate I-75 (0.654 mmol) in THF (2.5 mL) was added over 30 seconds. After 30 minutes at 0deg.C, a solution of 4- (bromomethyl) -3-fluorobenzonitrile (2.62 mmol,4 eq.) in THF (2.5 mL) was added. The mixture was stirred at room temperature for 16 hours. The reaction was quenched with water (15 mL). The mixture was extracted with EtOAc. The combined organic phases were dried over sodium sulfate and the solvent was removed under reduced pressure. The resulting residue was purified by silica gel column chromatography (0-20% etoac/hexanes) to give (R) -4- (((1- ((tert-butyldimethylsilyl) oxy) -3- (tetradecyloxy) prop-2-yloxy) methyl) -3-fluorobenzonitrile as a mixture of impurities. To a solution of this mixture (460 mg,0.866 mmol) in THF (3.3 mL) was added 1M solution of TBAF in THF (2 mL) at 0deg.C. The mixture was stirred for 1 hour and concentrated to dryness. The residue was purified by silica gel column chromatography (0 to 60% ethyl acetate in hexane) to give intermediate I-110. 1 H NMR(400MHz,DMSO-d6)δ7.82(dd,J＝10.0,1.5Hz,1H),7.80–7.67(m,2H),4.77(s,2H),4.71(t,J＝5.6Hz,1H),3.65–3.34(m,6H),1.52–1.39(m,2H),1.34–1.11(m,22H),0.94–0.78(m,3H).
Intermediate I-111: (S) -4- ((1-hydroxy-3- (octadecyloxy) propan-2-yl) oxy) -2-isopropoxy-benzoic acid Nitrile (II)
To a solution of intermediate I-128 (5.11 mmol) in THF (30 mL) at 20deg.C was added 60% NaH (12.7 mmol). The resulting mixture was stirred at 20℃for 30 min, 4-fluoro-2-isopropoxybenzonitrile (10.2 mmol) dissolved in DMF (60 mL) was added dropwise. The resulting mixture was warmed to 25℃and stirred for 30 min with NH 4 The reaction was quenched with aqueous Cl (2 mL). After dilution with brine (40 mL), the mixture was extracted with EtOAc (30 ml×2), dried over sodium sulfate and concentrated in vacuo to give (R) -2-isopropoxy-4- ((1- (octadecyloxy) -3- (tritoxy) propan-2-yl) oxy) benzonitrile as a mixture containing impurities. To a solution of this mixture (4.5 mmol) in MeOH (30 mL) was added i-PrOH (30 mL) and 12M HCl (30 mL). The reaction mixture was heated to 50deg.C, stirred for 2 hours, water (50 mL) was added and extracted with EtOAc (50 mL. Times.3). The organic layer was washed with brine (25 ml×2), concentrated in vacuo, and purified by silica gel column chromatography (petroleum ether/etoac=50/1 to 3/1) to give intermediate I-111. 1 H NMR(CDCl 3 400MHz):δ7.45-7.46(m,1H),6.56-6.58(m,2H),4.52-4.60(m,2H),3.88-3.91(m,2H),3.66-3.68(m,2H),3.46-3.47(m,2H),1.54-1.59(m,2H),1.39-1.40(m,6H),1.30(s,30H),0.86-0.90(t,J＝6.4Hz,3H).
Intermediate I-112 (R) -1- (trityloxy) di-undecan-2-ol
To a mixture of Mg (103.5 mmol,1.1 eq.) in 2-Me-THF (15 mL) under N2 was added I 2 (899.8. Mu.L, 181.3. Mu.L, 0.01 eq.) and BrCH2CH2Br (0.1 mL). 1-bromooctadecane (9 mmol) in 2-Me-THF (30 mL) was then added dropwise to the mixture. Stirring and reacting until I 2 The color of (a) fades into a colorless solution. A solution of the remaining 1-bromooctadecane (84.0 mmol) in 2-Me-THF (255 mL) was then added and stirred at 25℃for 4 hours. The compound octadecyl magnesium bromide (0.3M in 300mL THF) was used directly in the next step. Octadecyl magnesium bromide (78.3 mmol,1.3 eq.) was added via cannula to a mixture of (2R) -2- (trityl) oxirane (60.2 mmol,1 eq.) and CuI (3.0 mmol,0.05 eq.) in 2-MeTHF (150 mL) at-20deg.C over 10 min. Severe intensityStirring was carried out for 5 minutes, heating to 0℃and stirring was continued for 2 hours. By addition of saturated NH 4 Cl solution (300 mL) and then the mixture was extracted with ethyl acetate (150 mL. Times.3). By H 2 The combined organic layers were washed with O (200 mL. Times.2) and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (. Times.)120g/>Silica Flash Column, 0-3% MTBE/petroleum ether gradient eluent @150 mL/min) to obtain intermediate I-112.1H NMR (400 MHz, chloroform-d) delta 7.51-7.46 (m, 6H), 7.39-7.28 (m, 9H), 3.81 (brdd, J=3.4, 6.8Hz, 1H), 3.22 (dd, J=3.2, 9.3Hz, 1H), 3.07 (dd, J=7.7, 9.2Hz, 1H), 2.35 (d, J=3.3 Hz, 1H), 1.42 (br s, 2H), 1.37-1.23 (m, 34H), 0.93 (t, J=6.8 Hz, 3H) MS (ESI) m/z=243.0 [ M+H) ]+
Intermediate I-113 (R) -4- (((1-hydroxy-di-undec-2-yl) oxy) methyl) -2-isopropoxy-benzonitrile
To a solution of intermediate I-112 (5.25 mmol) in THF (30 mL) was added 60% NaH (26.2 mmol) in portions. The resulting mixture was stirred at 70℃for 30 min, and 4- (bromomethyl) -2-isopropoxybenzonitrile (7.88 mmol) in THF (12 mL) was added dropwise. The resulting mixture was stirred at 70℃for 16 hours, and the reaction was quenched with aqueous ammonium chloride (2 mL). After dilution with brine (40 mL), the mixture was extracted with EtOAc (30 ml×3), dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (0 to 20% EtOAc in hexanes) to give (R) -2-isopropoxy-4- (((1- (tritoxy) di-undec-2-yl) oxy) methyl) benzonitrile as a mixture with impurities. To a solution of this mixture (3.9 g,5.24 mmol) in MeOH (20 mL) was added i-PrOH (20 mL) and 12MHCl (18 mL). The reaction mixture was heated to 50 ℃ and stirred for 1 hour, water (200mL), extracted with EtOAc (150 ml×2), washed with brine, dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (0 to 100% EtOAc in petroleum ether) to afford intermediate I-113. 1 HNMR(CDCl 3 400MHz):δ7.51(d,J＝8.0Hz,1H),6.99(s,1H),6.91(d,J＝8.0Hz,1H),4.70-4.66(m,1H),4.62(s,2H),3.73-3.72(m,1H),3.60-3.50(m,2H),2.05(m,1H),1.83-1.52(m,2H),1.40(d,J＝6.0Hz,6H),1.37-1.30(m,34H),0.88(d,J＝6.8Hz,3H).MS m/z[M+1]＝502.3
Intermediate I-114:4-cyano-3- (1H-1, 2, 4-triazol-1-yl) benzoic acid methyl ester
To a solution of methyl 4-cyano-3-fluorobenzoate (106 mmol) in DMF (133 mL) at room temperature was added 1H-1,2, 4-triazole (106 mmol) and K 2 CO 3 (116 mmol). The resulting mixture was heated at 80℃for 3 hours, cooled to room temperature, water (100 mL) was added and extracted with EtOAc (50 mL. Times.3). The organic layer was saturated with NaHCO 3 (50 mL) washed, dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (petroleum ether/etoac=20/1 to 5/1) to give intermediate I-114. 1 H NMR(DMSO-d 6 400MHz):δ9.29(s,1H),8.39(s,1H),8.32(d,J＝1.6Hz,1H),8.23(d,J＝8.0Hz,1H),8.14(d,J＝8.0Hz,1H),3.93(s,3H).MS m/z[M+1]＝229.1
Intermediate I-115:4- (hydroxymethyl) -2- (1H-1, 2, 4-triazol-1-yl) benzonitrile
To a solution of methyl 4-cyano-3- (1H-1, 2, 4-triazol-1-yl) benzoate (83.2 mmol) in THF (760 mL) was added LiBH in 3 portions 4 (91.5 mmol). The reaction mixture was stirred at 25 ℃ for 16 hours, then cooled to 0 ℃, quenched with water (300 mL), extracted with EtOAc (100 ml×3), the organic layer was collected, washed with brine (100 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo to afford intermediate I-115.MS M/z [ M+1 ]]＝201.1
Intermediate I-116: (R) -2, 2-dimethyl-4- ((octadecyloxy) methyl) -1, 3-dioxolane
(R) - (2, 2-dimethyl-1, 3-dioxolan-4-yl) methanol (529 mmol,1.00 eq) was added to ACN (2850 mL). KOH (2.65 mol,5.00 eq) and TBAI (52.9 mmol,0.10 eq) were added. Stirred at 25℃for 0.1 hour. 1-bromooctadecane (635 mmol,1.20 eq) was added. Stirred at 25℃for 16 hours. Concentrating in vacuum. The residue was purified by column chromatography (SiO 2 Petroleum ether/ethyl acetate=30/1 to 10/1) to give intermediate I-116.TLC R f =0.40 (eluent: petroleum ether/ethyl acetate=10:1).
Intermediate I-117 (S) -3- (octadecyloxy) propane-1, 2-diol
Intermediate I-116 (262 mmol,1.00 eq) was added to THF (500 mL). AcOH (600 mL) and H were added to the solution 2 O (400 mL). Stirred at 50℃for 16 hours. Concentrating in vacuum. Azeotroped 3 times with toluene. The crude product was triturated with petroleum ether: ethyl acetate=3:1 at 25 ℃ for 2 hours and filtered to give intermediate I-117. 1 H NMR:(CDCl 3 400MHz):δ3.86(s,1H),3.54-3.67(m,1H),3.52-3.53(m,1H),3.46-3.51(m,4H),2.67(s,1H),2.25(s,1H),1.58-1.64(m,2H),1.26(s,30H),0.86-0.90(t,3H).
Intermediate I-118: (R) -1- (octadecyloxy) -3- ((triisopropylsilyl) oxy) propan-2-ol
Intermediate I-117 (211 mmol,1.00 eq) and imidazole (423 mmol,2.00 eq) were added to DCM (730 mL). TIPSCl (338 mmol,72.5mL,1.60 eq) was added to the reaction mixture at 0deg.C. Stirred at 25℃for 5 hours. Water (300 mL) was added to the reaction mixture. Extracted with DCM (200 mL. Times.3). The organic layer was collected. Through Na 2 SO 4 And (5) drying. Concentrating in vacuum. The residue was purified by column chromatography (SiO 2 Petroleum ether/ethyl acetate=20/1 to 1/1) to afford intermediate I-118. 1 H NMR:(CDCl 3 400MHz):δ3.74-3.83(m,1H),3.72-3.73(d,J＝2.0Hz,1H),3.43-3.49(m,4H),2.27(brs,1H),1.55-1.58(m,1H),1.35-1.20(m,30H),1.05-1.12(m,30H),0.86-0.89(t,3H).
Intermediate I-119, (S) -4- (((1-hydroxy-3- (octadecyloxy) propan-2-yl) oxy) methyl) -2- (1H-1, 2, 4-triazol-1-yl) benzonitrile
To a solution of intermediate I-115 (14.9 mmol) in DCM (60 mL) at 25deg.C was added pBR 3 (7.49 mmol). The resulting mixture was stirred at 25 ℃ for 16 hours, concentrated in vacuo, and purified by silica gel column chromatography (petroleum ether/etoac=30/1 to 2/1) to give 4- (bromomethyl) -2- (1H-1, 2, 4-triazol-1-yl) benzonitrile. TLC rf=0.43 (eluent: petroleum ether/ethyl acetate=1/1).
To a solution of 4- (bromomethyl) -2- (1H-1, 2, 4-triazol-1-yl) benzonitrile (3.17 mmol) in THF (10 mL) at 25deg.C was added 60% NaH (15.8 mmol). The resulting mixture was stirred at 25 ℃ for 30 min, and intermediate I-117 (3.80 mmol) in THF (5 mL) was added dropwise. The mixture was stirred for 2 hours and quenched with water (30 ml). The aqueous layer was extracted with EtOAc (30 ml×3), dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (petroleum ether/etoac=50/1 to 3/1) to give (R) -4- (((1- (octadecyloxy) -3- ((triisopropylsilyl) oxy) propan-2-yl) oxy) methyl) -2- (1H-1, 2, 4-triazol-1-yl) benzonitrile. TLC rf=0.60 (eluent: petroleum ether/ethyl acetate=5/1).
To a solution of (R) -4- (((1- (octadecyloxy) -3- ((triisopropylsilyl) oxy) propan-2-yl) oxy) methyl) -2- (1H-1, 2, 4-triazol-1-yl) benzonitrile (1.90 mmol) in THF (13 mL) at 25℃was added TBAF (1M in THF, 5.71 mL). The resulting mixture was stirred at 25 ℃ for 30 min, concentrated in vacuo, and purified by silica gel column chromatography (petroleum ether/etoac=50/1 to 2/1) to afford intermediate I-119. 1 H NMR(CDCl 3 400MHz):δ8.78(s,1H),8.19(s,1H),7.80-7.82(d,J＝8.0Hz,2H),7.53-7.55(d,J＝9.2Hz,1H),4.80-4.89(m,2H),3.62-3.74(m,3H),3.59-3.61(m,2H),3.43-3.46(m,2H),2.08-2.14(m,1H),1.54-1.60(m,2H),1.30(s,30H),0.86-0.90(t,J＝6.8Hz,3H).MS m/z[M+1]＝527.3
Intermediate I-120:1- (octadecyloxy) -3- (trityloxy) propan-2-one
To a solution of PCC (71.0 mmol) and EtOAc (10.3 mmol) in DCM (219 mL) was added dropwise a solution of intermediate I-128 (35.4 mmol) in DCM (109 mL). The resulting mixture was heated at 45 ℃ for 12 hours and filtered. The filtrate was concentrated in vacuo and purified by silica gel column chromatography (petroleum ether/etoac=70/1 to 10/1) to give intermediate I-120. 1 H NMR(CDCl 3 400MHz):δ7.34-7.36(m,6H),7.18-7.24(m,9H),4.20-4.27(m,1H),4.23(s,2H),3.83(s,2H),1.46-1.48(m,3H),1.18(m,30H),0.80(t,J＝8.0Hz,2H).
Intermediate I-121:3-fluoro-5- (3-hydroxy-2- ((octadecyloxy) methyl) propoxy) benzonitrile
At 25 ℃ to CH 3 PPh 3 To a solution of Br (3.19 mmol) in dioxane (2.5 mL) was added n-BuLi (2.5M, 1.34 mL). The resulting mixture was stirred at 25℃for 30 minutes and addedIntermediate I-120 (1.71 mmol) in dioxane (2.5 mL). The mixture was stirred at 25℃for 2 hours, water (2.0 mL) was added, and the resulting mixture was extracted with hexane (2 mL. Times.3). The combined organic layers were dried over sodium sulfate and concentrated in vacuo to give (((2- ((octadecyloxy) methyl) allyl) oxy) methanetriyl) triphenyl. TLC rf=0.70 (eluent: petroleum ether/ethyl acetate=8/1).
To a solution of (((2- ((octadecyloxy) methyl) allyl) oxy) methanetriyl) triphenyl (2.23 mmol) in dioxane (0.8 mL) at 25 ℃ was added BH 3 THF (1.00M, 2.61 mL). The resulting mixture was stirred at 25℃for 2 hours, and water (0.8 mL), 5NNaOH (1.60 mL) and H were added sequentially at 25℃ 2 O 2 (20.3 mmol). The resulting mixture was stirred at 50 ℃ for 2.5 hours, cooled to 25 ℃, water (20 mL) was added, and extracted with DCM (20 ml×2). The organic layer was dried over sodium sulfate, filtered, concentrated in vacuo, and purified by silica gel column chromatography (petroleum ether/etoac=80/1 to 5/1) to give 3- (octadecyloxy) -2- ((tritoxy) methyl) propan-1-ol. TLC rf=0.20 (eluent: petroleum ether/ethyl acetate=8/1).
To a solution of 3- (octadecyloxy) -2- ((trityloxy) methyl) propan-1-ol (1.66 mmol) in THF (10 mL) at 25deg.C was added PPh 3 (4.99 mmol) and 3-fluoro-5-hydroxybenzonitrile (2.00 mmol). The mixture was treated with N 2 The gas was degassed and DEAD (4.99 mmol) was added. The mixture was then stirred at 50 ℃ for 1 hour, cooled to 25 ℃, concentrated in vacuo, and purified by preparative TLC (SiO 2 Petroleum ether/EtOAc=8/1) to give 3-fluoro-5- (3- (octadecyloxy) -2- ((trityloxy) methyl) propoxy) benzonitrile. TLC rf=0.70 (eluent: petroleum ether/ethyl acetate=8/1).
To a solution of 3-fluoro-5- (3- (octadecyloxy) -2- ((trityloxy) methyl) propoxy) benzonitrile (0.04 mmol) in MeOH (0.12 mL) was added i-PrOH (0.12 mL) and 12M HCl (81 eq). The reaction mixture was heated to 60 ℃ and stirred for 4 hours, cooled to room temperature, added water (20 mL), extracted with EtOAc (20 ml×2), dried over sodium sulfate, concentrated in vacuo, and purified by preparative TLC (SiO 2 Petroleum ether/etoac=8/1) to afford intermediate I-121. 1 H NMR(400 MHz, chloroform-d) delta 7.04-7.00 (m, 1H), 7.01-6.95 (m, 1H), 6.94-6.85 (m, 1H), 4.13 (d, j=6.3 hz, 2H), 3.95-3.84 (m, 2H), 3.73-3.64 (m, 2H), 3.52-3.40 (m, 2H), 2.34-2.23 (m, 1H), 1.65-1.52 (m, 2H), 1.38-1.21 (m, 30H), 0.90 (t, j=6.7 hz, 3H). 19 FNMR (376 MHz, chloroform-d) delta-108.71. MS M/z [ M+1 ]]＝478.2
Intermediate I-122:5- (bromomethyl) -2- (1H-1, 2, 4-triazol-1-yl) benzonitrile
Methyl 3-cyano-4-fluorobenzoate (134 mmol,1.00 eq) was added to DMF (168 mL). 1H-1,2, 4-triazole (161 mmol,1.20 eq) and K were added 2 CO 3 (161 mmol,1.20 eq) and heated to 80℃for 3 hours. Water (40 mL) was added and stirred at 25℃for 10 min, then the filter cake was filtered and dried under reduced pressure to give intermediate I-122a. 1 H NMR(DMSO-d 6 400MHz)δ9.29(s,1H),8.39(s,1H),8.32(d,J＝1.6Hz,1H),8.23(d,J＝8.0Hz,1H),8.14(d,J＝8.0Hz,1H),3.93(s,3H).MS m/z[M+1]＝229.1.
Intermediate I-122a (110 mmol,1.00 eq) was added to THF (1.0L). The solution was cooled to 0 ℃. At N 2 Adding LiBH 4 (132 mmol,1.21 eq) and stirred at 25℃for 16 hours. Water (800 mL) was added at 0deg.C and extracted with EtOAc (600 mL. Times.3). The organic layer was washed with brine (2X 500 mL) and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo to afford intermediate I-122b. 1 HNMR(DMSO-d 6 400MHz)δ9.17(s,1H),8.35(s,1H),7.84(s,3H),4.63(m,2H).MS m/z[M+1]＝201.1.
Intermediate I-122b (29.9 mmol,1.00 eq) was added to THF (42.0 mL). Addition of pBR 3 (14.9 mmol,0.50 eq) and stirred at 25℃for 16 hours. Pouring the mixture into H 2 O (200 mL) was extracted with EtOAc (150 mL. Times.2). The organic layer was saturated with NaHCO 3 (200 mL) and brine, washed with Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel column chromatography (SiO 2 Petroleum ether/acetic acidEthyl=1/0 to 0/1), intermediate I-122 is obtained. 1 H NMR(CDCl 3 400MHz)δ8.83(s,1H),8.20(s,1H),7.87(s,1H),7.79(s,2H),4.52(s,2H).
Intermediate I-123 (R) -5- (((1-hydroxyhexan-2-yl) oxy) methyl) -2- (1H-1, 2, 4-triazole-1- Radical) benzonitrile
/>
Intermediate I-112 (5.25 mmol,1.00 eq) was added to a round bottom flask containing THF (30.0 mL). NaH (26.2 mmol,60% purity, 5.00 eq.) was added in portions. A solution of intermediate I-122 (7.88 mmol,1.50 eq) in THF (12.0 mL) was added with stirring at 70℃for 0.5 h. Stirring at 70℃for 16 hours, at which time the resulting mixture is poured into saturated NH 4 Cl (200 mL) and extracted with EtOAc (150 mL. Times.2). The organic layer was washed with brine, dried over Na 2 SO 4 Dried and concentrated in vacuo. The residue was purified by column chromatography (SiO 2 Petroleum ether/ethyl acetate=1/0 to 0/1) to give intermediate I-123a. TLC rf=0.2 (eluent: petroleum ether/ethyl acetate=10/1).
Intermediate I-123a (2.66 mmol,1.00 eq) was added to a round bottom flask containing MeOH (20.0 mL) and I-PrOH (20.0 mL). Aqueous HCl (12M, 10.1 mL) was added and stirred at 50deg.C for 1 hour. Pouring the mixture into H 2 O (200 mL) was extracted with EtOAc (150 mL. Times.2). The organic layer was washed with brine, dried over Na 2 SO 4 Dried and concentrated in vacuo. Purification of the crude product by column chromatography (SiO 2 Petroleum ether/ethyl acetate=1/0 to 0/1) to provide intermediate I-123.CDCl3 400 MHz): delta 8.76 (s, 1H), 8.19 (s, 1H), 7.85 (s, 1H), 7.75 (s, 2H), 4.71 (s, 2H), 3.79-3.75 (M, 1H), 3.66-3.57 (M, 2H), 1.63-1.56 (M, 2H), 1.37-1.25 (M, 34H), 0.88 (t, J=6.4 Hz, 3H): MS M/z [ M+1 ]]＝511.3.
Intermediate I-124:4- (((1-hydroxy-3- (octadecyloxy) propan-2-yl) oxy) methyl) -3-methoxybenzyl) Nitrile (II)
A60% dispersion of sodium hydride in mineral oil (3.42 mmol) was suspended in tetrahydrofuran (7.5 mL) and cooled to 0deg.C. A solution of 1- ((tert-butyldimethylsilyl) oxy) -3- (octadecyloxy) propan-2-ol (0.697 mmol) in tetrahydrofuran (3 mL) was added over 30 seconds. After 30 minutes, a solution of 4- (bromomethyl) -3-methoxybenzonitrile (2.3 mmol) in tetrahydrofuran (3 mL) was added. The ice bath was removed. After 16 hours, quench the reaction with water (10 mL) at 0deg.C. The mixture was extracted with ethyl acetate (3X 10 mL). The combined organic phases were dried over sodium sulfate and the solvent was removed under reduced pressure. Flash chromatography (0-20% ethyl acetate/hexane) of the residue was performed. The product containing fractions were combined and the solvent removed under reduced pressure to afford intermediate-124 a.
A solution of tetrabutylammonium fluoride in tetrahydrofuran (2.66 mL,2.66 mmol) was added to a solution of intermediate I-124a (0.569 mmol) in tetrahydrofuran (5 mL). After 1h, the resulting mixture was concentrated under reduced pressure. Flash chromatography (0-20% ethyl acetate/hexane) of the residue was performed. The product containing fractions were combined and the solvent removed under reduced pressure to afford intermediate I-124. 1 H NMR (400 MHz, chloroform-d) delta 7.54 (d, j=7.7 hz, 1H), 7.28 (dd, j=7.7, 1.4hz, 1H), 7.08 (d, j=1.4 hz, 1H), 4.73 (s, 2H), 3.87 (s, 3H), 3.83-3.67 (m, 3H), 3.64-3.52 (m, 2H), 3.45 (td, j=6.6, 2.4hz, 2H), 2.34 (s, 1H), 1.66-1.52 (m, 2H), 1.26 (s, 30H), 0.89 (t, j=6.8 hz, 3H).
Intermediate I-125 (R) -4- ((1-hydroxy-di-undec-2-yl) oxy) -2, 6-dimethoxy benzonitrile
Intermediate I-112 (5.25 mmol,1.00 eq) was added to a round bottom flask containing THF (30.0 mL). Adding PPh 3 (10.5 mmol,2.00 eq) and 4-hydroxy-2, 6-dimethoxy benzonitrile (6.31 mmol,1.20 eq). By N 2 Degassing, 3x. DEAD (10.5 mmol,2.00 eq) was added dropwise and at 50 ℃Stirring for 16 hours. The resulting solution was added to a round bottom flask containing MeOH (21.0 mL) and i-PrOH (21.0 mL). HCl (21.0 mL) was added and stirred at 50deg.C for 1 hour. Pouring the solution into H 2 O (200 mL) was extracted with EtOAc (150 mL. Times.2). The organic layer was washed with brine, dried over Na 2 SO 4 Dried, and concentrated under reduced pressure. The residue was purified by column chromatography (SiO 2 Petroleum ether/ethyl acetate=1/0 to 0/1) to give intermediate I-125. 1 H NMR:(CDCl 3 400MHz):δ6.13(s,2H),4.44-4.40(m,1H),3.87(s,6H),3.81-3.77(m,2H),1.80(br,1H),1.70-1.66(m,2H),1.37-1.26(m,34H),0.88(t,J＝6.8Hz,3H).MS m/z[M+1]＝489.4.MS m/z[M+1]＝489.4
Intermediate I-126:5- ((1-hydroxy-3- (octadecyl) propan-2-yl) oxy) pyridine carbonitrile
1- (octadecyloxy) -3- (trityloxy) propan-2-ol (0.85 mmol,1.00 eq) was added to THF (5.00 mL). NaH (2.13 mmol,60% purity, 2.50 eq.) was added and stirred at 25℃for 0.5 h. A solution of 5-fluorovaleronitrile (1.28 mmol,1.50 eq) in DMF (10.0 mL) was added and stirred at 25℃for 1.5 h. Cooled to 0 ℃ and saturated NH is added 4 Cl (20.0 mL). The resulting mixture was extracted with EtOAc (30.0 mL. Times.3) and the organic layer was dried over Na 2 SO 4 Drying and vacuum concentrating. The residue was purified by column chromatography (SiO 2 Petroleum ether/ethyl acetate=50/1 to 5/1) to give intermediate I-126a. TLC R f =0.73 (eluent: petroleum ether/ethyl acetate=5/1).
Intermediate I-126a (2.18 mmol,1.00 eq) was added to MeOH (15.0 mL). i-PrOH (195 mmol,15.0mL,89.9 eq) and HCl (12M, 15.0mL,82.6 eq) were added and heated to 50deg.C for 2 hours. Water (50.0 mL) was added and the resulting mixture was extracted with EtOAc (30.0 mL. Times.3). The organic layer was purified by Na 2 SO 4 Dried and concentrated in vacuo. The residue was purified by column chromatography (SiO 2 Petroleum ether/ethyl acetate=50/1 to 5/1) to give intermediate I-126. 1 H NMR(CDCl 3 400MHz):δ8.42-8.43(d,J＝2.8Hz,1H),7.61-7.64(d,J＝8.8Hz,1H),7.39-7.42(dd,J＝3.2Hz,1H),4.61-4.63(m,1H),3.89-3.94(m,2H),3.68-3.69(m,2H),3.42-3.45(m,2H),1.51-1.54(m,2H),1.25(s,31H),0.86-0.89(t,J＝6.4Hz,3H).MS m/z[M+1]＝447.2.
Intermediate I-127 (R) -4- ((1-hydroxy-di-undec-2-yl) oxy) -2-isopropoxy-benzonitrile
To a solution of intermediate I-112 (5.25 mmol,1.00 eq) in THF (15 mL) was added 60% NaH (13.1 mmol) at 25deg.C. The resulting mixture was stirred at 25℃for 30 min, cooled to 0℃and a solution of 4-fluoro-2-isopropoxybenzonitrile (7.88 mmol,1.50 eq) in DMF (30 mL) was added dropwise. The resulting mixture was heated to 20 ℃ and stirred for 1 hour. The mixture was then added to a round bottom flask containing MeOH (15.0 mL) and i-PrOH (15.0 mL). Aqueous HCl (12.0M, 10.0 mL) was added and stirred at 50deg.C for 1 hour. Pouring the solution into H 2 O (200 mL) was extracted with EtOAc (150 mL. Times.2). The organic layer was washed with brine, dried over Na 2 SO 4 Dried and concentrated in vacuo. Purification of the crude product by column chromatography (SiO 2 Petroleum ether/etoac=1/0 to 0/1) to afford intermediate I-127. 1 H NMR:(CDCl 3 400MHz):δ7.44(d,J＝8.4Hz,1H),6.53-6.50(m,2H),4.60-4.57(m,1H),4.41-4.38(m,1H),3.81-3.74(m,2H),1.67(br,1H),1.65-1.63(m,2H),1.40(d,J＝6.0Hz,6H),1.30-1.25(m,34H),0.88(t,J＝6.4Hz,3H).MS m/z[M+1]＝488.4.
Intermediate I-128 (R) -1- (octadecyloxy) -3- (trityloxy) propan-2-ol
Intermediate I-128 was prepared according to WO 2010052718.
Intermediate I-129 (R) -1- (triphenylmethoxy) octadecaAlkan-2-ols
At N 2 Next, to a solution of Mg (1.9 g,79.0mmol,1.2 eq) in 2-MeTHF (20 mL) was added I 2 (174.3 mg,686.6umol,138.3uL,0.01 eq) and 1, 2-dibromoethane (0.2 mL). A solution of 1-bromopentadecane (2.0 g) in 2-MeTHF (20 mL) was then added dropwise. The mixture was stirred until I 2 Is faded to colorless. A solution of the remaining 1-bromopentadecane (18 g) in 2-MeTHF (180 mL) was then added and the mixture was stirred at 25℃for 4 hours. The crude pentadecyl magnesium bromide (in 2-MeTHF) in the form of a brown solution was used in the next step without further purification.
Pentadecyl magnesium bromide (20 g,63.4mmol,1.3 eq) was added via cannula to a mixture of (2R) -2- (trityloxymethyl) oxirane (15.4 g,48.7mmol,1 eq), cuI (464.2 mg,2.5mmol,0.05 eq) in 2-MeTHF (50 mL) at-20 ℃. The reaction was stirred vigorously for 5 minutes, warmed to 0 ℃, and stirred for 2 hours. By addition of saturated NH 4 The reaction mixture was quenched with aqueous Cl (350 mL) and the mixture was extracted with ethyl acetate (200 mL. Times.3). By H 2 The combined organic layers were washed with O (400 mL. Times.2) and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography 80g/>Silica Flash Column, gradient of 0-3% ethyl acetate/petroleum ether @120 mL/min) to give compound (R) -1- (tritoxy) octadecan-2-ol intermediate I-129. 1 H NMR (400 MHz, chloroform-d) delta 7.39 (d, j=7.6 hz, 6H), 7.26-7.16 (m, 9H), 3.76-3.67 (m, 1H), 3.13 (dd, j=3.2, 9.3hz, 1H), 3.02-2.92 (m, 1H), 2.26 (d, j=3.3 hz, 1H), 1.34-1.29 (m, 2H), 1.20 (br d, j=9.4 hz, 27H), 0.83 (t, j=6.8 hz, 3H).
Intermediate I-130 (R) -3-fluoro-5- (((1- (tritoxy) di-undec-2-yl) oxy) methyl) benzyl Nitrile (II)
To a solution of NaH (926.5 mg,23.2mmol,60% pure, 2.5 eq) in THF (80 mL) at 0 ℃ was added (2R) -1-trityloxy-octadecan-2-ol, intermediate I-129 (4.9 g,9.3mmol,1 eq) and the mixture was stirred at 0 ℃ for 30 min. 3- (bromomethyl) -5-fluoro-benzonitrile (2.5 g,11.6mmol,1.3 eq) was then added and the mixture stirred at 65℃for 5 hours. 20℃by addition of saturated NH 4 The reaction mixture was quenched with Cl solution (100 mL) and extracted with ethyl acetate (60 mL. Times.3). The combined organic layers were treated with H 2 O (120 mL. Times.2) washed with Na 2 SO 4 Dried and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography20g/>Silica Flash Column the eluent is 0-3% ethyl acetate/petroleum ether gradient @45 mL/min) to obtain the compound (R) -3-fluoro-5- (((1- (trityloxy) octadecan-2-yl) oxy) methyl) benzonitrile, intermediate I-130. 1 H NMR (400 MHz, chloroform-d) delta 7.45 (br d, j=7.1 hz, 6H), 7.36-7.25 (m, 12H), 4.73 (d, j=12.8 hz, 1H), 4.57 (d, j=12.9 hz, 1H), 3.53 (td, j=5.2, 10.8hz, 1H), 3.22 (d, j=4.6 hz, 2H), 1.58-1.50 (m, 2H), 1.32-1.22 (m, 28H), 0.89 (br t, j=6.7 hz, 3H).
Intermediate I-131 (R) -3-fluoro-5- (((1-hydroxyoctadeca-2-yl) oxy) methyl) benzonitrile
To 3-fluoro-5- [ [ (1R) -1- (trityloxy) heptadecyloxy]Methyl group]Benzonitrile, intermediate I-130 (4.3 g,6.5mmol,1 eq) in MeOH (12 mL) and MTBE (86 mL) was added anisole (351.2 mg,3.3mmol,353.0uL,0.5 eq) and PTSA (559.3 mg,3.3mmol,0.5 eq) and the mixture was stirred at 50℃for 2 hours. The reaction mixture was taken up in 100mL of saturated NaHCO 3 Quench and extract with ethyl acetate (60 mL. Times.3). By H 2 O (100 mL. Times.2) the combined organic layers were washed with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography20g/>Silica Flash Column the eluent is 0-9% ethyl acetate/petroleum ether gradient @45 mL/min) to obtain the compound (R) -3-fluoro-5- (((1-hydroxyoctadeca-2-yl) oxy) methyl) benzonitrile, intermediate I-131. 1 H NMR (400 MHz, chloroform-d) delta 7.46 (s, 1H), 7.35 (br d, J=9.0 Hz, 1H), 7.27 (s, 1H), 4.64 (s, 2H), 3.79-3.72 (m, 1H), 3.67-3.49 (m, 2H), 1.67-1.47 (m, 2H), 1.26 (s, 28H), 0.88 (br t, J=6.6 Hz, 3H) & MS (ESI) m/z=442.2 [ M+Na ] ] +
Intermediate I-132: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((3-cyano-5-fluorobenzyl) oxy) octadecyl) phosphate
1H-1,2, 4-triazole (187 mg,2.71mmol,5.05 eq) was dissolved in THF (6.0 mL). TEA (0.20 mL,1.42mmol,2.65 eq.) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.10 mL,0.59mmol,1.1 eq.). The reaction mixture was stirred at room temperatureAfter stirring for 6 minutes, (3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) is added in one portion][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopentene-4-carbonitrile intermediate I-3a (192 mg,0.58mmol,1.08 eq.) followed by 1-methylimidazole (0.06 mL,0.70mmol,1.3 eq.) was added. The solution was stirred for an additional 17 minutes, then (R) -3-fluoro-5- (((1-hydroxyoctadeca-2-yl) oxy) methyl) benzonitrile, intermediate-131 (225 mg,0.54mmol,1 eq.) was added. After stirring at room temperature for 20 min, the solution was diluted with EtOAc (50 mL) and water (50 mL). The aqueous layer was re-extracted with EtOAc (50 mL). The organic layers were combined, washed with brine (50 mL), dried over magnesium sulfate, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% ethyl acetate/hexanes) to give the title compound, intermediate 1-132. 1 H NMR (400 MHz, methanol-d 4) delta 7.80-7.78 (m, 1H), 7.48-7.28 (m, 5H), 7.20-7.08 (m, 2H), 6.85-6.79 (m, 1H), 6.79-6.74 (m, 1H), 5.66-5.62 (m, 1H), 5.32-5.28 (m, 1H), 5.18-5.12 (m, 1H), 4.64-4.44 (m, 4H), 4.36-4.25 (m, 1H), 4.23-4.10 (m, 1H), 3.63-3.55 (m, 1H), 1.72 (s, 3H), 1.61-1.18 (m, 33H), 0.93-0.86 (m, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.71- -112.81 (M). MS M/z [ M+1)]＝923.1
Intermediate I-133: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- ((3-cyano-) 5-fluorobenzyl) oxy) octadecyl) hydrogen phosphate
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][124]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) octadecyl) phosphate, intermediate-132, (110 mg,0.119mmol,1.0 eq.) in THF (5.0 mL) was added 1, 3-tetramethylguanidine (0.09 mL, 0.015 mmol,6.0 eq.) and cis-2-pyridinealdoxime (9)0mg,0.737mmol,6.19 eq). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-50% MeOH/DCM) to give the title compound as intermediate-133. 1 H NMR (400 MHz, methanol-d 4) delta 7.82 (s, 1H), 7.50-7.47 (m, 1H), 7.43-7.33 (m, 2H), 6.83 (d, j=4.5 hz, 1H), 6.78 (d, j=4.5 hz, 1H), 5.63 (d, j=3.6 hz, 1H), 5.26 (dd, j=6.6, 3.6hz, 1H), 5.13 (d, j=6.6 hz, 1H), 4.73 (d, j=13.0 hz, 1H), 4.51 (d, j=13.0 hz, 1H), 4.18-4.07 (m, 2H), 3.96-3.82 (m, 2H), 3.59-3.50 (m, 1H), 1.70 (s, 3H), 1.48-1.21 (m, 33H), 0.90 (j=6.7 hz, 1H). 19 F NMR (376 MHz, methanol-d 4) delta-112.92- -113.07 (M). MS M/z [ M+1)]＝813.2
Intermediate I-134 (S) -1- (trityloxy) octadecan-2-ol
Bromine (pentadecyl) magnesium (20.8 g,65.7mmol,1.3 eq) was added via cannula to a mixture of (2S) -2- (trityl) oxirane (16 g,50.6mmol,1 eq), cuI (481.6 mg,2.5mmol,0.05 eq) in 2-MeTHF (100 mL) at-20 ℃. The reaction was stirred vigorously for 5 minutes, warmed to 0 ℃, and stirred for 2 hours. Residue with NH 4 Cl 300mL was diluted and extracted with EtOAc 300mL (100 mL. Times.3). The combined organic layers were washed with 200mL (100 mL. Times.2) brine, and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography120g />Silica Flash Column the eluent is 0-60% ethyl acetate/petroleum ether gradient @120 mL/min) to obtain the compound (S) -1- (tritoxy) octadecan-2-ol intermediate I-134. 1 H NMR (400 MHz, chloroform-d) delta 7.38-7.34 (m, 6H), 7.25-7.16 (m, 9H), 3.73-3.64 (m, 1H), 3.12-3.07 (m, 1H), 2.95 (dd, J= 7.6,9.3H)z,1H),2.22(d,J＝3.5Hz,1H),1.34-1.25(m,4H),1.22-1.14(m,26H),0.80(t,J＝6.8Hz,3H).
Intermediate I-135 (S) -3-fluoro-5- (((1- (trityl) octadeca-2-yl) oxy) methyl) benzonitrile
To a solution of NaH (945.5 mg,23.6mmol,60% pure, 2.5 eq) in THF (80 mL) at 0 ℃ was added (2S) -1-trityloxy-octadecan-2-ol intermediate I-134 (5 g,9.5mmol,1 eq) and the mixture was stirred at 0 ℃ for 30 min. 3- (bromomethyl) -5-fluoro-benzonitrile (2.4 g,11.4mmol,1.2 eq) was then added and the mixture stirred at 65℃for 12 hours. At 20℃by addition of saturated NH 4 The reaction mixture was quenched with Cl solution (100 mL) and extracted with ethyl acetate (50 mL. Times.3). The combined organic layers were treated with H 2 O (70 mL. Times.2) washed with Na 2 SO 4 Dried and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography40g />Silica Flash Column the eluent is 0-4% ethyl acetate/petroleum ether gradient @40 mL/min) to obtain the compound (S) -3-fluoro-5- (((1- (trityloxy) octadecan-2-yl) oxy) methyl) benzonitrile, intermediate I-135. 1 H NMR (400 MHz, chloroform-d) delta 7.53-7.41 (m, 7H), 7.41-7.23 (m, 11H), 4.81-4.73 (m, 1H), 4.60 (d, j=12.8 hz, 1H), 3.61-3.52 (m, 1H), 3.29-3.20 (m, 2H), 1.58 (br d, j=6.7 hz, 2H), 1.30 (br s, 28H), 0.93 (br t, j=6.6 hz, 3H).
Intermediate I-136 (S) -3-fluoro-5- (((1-hydroxyoctadeca-2-yl) oxy) methyl) benzonitrile
To 3-fluoro-5- [ [ (1S) -1- (trityloxy) heptadecyloxy]Methyl group]Benzonitrile, intermediate I-135 (4.4 g,6.6mmol,1 eq) in MTBE (90 mL) and MeOH (13.5 mL) was added anisole (359.4 mg,3.3mmol,361.2uL,0.5 eq) and PTSA (572.3 mg,3.3mmol,0.5 eq) and the mixture was stirred at 50℃for 2 hours. The reaction mixture was taken up in 100mL of saturated NaHCO 3 Quench and extract with ethyl acetate (60 mL. Times.3). By H 2 O (100 mL. Times.2) the combined organic layers were washed with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography20g/>Silica Flash Column the eluent is 0-9% ethyl acetate/petroleum ether gradient @45 mL/min) to obtain the compound (S) -3-fluoro-5- (((1-hydroxyoctadeca-2-yl) oxy) methyl) benzonitrile, intermediate I-136. 1 H NMR (400 MHz, chloroform-d) delta 7.46 (br s, 1H), 7.38-7.32 (m, 1H), 7.28 (br s, 1H), 4.69-4.63 (m, 2H), 3.76 (br d, J=10.3 Hz, 1H), 3.67-3.50 (m, 2H), 1.65-1.52 (m, 2H), 1.36-1.25 (m, 28H), 0.93-0.86 (m, 3H) MS (ESI) m/z=442.2 [ M+Na ]] +
Intermediate I-137: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((S) scheme 2- ((3-cyano-5-fluorobenzyl) oxy) octadecyl) phosphate
1H-1,2, 4-triazole (140 mg,2.03mmol,3.78 eq) was dissolved in THF (10.0 mL). TEA (0.20 mL,1.42mmol,2.65 eq.) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.10 mL,0.59mmol,1.1 equivalent). The reaction mixture was stirred at room temperature for 10 minutes, and then (3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) was added in one portion][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopentene-4-carbonitrile intermediate I-3a (203 mg,0.61mmol,1.14 eq.) was followed by 1-methylimidazole (0.06 mL,0.70mmol,1.3 eq.) was added. The solution was stirred for an additional 15 minutes, then (S) -3-fluoro-5- (((1-hydroxyoctadeca-2-yl) oxy) methyl) benzonitrile, intermediate-136 (225 mg,0.54mmol,1 eq.) was added. After stirring at room temperature for 4 hours 15 minutes, the solution was diluted with EtOAc (50 mL) and water (50 mL). The aqueous layer was re-extracted with EtOAc (50 mL). The organic layers were combined, washed with brine (50 mL), dried over magnesium sulfate, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% ethyl acetate/hexanes) to give the title compound, intermediate 1-137. 1 H NMR (400 MHz, methanol-d 4) delta 7.82-7.77 (m, 1H), 7.48-7.30 (m, 5H), 7.20-7.08 (m, 2H), 6.86-6.80 (m, 1H), 6.79-6.74 (m, 1H), 5.66-5.62 (m, 1H), 5.34-5.27 (m, 1H), 5.17 (d, J=6.5 Hz, 0.5H), 5.12 (d, J=6.6 Hz, 0.5H), 4.65-4.47 (m, 4H), 4.38-4.28 (m, 1H), 4.20-4.06 (m, 1H), 3.67-3.56 (m, 1H), 1.73-1.70 (m, 3H), 1.58-1.19 (m, 33H), 0.92-0.86 (m, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.68- -112.83 (m). MS M/z [ M+1 ]]＝923.1
Intermediate I-138: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((S) -2- ((3-cyano-) 5-fluorobenzyl) oxy) octadecyl) hydrogen phosphate
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][124]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) octadecyl phosphate, intermediate-137, (130 mg,0.141mmol,1.0 eq.) THF (5.0 mL)) To the solution were added 1, 3-tetramethylguanidine (0.11 mL,0.845mmol,6.0 eq.) and cis-2-pyridine aldoxime (137 mg,1.12mmol,7.97 eq.). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-50% MeOH/DCM) to give the title compound as intermediate-138. 1 H NMR (400 MHz, methanol-d 4) delta 7.83 (s, 1H), 7.49 (s, 1H), 7.43-7.33 (m, 2H), 6.85-6.78 (m, 2H), 5.63 (d, j=3.7 hz, 1H), 5.27 (dd, j=6.6, 3.6hz, 1H), 5.12 (d, j=6.6 hz, 1H), 4.72 (d, j=13.0 hz, 1H), 4.48 (d, j=13.0 hz, 1H), 4.17-4.06 (m, 2H), 3.96-3.81 (m, 2H), 3.62-3.52 (m, 1H), 1.69 (s, 3H), 1.49-1.19 (m, 33H), 0.94-0.85 (m, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.96- -113.08 (m). MS M/z [ M+1 ]]＝813.2
Intermediate I-139 tetradecylmagnesium bromide
At N 2 Next, to a solution of Mg (2.5 g,103.7mmol,1.2 eq) in 2-MeTHF (30 mL) was added I 2 (228.8 mg,901.6umol,181.6uL,0.01 eq) and BrCH 2 CH 2 Br (0.15 mL). A solution of 1-bromotetradecane (2.0 g,7.2 mmol) in 2-MeTHF (20 mL) was then added dropwise. The mixture was stirred until I 2 Is faded to colorless. A solution of the remaining 1-bromotetradecane (23.0 g,83.0 mmol) in 2-MeTHF (230 mL) was then added and the mixture stirred at 25℃for 4 hours. The crude product magnesium tetradecyl bromide, intermediate I-139, was a brown liquid (in 2-MeTHF) and was used in the next step without further purification.
Intermediate I-140 (R) -1- (triphenylmethoxy) heptadec-2-ol
Magnesium (tetradecyl) bromide (25 g,82.9mmol,1.3 eq) was added via cannula to (2R) -2- (trityloxymethyl) oxirane (20.2 g,63.8mmol,1 eq) over 10 minutes at-20 ℃ ) In a mixture of CuI (607.2 mg,3.2mmol,0.05 eq) in 2-MeTHF (50 mL). The reaction was stirred vigorously for 5 minutes, warmed to 0 ℃, and stirred for 2 hours. By addition of saturated NH 4 The reaction mixture was quenched with Cl solution (350 mL) and the mixture was extracted with ethyl acetate (200 mL. Times.3). By H 2 The combined organic layers were washed with O (400 mL. Times.2) and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography80g/>Silica Flash Column, eluting with 0-3% ethyl acetate/petroleum ether gradient @120 mL/min) to give compound (R) -1- (triphenylmethoxy) heptadec-2-ol intermediate I-140. 1 H NMR (400 MHz, chloroform-d) delta 7.39 (br d, j=7.6 hz, 5H), 7.26-7.19 (m, 10H), 3.71 (br d, j=2.6 hz, 1H), 3.12 (dd, j=2.8, 9.3hz, 1H), 3.01-2.94 (m, 1H), 2.24 (br d, j=3.0 hz, 1H), 1.39-1.26 (m, 4H), 1.19 (br d, j=8.9 hz, 24H), 0.83 (br t, j=6.6 hz, 3H).
Intermediate I-141 (R) -3-fluoro-5- (((1- (triphenylmethoxy) heptadec-2-yl) oxy) methyl) benzonitrile
/>
To a solution of NaH (971.2 mg,24.3mmol,60% pure, 2.5 eq) in THF (80 mL) was added (2R) -1-tritoxy heptadec-2-ol, intermediate I-140 (5 g,9.7mmol,1 eq) at 0 ℃ and the mixture was stirred at 0 ℃ for 30 min. 3- (bromomethyl) -5-fluoro-benzonitrile (2.5 g,11.7mmol,1.2 eq) was then added and the mixture stirred at 65℃for 12 hours. At 20℃by addition of saturated NH 4 The reaction mixture was quenched with Cl solution (100 mL) and extracted with ethyl acetate (50 mL. Times.3). The combined organic layers were treated with H 2 O (70 mL. Times.2) washed with Na 2 SO 4 Dried and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography20g/>Silica Flash Column the eluent is 0-3% ethyl acetate/petroleum ether gradient @45 mL/min) to obtain the compound (R) -3-fluoro-5- (((1- (tritoxy) heptadec-2-yl) oxy) methyl) benzonitrile, intermediate I-141. 1 H NMR (400 MHz, chloroform-d) delta 7.50-7.40 (m, 7H), 7.27 (s, 11H), 4.73 (br d, j=12.9 hz, 1H), 4.57 (br d, j=12.8 hz, 1H), 3.60-3.48 (m, 1H), 3.22 (br d, j=4.3 hz, 2H), 1.55 (br s, 2H), 1.27 (br s, 26H), 0.89 (br t, j=6.4 hz, 3H).
Intermediate I-142 (R) -3-fluoro-5- (((1-hydroxyheptadec-2-yl) oxy) methyl) benzonitrile
To a solution of (R) -3-fluoro-5- (((1- (tritoxy) heptadec-2-yl) oxy) methyl) benzonitrile intermediate I-141 (2.7 g,4.2mmol,1 eq) in MTBE (54 mL) and MeOH (8.1 mL) was added anisole (225.3 mg,2.1mmol, 226.4. Mu.L, 0.5 eq) and PTSA (358.8 mg,2.1mmol,0.5 eq) and the mixture was stirred at 50℃for 2 hours. The reaction mixture was taken up in 80mL of saturated NaHCO 3 Diluted and then extracted with ethyl acetate (40 ml×3). By H 2 O (100 mL. Times.2) the combined organic layers were washed with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography12g/>Silica Flash Column the eluent is 0-15% ethyl acetate/petroleum ether gradient @45 mL/min) to obtain (R) -3-fluoro-5- (((1-hydroxy heptadec-2-yl) oxy) methyl)Radical) benzonitrile, intermediate I-142. 1 H NMR (400 MHz, chloroform-d) delta 7.46 (br s, 1H), 7.35 (br d, J=8.9 Hz, 1H), 7.29 (br s, 1H), 4.64 (br s, 2H), 3.79-3.70 (m, 1H), 3.66-3.47 (m, 2H), 1.66-1.50 (m, 2H), 1.26 (br s, 26H), 0.89 (br s, 3H) MS (ESI) m/z=428.2 [ M+Na ]] +
Intermediate I-143: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((3-cyano-5-fluorobenzyl) oxy) heptadecyl) phosphate
1H-1,2, 4-triazole (236 mg,3.42mmol,3.96 eq) was dissolved in THF (10.0 mL). TEA (0.32 mL,2.29mmol,2.65 eq.) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.17 mL,1.04mmol,1.2 eq.). The reaction mixture was stirred at room temperature for 5 minutes, and then (3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) was added in one portion ][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopentene-4-carbonitrile intermediate I-3a (284 mg,0.86mmol,1.0 eq.) followed by 1-methylimidazole (0.09 mL,1.12mmol,1.3 eq.) was added. The solution was stirred for an additional 10 minutes, then (R) -3-fluoro-5- (((1-hydroxyheptadec-2-yl) oxy) methyl) benzonitrile intermediate I-142 (350 mg,0.86mmol,1.0 eq.) was added. After stirring at room temperature for 4 hours and 20 minutes, the solution was diluted with EtOAc (75 mL) and water (75 mL). The aqueous layer was re-extracted with EtOAc (75 mL). The organic layers were combined, washed with brine, dried over magnesium sulfate, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% ethyl acetate/hexanes) to give the title compound, intermediate 1-143. 1 H NMR (400 MHz, methanol-d 4) delta 7.81-7.78 (m, 1H), 7.48-7.29 (m, 5H), 7.20-7.07 (m, 2H), 6.86-6.80 (m, 1H), 6.78-6.74 (m, 1H), 5.67-5.62 (m, 1H), 5.33-5.27 (m, 1H), 5.18-5.12 (m, 1H), 4.65-4.44 (m, 4H), 4.36-4.24 (m, 1H), 4.23-4.10 (m, 1H), 3.63-3.55 (m, 1H), 1.72 (s,3H),1.59–1.21(m,31H),0.93–0.86(m,3H). 19 f NMR (376 MHz, methanol-d 4) delta-112.70- -112.79 (m). MS M/z [ M+1 ]]＝909.1
Intermediate I-144: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- ((3-cyano-) 5-fluorobenzyl) oxy) heptadecyl hydrogen phosphate
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][124]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopenten-4-yl) methyl (2-chlorophenyl) ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) heptadecyl) phosphate intermediate I-143 (323 mg,0.355mmol,1.0 eq.) in THF (10.0 mL) was added 1, 3-tetramethylguanidine (0.27 mL,2.13mmol,6.0 eq.) and cis-2-pyridine aldoxime (258 mg,2.11mmol,5.95 eq.). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-45% MeOH/DCM) to give the title compound as intermediate-144. 1 H NMR (400 MHz, methanol-d 4) delta 7.82 (s, 1H), 7.51-7.47 (m, 1H), 7.44-7.33 (m, 2H), 6.85-6.76 (m, 2H), 5.63 (d, j=3.6 hz, 1H), 5.26 (dd, j=6.6, 3.6hz, 1H), 5.13 (d, j=6.6 hz, 1H), 4.73 (d, j=13.0 hz, 1H), 4.51 (d, j=13.0 hz, 1H), 4.17-4.07 (m, 2H), 3.95-3.82 (m, 2H), 3.59-3.50 (m, 1H), 1.69 (s, 3H), 1.47-1.20 (m, 31H), 0.90 (t, j=6.8 hz, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.93- -113.12 (m). MS M/z [ M+1 ] ]＝799.2
Intermediate I-145:1-bromoheptadecane
Heptadec-1-ol (10 g,39.0mmol,1 eq) was purified at 20deg.C in HBr (60 mL,30% purity) (at H 2 O), in O)TBAB (502.8 mg,1.6mmol,0.04 eq) was added to the solution. The mixture was then stirred at 100℃for 12 hours. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was taken up in H 2 O (120 mL) was diluted and extracted with DCM (80 mL. Times.3). By H 2 The combined organic layers were washed with O (150 mL. Times.2) and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography80g/>Silica Flash Column the eluent was 0 ethyl acetate/petroleum ether gradient @100 mL/min) to give the compound bromoheptadecane, intermediate I-145 (8.4 g), as a white solid. 1 H NMR (400 MHz, chloroform-d) delta 3.42 (t, j=6.9 hz, 2H), 1.86 (quin, j=7.1 hz, 2H), 1.47-1.39 (m, 2H), 1.27 (s, 26H), 0.89 (t, j=6.8 hz, 3H).
Intermediate I-146 heptadecyl magnesium bromide
At N 2 Next, to a solution of Mg (875.2 Mg,36.0mmol,1.2 eq) in 2-MeTHF (30 mL) was added I 2 (79.5 mg, 313.1. Mu.L, 0.01 eq) and BrCH 2 CH 2 Br (0.1 mL). A solution of 1-bromoheptadecane intermediate I-145 (1 g,3.1 mmol) in 2-MeTHF (10 mL) was then added dropwise. The mixture was stirred until I 2 Is faded to colorless. A solution of the remaining 1-bromoheptadecane (9 g,28.2 mmol) in 2-MeTHF (90 mL) was then added and the mixture stirred at 25℃for 4 hours. The crude product heptadecyl magnesium bromide intermediate I-146 (in 2-MeTHF) was used as brown solution without further purification in the next step.
Intermediate I-147 (R) -1- (trityloxy) eicosan-2-ol
Bromine (heptadecyl) magnesium intermediate I-146 (10 g,29.1mmol,1.3 eq) was added via cannula to a mixture of (2R) -2- (trityl) oxirane (7.1 g,22.4mmol,1 eq), cuI (213.1 mg,1.1mmol,0.05 eq) in 2-MeTHF (70 mL) over 10 min. The reaction was stirred vigorously for 5 minutes, warmed to 0 ℃, and then stirred for 2 hours. By addition of saturated NH 4 The reaction mixture was quenched with aqueous Cl (200 mL) and the mixture was extracted with ethyl acetate (120 mL. Times.3). By H 2 The combined organic layers were washed with O (200 mL. Times.2) and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography80g/>Silica Flash Column the eluent is 0-4% ethyl acetate/petroleum ether gradient @100 mL/min) to obtain compound (R) -1- (tritoxy) eicosan-2-ol intermediate I-147. 1 H NMR (400 MHz, chloroform-d) delta 7.45 (d, j=7.5 hz, 5H), 7.27 (s, 10H), 3.77 (br dd, j=3.9, 7.4hz, 1H), 3.19 (dd, j=3.1, 9.3hz, 1H), 3.07-2.98 (m, 1H), 2.32-2.26 (m, 1H), 1.42-1.32 (m, 4H), 1.32-1.22 (m, 30H), 0.89 (t, j=6.7 hz, 3H), in-between>
Intermediate I-148:3- (bromomethyl) -5-chlorobenzonitrile
To a solution of 3-chloro-5-methyl-benzonitrile (4.5 g,29.7mmol,1 eq) in ACN (50 mL) was added NBS (5.8 g,32.6mmol,1.1 eq) and AIBN (4.9 g,29.7mmol,1 eq). The mixture was stirred at 80℃for 12 hours. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was taken up in H 2 O (60 mL) was diluted and extracted with ethyl acetate (40 mL. Times.3). By H 2 O(60ml×2) the combined organic layers were washed with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography20g/>Silica Flash Column the eluent is 0-1% ethyl acetate/petroleum ether gradient @45 mL/min) to obtain the compound 3- (bromomethyl) -5-chlorobenzonitrile, intermediate I-148. 1 H NMR (400 MHz, chloroform-d) delta 7.65-7.57 (m, 3H), 4.43 (s, 2H).
Intermediate I-149 (R) -3-chloro-5- (((1- (trityl) icosane-2-yl) oxy) methyl) benzonitrile
To a solution of (2R) -1-tritoxyeicosan-2-ol intermediate I-147 (4.0 g,7.2mmol,1 eq) in THF (60 mL) at 0deg.C was added NaH (723.0 mg,18.1mmol,60% pure, 2.5 eq) and the mixture stirred at 0deg.C for 30 min. 3- (bromomethyl) -5-chloro-benzonitrile, intermediate I-148 (2.0 g,8.7mmol,1.2 eq), was then added and the mixture stirred at 65℃for 12 hours. 20℃by addition of saturated NH 4 The reaction mixture was quenched with Cl solution (60 mL) and extracted with ethyl acetate (40 mL. Times.3). The combined organic layers were treated with H 2 O (60 mL. Times.2) washed with Na 2 SO 4 Dried and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography20g/>Silica Flash Column the eluent is 0-3% ethyl acetate/petroleum ether gradient @45 mL/min) to obtain compound (R) -3-chloro-5- (((1- (tritoxy) eicosane)2-yl) oxy) methyl) benzonitrile, intermediate I-149. 1 H NMR (400 MHz, chloroform-d) delta 7.50 (s, 1H), 7.45 (s, 1H), 7.42 (s, 1H), 7.39-7.35 (m, 5H), 7.25-7.16 (m, 10H), 4.63 (d, j=12.8 hz, 1H), 4.46 (d, j=12.8 hz, 1H), 3.48-3.40 (m, 1H), 3.13 (d, j=4.8 hz, 2H), 1.49-1.41 (m, 2H), 1.23-1.14 (m, 32H), 0.81 (t, j=6.8 hz, 3H).
Intermediate I-150 (R) -3-chloro-5- (((1-hydroxyeicosan-2-yl) oxy) methyl) benzonitrile
To 3-chloro-5- [ [ (1R) -1- (trityloxymethyl) nonadecyloxy]Methyl group]Benzonitrile, intermediate I-149 (3.9 g,5.5mmol,1.0 eq) in MTBE (80 mL) and MeOH (12 mL) was added anisole (298.5 mg,2.8mmol,300.0uL,0.5 eq) and PTSA (475.3 mg,2.8mmol,0.5 eq) and the mixture was stirred at 50℃for 2 hours. The reaction mixture was taken up in 120mL of saturated NaHCO 3 Diluted and then extracted with ethyl acetate (80 ml×3). By H 2 O (100 mL. Times.2) the combined organic layers were washed with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography20g/>Silica Flash Column the eluent is 0-8% ethyl acetate/petroleum ether gradient @45 mL/min) to obtain the compound (R) -3-chloro-5- (((1-hydroxyeicosan-2-yl) oxy) methyl) benzonitrile, intermediate I-150. 1 H NMR (400 MHz, chloroform-d) delta 7.61-7.53 (m, 3H), 4.62 (s, 2H), 3.75 (br d, J=10.8 Hz, 1H), 3.66-3.58 (m, 1H), 3.56-3.49 (m, 1H), 1.81 (br s, 1H), 1.67-1.48 (m, 2H), 1.26 (s, 32H), 0.89 (t, J=6.6 Hz, 3H) MS (ESI) m/z=486.2 [ M+Na ]] +
Intermediate I-151: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-22-Dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-chloro-5-) Cyanobenzyl) oxy) eicosyl) (2-chlorophenyl) phosphate
1H-1,2, 4-triazole (125 mg,1.81mmol,3.46 eq) was dissolved in THF (10 mL). TEA (0.19 mL,1.39mmol,2.65 eq.) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.10 mL,0.575mmol,1.1 eq.). The reaction mixture was stirred at room temperature for 10 minutes, and then (3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) was added in one portion ][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopentene-4-carbonitrile intermediate I-3a (173 mg, 0.803 mmol,1.0 eq.) followed by 1-methylimidazole (0.10 mL,1.25mmol,2.4 eq.) was added. The solution was stirred for an additional 9 minutes, then (R) -3-chloro-5- (((1-hydroxyeicosan-2-yl) oxy) methyl) benzonitrile intermediate I-150 (243 mg, 0.323 mmol,1.0 eq.) was added. After stirring overnight at room temperature, the solution was diluted with EtOAc (100 mL) and water (100 mL). The aqueous layer was re-extracted with EtOAc (100 mL). The organic layers were combined, washed with 1:1 water: brine (100 mL), dried over magnesium sulfate, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% ethyl acetate/hexanes) to give the title compound, intermediate 1-151. 1 H NMR (400 MHz, methanol-d 4) delta 7.81-7.77 (m, 1H), 7.64-7.56 (m, 2H), 7.56-7.51 (m, 1H), 7.48-7.29 (m, 2H), 7.20-7.08 (m, 2H), 6.86-6.80 (m, 1H), 6.78-6.74 (m, 1H), 5.68-5.62 (m, 1H), 5.33-5.26 (m, 1H), 5.19-5.12 (m, 1H), 4.64-4.42 (m, 4H), 4.36-4.25 (m, 1H), 4.24-4.06 (m, 1H), 3.63-3.55 (m, 1H), 1.72 (s, 3H), 1.58-1.20 (m, 37H), 0.93-0.85 (m, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-7.53- -8.01 (m). MS M/z [ M+1 ] ]＝967.1
Intermediate I-152: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxol-4-yl) methyl ((R) -2- ((3-chloro-5)- Cyanobenzyl) oxy) eicosyl) hydrogen phosphate
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]To a solution of dioxol-4-yl) methyl ((R) -2- ((3-chloro-5-cyanobenzyl) oxy) eicosyl) (2-chlorophenyl) phosphate intermediate I-151 (164 mg,0.169mmol,1.0 eq.) in THF (5.0 mL) was added 1, 3-tetramethylguanidine (0.13 mL,1.02mmol,6.0 eq.) and cis-2-pyridine aldoxime (196 mg,1.60mmol,9.47 eq.). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-40% MeOH/DCM) to give the title compound as intermediate-152. 1 H NMR (400 MHz, methanol-d 4) delta 7.82 (s, 1H), 7.65-7.57 (m, 3H), 6.83 (d, j=4.5 hz, 1H), 6.78 (d, j=4.5 hz, 1H), 5.63 (d, j=3.6 hz, 1H), 5.25 (dd, j=6.6, 3.6hz, 1H), 5.13 (d, j=6.6 hz, 1H), 4.72 (d, j=13.0 hz, 1H), 4.49 (d, j=12.9 hz, 1H), 4.17-4.07 (m, 2H), 3.95-3.81 (m, 2H), 3.59-3.50 (m, 1H), 1.69 (s, 3H), 1.47-1.18 (m, 37H), 0.89 (t, j=6.8 hz, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.19- -0.73 (m). MS M/z [ M+1 ]]＝857.2
Intermediate I-153 (R) -3-chloro-5- (((1- (tritoxy) di-undec-2-yl) oxy) methyl) benzyl Nitrile (II)
To a solution of (R) -1- (trityloxy) di-undecan-2-ol (2.0 g,3.5mmol,1 eq) in THF (80 mL) was added NaH (420.4 mg,10.5mmol,60% purity, 3 eq) at 0deg.C. The mixture was stirred at 0℃for 0.5 hours, and then 3- (bromomethyl) -5-chloro-benzonitrile (1.2 g,5.2mmol,1.5 eq) was added to the above solution at 0 ℃. The mixture was stirred at 65℃for 12 hours. At 0℃by addition of saturated NH 4 Cl (50 mL)The reaction mixture was quenched and extracted with ethyl acetate (20 mL. Times.3). The combined organic layers were washed with NaCl (20 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/MTBE=100/1 to 100/4), yielding (R) -3-chloro-5- (((1- (trityloxy) di-undec-2-yl) oxy) methyl) benzonitrile intermediate I-153. 1 H NMR (400 MHz, chloroform-d) delta 7.64-7.52 (m, 3H), 7.48 (d, j=7.2 hz, 6H), 7.37-7.26 (m, 11H), 4.78-4.53 (m, 2H), 3.58-3.52 (m, 1H), 3.24 (d, j=4.8 hz, 2H), 1.29 (s, 36H), 0.92 (t, j=6.7 hz, 3H).
Intermediate I-154 (R) -3-chloro-5- (((1-hydroxy-di-undec-2-yl) oxy) methyl) benzonitrile
To a solution of (R) -3-chloro-5- (((1- (trityloxy) di-undec-2-yl) oxy) methyl) benzonitrile intermediate I-153 (1.2 g,1.6mmol, 615.7. Mu.L, 1 eq) in MTBE (15 mL) was added anisole (180.1 mg,1.6mmol, 181.0. Mu.L, 1 eq), meOH (2.4 mL) and 4-methylbenzenesulfonic acid (286.8 mg,1.6mmol,1 eq). The mixture was stirred at 50℃for 6 hours. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was washed with NaCl (20 mL. Times.3), with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/0 to 5/1), yielding (R) -3-chloro-5- (((1-hydroxy-di-undec-2-yl) oxy) methyl) benzonitrile intermediate I-154. 1 H NMR (400 MHz, chloroform-d) delta 7.59 (s, 1H), 7.58-7.53 (m, 2H), 4.62 (s, 2H), 3.80-3.71 (m, 1H), 3.66-3.58 (m, 1H), 3.57-3.49 (m, 1H), 1.76 (br s, 1H), 1.59-1.46 (m, 2H), 1.26 (s, 34H), 0.89 (t, J=6.8 Hz, 3H) MS (ESI) m/z=500.3 [ M+Na ]] +
Intermediate I-155: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-chloro-5-) Cyanobenzyl) oxy) heneicosyl) (2-chlorophenyl) phosphate
1H-1,2, 4-triazole (239 mg,3.46mmol,6.62 eq) was dissolved in THF (10 mL). TEA (0.19 mL,1.39mmol,2.65 eq.) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.10 mL,0.575mmol,1.1 eq.). The reaction mixture was stirred at room temperature for 6 minutes, and then (3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) was added in one portion][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopentene-4-carbonitrile intermediate I-3a (173 mg, 0.803 mmol,1.0 eq.) was followed by 1-methylimidazole (0.05 mL,0.680mmol,1.3 eq.) was added. The solution was stirred for an additional 14 minutes, then (R) -3-chloro-5- (((1-hydroxy-di-undec-2-yl) oxy) methyl) benzonitrile intermediate I-154 (250 mg,0.523mmol,1.0 eq.) was added. After stirring at room temperature for 4h, the solution was diluted with EtOAc (100 mL) and water (100 mL). The aqueous layer was re-extracted with EtOAc (100 mL). The organic layers were combined, washed with 1:1 water: brine (60 mL), dried over magnesium sulfate, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% ethyl acetate/hexanes) to give the title compound, intermediate 1-155. 1 H NMR (400 MHz, methanol-d) 4 )δ7.81–7.77(m,1H),7.64–7.56(m,2H),7.55–7.52(m,1H),7.47–7.29(m,2H),7.20–7.08(m,2H),6.86–6.80(m,1H),6.78–6.74(m,1H),5.67–5.62(m,1H),5.32–5.28(m,1H),5.18–5.12(m,1H),4.64–4.42(m,4H),4.36–4.25(m,1H),4.23–4.12(m,1H),3.63–3.55(m,1H),1.72(s,3H),1.59–1.20(m,39H),0.93–0.86(m,3H). 31 P NMR (162 MHz, methanol-d 4) delta-7.54- -8.02 (m). MS M/z [ M+1 ] ]＝981.2
Intermediate I-156: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-chloro-5-) Cyanobenzyl) oxy) heneicosyl) hydrogen phosphate
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]To a solution of dioxol-4-yl) methyl ((R) -2- ((3-chloro-5-cyanobenzyl) oxy) heneicosyl) (2-chlorophenyl) phosphate intermediate I-155 (178 mg,0.181mmol,1.0 eq.) in THF (5.0 mL) was added 1, 3-tetramethylguanidine (0.14 mL,1.09mmol,6.0 eq.) and cis-2-pyridine aldoxime (164 mg,1.34mmol,7.41 eq.). The reaction mixture was stirred at room temperature overnight. Another 80mg of cis-2-pyridine aldoxime (0.65mmol, 3.61 eq.) was added and stirred overnight. The solution was concentrated in vacuo and purified by silica gel (0-40% MeOH/DCM) to give the title compound as intermediate-156. 1 H NMR (400 MHz, methanol-d 4) delta 7.82 (s, 1H), 7.65-7.57 (m, 3H), 6.83 (d, j=4.5 hz, 1H), 6.78 (d, j=4.5 hz, 1H), 5.63 (d, j=3.6 hz, 1H), 5.25 (dd, j=6.6, 3.6hz, 1H), 5.13 (d, j=6.6 hz, 1H), 4.72 (d, j=13.0 hz, 1H), 4.49 (d, j=13.0 hz, 1H), 4.17-4.07 (m, 2H), 3.96-3.81 (m, 2H), 3.59-3.49 (m, 1H), 1.69 (s, 3H), 1.46-1.21 (m, 39H), 0.90 (t, j=6.8 hz, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.16- -0.78 (m). MS M/z [ M+1 ]]＝871.1
Intermediate I-161 (R) -3-fluoro-5- (((1- (trityl) icosane-2-yl) oxy) methyl) benzonitrile
/>
To a solution of (R) -1- (trityloxy) eicosan-2-ol (2.5 g,4.4mmol,1 eq) in THF (80 mL) was added NaH (538.7 mg,13.4mmol,60% purity, 3 eq) at 0deg.C. The mixture was stirred at 0℃for 0.5 hours, and then 3- (bromomethyl) -5-fluoro-benzonitrile (1.9 g,8.9mmol,2 eq) was added to the above solution at 0 ℃. The mixture was stirred at 65℃for 12 hours. At 0℃by addition of saturated NH 4 Cl (50 mL) quench the reaction mixture andethyl acetate (20 ml×3) extraction. The combined organic layers were washed with NaCl (20 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/mtbe=100/1 to 100/8) to give (R) -3-fluoro-5- (((1- (trityloxy) eicosan-2-yl) oxy) methyl) benzonitrile intermediate I-161. 1 H NMR (400 MHz, chloroform-d) delta 7.51-7.42 (m, 7H), 7.38-7.24 (m, 12H), 4.82-4.51 (m, 2H), 3.63-3.47 (m, 1H), 3.24 (d, J=4.6 Hz, 2H), 1.43-1.20 (m, 34H), 0.92 (brt, J=6.6 Hz, 3H).
Intermediate I-162 (R) -3-fluoro-5- (((1-hydroxyeicosan-2-yl) oxy) methyl) benzonitrile
To a solution of (R) -3-fluoro-5- (((1- (trityloxy) eicosan-2-yl) oxy) methyl) benzonitrile intermediate I-161 (1.8 g,2.6mmol, 615.7. Mu.L, 1 eq) in MTBE (30 mL) was added anisole (282.1 mg,2.6mmol,283.5uL,1 eq), meOH (4.8 mL) and 4-methylbenzenesulfonic acid (449.2 mg,2.6mmol,1 eq). The mixture was stirred at 50℃for 6 hours. At 0℃by addition of saturated NH 4 Cl (20 mL) quenched the reaction mixture and extracted with ethyl acetate (30 mL. Times.3). The combined organic layers were washed with NaCl (20 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/0 to 5/1), yielding (R) -3-fluoro-5- (((1-hydroxyeicosan-2-yl) oxy) methyl) benzonitrile intermediate I-162. 1 H NMR (400 MHz, chloroform-d) delta 7.38 (s, 1H), 7.27 (br d, J=9.0 Hz, 1H), 7.22-7.17 (m, 1H), 4.56 (s, 2H), 3.74-3.63 (m, 1H), 3.58-3.39 (m, 2H), 1.74-1.63 (m, 1H), 1.54-1.39 (m, 3H), 1.18 (s, 32H), 0.81 (t, J=6.6 Hz, 3H) MS (ESI) m/z=470.3 [ M+Na ]] +
Intermediate I-163: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl Radical) ((R)/(R) materials) 2- ((3-cyano-5-fluorobenzyl) oxy) eicosyl) phosphate
1H-1,2, 4-triazole (183 mg,2.65mmol,4.94 eq) was dissolved in THF (10.0 mL). TEA (0.20 mL,1.42mmol,2.65 eq.) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.15 mL,0.912mmol,1.7 eq.). The reaction mixture was stirred at room temperature for 4 minutes, and then (3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) was added in one portion][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopentene-4-carbonitrile intermediate I-3a (178 mg, 0.534 mmol,1.0 eq.) followed by 1-methylimidazole (0.06 mL,0.753mmol,1.4 eq.) was added. The solution was stirred for an additional 10 minutes, then (R) -3-fluoro-5- (((1-hydroxyeicosan-2-yl) oxy) methyl) benzonitrile intermediate I-162 (240 mg,0.536mmol,1.0 eq.) was added. After stirring overnight at room temperature, the solution was diluted with EtOAc (100 mL) and water (100 mL). The aqueous layer was re-extracted with EtOAc (100 mL). The organic layers were combined, washed with brine (50 mL), dried over magnesium sulfate, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% ethyl acetate/hexanes) to give the title compound, intermediate 1-163. 1 H NMR (400 MHz, methanol-d 4) delta 7.81-7.77 (m, 1H), 7.49-7.28 (m, 5H), 7.20-7.07 (m, 2H), 6.86-6.79 (m, 1H), 6.78-6.73 (m, 1H), 5.68-5.60 (m, 1H), 5.33-5.26 (m, 1H), 5.19-5.12 (m, 1H), 4.65-4.43 (m, 4H), 4.37-4.25 (m, 1H), 4.23-4.11 (m, 1H), 3.64-3.55 (m, 1H), 1.72 (s, 3H), 1.58-1.19 (m, 37H), 0.93-0.85 (m, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.63- -112.76 (m). 31 P NMR (162 MHz, methanol-d 4) delta-7.57- -7.94 (m). MS M/z [ M+1 ]]＝951.2
Intermediate I-164: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- ((3-cyano-) 5-fluorobenzyl) oxy) eicosyl) phosphorusAcid hydrogen salt
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][124]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) eicosyl) phosphate intermediate I-163 (267 mg,0.281mmol,1.0 eq.) in THF (10.0 mL) was added 1, 3-tetramethylguanidine (0.21 mL,1.68mmol,6.0 eq.) and cis-2-pyridine aldoxime (229 mg,1.88mmol,6.68 eq.). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-40% MeOH/DCM) to give the title compound as intermediate-164. 1 H NMR (400 MHz, methanol-d 4) delta 7.82 (s, 1H), 7.51-7.47 (m, 1H), 7.43-7.33 (m, 2H), 6.83 (d, j=4.5 hz, 1H), 6.78 (d, j=4.5 hz, 1H), 5.63 (d, j=3.6 hz, 1H), 5.26 (dd, j=6.6, 3.6hz, 1H), 5.13 (d, j=6.6 hz, 1H), 4.73 (d, j=13.0 hz, 2H), 4.51 (d, j=13.1 hz, 1H), 4.17-4.07 (m, 2H), 3.95-3.82 (m, 2H), 3.59-3.50 (m, 1H), 1.69 (s, 3H), 1.48-1.19 (m, 37H), 0.89 (j=6.6 hz, 1H). 19 F NMR (376 MHz, methanol-d 4) delta-112.92- -113.04 (m). 31 P NMR (162 MHz, methanol-d 4) delta-0.32- -0.74 (m). MS M/z [ M+1 ]]＝841.2
Intermediate I-165 octadecyl magnesium bromide
At N 2 Next, to a solution of Mg (3.4 g,138.0mmol,1.2 eq) in 2-MeTHF (30 mL) was added I 2 (304.5 mg,1.2mmol,241.7uL,0.01 eq) and BrCH 2 CH 2 Br (0.2 mL). A solution of 1-bromooctadecane (4.0 g,12.0 mmol) in 2-MeTHF (40 mL) was then added dropwise. The mixture was stirred until I 2 Is faded to colorless. A solution of the remaining 1-bromooctadecane (36.0 g,108.0 mmol) in 2-MeTHF (360 mL) was then added and the mixture stirred at 25℃for 4 hours. Crude productOctadecyl magnesium bromide, intermediate I-165, was a brown liquid (in 2-MeTHF) and was used in the next step without further purification.
Intermediate I-166 (S) -1- (trityloxy) di-undecan-2-ol
Bromine (octadecyl) magnesium intermediate I-165 (40.0 g,111.8mmol,1.3 eq) was added via cannula to a mixture of (2S) -2- (trityloxymethyl) oxirane (27.2 g,86.0mmol,1.0 eq), cuI (819.1 mg,4.3mmol,0.05 eq) in 2-MeTHF (100 mL) at-20 ℃ over 10 min. Stirring vigorously for 5 minutes, heating to 0℃and stirring for 2 hours. By addition of saturated NH 4 The reaction mixture was quenched with Cl solution (500 mL) and the mixture was extracted with ethyl acetate (250 mL. Times.3). By H 2 The combined organic layers were washed with O (450 mL. Times.2) and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (silica gel flash column, eluent 0-5% ethyl acetate/petroleum ether gradient @120 mL/min) to give compound (S) -1- (tritoxy) di-undecan-2-ol intermediate I-166. 1 H NMR (400 MHz, chloroform-d) delta 7.41-7.36 (m, 6H), 7.27-7.16 (m, 9H), 3.75-3.66 (m, 1H), 3.16-3.08 (m, 1H), 3.03-2.92 (m, 1H), 2.26-2.20 (m, 1H), 1.36-1.29 (m, 2H), 1.23-1.16 (m, 34H), 0.86-0.80 (m, 3H).
Intermediate I-167 (R) -2-fluoro-4- ((1- (trityloxy) di-undec-2-yl) oxy) benzonitrile
At N 2 Next, to a solution of (2S) -1-trityloxyundecan-2-ol intermediate I-166 (3.5 g,6.1mmol,1 eq) in THF (30 mL) was added 2-fluoro-4-hydroxy-benzonitrile (1.0 g,7.4mmol,1.2 eq) and PPh 3 (1.6 g,6.1mmol,1 eq). The mixture was cooled to 0 ℃ and dried over THF (10 mDIAD (1.5 g,7.4mmol,1.4mL,1.2 eq) in L) was added to the above solution. The mixture was stirred at 20℃for 12 hours. The reaction mixture was treated with H 2 O (60 mL) was diluted and extracted with ethyl acetate (40 mL. Times.2). By H 2 The combined organic layers were washed with O (80 mL. Times.2) and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (20 g silica gel flash column, eluent 0-3% ethyl acetate/petroleum ether gradient @45 mL/min) to give compound (R) -2-fluoro-4- ((1- (trityloxy) di-undec-2-yl) oxy) benzonitrile intermediate I-167. 1 H NMR (400 MHz, chloroform-d) delta 7.41-7.36 (m, 1H), 7.29 (br d, J=7.0 Hz, 6H), 7.24-7.12 (m, 9H), 6.69-6.61 (m, 2H), 4.35-4.26 (m, 1H), 3.29-3.14 (m, 2H), 1.63-1.55 (m, 2H), 1.24-1.13 (m, 34H), 0.80 (t, J=6.7 Hz, 3H).
Intermediate I-168 (R) -2-fluoro-4- ((1-hydroxy-di-undec-2-yl) oxy) benzonitrile
To 2-fluoro-4- [ (1R) -1- (trityloxymethyl) eicosyloxy]To a solution of benzonitrile intermediate I-167 (2.9 g,4.2mmol,1 eq) in MTBE (58 mL) and MeOH (8.7 mL) was added anisole (227.3 mg,2.1mmol,228.4uL,0.5 eq) and PTSA (361.9 mg,2.1mmol,0.5 eq) and the mixture was stirred at 50℃for 2 hours. The reaction mixture was taken up in 80mL of saturated NaHCO 3 Diluted and then extracted with ethyl acetate (40 ml×3). By H 2 O (50 mL. Times.2) wash the combined organic layers with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (20 g silica gel flash column, eluent 0-8% ethyl acetate/petroleum ether gradient @80 mL/min) to give compound (R) -2-fluoro-4- ((1-hydroxydi-undec-2-yl) oxy) benzonitrile intermediate I-168. 1 H NMR (400 MHz, chloroform-d) delta 7.50-7.36 (m, 1H), 6.80-6.58 (m, 2H), 4.32 (br d, J=4.4 Hz, 1H), 3.86-3.63 (m, 2H), 1.71-1.53 (m, 3H), 1.16 (br d, J=13.9 Hz, 34H), 0.91-0.74 (m, 3H) MS (ESI) m/z=448.3 [ M+H ]] +
Intermediate I-169: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- (4-cyano-3-fluorophenoxy) heneicosyl phosphate
1H-1,2, 4-triazole (176 mg,2.55mmol,4.75 eq.) was dissolved in THF (10.0 mL). TEA (0.20 mL,1.42mmol,2.65 eq.) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.15 mL,0.912mmol,1.70 eq.). The reaction mixture was stirred at room temperature for 4 minutes, and then (3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) was added in one portion ][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopentene-4-carbonitrile intermediate I-3a (178 mg, 0.534 mmol,1.0 eq.) followed by 1-methylimidazole (0.06 mL,0.753mmol,1.40 eq.) was added. The solution was stirred for an additional 12 minutes, then (R) -2-fluoro-4- ((1-hydroxydi-undec-2-yl) oxy) benzonitrile intermediate I-168 (240 mg,0.536mmol,1.0 eq.) was added. After stirring at room temperature for 2 hours, the solution was diluted with EtOAc (100 mL) and water (100 mL). The aqueous layer was re-extracted with EtOAc (100 mL). The organic layers were combined, washed with brine (50 mL), dried over magnesium sulfate, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% ethyl acetate/hexanes) to give the title compound, intermediate 1-169. 1 H NMR (400 MHz, methanol-d 4) delta 7.82-7.78 (m, 1H), 7.57-7.02 (m, 5H), 6.88-6.75 (m, 4H), 5.67-5.64 (m, 1H), 5.35-5.28 (m, 1H), 5.19 (d, J=6.5 Hz, 0.5H), 5.12 (d, J=6.6 Hz, 0.5H), 4.70-4.44 (m, 3H), 4.38-4.20 (m, 2H), 1.75-1.71 (m, 3H), 1.65-1.56 (m, 2H), 1.45-1.21 (m, 37H), 0.89 (t, J=6.8 Hz, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-107.58- -107.78 (m). 31 P NMR(162MHz,Methanol-d4)δ-7.68–-8.52(m).MS m/z[M+1]＝951.2
Intermediate I-170: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- (4-cyano-) 3-fluorophenoxy) heneicosyl) phosphate dibasic salt
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]To a solution of dioxol-4-yl) methyl (2-chlorophenyl) ((R) -2- (4-cyano-3-fluorophenoxy) heneicosyl) phosphate intermediate I-169 (234 mg,0.246mmol,1.0 eq.) in THF (10.0 mL) was added 1, 3-tetramethylguanidine (0.18 mL,1.48mmol,6.0 eq.) and cis-2-pyridine aldoxime (215 mg,1.76mmol,7.16 eq.). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-40% MeOH/DCM) to give the title compound as intermediate-170. 1 H NMR (400 MHz, methanol-d 4) delta 7.83 (s, 1H), 7.56-7.48 (m, 1H), 6.93-6.82 (m, 3H), 6.79 (d, j=4.5 hz, 1H), 5.64 (d, j=3.6 hz, 1H), 5.27 (dd, j=6.6, 3.6hz, 1H), 5.11 (d, j=6.6 hz, 1H), 4.59-4.50 (m, 1H), 4.13-4.02 (m, 2H), 4.00-3.89 (m, 2H), 1.70 (s, 3H), 1.67-1.48 (m, 2H), 1.46-1.19 (m, 37H), 0.94-0.86 (m, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-108.02- -108.19 (m). 31 P NMR (162 MHz, methanol-d 4) delta-0.47- -1.27 (m). MS M/z [ M+1 ] ]＝841.2
Intermediate I-171 tridecyl magnesium bromide
At N 2 Next, to a solution of Mg (1.5 g,65.5mmol,1.1 eq) in 2-MeTHF (50 mL) was added I 2 (144.6 mg,569.7umol, 114.7. Mu.L, 0.01 eq) and BrCH 2 CH 2 Br (10.9 g,56.9mmol,0.1mL,1.0 eq). 1/10 of 1-bromotridecane (1.5 g,5.7mmol,1.5mL,0.1 eq) is then added dropwise2-MeTHF (150 mL) solution. The mixture was stirred until I 2 Is faded to colorless. The remaining 1-bromotridecane intermediate I-171 (13.5 g,51.3mmol,13.5mL,0.9 eq) in 2-MeTHF (150 mL) was then added and the mixture stirred at 25℃for 4 h. The crude solution was used as gray solution without further purification in the next step.
Intermediate I-172 (S) -1- (trityloxy) hexadecan-2-ol
Tridecyl magnesium bromide intermediate I-171 (14.1 g,49.3mmol,1.3 eq.) was added via cannula to a mixture of (2S) -2- (trityl) oxirane (12 g,37.9mmol,1 eq.) cuI (361.1 mg,1.9mmol,0.05 eq.) in 2-MeTHF (100 mL) at-20deg.C over 30 min. The mixture was stirred at 0 ℃ for 1 hour and at 20 ℃ for 12 hours. At 0℃by addition of saturated NH 4 The reaction mixture was quenched with Cl solution (20 mL) and extracted with ethyl acetate (15 mL. Times.3). The combined organic layers were washed with NaCl (10 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/3 to 100/6), yielding (S) -1- (triphenylmethoxy) hexadecan-2-ol intermediate I-172. 1 H NMR (400 MHz, chloroform-d) delta 7.48 (br d, j=7.6 hz, 6H), 7.39-7.25 (m, 11H), 3.88-3.74 (m, 1H), 3.25-3.17 (m, 1H), 3.11-3.01 (m, 1H), 2.35 (d, j=3.4 hz, 1H), 1.40-1.23 (m, 26H), 0.92 (t, j=6.7 hz, 3H).
Intermediate I-173 (S) -3-fluoro-5- (((1- (tritoxy) hexadecan-2-yl) oxy) methyl) benzonitrile
To (S) -1- (trityloxy) hexadecan-2-ol intermediate I-172 (2.5 g,4.9mmol,1 eq) at T at 0deg.CTo a solution of HF (20 mL) was added NaH (599.1 mg,14.9mmol,60% purity, 3 eq). The mixture was stirred at 0℃for 0.5 hours, and then 3- (bromomethyl) -5-fluoro-benzonitrile (1.6 g,7.4mmol,1.5 eq) was added to the above solution at 0 ℃. The mixture was stirred at 65℃for 12 hours. At 0℃by addition of saturated NH 4 Cl (50 mL) quenched the reaction mixture and extracted with ethyl acetate (20 mL. Times.3). The combined organic layers were washed with NaCl (20 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/MTBE=100/0 to 10/1), yielding (S) -3-fluoro-5- (((1- (tritoxy) hexadecan-2-yl) oxy) methyl) benzonitrile intermediate I-173. 1 H NMR (400 MHz, chloroform-d) delta 7.41-7.32 (m, 6H), 7.32-7.09 (m, 12H), 4.74-4.54 (m, 1H), 4.54-4.39 (m, 1H), 3.53-3.35 (m, 1H), 3.13 (d, j=4.8 hz, 2H), 1.45 (br d, j=4.4 hz, 2H), 1.26-1.12 (m, 26H), 0.81 (br t, j=6.8 hz, 3H).
Intermediate I-174 (S) -3-fluoro-5- (((1-hydroxyhexadecan-2-yl) oxy) methyl) benzonitrile
/>
To a solution of (S) -3-fluoro-5- (((1- (tritoxy) hexadecan-2-yl) oxy) methyl) benzonitrile intermediate I-173 (2 g,3.1mmol,1 eq) in MTBE (30 mL) was added anisole (341.2 mg,3.1mmol,342.9uL,1 eq), meOH (4.8 mL) and 4-methylbenzenesulfonic acid (543.3 mg,3.1mmol,1 eq). The mixture was stirred at 50℃for 3 hours. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was diluted with 30mL of ethyl acetate, washed with NaCl (20 mL. Times.3), and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/0 to 3/1), yielding (S) -3-fluoro-5- (((1-hydroxyhexadecan-2-yl) oxy) methyl) benzonitrile intermediate I-174. 1 H NMR (400 MHz, chloroform-d) delta 7.46 (s, 1H), 7.37-7.27 (m, 2H), 4.64 (s, 2H), 3.78-3.73 (m, 1H), 3.65-3.59 (m, 1H), 3.56-3.50 (m, 1H), 1.79 (br s, 1H), 1.67-1.55 (m, 2)H),1.26(s,24H),0.89(t,J＝6.7Hz,3H).MS(ESI):m/z＝414.2[M+Na] +
Intermediate I-175: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((S) scheme 2- ((3-cyano-5-fluorobenzyl) oxy) hexadecyl) phosphate
1H-1,2, 4-triazole (145 mg,2.10mmol,3.92 eq) was dissolved in THF (10.0 mL). TEA (0.30 mL,2.14mmol,4.0 eq.) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.15 mL,0.912mmol,1.70 eq.). The reaction mixture was stirred at room temperature for 8 minutes, and then (3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) was added in one portion][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopentene-4-carbonitrile intermediate I-3a (178 mg,0.536mmol,1.0 eq.) followed by 1-methylimidazole (0.10 mL,1.25mmol,2.34 eq.) was added. The solution was stirred for an additional 8 minutes, then (S) -3-fluoro-5- (((1-hydroxyhexadecan-2-yl) oxy) methyl) benzonitrile intermediate I-174 (210 mg,0.536mmol,1.0 eq.) was added. After stirring overnight at room temperature, the solution was diluted with EtOAc (100 mL) and water (100 mL). The aqueous layer was re-extracted with EtOAc (100 mL). The organic layers were combined, washed with brine, dried over magnesium sulfate, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% ethyl acetate/hexanes) to give the title compound, intermediate 1-175. 1 H NMR (400 MHz, methanol-d 4) delta 7.81-7.78 (m, 1H), 7.48-7.30 (m, 5H), 7.20-7.07 (m, 2H), 6.85-6.80 (m, 1H), 6.78-6.74 (m, 1H), 5.66-5.62 (m, 1H), 5.34-5.27 (m, 1H), 5.17 (d, j=6.6 hz, 0.5H), 5.12 (d, j=6.6 hz, 0.5H), 4.65-4.48 (m, 4H), 4.38-4.27 (m, 1H), 4.20-4.06 (m, 1H), 3.66-3.57 (m, 1H), 1.74-1.69 (m, 3H), 1.58-1.18 (m, 29H), 0.89 (t, j=6.7 hz, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.67- -112.83 (m). 31 P NMR (162 MHz, methanol-d 4)δ-7.40--8.14(m)。MS m/z[M+1]＝895.0
Intermediate I-176: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((S) -2- ((3-cyano-) 5-fluorobenzyl) oxy) hexadecyl) hydrogen phosphate
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopenten-4-yl) methyl (2-chlorophenyl) ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) hexadecyl) phosphate intermediate I-175 (306 mg, 0.348 mmol,1.0 eq.) in THF (10.0 mL) was added 1, 3-tetramethylguanidine (0.09 mL,0.683mmol,2.0 eq.) and cis-2-pyridine aldoxime (250 mg,2.05mmol,6.0 eq.). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-40% MeOH/DCM) to give the title compound as intermediate-176. 1 H NMR (400 MHz, methanol-d 4) delta 7.83 (s, 1H), 7.51-7.48 (m, 1H), 7.43-7.33 (m, 2H), 6.83 (d, j=4.5 hz, 1H), 6.80 (d, j=4.5 hz, 1H), 5.63 (d, j=3.6 hz, 1H), 5.27 (dd, j=6.6, 3.7hz, 1H), 5.13 (d, j=6.6 hz, 1H), 4.73 (d, j=13.0 hz, 1H), 4.49 (d, j=12.9 hz, 1H), 4.16-4.06 (m, 2H), 3.97-3.81 (m, 2H), 3.61-3.53 (m, 1H), 1.69 (s, 3H), 1.48-1.19 (m, 29H), 0.92-0.86 (m, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.95- -113.06 (m). 31 P NMR (162 MHz, methanol-d 4) delta-0.13- -1.09 (m). MS M/z [ M+1 ]]＝785.2
Intermediate I-177 heptadecyl magnesium bromide
At N 2 Next, to a solution of Mg (875.2 Mg,36.0mmol,1.15 eq) in 2-MeTHF (30 mL) was added I 2 (79.5 mg, 313.1. Mu. Mol, 63.1. Mu.L, 0.01 eq) and BrCH 2 CH 2 Br (0.2 mL). A solution of 1-bromoheptadecane (1.0 g,3.1 mmol) in 2-MeTHF (10 mL) was then added dropwise. The mixture was stirred until I 2 Is faded to colorless. A solution of the remaining 1-bromoheptadecane (9.0 g,28.2 mmol) in 2-MeTHF (90 mL) was then added and the mixture stirred at 25℃for 4 hours. The crude product heptadecyl magnesium bromide, intermediate I-177, was a brown liquid (in 2-MeTHF) used in the next step without further purification.
Intermediate I-178 (S) -1- (trityloxy) eicosan-2-ol
Bromine (heptadecyl) magnesium (10.0 g,29.1mmol,1.3 eq) was added via cannula to a mixture of (2S) -2- (trityl) oxirane (7.1 g,22.4mmol,1.0 eq), cuI (213.1 mg,1.1mmol,0.05 eq) in 2-MeTHF (40 mL) at-20 ℃. Stirring vigorously for 5 minutes, heating to 0℃and stirring for 2 hours. By addition of saturated NH 4 The reaction mixture was quenched with Cl solution (200 mL) and the mixture was extracted with ethyl acetate (100 mL. Times.3). By H 2 The combined organic layers were washed with O (150 mL. Times.2) and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (40 g flash column on silica gel, eluent 0-3% ethyl acetate/petroleum ether gradient @80 mL/min) to give compound (S) -1- (tritoxy) eicosan-2-ol intermediate I-178. 1 H NMR (400 MHz, chloroform-d) delta 7.38 (d, j=7.4 hz, 6H), 7.26-7.16 (m, 9H), 3.76-3.65 (m, 1H), 3.12 (dd, j=3.2, 9.3hz, 1H), 2.96 (dd, j=7.8, 9.1hz, 1H), 2.29-2.20 (m, 1H), 1.31 (br s, 2H), 1.25-1.15 (m, 32H), 0.83 (t, j=6.8 hz, 3H).
Intermediate I-179 (S) -3-chloro-5- (((1- (trityl) icosane-2-yl) oxy) methyl) benzonitrile
To a solution of (2S) -1-tritoxyeicosan-2-ol intermediate I-178 (2.5 g,4.5mmol,1.0 eq) in THF (35 mL) at 0deg.C was added NaH (448.9 mg,11.2mmol,60% pure, 2.5 eq) and the mixture stirred at 0deg.C for 30 min. 3- (bromomethyl) -5-chloro-benzonitrile (1.2 g,5.4mmol,1.2 eq) was then added and the mixture stirred at 65℃for 12 hours. At 20℃by addition of saturated NH 4 The reaction mixture was quenched with Cl solution (60 mL) and extracted with ethyl acetate (30 mL. Times.3). The combined organic layers were treated with H 2 O (60 mL. Times.2) washed with Na 2 SO 4 Dried and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (20 g flash column, eluent 0-3% ethyl acetate/petroleum ether gradient @45 mL/min) to give compound (S) -3-chloro-5- (((1- (trityloxy) eicosan-2-yl) oxy) methyl) benzonitrile intermediate I-179. 1 HNMR (400 MHz, chloroform-d) delta 7.53 (s, 1H), 7.48 (s, 1H), 7.45 (s, 1H), 7.43-7.37 (m, 6H), 7.27 (s, 9H), 4.70-4.62 (m, 1H), 4.50 (d, j=12.8 hz, 1H), 3.53-3.41 (m, 1H), 3.17 (d, j=4.9 hz, 2H), 1.53-1.44 (m, 2H), 1.26-1.18 (m, 32H), 0.84 (t, j=6.8 hz, 3H).
Intermediate I-180 (S) -3-chloro-5- (((1-hydroxyeicosan-2-yl) oxy) methyl) benzonitrile
To 3-chloro-5- [ [ (1S) -1- (trityloxymethyl) nonadecyloxy]Methyl group]Benzonitrile, intermediate I-179 (1.9 g,2.7mmol,1.0 eq) in MTBE (40 mL) and MeOH (6 mL) was added anisole (145.4 mg,1.3mmol,146.2uL,0.5 eq) and PTSA (231.6 mg,1.3mmol,0.5 eq) and the mixture was stirred at 50℃for 2 hours. The reaction mixture was taken up in 80mL of saturated NaHCO 3 Diluted and then extracted with ethyl acetate (40 ml×3). By H 2 O (50 mL. Times.2) wash the combined organic layers with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (12g silica gel flash column, eluent 0-8% ethyl acetate/petroleum ether gradient @45 mL/min) to give compound (S) -3-chloro-5- (((1-hydroxyeicosan-2-yl) oxy) methyl) benzonitrile intermediate I-180. 1 H NMR (400 MHz, chloroform-d) delta 7.59 (s, 1H), 7.55 (d, J=2.0 Hz, 2H), 4.62 (s, 2H), 3.75 (dd, J=3.2, 11.6Hz, 1H), 3.65-3.58 (m, 1H), 3.56-3.48 (m, 1H), 1.82 (br s, 1H), 1.64-1.50 (m, 2H), 1.26 (s, 32H), 0.88 (t, J=6.8 Hz, 3H) MS (ESI) m/z=486.2 [ M+Na ]] +
Intermediate I-181: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxacyclopenten-4-yl) methyl ((S) -2- ((3-chloro-5-) Cyanobenzyl) oxy) eicosyl) (2-chlorophenyl) phosphate
1H-1,2, 4-triazole (145 mg,2.10mmol,3.92 eq) was dissolved in THF (10.0 mL). TEA (0.30 mL,2.14mmol,4.0 eq.) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.15 mL,0.912mmol,1.70 eq.). The reaction mixture was stirred at room temperature for 10 minutes, and then (3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) was added in one portion ][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopentene-4-carbonitrile intermediate I-3a (178 mg,0.536mmol,1.0 eq.) followed by 1-methylimidazole (0.10 mL,1.25mmol,2.34 eq.) was added. The solution was stirred for an additional 12 minutes, then (S) -3-chloro-5- (((1-hydroxyeicosan-2-yl) oxy) methyl) benzonitrile intermediate I-180 (249 mg, 0.534 mmol,1.0 eq.) was added. After stirring at room temperature for 2 hours and 20 minutes, the solution was diluted with EtOAc (100 mL) and water (100 mL). The aqueous layer was re-extracted with EtOAc (100 mL). The organic layers were combined, washed with brine, dried over magnesium sulfate, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% ethyl acetate/hexanes) to give the title compound, intermediate 1-181. 1 H NMR (400 MHz, methanol-d 4) delta 7.81-7.78 (m, 1H), 7.65-7.59 (m, 2H), 7.57-7.54 (m,1H),7.46–7.30(m,2H),7.21–7.07(m,2H),6.85–6.80(m,1H),6.79–6.73(m,1H),5.67–5.61(m,1H),5.34–5.26(m,1H),5.17(d,J＝6.6Hz,0.5H),5.12(d,J＝6.6Hz,0.5H),4.64–4.45(m,4H),4.38–4.26(m,1H),4.21–4.06(m,1H),3.66–3.55(m,1H),1.74–1.68(m,3H),1.58–1.17(m,37H),0.93–0.84(m,3H). 31 p NMR (162 MHz, methanol-d 4) delta-7.40- -8.17 (m). MS M/z [ M+1 ]]＝967.1
Intermediate I-182: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxacyclopenten-4-yl) methyl ((S) -2- ((3-chloro-5-) Cyanobenzyl) oxy) eicosyl) hydrogen phosphate
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopenten-4-yl) methyl ((S) -2- ((3-chloro-5-cyanobenzyl) oxy) eicosyl) (2-chlorophenyl) phosphate, intermediate I-181 (354 mg, 0.356 mmol,1.0 eq.) was added to a solution of cis-2-pyridine aldoxime (268 mg,2.19mmol,6.0 eq.) in THF (10.0 mL). The reaction mixture was stirred at room temperature overnight. 1, 3-tetramethylguanidine (0.09 mL,0.731mmol,2.0 eq.) was added and the solution was stirred again at room temperature overnight. The reaction mixture was concentrated in vacuo and purified by silica gel (0-40% MeOH/DCM) to give the title compound as intermediate I-182. 1 H NMR (400 MHz, methanol-d 4) delta 7.83 (s, 1H), 7.66-7.56 (m, 3H), 6.88-6.76 (m, 2H), 5.63 (d, j=3.7 hz, 1H), 5.26 (dd, j=6.6, 3.7hz, 1H), 5.12 (d, j=6.6 hz, 1H), 4.72 (d, j=12.9 hz, 1H), 4.47 (d, j=12.9 hz, 1H), 4.17-4.06 (m, 2H), 3.97-3.81 (m, 2H), 3.61-3.52 (m, 1H), 1.69 (s, 3H), 1.51-1.18 (m, 37H), 0.89 (t, j=6.7 hz, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.28- -1.06 (m). MS M/z [ M+1 ]]＝857.2
Intermediate I-183 (S) -4- ((hexadecyloxy) methyl) -2, 2-dimethyl-1, 3-dioxolane
To 1-Bromohexadecane (5 g,16.3mmol,5.0mL,1 eq) in [ (4S) -2, 2-dimethyl-1, 3-dioxolan-4-yl ]To a solution of KOH (2.3 g,40.9mmol,2.5 eq) and TBAB (1.06 g,3.2mmol,0.2 eq) in methanol (10 g,75.6mmol,9.3mL,4.6 eq) were added. The mixture was stirred at 40℃for 12 hours, with H 2 O (20 mL) was diluted and extracted with ethyl acetate (20 mL. Times.3). The combined organic layers were washed with brine (20 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/1 to 100/5), giving (S) -4- ((hexadecyloxy) methyl) -2, 2-dimethyl-1, 3-dioxolane, intermediate I-183. 1 H NMR (400 MHz, chloroform-d) delta 4.33-4.23 (m, 1H), 4.13-4.02 (m, 1H), 3.80-3.69 (m, 1H), 3.59-3.38 (m, 4H), 1.62-1.51 (m, 2H), 1.46-1.25 (m, 32H), 0.89 (t, J=6.8 Hz, 3H)
Intermediate I-184 (R) -3- (hexadecyloxy) propane-1, 2-diol
(S) -4- ((hexadecyloxy) methyl) -2, 2-dimethyl-1, 3-dioxolane, intermediate I-183 (5.3 g,14.8mmol,1 eq) was dissolved in THF (50 mL), H 2 O (40 mL) and AcOH (63.0 g,1.05mol,60mL,70.5 eq). The mixture was stirred at 50 ℃ for 12 hours and concentrated under high vacuum to remove solvent to give the crude product (R) -3- (hexadecyloxy) propane-1, 2-diol, intermediate I-184. 1 H NMR (400 MHz, chloroform-d) delta 3.90-3.85 (m, 1H), 3.76-3.64 (m, 2H), 3.57-3.43 (m, 4H), 1.63-1.54 (m, 2H), 1.35-1.20 (m, 26H), 0.89 (t, J=6.7 Hz, 3H)
Intermediate I-185 (S) -1- (hexadecyloxy) -3- (triphenylmethoxy) propan-2-ol
(R) -3- (hexadecyloxy) propane-1, 2-diol (5.2 g,14.7mmol,90% purity, 1 eq) was dissolved in DCM (80 mL), then TEA (2.6 g,26.6mmol,3.7mL,1.8 eq) was added and the mixture was stirred at 0deg.C for 0.5 h. TrtCl (3.9 g,14.0mmol,0.9 eq) was then added at 0deg.C. The mixture was stirred at 20deg.C for 12 hours, diluted with DCM (20 mL), and concentrated with H 2 O (50 mL. Times.3) washed with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/1 to 100/6), to give (S) -1- (hexadecyloxy) -3- (triphenylmethoxy) propan-2-ol, intermediate I-185. 1 H NMR (400 MHz, chloroform-d) delta 7.40-7.30 (m, 6H), 7.28-7.13 (m, 9H), 3.94-3.82 (m, 1H), 3.51-3.30 (m, 4H), 3.19-3.04 (m, 2H), 2.33 (d, J=4.5 Hz, 1H), 1.52-1.41 (m, 2H), 1.30-1.10 (m, 26H), 0.81 (t, J=6.8 Hz, 3H)
Intermediate I-186 (S) -3-fluoro-5- (((1- (hexadecyloxy) -3- (triphenylmethoxy) prop-2-yl) oxy) Methyl) benzonitrile
To a solution of (S) -1- (hexadecyloxy) -3- (trityloxy) propan-2-ol, intermediate I-185 (2 g,3.5mmol,615.7uL,1 eq) in THF (30 mL) was added NaH (429.4 mg,10.7mmol,60% purity, 3 eq) at 0deg.C. The mixture was stirred at 0deg.C for 0.5 hours, then 3- (bromomethyl) -5-fluoro-benzonitrile (1.53 g,7.16mmol,2 eq) was added at 0deg.C. The mixture was stirred at 65℃for 12 hours, at 0℃with saturated NH 4 The Cl solution (20 mL) was diluted and extracted with ethyl acetate (30 mL. Times.3). The combined organic layers were washed with brine (20 mL. Times.3), and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/mtbe=100/1 to 15/1), to obtain(S) -3-fluoro-5- (((1- (hexadecyloxy) -3- (trityloxy) propan-2-yl) oxy) methyl) benzonitrile, intermediate I-186. 1 H NMR (400 MHz, chloroform-d) delta 7.50-7.30 (m, 7H), 7.43-7.23 (m, 11H), 4.72 (s, 2H), 3.79-3.71 (m, 1H), 3.64-3.58 (m, 2H), 3.45 (t, J=6.7 Hz, 2H), 3.35-3.23 (m, 2H), 1.35-1.25 (m, 28H), 0.92 (t, J=6.8 Hz, 3H)
Intermediate I-187: (R) -3-fluoro-5- (((1- (hexadecyloxy) -3-hydroxy-propan-2-yl) oxy) methyl) benzyl Nitrile (II)
To a solution of (S) -3-fluoro-5- (((1- (hexadecyloxy) -3- (trityloxy) propan-2-yl) oxy) methyl) benzonitrile intermediate I-186 (1.8 g,2.6mmol,615.7ul,1 eq) in MTBE (30 mL) was added anisole (281.3 mg,2.6mmol,282.7ul,1 eq), meOH (4.8 mL) and 4-methylbenzenesulfonic acid (447.9 mg,2.6mmol,1 eq). The mixture was stirred at 50℃for 6 hours by addition of saturated NH at 0 ℃ 4 The reaction was quenched with Cl 20mL and the mixture was extracted with ethyl acetate (30 mL. Times.3). The combined organic layers were washed with NaCl (20 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/0 to 3/1) to give intermediate I-187. 1 H NMR (400 MHz, chloroform-d) delta 7.47 (s, 1H), 7.37 (d, J=9.0 Hz, 1H), 7.30-7.25 (m, 1H), 4.83-4.64 (m, 2H), 3.85-3.76 (m, 1H), 3.76-3.66 (m, 2H), 3.65-3.55 (m, 2H), 3.50-3.41 (m, 2H), 2.15-2.01 (m, 1H), 1.63-1.50 (m, 2H), 1.40-1.20 (m, 26H), 0.89 (t, J=6.8 Hz, 3H) MS (ESI) m/z=450.2 [ M+H ]] +
Intermediate I-215 (S) - ((2- (benzyloxy) -3- (hexadecyloxy) propoxy) methanetriyl) triphenyl
At 0℃to (S) -1- (hexadecyloxy)) To a solution of 3- (trityloxy) propan-2-ol (3 g,5.3mmol,1 eq) in THF (20 mL) was added NaH (644.2 mg,16.1mmol,60% purity, 3 eq). The mixture was stirred at 0deg.C for 0.5 hours, then benzyl bromide (1.3 g,8.0mmol,956.7uL,1.5 eq) was added to the solution at 0deg.C. The mixture was stirred at 65℃for 12 hours. By addition of saturated NH at 0 DEG C 4 The reaction was quenched in Cl (50 mL) and the mixture was extracted with ethyl acetate (20 mL. Times.3). The combined organic layers were washed with NaCl (20 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/0 to 100/8), to give (S) - ((2- (benzyloxy) -3- (hexadecyloxy) propoxy) methanetriyl) triphenyl, intermediate I-215. 1 H NMR (400 MHz, chloroform-d) delta 7.55-7.40 (m, 6H), 7.45-7.25 (m, 14H), 4.80-4.66 (m, 2H), 3.85-3.77 (m, 1H), 3.71-3.60 (m, 2H), 3.46 (t, J=6.6 Hz, 2H), 3.30 (d, J=5.0 Hz, 2H), 1.60-1.50 (m, 2H), 1.45-1.28 (m, 26H), 0.95 (t, J=6.7 Hz, 3H)
Intermediate I-216 (R) -2- (benzyloxy) -3- (hexadecyloxy) propan-1-ol
To a solution of (S) - ((2- (benzyloxy) -3- (hexadecyloxy) propoxy) methanetriyl) triphenyl, intermediate I-215 (3.3 g,5.0mmol,1 eq) in MTBE (30 mL) was added anisole (549.9 mg,5.0mmol,552.6uL,1 eq), MEOH (4.8 mL) and 4-methylbenzenesulfonic acid (875.6 mg,5.0mmol,1 eq). The mixture was stirred at 50 ℃ for 3 hours and concentrated under reduced pressure to remove the solvent. The residue was diluted with ethyl acetate (30 mL), washed with NaCl (20 mL. Times.3), and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/0 to 100/17) to give intermediate I-216. 1 H NMR (400 MHz, chloroform-d) delta 7.39-7.34 (m, 4H), 7.33-7.28 (m, 1H), 4.79-4.58 (m, 2H), 3.82-3.73 (m, 1H), 3.72-3.65 (m, 2H), 3.64-3.51 (m, 2H), 3.45 (t, J=6.6 Hz, 2H), 2.34-1.93 (m, 1H), 1.63-1.51(m,2H),1.40–1.20(m,26H),0.89(t,J＝6.7Hz,3H).MS(ESI):m/z＝407.3[M+H] +
Intermediate I-217 heptadecyl magnesium bromide
At N 2 Next, add I to a solution of Mg (2.2 g,90.0mmol,1.2 eq) in 2-MeTHF (20 mL) 2 (198.7 mg,782.8umol,157.7uL,0.01 eq) and BrCH 2 CH 2 Br (0.15 mL). A solution of 1-bromoheptadecane (2.5 g,7.8 mmol) in 2-MeTHF (25 ml) was then added dropwise. The mixture was stirred until I 2 Is faded to colorless. A solution of the remaining 1-bromoheptadecane (22.5 g,70.4 mmol) in 2-MeTHF (225 ml) was then added and the mixture stirred at 25℃for 4 hours. D (D) 2 H NMR of the 0-quenched reaction mixture showed the reactants to be consumed. The crude product heptadecyl magnesium bromide (in 2-MeTHF) in the form of a brown liquid was used in the next step without further purification.
Intermediate I-218 (S) -1- (trityloxy) eicosan-2-ol
Bromine (heptadecyl) magnesium (25 g,72.7mmol,1.3 eq) was added via cannula to a mixture of (2S) -2- (trityl) oxirane (17.7 g,56.0mmol,1 eq) and CuI (532.9 mg,2.8mmol,0.05 eq) in 2-MeTHF (100 mL) at-20 ℃. The resulting mixture was vigorously stirred for 5 minutes, warmed to 0 ℃, and then stirred for 2 hours. By addition of saturated NH 4 The reaction was quenched with Cl solution (450 mL) and the mixture was extracted with ethyl acetate (250 mL. Times.3). By H 2 O (500 mL. Times.2) wash the combined organic layers with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (silica gel flash column, eluent 0-4% ethyl acetate/petroleum ether gradient@120 mL/min) to give compound (S) -1- (tritoxy) eicosan-2-ol, intermediate I-218. 1 H NMR (400 MHz, chloroform-d) delta 7.47-7.43 (m, 5H), 7.36-7.21 (m, 10H), 3.77 (br s, 1H), 3.19 (dd, J=3.3, 9.4Hz, 1H), 3.03 (dd, J=7.6, 9.3Hz, 1H), 2.35-2.25 (m, 1H), 1.45-1.20 (m, 34H), 0.89 (t, J=6.8 Hz, 3H)
Intermediate I-219 (S) - (((2- (benzyloxy) eicosyl) oxy) methanetriyl) triphenyl
To a solution of (2S) -1-trityloxyeicosan-2-ol, intermediate I-218 (3.0 g,5.4mmol,1 eq) in THF (30 mL) at 0deg.C was added NaH (646.4 mg,16.2mmol,60% pure, 3 eq). The mixture was stirred at 0deg.C for 0.5 hours, and bromotoluene (bromoxynil) (1.4 g,8.1mmol,959.8uL,1.5 eq) was then added to the solution at 0deg.C. The mixture was stirred at 65℃for 12 hours. By addition of saturated NH at 0 DEG C 4 The reaction was quenched in Cl (60 mL) and the mixture was extracted with ethyl acetate (30 mL. Times.3). The combined organic layers were washed with NaCl (30 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (flash column, eluent 0-3% ethyl acetate/petroleum ether gradient @45 mL/min) to give the compound (S) - (((2- (benzyloxy) eicosyl) oxy) methanetriyl) triphenyl, intermediate I-219. 1 H NMR (400 Mhz, chloroform-d) delta 7.44-7.37 (m, 6H), 7.30-7.13 (m, 14H), 4.66-4.60 (m, 1H), 4.49-4.42 (m, 1H), 3.16-3.10 (m, 1H), 3.10-3.03 (m, 1H), 3.03-2.97 (m, 1H), 1.38-1.34 (m, 2H), 1.28-1.11 (m, 32H), 0.84-0.76 (m, 3H)
Intermediate I-220 (S) -2- (benzyloxy) eicosan-1-ol
To [ [ (2S) -2-benzyloxy-icosaoxy ] groups]-diphenylmethyl group]Benzene, intermediate I-219 (2.9 g)To a solution of 4.5mmol,1 eq) in MeOH (9 mL) and MTBE (60 mL) was added anisole (242.4 mg,2.2mmol,243.6uL,0.5 eq) and PTSA (385.9 mg,2.2mmol,0.5 eq). The resulting mixture was stirred at 50℃for 2 hours by adding saturated NH at 0 ℃ 4 Cl (30 mL) quenched and the mixture extracted with ethyl acetate (15 mL. Times.3). The combined organic layers were washed with NaCl (15 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (Silica Flash Column, eluent 0-3% ethyl acetate/petroleum ether gradient @45 mL/min) to give intermediate I-220. 1 H NMR (400 MHz, chloroform-d) delta 7.42-7.30 (m, 4H), 7.28-7.23 (m, 1H), 4.70-4.65 (m, 1H), 4.61-4.55 (m, 1H), 3.81-3.71 (m, 1H), 3.61-3.48 (m, 2H), 1.74-1.62 (m, 1H), 1.58-1.45 (m, 1H), 1.44-1.22 (m, 32H), 0.96-0.88 (m, 3H) MS (ESI) m/z=427.3 [ M+Na ]] +
Intermediate I-221 (S) - (2-methyl-oxiran-2-yl) methanol
A mixture of 4A MS (25 g,300.0mmol,1 eq) in DCM (800 mL) was cooled to-35℃and then Ti (i-PrO) was added using a syringe 4 (8.5 g,30.0mmol,8.8mL,0.1 eq) in DCM (50 mL) and (2R, 3R) -2, 3-dihydroxysuccinate (10.5 g,45.0mmol,9.4mL,0.15 eq). The mixture was then stirred at-35 ℃ for 30 min, and 2-methylpropan-2-en-1-ol (21.6 g,300mmol,25.3mL,1 eq) in DCM (100 mL) was added to the solution using a syringe followed by cumene hydroperoxide (82.5 g,450.0mmol,79.3mL,83% purity, 1.50 eq). The mixture was stirred at-35 ℃ for 1 hour and then at-20 ℃ in a low temperature bath for 35 hours. Trimethyl phosphite (60 mL) was added dropwise to the solution at-10deg.C to quench excess cumene hydroperoxide. The reaction mixture was then filtered through a short pad of celite to give the crude product (S) - (2-methyl-oxiran-2-yl) methanol, intermediate I-221 (26.4 g, crude), as a pale yellow liquid, which was used for the next reaction without further purification And (3) step (c).
Intermediate I-222 (R) -2-methyl-2- ((tritoxy) methyl) oxirane
To a solution of (S) - (2-methyl-oxiran-2-yl) methanol (6.6 g,74.9mmol,2.5mL,1 eq) in DCM (800 mL) were added TEA (13.6 g,134.8mmol,18.7mL,1.8 eq) and DMAP (1.3 g,11.2mmol,0.15 eq). The mixture was cooled to 0deg.C and TrtCl (73.0 g,262.1mmol,3.5 eq) was added at 0deg.C. The mixture was stirred at 20℃for 24 hours with 10% citric acid (100 mL. Times.3) and H 2 O (100 mL. Times.3) was washed. With Na 2 SO 4 The combined organic layers were dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO 2 Petroleum ether/mtbe=100/1 to 100/2). The residue was further purified by silica gel column chromatography330g/>Silica Flash Column, gradient of 0-8% MTBE/petroleum ether @180 mL/min) to give (R) -2-methyl-2- ((tritoxy) methyl) oxirane, intermediate I-222. 1 H NMR (400 MHz, chloroform-d) delta 7.53-7.45 (m, 6H), 7.40-7.26 (m, 9H), 3.32-3.07 (m, 2H), 2.87 (s, 1H), 2.50 (s, 1H), 1.29 (s, 3H)
Intermediate I-223 (R) -2-methyl-1- (octadecyloxy) -3- (triphenylmethoxy) propan-2-ol
To a solution of (R) -2-methyl-2- ((trityloxy) methyl) oxirane, intermediate I-222 (9.7 g,29.5mmol,1 eq) in DMA (200 mL) was added t-BuOK (6.6 g,59.1mmol,2 eq) and octadecane-1 Alcohol (8 g,29.5mmol,9.8mL,1 eq). The mixture was stirred at 80℃for 12 hours with H 2 O (10 mL) was diluted and extracted with ethyl acetate (100 mL. Times.3). The combined organic layers were washed with NaCl (50 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purifying the residue by silica gel column chromatography220g/>Silica Flash Column the eluent was 0-7% ethyl acetate/petroleum ether gradient @150 mL/min) to give (R) -2-methyl-1- (octadecyloxy) -3- (trityloxy) propan-2-ol, intermediate I-223, as a colourless oil. 1 HNMR (400 MHz, chloroform-d) δ=7.40-7.33 (m, 6H), 7.27-7.12 (m, 9H), 3.43 (d, j=8.9 hz, 1H), 3.36 (t, j=6.6 hz, 2H), 3.31 (d, j=8.9 hz, 1H), 3.03-2.94 (m, 2H), 1.50-1.40 (m, 2H), 1.26-1.15 (m, 30H), 1.13-1.07 (m, 3H), 0.81 (t, j=6.8 hz, 3H)
Intermediate I-224 (R) -3-fluoro-5- (((2-methyl-1- (octadecyloxy) -3- (triphenylmethoxy) propane-2-) Group) oxy) methyl) benzonitrile
To a solution of (R) -2-methyl-1- (octadecyloxy) -3- (trityloxy) propan-2-ol intermediate I-223 (5 g,8.3mmol,615.7uL,1 eq) in THF (80 mL) was added NaH (998.3 mg,24.9mmol,60% purity, 3 eq) at 0deg.C. The mixture was stirred at 0℃for 0.5 hours, and then 3- (bromomethyl) -5-fluoro-benzonitrile (2.6 g,12.4mmol,1.5 eq) was added to the above solution at 0 ℃. The mixture was stirred at 65℃for 12 hours. By addition of saturated NH at 0 DEG C 4 The reaction was quenched with Cl solution (50 mL) and the mixture was extracted with ethyl acetate (80 mL. Times.3). The combined organic layers were washed with NaCl (50 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Passing the residue through siliconPurifying by gel column chromatography80g/>Silica Flash Column the eluent is 0-5% ethyl acetate/petroleum ether gradient @100 mL/min) to give (R) -3-fluoro-5- (((2-methyl-1- (octadecyloxy) -3- (trityloxy) propan-2-yl) oxy) methyl) benzonitrile, intermediate I-224. 1 H NMR (400 MHz, chloroform-d) delta=7.42-7.32 (m, 8H), 7.29-7.09 (m, 10H), 4.43-4.27 (m, 2H), 3.60-3.41 (m, 2H), 3.40-3.32 (m, 2H), 3.19-3.07 (m, 2H), 1.54-1.41 (m, 2H), 1.18 (s, 33H), 0.81 (t, J=6.8 Hz, 3H)
Intermediate I-225 (S) -3-fluoro-5- (((1-hydroxy-2-methyl-3- (octadecyloxy) propan-2-yl) oxy) methyl) Radical) benzonitrile
To a solution of (R) -3-fluoro-5- (((2-methyl-1- (octadecyl) -3- (trityloxy) propan-2-yl) oxy) methyl) benzonitrile, intermediate I-224 (3.3 g,4.5mmol,615.8uL,1 eq) in MTBE (30 mL) was added anisole (243.0 mg,2.2mmol,244.3uL,0.5 eq), meOH (4.8 mL) and PTSA (387.0 mg,2.2mmol,0.5 eq). The mixture was stirred at 50℃for 12 hours with saturated NaHCO 3 (80 mL) was diluted and extracted with ethyl acetate (80 mL. Times.3). The combined organic layers were washed with NaCl (50 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO 2, petroleum ether/ethyl acetate=100/1 to 20/1) to give (S) -3-fluoro-5- (((1-hydroxy-2-methyl-3- (octadecyloxy) propan-2-yl) oxy) methyl) benzonitrile, intermediate I-225. 1 H NMR (400 MHz, chloroform-d) delta=7.49-7.44 (m, 1H), 7.35 (d, J=9.1 Hz, 1H), 7.27-7.23 (m, 1H), 4.69-4.57 (m, 2H), 3.75-3.65 (m, 2H), 3.62-3.49 (m, 2H), 3.48-3.42 (m, 2H), 2.47 (br s, 1H), 1.63-1.53 (m, 2H), 1.45-1.22 (s, 30H), 1.22 (s, 3H), 0.93-0.85 (m, 3H) MS (ESI): m/z＝514.2[M+Na] +
Intermediate I-226:2-chlorophenyl di (1H-1, 2, 4-triazol-1-yl) phosphinate
1H-1,2, 4-triazole (714mg, 10.3 mmol) and TEA (1.44 mL,10.3 mmol) were dissolved in THF (8 mL). To this solution was added dropwise 1-chloro-2-dichlorophosphoryloxy benzene (0.81 mL,4.92 mmol) at room temperature. The reaction mixture was stirred at room temperature for 30 minutes and filtered into a graduated tube, the filter cake was washed with THF (8 mL) and additional THF was added to the filtrate to a total volume of 20mL, yielding a stock solution of intermediate I-226 of about 0.246M, which was used in the next reaction. 31 P NMR (162 MHz, acetonitrile-d) 3 )δ-16.94.
Intermediate I-227: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((S) scheme 2- ((3-cyano-5-fluorobenzyl) oxy) -3- (hexadecyloxy) propyl) phosphate
To a solution of intermediate I-226 (0.246M in THF, 2.23mL,0.549 mmol) was added in one portion intermediate I-3a (171 mg,0.423 mmol) followed by 1-methylimidazole (0.044 mL,0.549 mmol). The reaction mixture was stirred at room temperature for 20 min, and intermediate I-187 (209 mg, 0.460 mmol) in THF (1 mL) was added dropwise. The resulting mixture was stirred for 1 hour, diluted with EtOAc (50 mL) -water (20 mL) -brine (20 mL), stirred for 10 minutes, the layers separated and the aqueous layer extracted with EtOAc (20 mL. Times.3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0-5% MeOH/DCM) to afford intermediate I-227. 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.89-7.78 (m, 1H), 7.55-7.28 (m, 5H), 7.27-7.05(m,2H),6.80-6.75(m,1H),6.76-6.64(m,1H),6.25(s,2H),5.69-5.56(m,1H),5.32 5.19(m,1H),5.14-5.00(m,1H),4.65–4.61(m,2H),4.58–4.43(m,2H),4.39-4.28(m,1H),4.27-4.12(m,1H),3.85–3.65(m,1H),3.53–3.42(m,2H),3.42-3.30(m,2H),1.73-1.62(m,3H),1.57-1.43(m,2H),1.40-1.06(m,29H),0.94–0.82(m,3H). 19 F NMR (376 MHz, acetonitrile-d) 3 )δ-112.79,-112.83。 31 P NMR (162 MHz, acetonitrile-d) 3 )δ-7.25,-7.48。MS m/z[M+1]＝953.6
Intermediate I-228: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ] ][1,3]Dioxolan-4-yl) methyl ((S) -2- ((3-cyano-) 5-fluorobenzyl) oxy) -3- (hexadecyloxy) propyl) hydrogen phosphate
To a solution of intermediate I-227 (276 mg,0.3289 mmol) in THF (5 mL) was added 1, 3-tetramethylguanidine (0.218 mL,1.78 mmol) and cis-2-pyridine aldoxime (143 mg,1.17 mmol). The reaction mixture was stirred at room temperature for 15 hours, diluted with EtOAc (100 mL), washed with saturated aqueous ammonium chloride (25 ml×3), dried over sodium sulfate, concentrated in vacuo, and purified by silica gel (0-60% meoh in DCM) to give intermediate I-228. 1 H NMR (400 MHz, methanol-d 4) delta 7.86 (s, 1H), 7.55 (s, 1H), 7.49-7.42 (m, 1H), 7.42-7.29 (m, 1H), 6.87 (d, j=4.6 hz, 1H), 6.83 (d, j=4.6 hz, 1H), 5.65 (d, j=3.7 hz, 1H), 5.28 (dd, j=6.6, 3.7hz, 1H), 5.15 (d, j=6.5 hz, 1H), 4.74 (d, j=13.3 hz, 1H), 4.62 (d, j=13.2 hz, 1H), 4.18-4.04 (m, 2H), 4.02-3.87 (m, 2H), 3.80-3.68 (m, 1H), 3.54-3.45 (m, 2H), 3.44-3.36 (m, 3.36, 1H), 4.18-4.4 (m, 1H), 3.44 (d, 3.36 (m, 1H), 3.44-3.3 hz, 1H), 1.29 (t, 1H). 19 F NMR (376 MHz, methanol-d 4) delta-113.04. 31 P NMR (162 MHz, methanol-d 4) delta-0.49. MS M/z [ M+1 ]]＝842.9
Intermediate I-235: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((S) -2- (benzyloxy) methyl- 3- (hexadecyloxy) propyl) (2-chlorophenyl) phosphate
/>
To a solution of intermediate I-226 (0.246M in THF, 3.00mL,0.738 mmol) was added in one portion intermediate I-3a (200 mg,0.604 mmol) followed by 1-methylimidazole (0.060 mL,0.785 mmol). The reaction mixture was stirred at room temperature for 10 min, then intermediate I-216 (250 mg, 0.616 mmol) in THF (1 mL) was added dropwise. The resulting mixture was stirred for 1 hour, diluted with EtOAc (50 mL) -brine (40 m), stirred for 10 minutes, separated, and the aqueous layer extracted with EtOAc (20 mL. Times.3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0-5% MeOH/DCM) to give intermediate I-235. 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.90-7.86 (m, 1H), 7.50-7.43 (m, 1H), 7.42-7.36 (m, 1H), 7.35-7.24 (m, 5H), 7.23-7.14 (m, 2H), 6.81-6.72 (m, 2H), 6.28 (s, 2H), 5.70-5.64 (m, 1H), 5.33-5.25 (m, 1H), 5.12-5.02 (m, 1H), 4.62-4.56 (m, 2H), 4.56-4.44 (m, 2H), 4.39-4.31 (m, 1H), 4.26-4.15 (m, 1H), 3.81-3.70 (m, 1H), 3.50-3.42 (m, 2H), 3.42-3.32 (m, 2H), 1.12-5.02 (m, 1H), 4.62-4.56 (m, 2H), 4.56-4.30 (m, 1H), 4.39-4.31 (m, 1H), 3.7-3.42 (m, 1.31 (m, 1H), 1.31-1.7 (m, 1H). 31 P NMR (162 MHz, acetonitrile-d 3) delta-7.31, -7.46.MS M/z [ M+1 ]]＝910.4
Intermediate I-236: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((S) -2- (benzyloxy) methyl- 3- (hexadecyloxy) propyl) hydrogen phosphate
To a solution of intermediate I-235 (304 mg, 0.336 mmol) in THF (5 mL) was added 1, 3-tetramethyleneGuanidine (0.251 mL,2.00 mmol) and cis-2-pyridine aldoxime (165 mg,1.35 mmol). The reaction mixture was stirred at room temperature for 15 hours, diluted with EtOAc (100 mL) -2-propanol (4 mL), washed with saturated aqueous ammonium chloride (25 ml×3), dried over sodium sulfate, concentrated in vacuo, and purified by silica gel (0-60% meoh/DCM) to give intermediate I-236. 1 H NMR (400 MHz, methanol-d 4) delta 7.87 (s, 1H), 7.40-7.19 (m, 5H), 6.92 (d, j=4.6 hz, 1H), 6.85 (d, j=4.6 hz, 1H), 5.66 (d, j=3.7 hz, 1H), 5.25 (dd, j=6.6, 3.7hz, 1H), 5.13 (d, j=6.6 hz, 1H), 4.66 (d, j=11.8 hz, 1H), 4.58 (d, j=11.8 hz, 1H), 4.18-4.07 (m, 2H), 4.03-3.89 (m, 2H), 3.80-3.69 (m, 1H), 3.54-3.42 (m, 2H), 3.41-3.37 (m, 2H), 1.71 (s, 3H), 1.58-1.46 (m, 2.46-1H), 4.03-3.89 (m, 1H), 1.41-3.37 (m, 1H). 31 P NMR (162 MHz, methanol-d 4) delta-0.47. MS M/z [ M+1 ] ]＝800.4
Intermediate I-237: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxol-4-yl) methyl ((S) -2- (benzyloxy) Eicosyl) (2-chlorophenyl) phosphate
To a solution of intermediate I-226 (0.246M in THF, 3.00mL,0.738 mmol) was added in one portion intermediate I-3a (215 mg,0.649 mmol) followed by 1-methylimidazole (0.060 mL,0.844 mmol). The reaction mixture was stirred at room temperature for 10 min, then intermediate I-220 (250 mg,0.618 mmol) in THF (1 mL) was added dropwise. The resulting mixture was stirred for 1 hour, diluted with EtOAc (50 mL) -brine (20 m), stirred for 10 minutes, separated, and the aqueous layer extracted with EtOAc (20 mL. Times.3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0-5% MeOH/DCM) to afford intermediate I-237. 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.96-7.78 (m, 1H), 7.53-7.44 (m, 1H), 7.44-7.35 (m, 1H), 7.32-7.15 (m, 7H), 6.81-6.77 (m, 1H), 6.77-6.70 (m, 1H), 6.26 (s, 2H), 5.70-5.66 (m, 1H), 5.31-5.21 (m, 1H), 5.10 (d, J=6.6 Hz, 0.5H), 5.06(d,J＝6.6Hz,0.5H),4.64–4.38(m,4H),4.35–4.23(m,1H),4.18-4.04(m,1H),3.64-3.50(m,1H),1.75-1.63(m,3H),1.56–1.04(m,37H),0.95–0.79(m,3H). 31 P NMR (162 MHz, acetonitrile-d 3) delta-7.23, -7.44.MS M/z [ M+1]＝908.4
Intermediate I-238: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxol-4-yl) methyl ((S) -2-(benzyloxy) eicosyl) hydrogen phosphate
To a solution of intermediate I-237 (335 mg,0.369 mmol) in THF (5 mL) was added 1, 3-tetramethylguanidine (0.278 mL,2.21 mmol) and cis-2-pyridine aldoxime (183 mg,1.50 mmol). The reaction mixture was stirred at room temperature for 15 hours, diluted with EtOAc (100 mL) -2-propanol (4 mL), washed with saturated aqueous ammonium chloride (25 ml×3), dried over sodium sulfate, concentrated in vacuo, and purified by silica gel (0-60% meoh/DCM) to give intermediate I-238 (277 mg, 94%). 1 H NMR (400 MHz, methanol-d 4) delta 7.87 (s, 1H), 7.36-7.18 (m, 5H), 6.93 (d, j=4.6 hz, 1H), 6.86 (d, j=4.5 hz, 1H), 5.67 (d, j=3.6 hz, 1H), 5.25 (dd, j=6.6, 3.7hz, 1H), 5.14 (d, j=6.6 hz, 1H), 4.67 (d, j=11.6 hz, 1H), 4.47 (d, j=11.6 hz, 1H), 4.22-4.09 (m, 2H), 3.90 (t, j=5.5 hz, 2H), 3.61-3.52 (m, 1H), 1.71 (s, 3H), 1.52-1.13 (m, 37H), 0.97-0.82 (m, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.37. MS M/z [ M+1 ]]＝798.3
Intermediate I-239: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((3-cyano-5-fluorobenzyl) oxy) -2-methyl-3- (octadecyloxy) propyl) phosphate
/>
To a solution of intermediate I-226 (0.246M in THF, 2.77mL,0.683 mmol) was added in one portion intermediate I-3a (185 mg, 0.5538 mmol) followed by 1-methylimidazole (0.058 mL,0.726 mmol). The reaction mixture was stirred at room temperature for 10 min, then intermediate I-225 (250 mg,0.508 mmol) in THF (1 mL) was added dropwise. The resulting mixture was stirred for 1 hour, diluted with EtOAc (50 mL) -brine (40 m), stirred for 10 minutes, separated, and the aqueous layer extracted with EtOAc (20 mL. Times.3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel chromatography (0-5% MeOH/DCM) to give intermediate I-239 (288 mg, 52%). 1 H NMR (400 MHz, acetonitrile-d 3) delta 7.87 (s, 1H), 7.52-7.42 (m, 2H), 7.40-7.32 (m, 3H), 7.25-7.13 (m, 2H), 6.86-6.76 (m, 1H), 6.75-6.69 (m, 1H), 6.26 (s, 2H), 5.69-5.64 (m, 1H), 5.33-5.26 (m, 1H), 5.15-5.05 (m, 1H), 4.61-4.39 (m, 4H), 4.23 (d, J=6.1 Hz, 1H), 4.18 (d, J=5.9 Hz, 1H), 3.51-3.43 (m, 1H), 3.41-3.26 (m, 3H), 1.72 (s, 3H), 1.55-1.45 (m, 2H), 1.38 (m, 1H), 4.61-4.39 (m, 1H), 4.23 (d, 1.9 Hz, 1H), 4.18 (d, 1.9 Hz, 1H), 3.51-3.43 (m, 1H), 1.20-5.20 (s, 1.20.5H). 31 P NMR (162 MHz, acetonitrile-d 3) delta-7.48, -7.53.MS M/z [ M+1 ] ]＝995.6.
Intermediate I-240: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- ((3-cyano-) 5-Fluorobenzyl) oxy) -2-methyl-3- (octadecyloxy) propyl) hydrogen phosphate
To a solution of intermediate I-239 (288 mg,0.289 mmol) in THF (5 mL) was added 1, 3-tetramethylguanidine (0.218 mL,1.74 mmol) and cis-2-pyridine aldoxime (143 mg,1.17 mmol). The reaction mixture was stirred at room temperature for 15 hours, diluted with EtOAc (100 mL) -2-propanol (10 mL), washed with saturated aqueous ammonium chloride (25 ml×3), dried over sodium sulfate, concentrated in vacuo, and purified by silica gel (0-60% meoh/DCM) to give intermediate I-240 (224 mg, 100%). 1 H NMR (400 MHz, methanol-d 4) delta 7.93 (s, 1H), 7.53 (s, 1H), 7.48-7.42 (m, 1H), 7.37-7.30 (m, 1H), 7.03 (d, j=4.6 hz, 1H), 6.90 (d, j=4.6 hz, 1H), 5.66 (d, j=3.6 hz, 1H), 5.26 (dd, j=6.6, 3.7hz, 1H), 5.17 (d, j=6.6 hz, 1H), 4.66 (s, 2H), 4.18-4.06 (m, 2H), 4.04-3.91 (m, 2H), 3.52-3.45 (m, 2H), 3.45-3.38 (m, 2H), 1.71 (s, 3H), 1.60-1.50 (m, 2H), 1.40 (s, 3.36-3.6 hz, 1H), 4.66 (s, 2H), 4.18-4.06 (m, 2H), 4.04-3.91 (m, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.67. MS M/z [ M+1 ]]＝885.3
Intermediate I-245 (S) -3-fluoro-5- ((1- (trityl) eicosan-2-yl) oxy) benzonitrile
To a solution of (2R) -1-trityloxyeicosan-2-ol (3 g,5.39mmol,1 eq) in THF (50 mL) was added 3-fluoro-5-hydroxy-benzonitrile (1.11 g,8.08mmol,1.5 eq) and PPh 3 (1.70 g,6.46mmol,1.2 eq). The mixture was cooled to 0deg.C and DIAD (1.31 g,6.46mmol,1.26mL,1.2 eq) was added to the solution. The mixture was stirred at 20 ℃ for 12 hours. TLC indicated that reactant 1 was consumed and a new spot formed. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was taken up in H 2 O (30 mL) was diluted and extracted with ethyl acetate (50 mL. Times.3). The combined organic layers were washed with NaCl (30 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/1 to 100/6) to give intermediate I-245. 1 H NMR (400 MHz, chloroform-d) delta 7.42 (d, j=7.2 hz, 6H), 7.37-7.24 (m, 10H), 7.04 (s, 1H), 7.00-6.89 (m, 2H), 4.48-4.25 (m, 1H), 3.43-3.22 (m, 2H), 1.75-1.65 (m, 2H), 1.33-1.24 (m, 32H), 0.92 (t, j=6.7 hz, 3H).
Intermediate I-246 (S) -3-fluoro-5- ((1-hydroxyeicosan-2-yl) oxy) benzonitrile
To a solution of (S) -3-fluoro-5- ((1- (trityloxy) hexadecan-2-yl) oxy) benzonitrile, intermediate I-245 (2.4 g,3.6mmol,1 eq) in MTBE (30 mL) was added anisole (388.7 mg,3.6mmol,390.7uL,1 eq), meOH (4.8 mL) and 4-methylbenzenesulfonic acid (619.0 mg,3.6mmol,1 eq). The mixture was stirred at 50℃for 3 hours. TLC indicated the reaction was consumed and a new spot formed. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was taken up in H 2 O (30 mL) was diluted and extracted with ethyl acetate (50 mL. Times.3). The combined organic layers were washed with NaCl (30 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/0 to 100/9), to give (S) -3-fluoro-5- ((1-hydroxyeicosan-2-yl) oxy) benzonitrile intermediate I-246. 1 H NMR (400 MHz, chloroform-d) delta 7.03 (s, 1H), 7.00-6.88 (m, 2H), 4.41-4.31 (m, 1H), 3.89-3.72 (m, 2H), 1.76 (br s, 1H), 1.71-1.62 (m, 2H), 1.43-1.21 (m, 32H), 0.89 (t, J=6.8 Hz, 3H) MS (ESI) m/z=434.2 [ M+H)] +
Intermediate I-247: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((S) scheme 2- (3-cyano-5-fluorophenoxy) eicosyl) phosphate
1H-1,2, 4-triazole (138 mg,2 mmol) was dissolved in THF (6.0 mL). TEA (0.21 mL,1.5 mmol) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (156 mg,0.63 mmol). The reaction mixture was stirred at room temperature for 6 minutes, and then (3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) was added in one portion][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofurano [3,4-d ][1,3]Dioxacyclopentene-4-carbonitrile intermediate I-3a (191 mg,0.58 mmol) was then added 1-methylimidazole (0.1 mL,1.38 mmol). The solution was stirred for an additional 17 minutes and then (S) -2 was added- (quinolin-2-ylmethoxy) eicosan-1-ol, intermediate I-246 (250 mg,0.58mmol,1 eq.). After stirring at room temperature for 20 min, the solution was diluted with EtOAc (50 mL) and water (50 mL). The organic layer was separated, washed with brine (5 mL), dried over magnesium sulfate, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% ethyl acetate/hexanes) to give intermediate I-247. 1 H NMR (400 MHz, methanol-d 4) delta 7.82 (d, j=3.4 hz, 1H), 7.41 (ddt, j=7.9, 5.1,1.2hz, 1H), 7.28 (ddt, j=8.5, 7.3,1.4hz, 1H), 7.17-7.01 (m, 5H), 6.86 (dd, j=6.6, 4.5hz, 1H), 6.79 (dd, j=4.5, 1.9hz, 1H), 5.67 (dd, j=6.3, 3.0hz, 1H), 5.33 (dd, j=6.5, 3.0hz, 1H), 5.18 (dd, j=6.6, 3.9hz, 1H), 4.56 (dd, j=25.1, 12.5,10.0,6.1hz, 3H), 4.37 (dd, j=4.5, 1.9hz, 1H), 5.67 (dd, 1.0 hz, 1.7 hz, 1H), 5.33 (dd, j=6.5, 3.0hz, 1H), 5.7.7 hz, 1H). 31 P NMR (162 MHz, methanol-d 4) delta-7.99 (dt, J=28.7, 7.0 Hz.) MS (ESI): m/z=434.2 [ M+H ]] +
Intermediate I-248 ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((S) -2- (3-cyano-) 5-fluorophenoxy) eicosyl) hydrogen phosphate
To a solution of intermediate I-247 (190 mg,0.2 mmol) in THF (5.0 mL) was added 1, 3-tetramethylguanidine (0.15 mL,1.22 mmol) and cis-2-pyridine aldoxime (248 mg,2 mmol). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-50% meoh in DCM) to give intermediate I-248.MS (ESI) m/z=827.2 [ M+H ]] +
Intermediate I-249, dodecyl magnesium bromide
At N 2 Next, to a solution of Mg (1.7 g,69.2mmol,1.2 eq) in 2-Me THF (30 ml) was added I 2 (152.8 mg,601.9umol, 121.2. Mu.L, 0.01 eq) and BrCH 2 CH 2 Br (0.2 mL). 1-bromododecane (1.5 g,6.0 mmol) in 2-Me THF (15 ml) was then added dropwise. The mixture was stirred until I 2 Is faded to colorless. A solution of the remaining 1-bromododecane (13.5 g,54.2 mmol) in 2-Me THF (135 ml) was then added and the mixture stirred at 25℃for 4 hours. The crude product magnesium dodecyl bromide in the form of a brown liquid, intermediate I-249 (in 2-Me THF) was used in the next step without further purification.
Intermediate I-250 (S) -1- (triphenylmethoxy) pentadec-2-ol
Bromine (dodecyl) magnesium intermediate I-249 (15.0 g,54.8mmol,1.3 eq.) was added via cannula to a mixture of (2S) -2- (trityl) oxirane (13.4 g,42.2mmol,1.0 eq.), cuI (401.7 mg,2.1mmol,0.05 eq.) in 2-Me THF (100 mL) over 10 minutes at-20 ℃. Stirring vigorously for 5 minutes, heating to 0℃and stirring for 2 hours. TLC indicated complete consumption of the reaction, and two new spots formed. By addition of saturated NH 4 Cl solution (300 mL) and then the mixture was extracted with ethyl acetate (150 mL. Times.3). By H 2 The combined organic layers were washed with O (350 mL. Times.2) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (50 g flash column on silica gel, eluent 0-4% ethyl acetate/petroleum ether gradient @120 mL/min) to give compound (S) -1- (tritoxy) pentadecan-2-ol, intermediate I-250. 1 H NMR (400 MHz, chloroform-d) delta 7.38 (br d, j=7.5 hz, 6H), 7.27 (br s, 9H), 3.71 (br d, j=3.0 hz, 1H), 3.12 (dd, j=3.1, 9.3hz, 1H), 3.01-2.92 (m, 1H), 2.25 (d, j=2.8 hz, 1H), 1.32 (br s, 2H), 1.27-1.11 (m, 22H), 0.82 (br t, j=6.7 hz, 3H).
Intermediate I-251 (S) -3-fluoro-5- (((1- (tri))Benzyl methoxy) pentadec-2-yl) oxy) methyl) benzonitrile
To a solution of (2S) -1-tritylpentadecan-2-ol, intermediate I-250 (3.5 g,7.2mmol,1.0 eq) in THF (50 mL) at 0deg.C was added NaH (719.0 mg,18.0mmol,60% pure, 2.5 eq) and the mixture stirred at 0deg.C for 30 min. 3- (bromomethyl) -5-fluoro-benzonitrile (1.9 g,9.0mmol,1.3 eq) was then added and the mixture stirred at 65℃for 12 hours. At 20℃by addition of saturated NH 4 The reaction mixture was quenched with Cl solution (100 mL) and extracted with ethyl acetate (50 mL. Times.3). The combined organic layers were treated with H 2 O (120 mL. Times.2) washed with Na 2 SO 4 Dried and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (20 g flash column, eluent 0-3% ethyl acetate/petroleum ether gradient @45 mL/min) to give compound (S) -3-fluoro-5- (((1- (tritoxy) pentadec-2-yl) oxy) methyl) benzonitrile intermediate I-251. 1 H NMR (400 MHz, chloroform-d) delta 7.41-7.32 (m, 7H), 7.27-7.13 (m, 11H), 4.64 (d, J=12.9 Hz, 1H), 4.51-4.44 (m, 1H), 3.48-3.40 (m, 1H), 3.14 (d, J=4.8 Hz, 2H), 1.46 (br d, J=4.1 Hz, 2H), 1.25-1.13 (m, 22H), 0.81 (t, J=6.7 Hz, 3H)
Intermediate I-252 (S) -3-fluoro-5- (((1-hydroxypentadec-2-yl) oxy) methyl) benzonitrile
To 3-fluoro-5- [ [ (1S) -1- (trityl) tetradecyloxy) ]Methyl group]Benzonitrile, intermediate I-251 (2.7 g,4.4mmol,1.0 eq) in MTBE (54 mL) and MeOH (7.5 mL) was added anisole (235.5 mg,2.2mmol,236.7uL,0.5 eq) and PTSA (375.1 mg,2.2mmol,0.5 eq) and the mixture stirred at 50℃for 2 hours. TLC indicated complete consumption of reactant 5A and formation of many new spots. The reaction mixture was saturated with 80mL of NaHCO 3 Diluted and then extracted with ethyl acetate (40 ml×3). By H 2 O (50 mL. Times.2) wash the combined organic layers with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash chromatography on silica gel (20 g flash column on silica gel, eluent 0-8% ethyl acetate/petroleum ether gradient @45 mL/min) to give the compound (S) -3-fluoro-5- (((1-hydroxypentadec-2-yl) oxy) methyl) benzonitrile, intermediate I-252. 1 H NMR (400 MHz, chloroform-d) delta 7.47 (br s, 1H), 7.36 (br d, j=8.9 hz, 1H), 7.32-7.26 (m, 1H), 4.66 (s, 2H), 3.77 (br dd, j=3.1, 11.5hz, 1H), 3.67-3.52 (m, 2H), 1.85 (br s, 1H), 1.67-1.57 (m, 2H), 1.28 (br s, 22H), 1.01-0.85 (m, 3H).
Intermediate I-253: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((S) scheme 2- ((3-cyano-5-fluorobenzyl) oxy) pentadecyl) phosphate
1H-1,2, 4-triazole (131 mg,1.9 mmol) was dissolved in THF (6.0 mL). TEA (0.20 mL,1.45mmol,2.65 eq.) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (148 mg,0.60 mmol). The reaction mixture was stirred at room temperature for 6 minutes, and then (3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) was added in one portion][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopentene-4-carbonitrile intermediate I-3a (182 mg,0.55 mmol) was then added 1-methylimidazole (0.06 mL,0.70mmol,1.3 eq). The solution was stirred for an additional 17 minutes, then (S) -2- (quinolin-2-ylmethoxy) eicosan-1-ol, intermediate I-252 (250 mg,0.54mmol,1 eq.) was added. After stirring at room temperature for 20 min, the solution was diluted with EtOAc (50 mL) and water (50 mL). The organic layers were combined, washed with brine (5 mL), dried over magnesium sulfate, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% ethyl acetate/hexanes) to give the intermediateBody I-253. 1 H NMR (400 MHz, methanol-d 4) delta 7.83 (d, j=5.8 hz, 1H), 7.58-7.32 (m, 5H), 7.28-7.06 (m, 2H), 6.94-6.74 (m, 2H), 5.68 (dd, j=3.0, 1.2hz, 1H), 5.34 (td, j=6.8, 3.0hz, 1H), 5.18 (dd, j=18.5, 6.6hz, 1H), 4.63-4.49 (m, 3H), 4.14 (q, j=7.2 hz, 4H), 2.05 (s, 6H), 1.32-1.26 (m, 24H), 0.93 (t, j=6.8 hz, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-7.76 (dt, J=48.8, 7.2 Hz.) MS (ESI): m/z=881.2 [ M+H)]+
Intermediate I-254: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((S) -2- ((3-cyano-) 5-fluorobenzyl) oxy) pentadecyl hydrogen phosphate
To a solution of intermediate I-253 (135 mg,0.14 mmol) in THF (5.0 mL) was added 1, 3-tetramethylguanidine (0.1 mL,0.84 mmol) and cis-2-pyridine aldoxime (172 mg,1.4 mmol). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-50% meoh in DCM) to give intermediate I-254.MS (ESI) m/z=771.3 [ M+H ]] +
Intermediate I-255: (S) -4- ((hexadecyloxy) methyl) -2, 2-dimethyl-1, 3-dioxolane
To 1-Bromohexadecane (5 g,16.3mmol,5.0mL,1 eq) in [ (4S) -2, 2-dimethyl-1, 3-dioxolan-4-yl]To a solution of methanol (10.0 g,75.6mmol,9.3mL,4.6 eq) was added KOH (2.3 g,40.9mmol,2.5 eq) and TBAB (1.0 g,3.2mmol,0.2 eq). The mixture was stirred at 40℃for 12 hours. TLC indicated that reactant 1 was consumed and a new spot formed. The reaction mixture was treated with 100mL NH 4 Cl was diluted and extracted with ethyl acetate (80 mL. Times.3). The combined organic layers were washed with NaCl (50 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/1 to 100/5), to obtain (S) -4- "as colorless oil(hexadecyloxy) methyl) -2, 2-dimethyl-1, 3-dioxolane, intermediate I-255 (13.5 g,3 g). 1 H NMR (400 MHz, chloroform-d) delta 4.35-4.16 (m, 1H), 4.09-4.01 (m, 1H), 3.78-3.68 (m, 1H), 3.54-3.38 (m, 4H), 1.61-1.52 (m, 2H), 1.42 (s, 3H), 1.36 (s, 3H), 1.25 (s, 26H), 0.88 (t, J=6.8 Hz, 3H).
Intermediate I-256 (R) -3- (hexadecyloxy) propane-1, 2-diol
To a solution of (S) -4- ((hexadecyloxy) methyl) -2, 2-dimethyl-1, 3-dioxolane, intermediate I-255 (5 g,14.0mmol,1 eq) in THF (50 mL) was added AcOH (63.0 g,1.0mol,60.0mL,74.8 eq) and H 2 O (40.0 g,2.2mol,40mL,158.3 eq). The mixture was stirred at 50℃for 6 hours. TLC indicated complete consumption of reactant 2 and formation of a new spot. The reaction mixture was concentrated under reduced pressure to remove THF at 50 ℃. 50mL of Tol was then added to the reaction and concentrated under reduced pressure at 50deg.C to remove AcOH and H 2 O, to give (R) -3- (hexadecyloxy) propane-1, 2-diol, intermediate I-256 (13 g,3 batch) as a white solid. 1 H NMR (400 MHz, chloroform-d) delta 3.94-3.80 (m, 1H), 3.76-3.61 (m, 2H), 3.56-3.38 (m, 4H), 1.67-1.49 (m, 2H), 1.26 (s, 26H), 0.95-0.83 (m, 3H).
Intermediate I-257 (S) -1- (hexadecyloxy) -3- (triphenylmethoxy) propan-2-ol
(R) -3- (hexadecyloxy) propane-1, 2-diol, intermediate I-2567 (7 g,19.9mmol,90% purity, 1 eq) was dissolved in DCM (80 mL), TEA (3.6 g,35.8mmol,4.9mL,1.8 eq) was added and stirred at 0deg.C for 0.5 h. Trityl chloride (5.2 g,18.9mmol,0.9 eq) was added at 0deg.C. The mixture was stirred at 20℃for 12 hours. TLC indicated that reactant 3 was consumed and a new spot formed. The reaction mixture was diluted with 50mL of DCM,by H 2 O (50 mL. Times.3) washed with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/1 to 100/6), to give (S) -1- (hexadecyloxy) -3- (triphenylmethoxy) propan-2-ol, intermediate I-257 (12 g,2 batches) as a white solid. 1 H NMR (400 MHz, chloroform-d) delta 7.44-7.38 (m, 6H), 7.27 (s, 13H), 3.96-3.88 (m, 1H), 3.53-3.31 (m, 4H), 3.23-3.12 (m, 2H), 2.02 (s, 1H), 1.29-1.20 (m, 26H), 0.89-0.82 (m, 3H)
Intermediate I-258 (S) -3-chloro-5- (((1- (hexadecyloxy) -3- (triphenylmethoxy) prop-2-yl) oxy) Methyl) benzonitrile
To a solution of (S) -1- (hexadecyloxy) -3- (trityloxy) propan-2-ol, intermediate I-257 (3 g,5.3mmol,1 eq) in THF (20 mL) was added NaH (644.2 mg,16.1mmol,60% purity, 3 eq) at 0deg.C. The mixture was stirred at 0℃for 0.5 hours, and then 3- (bromomethyl) -5-chloro-benzonitrile (1.8 g,8.0mmol,1.5 eq) was added to the above solution at 0 ℃. The mixture was stirred at 65℃for 12 hours. TLC indicated complete consumption of reactant 4 and formation of a new spot. At 0℃by addition of saturated NH 4 Cl (50 mL) quenched the reaction mixture and extracted with ethyl acetate (30 mL. Times.3). The combined organic layers were washed with NaCl (30 mL. Times.3) and with Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/MTBE=100/0 to 100/8), to give (S) -3-chloro-5- (((1- (hexadecyloxy) -3- (trityloxy) propan-2-yl) oxy) methyl) benzonitrile, intermediate I-258. 1 H NMR (400 MHz, chloroform-d) delta 7.64 (s, 1H), 7.56 (s, 2H), 7.48 (d, J=7.5 Hz, 6H), 7.37-7.25 (m, 11H), 4.70 (s, 2H), 3.80-3.70 (m, 1H), 3.61 (d, J=5.3 Hz, 2H), 3.45 (t, J=6.7 Hz, 2H), 3.36-3.22 (m, 2H), 1.42-1.19 (m, 28H), 0.92 (t, J=6.7 Hz, 3H)
Intermediate I-259: (R) -3-chloro-5- (((1- (hexadecyloxy) oxy)) -3-hydroxy-prop-2-yl) oxy) methyl) benzyl Nitrile (II)
To a solution of (S) -3-chloro-5- (((1- (hexadecyloxy) -3- (trityloxy) propan-2-yl) oxy) methyl) benzonitrile intermediate I-258 (3 g,4.2mmol,1 eq) in MTBE (30 mL) was added anisole (457.9 mg,4.2mmol,460.2ul,1 eq), meOH (4.8 mL) and 4-methylbenzenesulfonic acid (729.2 mg,4.2mmol,1 eq). The mixture was stirred at 50℃for 3 hours. TLC indicated complete consumption of reactant 5 and formation of a new spot. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was diluted with 30mL of ethyl acetate, washed with NaCl (20 mL. Times.3), and dried over Na 2 SO 4 Dried, filtered and concentrated under reduced pressure to give a residue. Purification of the residue by column chromatography (SiO 2 Petroleum ether/ethyl acetate=100/0 to 100/8), to give (R) -3-chloro-5- (((1- (hexadecyloxy) -3-hydroxypropan-2-yl) oxy) methyl) benzonitrile, intermediate I-259. 1 H NMR (400 MHz, chloroform-d) delta 7.61 (s, 1H), 7.59-7.53 (m, 2H), 4.80-4.65 (m, 2H), 3.84-3.76 (m, 1H), 3.75-3.66 (m, 2H), 3.64-3.55 (m, 2H), 3.49-3.42 (m, 2H), 2.20-2.00 (m, 1H), 1.63-1.54 (m, 2H), 1.37-1.22 (m, 26H), 0.93-0.83 (m, 3H) MS (ESI) m/z=466.2 [ M+H ]] +
Intermediate I-260: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((S) scheme 2- ((3-cyano-5-fluorobenzyl) oxy) -3- (hexadecyloxy) propyl) phosphate
1H-1,2, 4-triazole (128 mg,1.86 mmol) was dissolved in THF (6.0 mL). TEA (0.20 mL,1.42 mmol) was added to the solution followed by 2-chlorophenyl phosphorus dichloride (0.10 mL,0.59 mmol). The reaction mixture was stirred at room temperature for 6 minutes, and then (3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f) was added in one portion][1,2,4]Triazin-7-yl) -4- (hydroxymethyl) -2, 2-dimethyltetrahydrofurano [3,4-d ][1,3]Dioxacyclopentene-4-carbonitrile intermediate I-3a (178 mg,0.54 mmol) was followed by 1-methylimidazole (0.1 mL,1.3 mmol). The solution was stirred for an additional 17 minutes, then (R) -3-chloro-5- (((1- (hexadecyloxy) -3-hydroxypropan-2-yl) oxy) methyl) benzonitrile, intermediate I-259 (250 mg,0.54mmol,1 eq.) was added. After stirring at room temperature for 20 min, the solution was diluted with EtOAc (50 mL) and water (50 mL). The aqueous layer was re-extracted with EtOAc (50 mL). The organic layers were combined, washed with brine (5 mL), dried over magnesium sulfate, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-100% ethyl acetate/hexanes) to give intermediate I-260. 1 H NMR (400 MHz, methanol-d 4) delta 7.83 (d, j=5.0 hz, 1H), 7.67-7.61 (m, 3H), 7.49-7.41 (m, 1H), 7.37 (tt, j=8.7, 3.1hz, 1H), 7.22-7.11 (m, 2H), 6.86 (dd, j=7.1, 4.5hz, 1H), 6.79 (dd, j=4.5, 1.7hz, 1H), 5.67 (d, j=3.0 hz, 1H), 5.33 (ddd, j=7.3, 4.7,3.0hz, 1H), 5.17 (dd, j=17.2, 6.6hz, 1H), 4.66 (d, j=2.3 hz, 2H), 4.57 (dd, j=13.3, 11.4,6.5hz, 62.43, 62, 4.38 hz), 5.67 (d, 3.0hz, 1H), 5.33 (dd, 3.7, 3.0hz, 1H), 5.7 (dd, 3.7, 3.0hz, 1H), 5.17 (dd, 3.7, 3H), 4.17 (dd, 6.6hz, 1H), 4.7, 3H), 4.7 (dd, 3.7, 3hz, 3.3H), 4.7 (dd, 3.7). 31 P NMR (162 MHz, methanol-d 4) delta-7.78 (dt, J=38.1, 7.2 Hz.) MS (ESI): m/z=969.1 [ M ]] +
Intermediate I-261: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((S) -2- ((3-cyano-) 5-fluorobenzyl) oxy) -3- (hexadecyloxy) propyl) hydrogen phosphate
To a solution of intermediate I-260 (110 mg,0.119mmol,1.0 eq.) in THF (5.0 mL) was added 1, 3-tetramethylguanidine (0.09 mL, 0.715)mmol,6.0 equivalents) and cis-2-pyridine aldoxime (90 mg,0.737mmol,6.19 equivalents). The reaction mixture was stirred at room temperature overnight. The solution was concentrated in vacuo and purified by silica gel (0-50% meoh in DCM) to give intermediate I-261.MS (ESI) m/z=860.2 [ M+H ]] +
Intermediate I-262 (R) -1- (pentadecyloxy) -3- (trityloxy) propan-2-ol
To a solution of pentadecan-1-ol (5.00 g,21.8mmol,1.00 eq) in DMF (100 mL) was added t-BuOK (3.68 g,32.8mmol,1.50 eq) followed by (R) -2- ((trityloxy) methyl) oxirane (13.8 g,43.7mmol,2.00 eq) at room temperature. The reaction mixture was stirred at 100℃for 2 hours. Water (100 mL) was added at 25℃and extracted with EtOAc (100 mL). The organic layer was purified by Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=50/1 to 20/1) to give the title compound. TLC rf=0.70 (eluent: petroleum ether/ethyl acetate=4/1).
Intermediate I-263 (R) -3-fluoro-5- (((1- (pentadecyloxy) -3- (triphenylmethoxy) prop-2-yl) oxy) Methyl) benzonitrile
To a solution of (R) -1- (pentadecyloxy) -3- (trityloxy) propan-2-ol (5.00 g,9.19mmol,1.00 eq) in THF (50 mL) was added NaH (1.84 g,45.9mmol,60.0% purity, 5.00 eq) in small portions at room temperature. The solution was stirred for 0.5 hours. To the mixture was added dropwise a solution of 3- (bromomethyl) -5-fluorobenzonitrile (2.95 g,13.7mmol,1.50 eq) in DMF (100 mL) and stirring was continued for 12 hours. With saturated NH 4 The reaction was quenched with Cl (50.0 mL) and extracted with ethyl acetate (50.0 mL. Times.2). The organic layer was purified by Na 2 SO 4 Drying and concentrating. The crude product was purified by silica gel chromatography (petroleum ether/etoac=1/0 to 0/1) to give the title compound. TLC rf=0.80 (eluent: petroleum ether/ethyl acetate=5/1).
Intermediate I-264 (S) -3-fluoro-5- (((1-hydroxy-3- (pentadecyloxy) propan-2-yl) oxy) methyl) benzyl Synthesis of nitriles
To a mixture of (R) -3-fluoro-5- (((1- (pentadecyloxy) -3- (trityloxy) propan-2-yl) oxy) methyl) benzonitrile (3.60 g,5.31mmol,1.00 eq) in MeOH (14.4 mL) and i-PrOH (14.4 mL) was added HCl (12.0M, 10.0mL,22.8 eq) and stirred at 55deg.C for 1 hour. Pouring the solution into H 2 O (10.0 mL) was extracted with EtOAc (10.0 mL. Times.2). The combined organic layers were washed with saturated NaHCO 3 (10.0 mL) followed by washing with brine and Na 2 SO 4 And (5) drying. The solvent was concentrated in vacuo and the crude residue purified by silica gel chromatography (petroleum ether/etoac=1/0 to 0/1) to give the title compound. 1 H NMR (400 MHz, chloroform-d) delta 7.46 (s, 1H), 7.36 (d, j=8.0 hz, 1H), 7.27 (t, j=8.0 hz, 1H), 4.68-4.72 (m, 2H), 3.78-3.80 (m, 1H), 3.70-3.72 (m, 2H), 3.59-3.69 (m, 2H), 3.43-3.58 (m, 2H), 1.59 (s, 1H), 1.54-1.57 (m, 2H), 1.25-1.33 (m, 24H), 0.88 (t, j=8.0 hz, 3H); MS M/z [ M+1]]＝436.2
Intermediate I-265: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 6-cyano-2, 2-dimethyltetrahydrofuran [3,4-d ]][1,3]Dioxolan-4-yl) methyl (2-chlorophenyl) ((R) scheme 2- ((3-cyano-5-fluorobenzyl) oxy) -3- (pentadecyloxy) propyl) phosphate
(S) -3-fluoro-5- (((1-hydroxy-3- (pentadecyloxy) propan-2-yl) oxy) methyl) benzonitrile (0.12 mg,0.275 mmol) and ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2,1-f ] [1,2,4] triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d ] [1,3] dioxol-4-yl) methyl (2-chlorophenyl) phosphate (216 mg,0.413 mmol) were placed in a 20mL vial and dried in vacuo (1 hour). To this mixture was added DCM (4 mL), NMI (0.09 mg,1.1 mmol), TEA (77 uL, 0.553mmol) and Bop-Cl (0.281mg, 1.10 mmol) in this order. The reaction was stirred at room temperature overnight. The solvent was concentrated under reduced pressure and the crude product was dissolved in 20% meoh/DCM, loaded onto a 40g column, eluted with 100% hexane for 2 min, 0-100% etoac for 6 min and 100% etoac for 6 min. The product was eluted in 100% EtOAc and the fractions containing the pure product were combined and concentrated to give intermediate I-265.MS M/z [ m+1] = 939.21.
Intermediate I-266: ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 4-cyano-2, 2-dimethyltetrahydrofuran o [3,4-d ]][1,3]Dioxolan-4-yl) methyl ((R) -2- ((3-cyano-) 5-fluorobenzyl) oxy) -3- (pentadecyloxy) propyl hydrogen phosphate
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxol-4-yl) methyl (2-chlorophenyl) ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) -3- (pentadecyloxy) propyl) phosphate (150 mg,0.160 mmol) was dissolved in 2:1 THF: ACN (6 mL), cesium fluoride (121 mg,0.798 mmol) in water (0.216 mL) was added, followed by 4- (dimethylamino) pyridine (0.097 mg,0.79 mmol). The reaction mixture was stirred at 80℃for 3 hours. The reaction was cooled to room temperature, 10% aqueous citric acid (15 mL) was added, and then 1M NaOH was added to adjust the pH to 3. Extracted with 2-MeTHF/EtOAc (3:2, 50 mL. Times.2). The combined organic layers were washed once with brine solution and over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-50% meoh in DCMLiquid) to give intermediate I-266.MS M/z [ M+1 ]]＝829.12
C. Compounds of formula (I)
Example 1: compound 1 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) -3- (octadecyl) Alkoxy) propyl) hydrogen phosphate
To a solution of intermediate I-25 (0.321 mmol) in THF (4.0 mL) was added dropwise concentrated HCl (0.534 mL,6.43 mmol) at 0deg.C. The reaction mixture was warmed to room temperature and stirred for 5 hours. The solution was cooled to 0 ℃ and 6 pieces of ice were added followed by NaOH solution (2M in water) until pH 8 was reached. To this solution was added phosphoric acid (85% aqueous solution) to adjust the pH to 3-4. Transfer to a separatory funnel and complete transfer with water (20 mL), etOAc/Me-THF (1:1, 50 mL). Extraction with EtOAc/MeTHF (1:1, 100 mL. Times.2) combined organic layers and washed once with brine (70 mL). Drying over sodium sulfate, filtration, concentration in vacuo, and purification by silica gel chromatography (0-100% meoh in DCM) afforded compound 1. 1 H NMR (400 MHz, methanol-d) 4 )δ7.84(s,1H),7.53(s,1H),7.45(d,J＝9.8Hz,1H),7.36(dt,J＝8.3,1.9Hz,1H),6.95–6.82(m,2H),5.56(d,J＝5.2Hz,1H),4.75–4.61(m,2H),4.59–4.48(m,2H),4.16(qd,J＝10.9,4.8Hz,2H),3.96(t,J＝6.3Hz,2H),3.76(dq,J＝9.0,5.2Hz,1H),3.61–3.39(m,4H),1.54(q,J＝6.8Hz,2H),1.29(d,J＝9.8Hz,30H),0.92(t,J＝6.7Hz,3H).MS m/z[M+1]＝831.3.
Example 7: compound 7 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((3-chloro-4-cyanobenzyl) oxy) -3- (octadecane Oxy) propyl) hydrogen phosphate
/>
Intermediate I-12 (0.168 mmol) was dissolved in THF (2.0 mL) and 25% HCl (1.0 mL) was added at room temperature. The resulting mixture was stirred at room temperature for 7 hours, diluted with DCMIPA (16 mL:4 mL), 5N NaOH (0.5 mL) was added to the mixture, and then washed with brine (10 mL. Times.2). The aqueous layer was extracted with DCM-IPA (4:1, 20 mL. Times.2), the combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (0% to 100% MeOH in DCM) to give compound 7. 1 H NMR (400 MHz, methanol-d 4) delta 7.83 (s, 1H), 7.67 (d, j=8.0 hz, 1H), 7.60 (d, j=1.4 hz, 1H), 7.41 (d, j=8.0 hz, 1H), 6.88 (d, j=4.6 hz, 1H), 6.85 (d, j=4.5 hz, 1H), 5.55 (d, j=5.2 hz, 1H), 4.73 (d, j=13.9 hz, 1H), 4.65 (d, j=13.7 hz, 1H), 4.57 (t, j=5.3 hz, 1H), 4.53 (d, j=5.5 hz, 1H), 4.16 (qd, j=10.9, 4.8hz, 2H), 3.96 (m, 2H), 3.75 (m, 1H), 3.57-3.37 (m, 4.52, 1H), 4.52 (m, 1.52, 1H), 4.7 (t, 3.7hz, 1H), 4.57 (t, 3.9H). 31 P NMR (162 MHz, methanol-d 4) delta-0.36. MS M/z [ M+1 ]]＝847.
Example 9: compound 9 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((3-cyano-4-methoxybenzyl) oxy) -3- (octadecyloxy) propyl) hydrogen phosphate
To a solution of intermediate I-29 (0.011 mmol) in THF (0.5 mL) was added dropwise concentrated HCl (0.047 mL,0.566 mmol) at 0deg.C. The reaction mixture was warmed to room temperature and stirred for 5 hours. The solution was cooled to 0 ℃, a small amount of ice particles was added followed by NaOH solution (2M in water) until pH8. To this solution was added phosphoric acid (85% aqueous solution) to adjust the pH to 3-4. Transfer to a separatory funnel was accomplished using water (20 mL) and EtOAc/Me-THF (1:1, 20 mL). Extraction with EtOAc/MeTHF (1:1, 50 mL. Times.2) combined organic layers and washed once with brine (70 mL). On sodium sulfate Dried, filtered, concentrated in vacuo, and then purified by silica gel chromatography (0% to 100% meoh in DCM) to afford compound 9. 1 H NMR (400 MHz, methanol-d) 4 )δ7.81(s,1H),7.57(d,J＝7.6Hz,2H),7.13–6.97(m,1H),6.90–6.77(m,2H),5.57(d,J＝5.3Hz,1H),4.68–4.38(m,4H),4.15(qd,J＝10.9,4.8Hz,2H),3.99–3.86(m,5H),3.81–3.62(m,1H),3.60–3.37(m,4H),1.52(q,J＝6.7Hz,2H),1.29(d,J＝7.9Hz,30H),0.92(t,J＝6.8Hz,3H). 31 P NMR (162 MHz, methanol-d) 4 )δ-0.34.MS m/z[M+1]＝843.2.
Example 16: compound 16 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((4-cyano-3- (1H-1, 2, 4-triazol-1-yl) Benzyl) oxy) -3- (octadecyloxy) propyl) hydrogen phosphate
To a solution of intermediate I-88 (0.159 mmol) in ACN (2 mL) -THF (1 mL) was added 25% HCl (1.25 mL) at room temperature. The solution was stirred at room temperature for 3 hours, diluted with EtOAc (30 mL), washed with water-2-propanol (20 mL: 1 mL) and the aqueous layer extracted with EtOAc (15 mLx 3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (0-100% MeOH in DCM) to give compound 16 as a white solid. 1 H NMR (400 MHz, methanol-d 4) δ9.03 (s, 1H), 8.23 (s, 1H), 8.02 (s, 1H), 7.90-7.81 (m, 2H), 7.68 (d, j=8.0 hz, 1H), 7.33 (d, j=4.7 hz, 1H), 7.03 (d, j=4.7 hz, 1H), 5.51 (d, j=4.8 hz, 1H), 4.94-4.74 (s, 2H,buried in solvent peak), 4.52-4.39 (m, 2H), 4.28-3.97 (m, 4H), 3.88 (m, 1H), 3.62 (m, 2H), 3.47 (m, 2H), 1.54 (m, 2H), 1.37-1.20 (m, 30H), 0.91 (t, j=6.7 hz, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.46. MS M/z [ M+1 ]]＝880.
Example 19: compound 19 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl (-/-)R) -2- ((6-cyanopyridin-3-yl) methoxy) -3- (deca Octaoxy) propyl) hydrogen phosphate
To a solution of intermediate I-35 (0.038 mmol) in THF (1.5 mL) was added dropwise concentrated HCl (0.19 mL,2.29 mmol) at 0deg.C. The reaction mixture was warmed to room temperature and stirred for 5 hours. The solution was cooled to 0 ℃, a small amount of ice particles was added followed by NaOH solution (2M in water) until pH 8 was reached. To this solution was added phosphoric acid (85% aqueous solution) to adjust the pH to 3-4, diluted with DCM-IPA (32/8 mL), transferred to a separatory funnel and the transfer was completed with water (10 mL). The organic layer was separated (40 mL. Times.2), washed once with brine/water (3/2, 50 mL) and dried over Na 2 SO 4 The top was dried, concentrated, dissolved in 5% MeOH/DCM (minimal solvent was used until the solid particles dissolved, additional MeOH was added dropwise if needed), loaded onto a 24g gold column, and run for 3 min 100% hex, 2 min 100% DCM, 16 min 0% -100% MeOH. The desired product was eluted in 50% meoh. The fractions containing the product were combined and concentrated to give compound 19. 1 H NMR (400 MHz, methanol-d) 4 )δ8.63(d,J＝2.0Hz,1H),7.97(dd,J＝8.0,2.1Hz,1H),7.81(s,1H),7.76(d,J＝8.0Hz,1H),6.84(t,J＝3.3Hz,2H),5.55(d,J＝5.2Hz,1H),4.83–4.66(m,2H),4.59(t,J＝5.3Hz,1H),4.53(d,J＝5.5Hz,1H),4.16(qd,J＝10.9,4.8Hz,2H),3.96(m,2H),3.78(td,J＝5.9,4.0Hz,1H),3.59–3.35(m,4H),1.52(m,2H),1.29(d,J＝7.0Hz,32H),0.92(t,J＝6.7Hz,3H). 31 P NMR (162 MHz, methanol-d) 4 )δ-0.37.MS m/z[M+1]＝814.3.
Example 21: compound 21 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((6-cyanopyridin-2-yl) oxy) -3- (octadecyl) Alkoxy) propyl) hydrogen phosphate
To a solution of intermediate I-32 (0.029 mmol) in THF (1.5 mL) at 0deg.C was added dropwise concentrated HCl (0.17 mL,2.05 mmol). The reaction mixture was warmed to room temperature and stirred for 5 hours. The solution was cooled to 0 ℃, a small amount of ice particles was added followed by NaOH solution (2M in water) until pH 8. To this solution was added phosphoric acid (85% aqueous solution) to adjust the pH to 3-4. Transfer to a separatory funnel and complete transfer with water (20 mL), etOAc/Me-THF (1:2, 20 mL). Extraction with EtOAc/MeTHF (1:2, 50 mL. Times.2) combined organic layers and washed once with brine (70 mL). Drying over sodium sulfate, filtration, concentration in vacuo, and purification by silica gel chromatography (0% -100% meoh in DCM) afforded compound 21. 1 H NMR (400 MHz, methanol-d) 4 )δ7.87–7.66(m,2H),7.38(dd,J＝10.3,7.2Hz,1H),7.06(dd,J＝12.5,8.5Hz,1H),6.86(dt,J＝7.3,3.9Hz,2H),5.60–5.39(m,2H),4.67–4.36(m,3H),4.31–4.02(m,3H),3.77–3.58(m,2H),3.53–3.35(m,2H),1.49(dq,J＝12.6,6.7Hz,2H),1.27(d,J＝21.6Hz,30H),0.92(t,J＝6.8Hz,3H). 31 P NMR (162 MHz, methanol-d) 4 )δ-0.57,-1.25。MS m/z[M+1]＝800.1.
Example 23: compound 23 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((4-cyano-3-isopropoxyphenoxy) -3- (octadecyloxy) propyl) hydrogen phosphate
A solution of intermediate I-81 (0.0446 mmol) in THF (1.0 mL) was 25% HCl (0.8 mL) at room temperature. The solution was stirred at room temperature for 3 hours, concentrated in vacuo and lyophilized in ACN-water to give compound 23. 1 H NMR (400 MHz, methanol-d 4) delta 8.03 (s, 1H), 7.37 (d, j=8.6 hz, 1H), 7.31 (d, j=4.7 hz, 1H), 7.07 (d, j=4.7 hz, 1H), 6.67 (d, j=2.1 hz, 1H), 6.61 (dd, j=8.8, 2.1hz, 1H), 5.57 (d, j=5.5 hz, 1H), 4.99-4.64 (m, 2H), 4.53-4.43 (m,2H),4.27–4.00(m,4H),3.74(dd,J＝10.8,3.4Hz,1H),3.64(dd,J＝10.9,5.9Hz,1H),3.52–3.35(m,2H),1.47(m,2H),1.41–1.20(m,36H),0.92(t,J＝6.7Hz,3H). 31 p NMR (162 MHz, methanol-d) 4 )δ-0.67.MS m/z[M+1]＝857.
Example 24: compound 24 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((6-cyanopyridin-3-yl) oxy) docosyl Radical) hydrogen phosphate
A solution of intermediate I-101 (0.153 mmol) in THF (4 ml) was cooled to 0deg.C and concentrated hydrochloric acid (0.51 ml) was added dropwise. The reaction mixture was warmed to room temperature and stirred for 4 hours. The solution was cooled to 0 ℃, a small amount of ice particles was added followed by NaOH solution (1M aqueous solution) until pH 8. To this solution was added phosphoric acid (85% aqueous solution) to adjust the pH to 3-4. Transfer to a separatory funnel was accomplished using water (20 mL) and EtOAc/Me-THF (1:1, 20 mL). Extraction with EtOAc/MeTHF (1:1, 50 mL. Times.2) combined organic layers and washed once with brine (70 mL). Dried over sodium sulfate, filtered, concentrated in vacuo, and then purified by silica gel chromatography (0-100% meoh in DCM) to give compound 24. 1 H NMR (400 MHz, methanol-d) 4 )δ8.32(d,J＝2.8Hz,1H),7.83(s,1H),7.67(d,J＝8.7Hz,1H),7.53(dd,J＝8.8,2.9Hz,1H),6.85-6.82(m,2H),5.56(d,J＝5.1Hz,1H),4.80-4.75(m,1H),4.60-4.56(m,2H),4.51(d,J＝5.4Hz,1H),4.19-4.11(m,2H),4.04-4.01(m,2H),3.66-3.62(m,1H),3.58-3.52(m,1H),3.46-3.39(m,1H),1.53–1.41(m,2H),1.27(d,J＝29.6Hz,30H),0.92(t,J＝6.6Hz,3H). 31 P NMR (162 MHz, methanol-d) 4 )δ-0.60.MS m/z[M+1]＝800.2.
Example 25: compound 25 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) diDecane Radical) hydrogen phosphate
To a solution of intermediate I-57 (1.06 mmol,1.0 eq.) in THF (7.0 mL) cooled in an ice-bath was added concentrated HCl (1.06 mL,12.0M,12 eq.). The reaction mixture was warmed to room temperature and stirred for 2 hours 30 minutes. The solution was diluted with 3:1 DCM: IPA (100 mL) and water (40 mL). The pH of the aqueous layer was adjusted to about 3 using 2M NaOH. The layers were separated. Water (40 mL) was added to the organics and the pH was adjusted to 3 with 1M HCl. The layers were separated again. The aqueous extracts were combined and extracted with 3:1 DCM: iPrOH (100 mL). The organic extracts were combined, washed with 3:2 brine: water (50 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% -60% meoh in DCM) to give compound 25. 1 H NMR (400 MHz, methanol-d) 4 )δ7.78(s,1H),7.48–7.45(m,1H),7.40–7.32(m,2H),6.84–6.80(m,2H),5.54(d,J＝5.1Hz,1H),4.69(d,J＝13.1Hz,1H),4.59–4.44(m,3H),4.20–4.07(m,2H),3.94–3.81(m,2H),3.58–3.50(m,1H),1.48–1.16(m,36H),0.93–0.86(m,3H). 19 F NMR (376 MHz, methanol-d) 4 )δ-112.91–-113.08(m). 31 PNMR (162 MHz, methanol-d) 4 )δ-0.12--0.84(m)。MS m/z[M+1]＝815.3.
Example 27: compound 27 ((2 r,3s,4 r) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((R) -2- ((4-cyano-3-methoxybenzyl) oxy) eicosane Radical) hydrogen phosphate
To a solution of intermediate I-44 (0.0867 mmol,1 eq.) in 2:1 THF: ACN (3.0 mL) was added concentrated HCl (0.50 mL,12.0M,69.2 eq.). The reaction mixture was allowed to stand at room temperatureStirring for 3 hours. The solution was diluted with 3:1 DCM: iPrOH (40 mL) and water (20 mL). The pH of the aqueous layer was adjusted to 14 using 2M NaOH and then to pH 3 using 1M HCl. The layers were separated. Water (20 mL) was added to the organics and the pH was adjusted to 3-4 with 1M HCl. The layers were separated again. The aqueous extracts were combined and extracted with 3:1 DCM: iPrOH (40 mL). The organic extracts were combined, washed with 2:1 brine: water (30 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% -40% meoh in DCM). The fractions containing the desired product were concentrated, dissolved in 1:1 water: ACN and filtered, then lyophilized to give compound 27. 1 H NMR (400 MHz, methanol-d) 4 )δ7.83(s,1H),7.47(d,J＝7.8Hz,1H),7.12(s,1H),7.00–6.92(m,2H),6.87(d,J＝4.6Hz,1H),5.53(d,J＝5.3Hz,1H),4.70(d,J＝13.2Hz,1H),4.57–4.48(m,3H),4.20–4.08(m,2H),4.03–3.83(m,5H),3.60–3.52(m,1H),1.51–1.19(m,36H),0.93–0.86(m,3H). 31 P NMR (162 MHz, methanol-d) 4 )δ-0.17--0.47(m)。MS m/z[M+1]＝827.3.
Example 28: compound 28 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((4-cyano-3-isopropoxybenzyl) oxy) di Dodecyl) hydrogen phosphate
To a solution of intermediate I-84 (0.0726 mmol) in ACN (2.0 mL) -THF (1 mL) was added 25% HCl (0.7 mL) at room temperature. The solution was stirred at room temperature for 2 hours, diluted with EtOAc (30 mL), washed with water-2-propanol (20 mL: 1 mL) and the aqueous layer extracted with EtOAc (15 mLx 3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (0-100% MeOH in DCM) to give compound 28. 1 H NMR (400 MHz, methanol-d) 4 )δ8.03(s,1H),7.48(d,J＝7.9Hz,1H),7.37(d,J＝4.7Hz,1H),7.14(d,J＝5.2Hz,1H),7.06(d,J＝4.8Hz,1H),7.00(d,J＝7.9Hz,1H),5.55(d,J＝5.1Hz,1H),4.91-4.72(s,2H),4.59(d,J＝13.2Hz,1H),4.49(m,2H),4.21(m,2H),4.08–3.91(m,2H),3.72–3.58(m,1H),1.56(m,2H),1.50–1.18(m,40H),0.92(t,J＝6.7Hz,3H). 31 P NMR (162 MHz, methanol-d) 4 )δ-0.50.MS m/z[M+1]＝855.
Example 30: compound 30 ((2 r,3s,4 r) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((R) -2- ((3-cyano-4- (1H-1, 2, 4-triazol-1-yl) benzyl) Group) oxy) eicosyl) hydrogen phosphate
To a solution of intermediate I-65 (0.392 mmol) in THF (4.0 mL) was added concentrated HCl (1.0 mL, 12.0M). The reaction mixture was stirred at room temperature for 6 hours 20 minutes. The solution was diluted with 3:1 DCM: IPA (100 mL) and water (40 mL). The pH of the aqueous layer was adjusted to about 3.5 using a combination of 50% wt KOH and 1M HCl. The layers were separated. The organic layer was washed with another 40mL of water, then with Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was loaded onto silica gel and purified by silica gel chromatography (0-40% meoh in DCM) to provide compound 30. 1 H NMR (400 MHz, methanol-d 4) delta 8.99 (s, 1H), 8.23 (s, 1H), 7.87-7.77 (m, 3H), 7.70 (d, j=8.3 hz, 1H), 6.95 (d, j=4.6 hz, 1H), 6.88 (d, j=4.6 hz, 1H), 5.53 (d, j=5.2 hz, 1H), 4.78 (d, j=12.9 hz, 1H), 4.60 (d, j=13.1 hz, 1H), 4.56-4.47 (m, 2H), 4.19-4.06 (m, 2H), 3.99-3.84 (m, 2H), 3.74-3.49 (m, 1H), 1.54-1.19 (m, 36H), 0.90 (t, j=6.7 hz, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.15- -0.48 (m). MS M/z [ M+1 ]]＝864.2
Example 31: compound 31 ((2 r,3s,4 r) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) eicosyl) phosphorus Acid hydrogen esters
To a solution of intermediate I-63 (0.164 mmol) in 2:1 THF: ACN (3.0 mL) was added concentrated HCl (0.12 mL, 12.0M). The reaction mixture was stirred at room temperature for 1 hour 45 minutes, then more concentrated HCl (0.12 ml,12.0 m) was added. After stirring for an additional 1.5 hours, the reaction mixture was diluted with 3:1 DCM: IPA (40 mL) and water (15 mL). The pH of the aqueous layer was adjusted to 3.5-4 using 50% wt KOH and 1 MHCl. The layers were separated. The organic layer was washed with another 15mL of water, then Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was purified by silica gel chromatography four times (0-40% MeOH in DCM) to give compound 31. 1 H NMR (400 MHz, methanol-d) 4 )δ7.79(s,1H),7.48–7.46(m,1H),7.41–7.32(m,2H),6.85–6.81(m,2H),5.54(d,J＝5.4Hz,1H),4.73(d,J＝12.9Hz,1H),4.59–4.43(m,3H),4.19–4.06(m,2H),3.94–3.80(m,2H),3.60–3.50(m,1H),1.48–1.16(m,36H),0.93–0.86(m,3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.98- -113.11 (m). 31 P NMR (162 MHz, methanol-d 4) delta-0.15- -0.54 (m). MS M/z [ M+1 ]]＝815.2
Example 34: compound 34 ((2 r,3s,4 r) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) behenyl Hydrogen phosphate salt
A solution of intermediate I-94 (0.082 mmol) in THF (1.5 mL) was cooled to 0deg.C and concentrated hydrochloric acid (0.414 mL) was added dropwise. The reaction mixture was warmed to room temperature and stirred for 3 hours. The solution was cooled to 0 ℃, a small amount of ice particles was added followed by NaOH solution (2M aqueous solution) until pH 8. To this solution was added phosphoric acid (85% aqueous solution) to adjust the pH to 3-4. Transfer to a separatory funnel was accomplished using water (20 mL) and EtOAc/Me-THF (1:1, 30 mL). Extracted with EtOAc/MeTHF (1:1, 50 mL. Times.2), combinedThe organic layer was washed once with brine (50 mL). Dried over sodium sulfate, filtered, concentrated in vacuo, and then purified by silica gel chromatography (0-100% meoh in DCM) to give compound 34. 1 H NMR (400 MHz, methanol-d 4) delta 7.81 (s, 1H), 7.49 (d, j=2.9 hz, 1H), 7.41-7.35 (m, 2H), 685-6.83 (m, 2H), 5.56 (d, j=4.9 hz, 1H), 4.76-4.70 (m, 1H), 4.60-4.56 (m, 1H), 4.55-4.45 (m, 2H), 4.20-4.11 (m, 2H), 3.95-3.85 (m, 2H), 3.63-3.49 (m, 1H), 2.92-2.70 (m, 3H), 1.47-1.43 (m, 2H), 1.35-1.27 (m, 36H), 0.92 (t, j=6.5 hz, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.28. MS M/z [ M+1 ]]＝829.2.
Example 36: compound 36 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) nonadecane Radical) hydrogen phosphate
To a solution of intermediate I-40 (0.0847 mmol,1 eq.) in THF (2.0 mL) was added concentrated HCl (0.50 mL,12.0M,70.9 eq.). The reaction mixture was stirred at room temperature for 5 hours. The solution was diluted with 3:1 DCM: iPrOH (20 mL) and water (10 mL). The pH of the aqueous layer was adjusted to about 4 using 2M NaOH. The layers were separated. Water (10 mL) was added to the organics and the pH was adjusted to 3-4 with 1M HCl. The layers were separated again. The aqueous extracts were combined and extracted with 3:1 DCM: iPrOH (20 mL). The organic extracts were combined, washed with 3:2 brine: water (30 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% -100% meoh in DCM) to give compound 36. 1 H NMR (400 MHz, methanol-d 4) delta 7.78 (s, 1H), 7.49-7.45 (m, 1H), 7.41-7.32 (m, 2H), 6.85-6.79 (m, 2H), 5.54 (d, J=5.1 Hz, 1H), 4.70 (d, J=13.0 Hz, 1H), 4.60-4.43 (m, 3H), 4.20-4.07 (m, 2H), 3.95-3.81 (m, 2H), 3.59-3.50 (m, 1H), 1.52-1.16 (m, 32H), 0.94-0.84 (m, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.89- -113.11 (m). 31 P NMR (162 MHz, methanol-d 4) delta-0.09- -0.57 (m). MS m/z[M+1]＝787.3.
Example 37: compound 37 ((2R, 3S, 4R) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) eicosyl) phosphorus Acid hydrogen salt
To a solution of intermediate I-50 (0.0149 mmol,1.0 eq.) in 2:1 THF: ACN (1.5 mL) was added concentrated HCl (0.25 mL,12.0M,202 eq.). The reaction mixture was stirred at room temperature for 2 hours 20 minutes. The solution was diluted with 3:1 DCM: IPA (20 mL) and water (20 mL). The pH of the aqueous layer was adjusted to about 3 using 2M NaOH. The layers were separated. Water (20 mL) was added to the organics and the pH was adjusted to 3 with 1M HCl. The layers were separated again. The aqueous extracts were combined and extracted with 3:1 DCM: iPrOH (20 mL). The organic extracts were combined, washed with 3:2 brine: water (30 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% -100% meoh in DCM) to give compound 37. 1 H NMR (400 MHz, methanol-d 4) delta 7.84-7.81 (m, 1H), 7.49-7.45 (m, 1H), 7.42-7.32 (m, 2H), 6.94-6.84 (m, 2H), 5.56-5.51 (m, 1H), 4.77-4.68 (m, 1H), 4.58-4.44 (m, 3H), 4.19-4.06 (m, 2H), 3.96-3.81 (m, 2H), 3.60-3.52 (m, 1H), 1.50-1.17 (m, 34H), 0.93-0.86 (m, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.94- -113.09 (m). 31 P NMR (162 MHz, methanol-d 4) delta-0.14- -0.54 (m). MS M/z [ M+1 ] ]＝801.3.
Example 38: compound 38 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((4-cyano-3-isopropoxyphenoxy) twenty Mono alkyl) hydrogen phosphate
To a solution of intermediate I-86 (101 mmol) in ACN (2.0 mL) -THF (1.0 mL) was added 25% HCl (0.9 mL) at room temperature. The solution was stirred at room temperature for 1 hour, diluted with EtOAc (30 mL), washed with water-2-propanol (20 mL: 1 mL) and the aqueous layer was extracted with EtOAc (15 mLx 3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (0-100% MeOH in DCM) to give compound 38. 1 H NMR (400 MHz, methanol-d 4) delta 8.03 (s, 1H), 7.39 (d, j=8.6 hz, 1H), 7.35 (d, j=4.8 hz, 1H), 7.03 (d, j=4.7 hz, 1H), 6.68-6.54 (m, 2H), 5.56 (d, j=5.4 hz, 1H), 4.75-4.58 (m, 2H), 4.48 (t, j=5.3 hz, 1H), 4.43 (d, j=5.3 hz, 1H), 4.24 (dd, j=11.1, 5.8hz, 1H), 4.16 (dd, j=11.1, 5.0hz, 1H), 4.07 (t, j=5.9 hz, 2H), 1.71 (m, 2H), 1.50-1.18 (m, 40H), 0.91 (t, j=6.7 hz, 1H). 31 P NMR (162 MHz, methanol-d 4) delta-0.87. MS M/z [ M+1 ]]＝841.
Example 39: compound 39 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((4-cyano-3, 5-dimethoxyphenoxy) di- Undecyl) hydrogen phosphate
A solution of intermediate I-97 (0.036 mmol) in THF (1.5 mL) was cooled to 0 ℃ Concentrated HCl (0.15 mL) was added dropwise. The reaction mixture was warmed to room temperature and stirred for 3 hours. The solution was cooled to 0 ℃, a small amount of ice particles was added followed by NaOH solution (2M aqueous solution) until pH 8. To this solution was added phosphoric acid (85% aqueous solution) to adjust the pH to 3-4. Transfer to a separatory funnel was completed using water (20 mL) and EtOAc/Me-THF (2:3, 30 mL). Extraction with EtOAc/MeTHF (2:3, 50 mL. Times.2) combined organic layers and washed once with brine (40 mL). Dried over sodium sulfate, filtered, concentrated in vacuo, and then purified by silica gel chromatography (0-100% meoh in DCM) to give compound 39. 1 H NMR(400MHz,DMSO-d6)δ8.16(s,2H),7.91(s,1H),6.96(d,J＝4.4Hz,1H),6.78(d,J＝4.5Hz,1H),6.36(s,2H),5.39(d,J＝5.8Hz,1H),4.76-4.70(m,1H),4.45-4.42(m,1H),4.25(d,J＝5.2Hz,1H),4.16-4.12(m,1H),4.05-3.93(m,3H),3.83(s,6H),1.59-1.53(m,2H),1.36-1.19(m,34H),0.85(t,J＝6.5Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ-1.67.MS m/z[M+1]＝843.2.
Example 43: compound 43 ((2R, 3S,4R, 5S) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl (3- (3-cyano-5-fluorophenoxy) -2- ((octadecyloxy) methyl Group) propyl) hydrogen phosphate
A solution of intermediate I-90 (0.115 mmol) in ACN (1 mL) -THF (0.5 mL) was 25% HCl (0.6 mL) at room temperature. The solution was stirred at room temperature for 3 hours, diluted with EtOAc (30 mL), washed with water-2-propanol (20 mL: 1 mL) and the aqueous layer extracted with EtOAc (15 mLx 3). The combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (0-100% MeOH in DCM) to give compound 43. 1 H NMR (400 MHz, methanol-d 4) delta 8.03 (s, 1H), 7.35 (d, J=4.7 Hz, 1H), 7.21-7.00 (m, 4H), 5.55 (d, J=4.5 Hz, 1H), 4.51-4.41 (m, 2H), 4.25-3.98 (m, 6H), 3.68-3.50 (m, 2H), 3.45 (m, 2H), 2.51-2.31 (m, 1H), 1.65-1.47 (m, 2H), 1.38-1.18 (m, 30H), 0.92 (m, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-110.96. 31 P NMR (162 MHz, methanol-d 4) delta 0.31, -0.33.MS M/z [ M+1 ]]＝831.
Example 50: compound 50 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1，2，4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- (3-cyanophenoxy) -3- (octadecyloxy) Propyl) hydrogen phosphate
Intermediate I-8 (0.087 mmol) was dissolved in THF (2.0 mL) and 25% HCl (0.5 mL) was added at room temperature. The resulting mixture was stirred at room temperature for 6 hours, diluted with DCM-IPA (16 mL:4 mL), 5N NaOH (0.5 mL) was added to the mixture, and then washed with brine (10 mL. Times.2). The aqueous layer was extracted with DCM-IPA (20 ml×2) and the combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (0% to 100% meoh in DCM) to give compound 50. 1 H NMR (400 MHz, methanol-d 4) delta 8.04 (s, 1H), 7.44-7.34 (m, 2H), 7.34-7.27 (m, 2H), 7.25 (dt, j=7.5, 1.2hz, 1H), 7.06 (d, j=4.8 hz, 1H), 5.55 (d, j=5.2 hz, 1H), 4.72 (m, 1H), 4.52-4.39 (m, 2H), 4.29-4.08 (m, 4H), 3.77-3.59 (m, 2H), 3.53-3.40 (m, 2H), 1.52 (m, 2H), 1.39-1.14 (m, 30H), 0.98-0.60 (m, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.80. MS M/z [ M+1 ]]＝799.
EXAMPLE 51 Compound 51 ((2R, 3S,4R, 5S) -5- (4-aminopyrrolo [2, 1-f)][1，2，4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- (3-cyanophenoxy) behenyl) phosphate hydrogen Salt
Intermediate I-19 (0.168 mmol) was dissolved in THF (2.0 mL) and 25% HCl (1.0 mL) was added at room temperature. The resulting mixture was stirred at room temperature for 4 hours, diluted with DCMIPA (16 mL:4 mL), 5N NaOH (0.5 mL) was added to the mixture, and then washed with brine (10 mL. Times.2). The aqueous layer was extracted with DCM-IPA (4:1, 20 mL. Times.2), the combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (0% to 100% MeOH in DCM) to give compound 51. 1 H NMR (400 MHz, methanol-d 4) delta 7.84 (s, 1H), 7.43-7.31 (m, 1H), 7.30-7.15 (m, 3H), 6.92 (dd, j=6.3, 4.6hz, 1H), 6.85 (d, j=4.5 hz, 1H), 5.56 (d, j=5.2 hz, 1H), 4.60-4.41 (m, 3H), 4.19-4.04 (m, 2H), 3.97 (m, 2H), 1.59 (m, 2H), 1.44-1.20 (m, 38H), 0.91 (t, j=6.7 hz, 3H). 31 PNMR (162 MHz, methanol-d 4) delta-0.44. MS M/z [ M+1 ]]＝797.
Example 53: compound 53 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) -3- (seventeen Alkoxy) propyl) hydrogen phosphate
Intermediate I-58 (0.042 mmol) was dissolved in THF (2.0 mL) and 25% HCl (0.388 mL) was added at room temperature. The resulting mixture was stirred at room temperature for 4 hours, diluted with DCMIPA (8 mL:2 mL), 5N NaOH (0.3 mL) (pH 2) was added to the mixture, and then washed with brine (5 mL. Times.2). The aqueous layer was extracted with DCM-IPA (10 mL. Times.2), the combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (0 to 100% MeOH in DCM) to give compound 53. 1 H NMR (400 MHz, methanol-d 4) delta 7.81 (s, 1H), 7.52 (s, 1H), 7.43 (dt, j=9.5, 1.9hz, 1H), 7.36 (dt, j=8.3, 1.9hz, 1H), 6.93-6.69 (m, 2H), 5.56 (d, j=5.0 hz, 1H), 4.71 (d, j=13.3 hz, 1H), 4.65-4.56 (m, 2H), 4.54 (m, 1H), 4.16 (qd, j=10.9, 4.7hz, 2H), 3.96 (m, 2H), 3.75 (m, 1H), 3.58-3.37 (m, 4H), 1.54 (m, 2H), 1.39-1.17 (m, 28H), 0.91 (t, j=6.7 hz, 2H). 19 F NMR (376 MHz, methanol-d 4) delta-112.90. 31 P NMR (162 MHz, methanol-d 4) delta-0.32. MS M/z [ M+1 ]]＝817.
Example 66: compound 66 ((2 r,3s,4 r) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((R) -2- ((5-cyanopyridin-3-yl) methoxy) -3- (octadecyl oxide Group) propyl) hydrogen phosphate
To a solution of intermediate I-53 (0.0177 mmol,1.0 eq.) in 2:1 THF: ACN (3.0 mL) was added concentrated HCl (0.30 mL,12.0M,204 eq.). The method comprisesThe reaction mixture was stirred at room temperature for 2 hours 15 minutes. Additional concentrated HCl (0.15 ml,12.0m,102 eq) was added and the solution stirred for 25 min. The solution was diluted with 3:1 DCM: iPrOH (20 mL) and water (20 mL). The pH of the aqueous layer was adjusted to about 10 using 2M NaOH and then to pH 3 using 1M HCl. The layers were separated. Water (20 mL) was added to the organics and the pH was adjusted to 3 with 1M HCl. The layers were separated again. The aqueous extracts were combined and extracted with 3:1 DCM: iPrOH (20 mL). The organic extracts were combined, washed with 3:2 brine: water (30 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0% -100% meoh in DCM) to give compound 66. 1 H NMR (400 MHz, methanol-d 4) delta 8.74-8.70 (m, 2H), 8.17-8.14 (m, 1H), 7.84 (s, 1H), 6.92 (d, j=4.6 hz, 1H), 6.87 (d, j=4.5 hz, 1H), 5.53 (d, j=5.3 hz, 1H), 4.80-4.64 (m, 2H), 4.57-4.48 (m, 2H), 4.19-4.08 (m, 2H), 4.01-3.90 (m, 2H), 3.80-3.74 (m, 1H), 3.56-3.35 (m, 4H), 1.57-1.47 (m, 2H), 1.38-1.21 (m, 30H), 0.93-0.86 (m, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.17- -0.57 (m). MS M/z [ M+1 ]]＝814.4.
EXAMPLE 67 Compound 67 ((2R, 3S, 4R) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((S) -2- ((4-cyano-2-methoxybenzyl) oxy) -3- (octadecyloxy) Propyl) phosphate, and compound 73: ((2R, 3S, 4R) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((4-cyano-2-methoxybenzyl) oxy) -3- (octadecyl) Alkoxy) propyl) hydrogen phosphate
To a solution of intermediate I-92 (0.062 mmol) in THF (3 mL) was added dropwise concentrated HCl (0.26 mL,3.11 mmol) at 0deg.C. The reaction mixture was warmed to room temperature and stirred for 5 hours. The solution was cooled to 0 ℃, a small amount of ice particles was added followed by NaOH solution (2M aqueous solution) until pH 8. To this solution was added phosphoric acid (85% aqueous solution) to adjust the pH to 3-4. Transfer to a separatory funnel was accomplished using water (20 mL) and EtOAc/Me-THF (1:1, 20 mL). Extraction with EtOAc/MeTHF (1:1, 50 mL. Times.2) combined organic layers and washed once with brine (70 mL). Dried over sodium sulfate, filtered, concentrated in vacuo, and then purified by silica gel chromatography (0-100% meoh in DCM) to afford compound 67 and compound 73.
Compound 67: 1 h NMR (400 MHz, methanol-d) 4 )δ7.80(s,1H),7.60(d,J＝7.8Hz,1H),7.23(d,J＝7.7,Hz,1H),7.20(d,J＝1.4Hz,1H),6.85-6.82(m,2H),5.55(d,J＝5.3Hz,1H),4.68(s,2H),4.60–4.46(m,2H),4.20-4.10(m,2H),3.99-3.96(m,2H),3.86(s,3H),3.81–3.71(m,1H),3.60–3.53(m,1H),3.51–3.45(m,1H),3.44–3.36(m,1H),1.71–1.43(m,2H),1.37–1.21(m,30H),0.92(t,J＝6.7Hz,3H). 31 P NMR (162 MHz, methanol-d) 4 )δ-0.37.MS m/z[M+1]＝843.2.
Compound 73: 1 h NMR (400 MHz, methanol-d) 4 )δ7.80(s,1H),7.60(d,J＝7.7Hz,1H),7.23(d,J＝8.0Hz,1H),7.20(s,1H),6.83(q,J＝4.6Hz,2H),5.55(d,J＝5.2Hz,1H),4.69(s,2H),4.62–4.47(m,2H),4.16(qd,J＝10.9,4.8Hz,2H),3.98(t,J＝5.5Hz,2H),3.86(s,3H),3.76(p,J＝5.0Hz,1H),3.56(dd,J＝10.7,3.6Hz,1H),3.48(dd,J＝10.8,6.2Hz,1H),3.41(q,J＝6.7Hz,1H),1.52(p,J＝6.6Hz,2H),1.29(d,J＝11.0Hz,30H),0.92(t,J＝6.6Hz,3H). 31 P NMR (162 MHz, methanol-d) 4 )δ-0.33.MS m/z[M+1]＝843.3.
Example 68: compound 68 ((2 r,3s,4 r) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((R) -2- ((6-cyanopyridin-2-yl) methoxy) -3- (octadecyl oxide Group) propyl) hydrogen phosphate
To a solution of intermediate I-106 (0.0293 mmol) in 2:1 THF: ACN (1.5 mL) was added concentrated HCl (0.036 mL). The reaction mixture is reacted in the presence ofStirred at room temperature for 6 hours. The reaction mixture was diluted with 3:1 DCM: IPA (5 mL) and K was added 2 HPO 4 ·3H 2 Aqueous O (240 mg in 2.0 mL) until the pH of the aqueous layer was 2-3. The layers were separated. The organic layer was washed with another 5mL of water, then with Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was purified by silica gel chromatography (0-70% MeOH in DCM) to give compound 68. 1 H NMR (400 MHz, methanol-d 4) delta 7.98-7.85 (m, 2H), 7.81 (s, 1H), 7.73-7.59 (m, 1H), 6.84 (s, 2H), 5.55 (d, j=5.4 hz, 1H), 4.60-4.56 (m, 1H), 4.52 (d, j=5.5 hz, 1H), 4.28-4.06 (m, 2H), 4.04-3.91 (m, 2H), 3.85-3.73 (m, 1H), 3.59-3.46 (m, 2H), 3.44-3.36 (m, 2H), 1.58-1.45 (m, 2H), 1.36-1.18 (m, 30H), 0.91 (t, j=6.7 hz, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.38. MS M/z [ M+1 ]]＝814.2.
Example 69: compound 69 ((2 r,3s,4 r) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((R) -2- ((4-cyanopyridin-2-yl) oxy) -3- (tetradecyloxy) Group) propyl) hydrogen phosphate
To a solution of intermediate I-107 (0.0332 mmol) in 2:1 THF: ACN (1.5 mL) was added concentrated HCl (0.041 mL). The reaction mixture was stirred at room temperature for 6 hours. The reaction mixture was diluted with 3:1 DCM: IPA (5 mL) and K was added 2 HPO 4 ·3H 2 Aqueous O (240 mg in 2.0 mL) until the pH of the aqueous layer was 2-3. The layers were separated. The organic layer was washed with another 5mL of water, then with Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was purified by silica gel chromatography 2 times (0-70% meoh in DCM) to give compound 69. 1 H NMR (400 MHz, methanol-d 4) delta 8.26-8.19 (m, 1H), 7.82 (s, 1H), 7.26-6.99 (m, 2H), 6.85 (s, 2H), 5.55 (d, J=5.4 Hz, 1H), 4.65-4.50 (m, 4H), 4.42 (dd, J=11.0, 5.5Hz, 1H), 4.64-4.50 (m, 2H), 3.78-3.62 (m, 2H), 3.46-3.39 (m, 2H), 1.60-1.44 (m, 2H), 1.39-1.17 (m, 22H), 0.91(t,J＝6.7Hz,3H). 31 P NMR (162 MHz, meOH-d 4) 31P NMR (162 MHz, meOD) delta-1.17- -1.25.MS M/z [ M+1 ]]＝744.3.
Example 70: compound 70 ((2 r,3s,4 r) -5- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) behenyl Hydrogen phosphate salt
A solution of intermediate I-95 (0.02 mmol) in THF (1.5 mL) was cooled to 0deg.C and concentrated hydrochloric acid (0.1 mL) was added dropwise. The reaction mixture was warmed to room temperature and stirred for 3 hours. The solution was cooled to 0 ℃, a small amount of ice particles was added followed by NaOH solution (2M aqueous solution) until pH 8. To this solution was added phosphoric acid (85% aqueous solution) to adjust the pH to 3-4. Transfer to a separatory funnel was accomplished using water (10 mL) and EtOAc/Me-THF (1:1, 20 mL). Extraction with EtOAc/MeTHF (1:1, 50 mL. Times.2) combined organic layers and washed once with brine (25 mL). Dried over sodium sulfate, filtered, concentrated in vacuo, and then purified by silica gel chromatography (0-100% meoh in DCM) to give compound 70.1H NMR (400 MHz, methanol-d 4) delta 7.80 (s, 1H), 7.48 (s, 1H), 7.41-7.35 (m, 2H), 6.85 (d, J=1.8 Hz, 1H), 6.84 (d, J=1.9 Hz, 1H), 5.56 (d, J=5.1 Hz, 1H), 4.73 (dd, J=13.0, 9.7Hz, 1H), 4.61-4.45 (m, 3H), 4.23-4.09 (m, 2H), 3.95-3.85 (m, 2H), 3.61-3.51 (m, 1H), 1.48-1.42 (m, 2H), 1.30-1.26 (m, 36H), 0.92 (t, J=6.7 Hz, 3H), 31P NMR (162 MHz, methanol-d 4) delta-0.28. MS M/z [ m+1] = 829.2.
Example 71: compound 71 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((5-cyanopyridin-2-yl) oxy) octadecane Radical) hydrogen phosphate
A solution of intermediate I-99 (0.153 mmol) in THF (4 mL) was cooled to 0deg.C and concentrated HCl (0.51 mL) was added dropwise. The reaction mixture was warmed to room temperature and stirred for 4 hours. The solution was cooled to 0 ℃, a small amount of ice particles was added followed by NaOH solution (1M aqueous solution) until pH 8. To this solution was added phosphoric acid (85% aqueous solution) to adjust the pH to 3-4. Transfer to a separatory funnel was accomplished using water (20 mL) and EtOAc/Me-THF (1:1, 20 mL). Extraction with EtOAc/MeTHF (1:1, 50 mL. Times.2) combined organic layers and washed once with brine (70 mL). Dried over sodium sulfate, filtered, concentrated in vacuo, and then purified by silica gel chromatography (0-100% meoh in DCM) to give compound 71. 1 H NMR (400 MHz, methanol-d) 4 )δ8.43(d,J＝2.3Hz,1H),7.87(dd,J＝8.7,2.4Hz,1H),7.84(s,1H),6.93–6.87(m,2H),6.85(d,J＝4.5Hz,1H),5.54(d,J＝5.3Hz,1H),4.64–4.51(m,4H),4.49–4.40(m,1H),4.25-4.16(m,2H),3.72-3.64(m,2H),3.45-3.41(m,2H),3.00–2.64(m,10H,Citrate salt),1.53-1.42(m,2H),1.39–1.15(m,22H),0.91(t,J＝6.7Hz,3H). 31 PNMR (162 MHz, methanol-d) 4 )δ-1.31.MS m/z[M+1]＝744.1.
Example 72: compound 72 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((S) -2- ((6-cyanopyridin-3-yl) oxy) -3- (octadecyl) Alkoxy) propyl) hydrogen phosphate
A solution of intermediate I-102 (0.095 mmol) in THF (3 mL) was cooled to 0deg.C and concentrated hydrochloric acid (0.47 mL) was added dropwise. The reaction mixture was warmed to room temperature and stirred for 5 hours. The solution was cooled to 0 ℃, a small amount of ice particles was added followed by NaOH solution (1M aqueous solution) until pH 8. To this solution was added phosphoric acid (85% aqueous solution) to adjust the pH to 3-4. Transfer to a separatory funnel was accomplished using water (20 mL) and EtOAc/Me-THF (1:1, 20 mL). Extracted with EtOAc/MeTHF (1:1, 50 mL. Times.2) and the organic layers combinedWashed once with brine (70 mL). Dried over sodium sulfate, filtered, concentrated in vacuo, and then purified by silica gel chromatography (0-100% meoh in DCM) to give compound 72. 1 H NMR (400 MHz, methanol-d 4) δ8.31 (d, j=2.8 hz, 1H), 8.03 (s, 1H), 7.70 (d, j=8.7 hz, 1H), 7.59 (dd, j=8.8, 2.9hz, 1H), 7.29 (d, j=4.7 hz, 1H), 7.04 (d, j=4.8 hz, 1H), 5.55 (d, j=5.1 hz, 1H), 4.54-4.42 (M, 2H), 4.19 (dd, j=11.0, 5.4hz, 1H), 4.14-4.09 (M, 2H), 3.98-3.90 (M, 1H), 3.77-3.72 (M, 2H), 3.66 (dd, j=10.9, 6.6hz, 1H), 3.54-3.38 (M, 2H), 1.54-4.42 (M, 2H), 4.19 (dd, j=11.0, 5.4hz, 1H), 4.14-4.09 (M, 2H), 3.98-3.90 (M, 1H), 3.54-3.38 (M, 2H)]＝800.2.
Example 73: compound 73 ((2 r,3s,4 r) -5- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((R) -2- ((4-cyano-2-methoxybenzyl) oxy) -3- (octadecyl) Alkoxy) propyl) hydrogen phosphate
The process for preparing compound 73 is described in example 67 above.
Example 74: compound 74 ((2 r,3s,4 r) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) nonadecyl) phosphorus Acid hydrogen salt
To a solution of intermediate I-104 (0.242 mmol) in THF (10 mL) cooled in an ice-bath was added concentrated HCl (0.504 mL). The reaction mixture was warmed to room temperature and stirred for 5 hours. The solution was diluted with 3:1 DCM: IPA (50 mL) and water (20 mL). The pH of the aqueous layer was adjusted to about 3 using 2M NaOH. The layers were separated. Water (20 mL) was added to the organics and the pH was adjusted to 3 with 1M HCl. The layers were separated again. The aqueous extracts were combined and extracted with 3:1 DCM: iPrOH (60 mL). The organic extracts were combined, washed with 3:2 brine: water (50 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then chromatographed on silica gelPurification by chromatography (0-100% MeOH in DCM) gave compound 74. 1 H NMR (400 MHz, methanol-d 4) delta 7.81 (s, 1H), 7.49 (s, 1H), 7.44-7.32 (m, 2H), 6.87-6.83 (m, 2H), 5.56 (d, J=5.3 Hz, 1H), 4.73 (d, J=13.0 Hz, 1H), 4.60-4.57 (m, 1H), 4.54-4.41 (m, 2H), 4.19-4.11 (m, 2H), 3.94-3.84 (m, 2H), 3.66-3.50 (m, 1H), 1.47-1.42 (m, 2H), 1.34-1.26 (m, 30H), 0.92 (t, J=6.7 Hz, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.59. MS M/z [ M-1]＝787.2.
Example 75: compound 75 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((4-cyano-2-fluorobenzyl) oxy) -3- (tetradecyl) Alkoxy) propyl) hydrogen phosphate
A solution of intermediate I-79 (0.128 mmol) in THF (2.0 mL) at room temperature was 25% HCl (0.7 mL). The solution was stirred at room temperature for 5 hours and diluted with DCM-IPA (16 mL: 4 mL). To the mixture was added 5N NaOH (0.5 mL) (pH 2), then washed with brine (5 mL x 2), the aqueous layer was extracted with DCM-IPA (10 mL x 2), the combined organic layers were dried over sodium sulfate, concentrated in vacuo, and purified by silica gel column chromatography (0 to 100% meoh in DCM) to give compound 75. 1 H NMR (400 MHz, methanol-d 4) delta 8.07 (s, 1H), 7.75 (t, j=7.5 hz, 1H), 7.47 (t, j=8.7 hz, 2H), 7.40 (d, j=4.6 hz, 1H), 7.07 (d, j=4.7 hz, 1H), 5.56 (d, j=4.7 hz, 1H), 4.82 (s, 2H), 4.54-4.43 (m, 2H), 4.18 (m, 2H), 4.04 (m, 2H), 3.85 (m, 1H), 3.59 (m, 2H), 3.46 (m, 2H), 1.54 (m, 2H), 1.47-1.21 (m, 22H), 0.91 (t, j=6.6 hz, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-118.39. 31 PNMR (162 MHz, methanol-d 4) delta-0.52. MS M/z [ M+1 ]]＝775.
Example 76: compound 76 ((2 r,3s,4 r) -5- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((R) -2- ((3-chloro-5-cyanobenzyl) oxy) nonadecyl) phosphate Hydrogen salt
To a solution of intermediate I-71 (0.145 mmol) in THF (4.0 mL) was added concentrated HCl (0.50 mL). The reaction mixture was stirred at room temperature for 4 hours. The solution was diluted with 4:1 DCM: IPA (100 mL) and water (50 mL). The pH of the aqueous layer was adjusted to between 3 and 4 using a combination of 20wt% KOH and 1M HCl. The layers were separated. The organic layer was washed with another 50mL of water, then with Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was loaded onto silica gel and purified by silica gel chromatography (0-40% meoh in DCM) to provide compound 76. 1 H NMR (400 MHz, methanol-d 4) delta 7.85 (s, 1H), 7.63-7.55 (m, 3H), 6.98 (d, j=4.6 hz, 1H), 6.89 (d, j=4.6 hz, 1H), 5.53 (d, j=5.1 hz, 1H), 4.72 (d, j=13.0 hz, 1H), 4.57-4.45 (m, 3H), 4.21-4.08 (m, 2H), 3.97-3.83 (m, 2H), 3.61-3.53 (m, 1H), 1.54-1.16 (m, 32H), 0.90 (t, j=6.8 hz, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.14- -0.48 (m). MS M/z [ M-1 ]]＝803.2.
Example 77: compound 77 ((2R, 3S, 4R) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) 2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((R) -2- ((6-cyanopyridin-3-yl) oxy) -3- (tetradecyloxy) Group) propyl) hydrogen phosphate
To a solution of intermediate I-73 (0.0159 mmol) in 2:1 THF: ACN (1.5 mL) was added concentrated HCl (0.25 mL). The reaction mixture was stirred at room temperature for 4 hours. The solution was diluted with 3:1 DCM: IPA (20 mL) and water (20 mL). The pH of the aqueous layer was adjusted to about 4 using 2M NaOH. The layers were separated. Water (20 mL) was added to the organics and the pH was adjusted to 3 with 1M HCl. The layers were separated again. The aqueous extracts were combined and extracted with 3:1 DCM: IPA (20 mL). The organic extracts were combined, washed with 1:1 brine: water (20 mL), and dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo, then purified by silica gel chromatography (0-70% meoh in DCM) to give compound 77. 1 H NMR (400 MHz, methanol-d 4) delta 8.30 (d, j=2.9 hz, 1H), 7.83-7.80 (m, 1H), 7.65 (d, j=8.7 hz, 1H), 7.51 (dd, j=8.8, 2.9hz, 1H), 6.86-6.80 (m, 2H), 5.54 (d, j=5.2 hz, 1H), 4.78-4.71 (m, 1H), 4.57-4.51 (m, 1H), 4.49 (d, j=5.5 hz, 1H), 4.18-4.07 (m, 2H), 4.04-3.98 (m, 2H), 3.67-3.33 (m, 4H), 1.51-1.41 (m, 2H), 1.37-1.15 (m, 22H), 0.90 (t, j=6.7 hz, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.45- -0.77 (m). MS M/z [ M-1 ]]＝744.3.
Example 78: compound 78 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) octadecane Radical) hydrogen phosphate
To ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) octadecyl) hydrogen phosphate intermediate I-133 (84 mg,0.103mmol,1.0 eq.) was added to a solution of concentrated HCl (0.50 mL,12.0M,58.1 eq.) in THF (4.0 mL). The reaction mixture was stirred at room temperature for 5 hours 30 minutes. The solution was diluted with 4:1 DCM: IPA (50 mL) and water (35 mL). The pH of the aqueous layer was adjusted to about 4.5 using a combination of 20wt% KOH and 1M HCl. The layers were separated. The organic layer was washed with an additional 35mL of water, then with Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was loaded onto silica gel and purified by silica gel chromatography (0-30% meoh in DCM) to provide the title compound 78. 1 H NMR (400 MHz, methanol-d 4) delta 7.84 (s, 1H), 7.49-7.45 (m, 1H), 7.42-7.32 (m, 2H), 6.95 (d, j=4.6 hz, 1H), 6.88 (d, j=4.6 hz, 1H), 5.53 (d, j=5.1 hz, 1H), 4.72 (d, j=13.0 hz, 1H), 4.58-4.46 (m, 3H), 4.21-4.08 (m, 2H), 3.96-3.83 (m, 2H), 3.61-3.52 (m, 1H) ),1.54–1.17(m,30H),0.90(t,J＝6.7Hz,3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.91- -113.06 (m). 31 P NMR (162 MHz, methanol-d 4) delta-0.02- -0.59 (m). MS M/z [ M+1 ]]＝773.1
Example 79: compound 79 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) octadecane Radical) hydrogen phosphate
To ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopenten-4-yl) methyl ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) octadecyl) hydrogen phosphate intermediate I-138 (94 mg,0.116mmol,1.0 eq.) was added to a solution of concentrated HCl (0.50 mL,12.0M,51.9 eq.) in THF (4.0 mL). The reaction mixture was stirred at room temperature for 6 hours. The solution was diluted with 4:1 DCM: IPA (50 mL) and water (35 mL). The pH of the aqueous layer was adjusted to about 3.0 using a combination of 20wt% KOH and 1M HCl. The layers were separated. The organic layer was washed with an additional 35mL of water, then with Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was loaded onto silica gel and purified by silica gel chromatography (0-30% meoh in DCM) to provide the title compound 79. 1 H NMR (400 MHz, methanol-d 4) delta 7.85 (s, 1H), 7.51-7.46 (m, 1H), 7.43-7.31 (m, 2H), 7.00 (d, j=4.6 hz, 1H), 6.90 (d, j=4.6 hz, 1H), 5.54 (d, j=5.3 hz, 1H), 4.75 (d, j=13.0 hz, 1H), 4.58-4.46 (m, 3H), 4.22-4.08 (m, 2H), 3.98-3.84 (m, 2H), 3.62-3.54 (m, 1H), 1.57-1.15 (m, 30H), 0.90 (t, j=6.7 hz, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.84- -113.07 (m). 31 P NMR (162 MHz, methanol-d 4) delta 0.14- -0.76 (m). MS M/z [ M+1 ]]＝773.1
Example 80: compound 80 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl) methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) heptadecane Radical) hydrogen phosphate
To ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) heptadecyl) phosphate intermediate I-144 (288 mg,0.361mmol,1.0 eq.) in THF (4.0 mL) was added concentrated HCl (0.50 mL,12.0M,16.6 eq.). The reaction mixture was stirred at room temperature overnight. The solution was diluted with 4:1 DCM: IPA (100 mL) and water (50 mL). The pH of the aqueous layer was adjusted to about 5 using a combination of 20wt% KOH and 1M HCl. The layers were separated. The organic layer was washed with another 50mL of water and 30mL of brine, then over Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was loaded onto silica gel and purified by silica gel chromatography (0-35% meoh in DCM) to provide the title compound 80. 1 H NMR (400 MHz, methanol-d 4) delta 7.84 (s, 1H), 7.50-7.45 (m, 1H), 7.43-7.31 (m, 2H), 6.98 (d, j=4.6 hz, 1H), 6.88 (d, j=4.6 hz, 1H), 5.53 (d, j=5.0 hz, 1H), 4.73 (d, j=13.0 hz, 1H), 4.57-4.46 (m, 3H), 4.24-4.07 (m, 2H), 3.99-3.84 (m, 2H), 3.62-3.53 (m, 1H), 1.53-1.18 (m, 28H), 0.89 (t, j=6.7 hz, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.77- -113.11 (m). 31 P NMR (162 MHz, methanol-d 4) delta-0.08- -0.55 (m). MS M/z [ M+1 ]]＝759.1
Example 81: compound 81 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((3-chloro-5-cyanobenzyl) oxy) eicosyl Hydrogen phosphate salt
Direction ((3 aS)4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-chloro-5-cyanobenzyl) oxy) eicosyl) phosphate intermediate I-152 (134 mg,0.156mmol,1.0 eq.) was added to a solution of concentrated HCl (0.50 mL,12.0M,38.4 eq.) in THF (4.0 mL). The reaction mixture was stirred at room temperature for 5 hours 15 minutes. The solution was diluted with 4:1 DCM: IPA (100 mL) and water (50 mL). The pH of the aqueous layer was adjusted to about 3 using a combination of 20wt% KOH and 1M HCl. The layers were separated. The organic layer was washed with another 50mL of water and 20mL of brine, then over Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was loaded onto silica gel and purified by silica gel chromatography (0-35% meoh in DCM) to give the title compound 81 as TFA salt. 1 H NMR (400 MHz, methanol-d 4) delta 7.80 (s, 1H), 7.62-7.55 (m, 3H), 6.87-6.81 (m, 2H), 5.54 (d, J=5.0 Hz, 1H), 4.69 (d, J=12.9 Hz, 1H), 4.59-4.41 (m, 3H), 4.23-4.07 (m, 2H), 3.97-3.82 (m, 2H), 3.59-3.50 (m, 1H), 1.52-1.16 (m, 34H), 0.89 (t, J=6.7 Hz, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-77.49. 31 P NMR (162 MHz, methanol-d 4) delta-0.10- -0.61 (m). MS M/z [ M+1 ]]＝817.2
Example 82: compound 82 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((3-chloro-5-cyanobenzyl) oxy) heneicosane Radical) hydrogen phosphate
To ((3 aS,4R,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-chloro-5-cyanobenzyl) oxy) heneicosyl) phosphate intermediate I-156 (147 mg,0.169mmol,1.0 eq.) was added to a solution of concentrated HCl (0.50 mL,12.0M,35.6 eq.) in THF (4.0 mL). The reaction mixture was stirred at room temperature for 5 hours. With 4:1 DCM: IPA (100 mL) andthe solution was diluted with water (50 mL). The pH of the aqueous layer was adjusted to 3.5-4 using a combination of 20wt% KOH and 1M HCl. The layers were separated. The organic layer was washed with another 50mL of water and 20mL of brine, then over Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was loaded onto silica gel and purified by silica gel chromatography (0-35% meoh in DCM) to give title compound 82 as TFA salt after lyophilization. 1 H NMR (400 MHz, methanol-d 4) delta 7.81 (s, 1H), 7.62-7.54 (m, 3H), 6.89 (d, j=4.6 hz, 1H), 6.84 (d, j=4.6 hz, 1H), 5.54 (d, j=5.0 hz, 1H), 4.70 (d, j=12.9 hz, 1H), 4.58-4.44 (m, 3H), 4.22-4.08 (m, 2H), 3.96-3.81 (m, 2H), 3.60-3.51 (m, 1H), 1.53-1.16 (m, 36H), 0.94-0.84 (m, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-77.49. 31 P NMR (162 MHz, methanol-d 4) delta 0.09- -0.89 (m). MS M/z [ M+1 ]]＝831.2
Example 84: compound 84 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) eicosane Radical) hydrogen phosphate
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopenten-4-yl) methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) eicosyl) phosphate, intermediate I-164, (218 mg, 0.319 mmol,1.0 eq.) in THF (4.0 mL) was added concentrated HCl (0.50 mL,12.0M,23.1 eq.). The reaction mixture was stirred at room temperature for 4 hours 30 minutes, then concentrated in vacuo and purified directly by silica gel chromatography (0-40% meoh in DCM) to give the title compound 84 as HCl salt after lyophilization. 1 H NMR (400 MHz, methanol-d 4) delta 8.01 (s, 1H), 7.50 (s, 1H), 7.45-7.31 (m, 3H), 7.05 (d, J=4.7 Hz, 1H), 5.53 (d, J=4.9 Hz, 1H), 4.80-4.74 (m, 1H), 4.60 (d, J=13.0 Hz, 1H), 4.51-4.41 (m, 2H), 4.28-4.13 (m, 2H), 4.08-3.89 (m, 2H), 3.69-3.60 (m, 1H), 1.60-1.19(m,34H),0.90(t,J＝6.7Hz,3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.83- -112.98 (m). 31 P NMR (162 MHz, methanol-d 4) delta-0.02- -0.94 (m). MS M/z [ M+1 ]]＝801.2
Example 85: compound 85 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((4-cyano-3-fluorophenoxy) heneicosyl Hydrogen phosphate salt
To a solution of ((4 as,4R,6s,6 as) -6- (4-aminopyrrolo [2,1-f ] [1,2,4] triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d ] [1,3] dioxol-4-yl) methyl ((R) -2- (4-cyano-3-fluorophenoxy) heneicosanyl) phosphate, intermediate I-170, (200 mg,0.238mmol,1.0 eq.) in THF (4.0 mL) was added concentrated HCl (0.50 mL,12.0m,25.2 eq.). The reaction mixture was stirred at room temperature for 5 hours 30 minutes, then concentrated in vacuo and purified directly by silica gel chromatography (0-40% meoh in DCM) to give the title compound 85 as HCl salt after lyophilization.
1 H NMR(400MHz,DMSO-d6)δ8.52–8.10(m,2H),7.93(s,1H),7.77–7.71(m,1H),7.15(dd,J＝12.0,2.4Hz,1H),7.01(d,J＝4.5Hz,1H),6.95(dd,J＝8.8,2.4Hz,1H),6.78(d,J＝4.5Hz,1H),5.38(d,J＝5.7Hz,1H),4.73–4.62(m,1H),4.44–4.38(m,1H),4.23(d,J＝5.3Hz,1H),4.16–4.08(m,1H),4.05–3.89(m,3H),1.61–1.48(m,2H),1.39–1.10(m,34H),0.84(t,J＝6.6Hz,3H). 19 F NMR(376MHz,DMSO-d6)δ-106.48–-107.05(m). 31 P NMR(162MHz,DMSO-d6)δ-1.59–-2.32(m).MS m/z[M+1]＝801.3
Example 86: compound 86 ((2R, 3S,4R, 5S) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) hexadecane Radical) hydrogen phosphate
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d ][1,3]Dioxacyclopenten-4-yl) methyl ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) hexadecyl) phosphate, intermediate I-176, (223 mg,0.284mmol,1.0 eq.) in THF (4.0 mL) was added concentrated HCl (0.50 mL,12.0M,21.1 eq.). The reaction mixture was stirred at room temperature overnight. The solution was diluted with 4:1 DCM: IPA (100 mL) and water (50 mL). The pH of the aqueous layer was adjusted to about 4 to 4.5 using 20wt% KOH. The layers were separated. The organic layer was washed with another 50mL of water, then with Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was purified by silica gel chromatography (0-40% MeOH in DCM) to give the title compound 86. 1 H NMR (400 MHz, methanol-d 4) delta 7.87 (s, 1H), 7.50-7.47 (m, 1H), 7.43-7.37 (m, 1H), 7.37-7.32 (m, 1H), 7.05 (d, j=4.6 hz, 1H), 6.93 (d, j=4.6 hz, 1H), 5.53 (d, j=5.2 hz, 1H), 4.76 (d, j=13.0 hz, 1H), 4.56-4.45 (m, 3H), 4.23-4.09 (m, 2H), 3.98-3.84 (m, 2H), 3.64-3.55 (m, 1H), 1.56-1.19 (m, 26H), 0.89 (t, j=6.8 hz, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-112.90- -113.02 (m). 31 P NMR (162 MHz, methanol-d 4) delta-0.10- -0.58 (m). MS M/z [ M+1 ]]＝745.2
Example 87: compound 87 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((S) -2- ((3-chloro-5-cyanobenzyl) oxy) eicosyl Hydrogen phosphate salt
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxol-4-yl) methylTo a solution of (S) -2- ((3-chloro-5-cyanobenzyl) oxy) eicosyl) phosphate intermediate I-182 (260 mg,0.303mmol,1.0 eq.) in THF (4.0 mL) was added concentrated HCl (0.50 mL,12.0M,19.8 eq.). The reaction mixture was stirred at room temperature overnight. The solution was diluted with 4:1 DCM: IPA (100 mL) and water (50 mL). The pH of the aqueous layer was adjusted to about 3 using 20wt% KOH. The layers were separated. The organic layer was washed with another 75mL of water, then over Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was purified by silica gel chromatography (0-40% MeOH in DCM) to give the title compound 87. 1 H NMR (400 MHz, methanol-d 4) delta 7.84 (s, 1H), 7.64-7.61 (m, 1H), 7.61-7.57 (m, 2H), 6.97 (d, j=4.6 hz, 1H), 6.89 (d, j=4.6 hz, 1H), 5.54 (d, j=5.3 hz, 1H), 4.73 (d, j=13.0 hz, 1H), 4.56-4.45 (m, 3H), 4.21-4.07 (m, 2H), 4.00-3.81 (m, 2H), 3.62-3.52 (m, 1H), 1.53-1.17 (m, 34H), 0.94-0.87 (m, 3H). 31 PNMR (162 MHz, methanol-d 4) delta-0.17- -0.47 (m). MS M/z [ M+1 ]]＝817.2
Example 88: compound 88 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f) ][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) -3- (sixteen Alkoxy) propyl) hydrogen phosphate
To a solution of intermediate I-228 (224 mg,0.266 mmol) in ACN (2 mL) -THF (2 mL) was added 25% hydrochloric acid (0.4 mL) at room temperature and the solution was stirred at room temperature for 15 hours, concentrated in vacuo, and purified by silica gel column chromatography (0 to 100% meoh in DCM) to give compound 88 (155.4 mg, 70%). 1 H NMR (400 MHz, methanol-d 4) delta 8.05 (s, 1H), 7.55 (s, 1H), 7.52-7.44 (m, 1H), 7.44-7.31 (m, 2H), 7.06 (d, j=4.7 hz, 1H), 5.56 (d, j=4.9 hz, 1H), 4.80 (d, j=13.3 hz, 1H), 4.73 (d, j=13.2 hz, 1H), 4.56-4.39 (m, 2H), 4.35-4.18 (m, 2H), 4.19-4.00 (m, 2H), 3.90-3.77 (m, 1H), 3.66-3.53 (m, 2H), 3.53-3.40 (m, 2H), 1.66-1.50 (m, 2H), 1.45-1.20 (m, 26H), 0.56-4.39 (t, 3.7 hz, 3H). 19 F NMR(376MHzMethanol-d 4) delta-112.83. 31 P NMR (162 MHz, methanol-d 4) delta-0.90. MS M/z [ M+1 ]]＝803.4
Example 92 Compound 92 ((2R, 3S,4R, 5S) -5- (4-aminopyrrolo [2, 1-f)][1，2，4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((S) -2- (benzyloxy) -3- (hexadecyloxy) propyl) phosphorus Acid hydrogen salt
To a solution of intermediate I-236 (237 mg, 0.298 mmol) in ACN (2 mL) -THF (2 mL) was added 25% hydrochloric acid (0.4 mL) at room temperature and the solution was stirred at room temperature for 6 hours, concentrated in vacuo, and purified by silica gel column chromatography (0 to 100% meoh in DCM) to give compound 92 (199mg, 84%). 1 H NMR (400 MHz, methanol-d) 4 )δ7.96(s,1H),7.38–7.20(m,6H),7.07(d,J＝4.8Hz,1H),5.56(d,J＝4.7Hz,1H),4.69(d,J＝11.8Hz,1H),4.62(d,J＝11.8Hz,1H),4.54-4.47(m,2H),4.24(dd,J＝11.1,5.6Hz,1H),4.17(dd,J＝11.1,5.2Hz,1H),4.07-3.96(m,2H),3.78(p,J＝5.2Hz,1H),3.58(dd,J＝10.6,4.2Hz,1H),3.52(dd,J＝10.5,5.8Hz,1H),3.47-3.38(m,2H),1.60-1.48(m,2H),1.41-1.21(m,26H),0.92(t,J＝6.7Hz,3H). 31 P NMR (162 MHz, methanol-d) 4 )δ-0.36.MS m/z[M+1]＝760.3
EXAMPLE 93 Compound 93 ((2R, 3S,4R, 5S) -5- (4-aminopyrrolo [2, 1-f)][1，2，4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((S) -2- (benzyloxy) eicosyl) phosphate hydrogen salt
To a solution of intermediate I-238 (277 mg, 0.277 mmol) in ACN (2 mL) -DCM (2 mL) was added 25% hydrochloric acid (0.4 mL) at room temperature and the solution was stirred at room temperature for 6 hours, concentrated in vacuo, and purified by silica gel column chromatography (0 to 100%MeOH in DCM) to afford compound 93 (207.52 mg, 79%). 1 H NMR (400 MHz, methanol-d 4) delta 8.04 (s, 1H), 7.41 (d, j=4.7 hz, 1H), 7.38-7.21 (m, 5H), 7.06 (d, j=4.7 hz, 1H), 5.58 (d, j=5.4 hz, 1H), 4.66 (d, j=11.6 hz, 1H), 4.54-4.47 (m, 2H), 4.41 (d, j=5.4 hz, 1H), 4.36-4.21 (m, 2H), 4.13-4.04 (m, 1H), 4.04-3.93 (m, 1H), 3.69-3.53 (m, 1H), 1.62-1.18 (m, 34H), 0.92 (t, j=6.7 hz, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-1.25. MS M/z [ M+1 ]]＝758.3
Example 94: compound 94 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) -2-methyl- 3- (octadecyloxy) propyl) hydrogen phosphate
/>
To a solution of intermediate I-240 (262 mg, 0.298 mmol) in ACN (2 mL) -THF (2 mL) was added 25% hydrochloric acid (0.4 mL) at room temperature and the solution was stirred at room temperature for 15 hours, concentrated in vacuo, and purified by silica gel column chromatography (0 to 100% meoh in DCM) to give compound 94 (210 mg, 84%). 1 H NMR (400 MHz, methanol-d 4) delta 7.90 (s, 1H), 7.51 (s, 1H), 7.49-7.39 (m, 1H), 7.36-7.29 (m, 1H), 7.07 (d, j=4.6 hz, 1H), 6.96 (d, j=4.6 hz, 1H), 5.55 (d, j=5.2 hz, 1H), 4.65 (s, 2H), 4.58-4.49 (m, 2H), 4.22-4.08 (m, 2H), 4.02-3.86 (m, 2H), 3.53-3.46 (m, 2H), 3.46-3.39 (m, 2H), 1.60-1.47 (m, 2H), 1.40-1.17 (m, 33H), 0.92 (t, j=6.7 hz, 3H). 19 F NMR (376 MHz, methanol-d 4) delta-113.23. 31 P NMR (162 MHz, methanol-d 4) delta-0.59. MS M/z [ M+1 ]]＝817.3
Example 96: compound 96 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((S) -2- ((3-cyano-5-fluorophenoxy) eicosyl) phosphorus Acid hydrogen salt
To a solution of intermediate I-248 (168 mg,0.203mmol,1.0 eq.) in THF (4.0 mL) was added concentrated HCl (0.50 mL,12.0M,58 eq.). The reaction mixture was stirred at room temperature for 6h. The solution was diluted with ethyl acetate (50 mL) and neutralized with saturated sodium bicarbonate. The layers were separated. The organic layer was washed with brine, dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was loaded onto silica gel and purified by silica gel chromatography (0-30% meoh in DCM) to provide the title compound 96. 1 H NMR (400 MHz, methanol-d 4) delta 7.83 (s, 1H), 7.16 (d, j=1.6 hz, 1H), 7.09 (dt, j=10.9, 2.3hz, 1H), 7.06-7.00 (m, 1H), 6.88 (d, j=4.5 hz, 1H), 6.84 (d, j=4.6 hz, 1H), 5.58 (d, j=5.2 hz, 1H), 4.63-4.45 (m, 3H), 4.12 (dd, j=6.3, 4.7hz, 2H), 3.98 (d, j=6.5 hz, 2H), 1.67-1.52 (m, 2H), 1.29 (d, j=20.7 hz, 27h), 0.96-0.89 (m, 4H); 31 p NMR (162 MHz, methanol-d 4) delta-0.73. MS M/z [ M+1 ]]＝787.3
Example 97: compound 97 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) pentadecane Radical) hydrogen phosphate
To a solution of intermediate I-254 (156 mg,0.203mmol,1.0 eq.) in THF (4.0 mL) was added concentrated HCl (0.50 mL,12.0M,58 eq.). The reaction mixture was stirred at room temperature for 6h. The solution was diluted with ethyl acetate (50 mL) and neutralized with saturated sodium bicarbonate. The layers were separated. The organic layer was washed with brine, dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was loaded onto silica gel and purified by silica gel chromatography (0-30% meoh in DCM) to provide the title compound 97. 1 H NMR (400 MHz, methanol-d 4) delta 7.98 (s, 1H), 7.52 (d, J=1.4 Hz, 1H), 7.49-7.43 (m, 1H), 7.39 (ddd,J＝8.3,2.6,1.4Hz,1H),7.24(d,J＝4.7Hz,1H),7.04(d,J＝4.7Hz,1H),5.56(d,J＝5.1Hz,1H),4.81(d,J＝13.1Hz,1H),4.60(d,J＝13.0Hz,1H),4.53–4.43(m,2H),4.32–4.08(m,2H),4.08–3.85(m,2H),3.72–3.59(m,1H),1.54(dt,J＝7.3,4.7Hz,2H),1.30(d,J＝4.1Hz,22H),0.93(t,J＝6.7Hz,3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.45. MS M/z [ M+1 ]]＝731.3
Example 98: compound 98 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((S) -2- ((3-chloro-5-cyanobenzyl) oxy) -3- (hexadecane) Oxy) propyl) hydrogen phosphate
To ((3 aS,4R,6S,6 aS) -6- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazin-7-yl) -4-cyano-2, 2-dimethyltetrahydrofurano [3,4-d][1,3]Dioxacyclopenten-4-yl) methyl ((S) -2- ((3-cyano-5-fluorobenzyl) oxy) -3- (hexadecyloxy) propyl) hydrogen phosphate, intermediate I-261 (84 mg,0.103mmol,1.0 eq.) was added to a solution of HCl (0.50 mL,12.0M,58 eq.) in THF (4.0 mL). The reaction mixture was stirred at room temperature for 6h. The solution was diluted with ethyl acetate (50 mL) and neutralized with saturated sodium bicarbonate. The layers were separated. The organic layer was washed with brine, dried over Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude residue was loaded onto silica gel and purified by silica gel chromatography (0-30% meoh in DCM) to provide the title compound 98. 1 H NMR (400 MHz, methanol-d 4) delta 7.91 (s, 1H), 7.71-7.60 (m, 4H), 7.07 (d, j=4.6 hz, 1H), 6.95 (d, j=4.6 hz, 1H), 5.56 (d, j=5.2 hz, 1H), 4.76 (d, j=13.2 hz, 1H), 4.64 (d, j=13.2 hz, 1H), 4.56 (t, j=5.3 hz, 1H), 4.51 (d, j=5.4 hz, 1H), 4.19 (qd, j=11.0, 5.2hz, 2H), 4.00 (hept, j=5.6 hz, 2H), 3.80 (p, j=5.3 hz, 1H), 3.53 (q, j=4.2 hz, 2H), 3.44 (td, j=6.5, 3.3 hz,2 hz), 4.9 (t, 3.7 hz, 3H), 4.19 (d, 1.5.5 hz, 3H), 3.9 (t, 3H). 31 P NMR (162 MHz, methanol-d 4) delta-0.65. 19 F NMR (376 MHz, methanol-d 4) delta-77.51.MS m/z[M]＝819.3.
Example 99: compound 99 ((2 r,3s,4r,5 s) -5- (4-aminopyrrolo [2, 1-f)][1,2,4]Triazine-7- Phenyl) -2-cyano-3, 4-dihydroxytetrahydrofuran-2-yl methyl ((R) -2- ((3-cyano-5-fluorobenzyl) oxy) -3- (pentadecade Alkoxy) propyl) hydrogen phosphate
To a solution of intermediate I-266 (200 mg,0.193 mmol) in THF (5 mL) cooled in an ice-bath was added concentrated HCl (0.804 mL). The reaction mixture was warmed to room temperature and stirred for 3 hours. The solution was cooled to 0 ℃ and small ice particles were added followed by dropwise addition of NaOH solution (2M aqueous solution) until a pH of-8 was reached. To this solution, phosphoric acid (85% aqueous solution) was added to adjust the pH to 3. To the solution was added a mixture of Me-THF/EtOAc (3/2, 50 mL). The solution was transferred to a separation flask and the transfer was completed with water (10 mL). The organic layer was separated and the aqueous layer was re-extracted with Me-THF/EtOAc (3/2, 50 mL). The organic fractions were combined and washed once with brine/water (3/2, 50 mL). The organic layer was purified by Na 2 SO 4 Drying and concentration gave the crude product. The crude product was dissolved in 5% meoh/DCM, loaded onto a 24g gold column and purified by flash column chromatography (3 min 100% hex,2 min 100% DCM,16 min 0-100% meoh/DCM). The desired product was eluted with 50% MeOH/DCM. Fractions containing the pure product were combined and concentrated to give compound 99. 1 H NMR (400 MHz, methanol-d) 4 )δ7.81(s,1H),7.53(s,1H),7.45-7.42(m,1H),7.38-7.35(m,1H),6.85(d,J＝4.6Hz,1H),6.83(d,J＝4.6Hz,1H),5.56(d,J＝5.1Hz,1H),4.71(d,J＝13.3Hz,1H),4.62(d,J＝13.4Hz,1H),4.56(dd,J＝17.0,5.4Hz,2H),4.21-4.11(m,2H),4.01–3.90(m,2H),3.77-3.72(m,1H),3.56–3.45(m,2H),3.45–3.36(m,2H),1.61-1.51(m,2H),1.34-1.27(m,24H),0.92(t,J＝6.8Hz,3H). 31 P NMR (162 MHz, methanol-d) 4 )δ-0.33.MS m/z[M+1]＝789.16
D. Biological examples
50 EXAMPLE A DENV-2moDC EC
Human monocyte-derived dendritic cells (moDCs) were derived from CD14+ monocytes (AllCells) cultured in human Mo-DC differentiation medium (Miltenyi Biotec) containing GM-CSF and IL-4. On day 7, modcs were harvested by mechanical disruption, washed, and suspended in serum-free RPMI. The mocc was infected with Dengue type 2 virus (ero-modified strain 2) from Vero for two hours with moi=0.1 in serum-free RPMI with gentle agitation at 37 ℃. Cells were washed and resuspended in 10% serum-containing RPMI (Gibco, supplemented with sodium pyruvate, NEAA, penicillin-streptomycin). 10-5 cells were plated in triplicate in 96-well plates, where the compounds were distributed in graded doses (Hewlett-Packard D300 digital distributor). All wells were normalized to 0.25% DMSO. At 48 hours, cells were washed with 1×pbs and all supernatant removed. Total RNA was extracted using RNeasy 96 plate (Qiagen) and was generated using XLT cDNA 5X Supermix (QuantaBio). The cDNA was used as a template in Taqman qPCR duplex reactions specific for the expression of the DENV2 virus and GAPDH genes. Determination of EC using Prism Graphpad software 50 Values, normalized to positive control and no complex negative control wells.
50 EXAMPLE B MoDC CC
Human monocyte-derived dendritic cells (moDCs) were derived from CD14+ monocytes (AllCells) cultured in human Mo-DC differentiation medium (Miltenyi Biotec) containing GM-CSF and IL-4. On day 7, moDCs were harvested by mechanical disruption, washed and cultured in triplicate in 96-well plates with 1X 10≡5-5X 10≡4 cells/well, where the compounds were distributed in graded doses (Hewlett-Packard D300 digital distributor). All wells were normalized to 0.25% DMSO. After 48 hours, cellTiter Glo (Promega) was added and incubated for 10min at room temperature before reading on a photometer. The% viability curve was calculated relative to the compound-free and cell-free control wells. CC determination Using Prism Graphpad software 50 Values.
50 EXAMPLE C DENV-2Huh-7 EC
Huh7 (human liver cancer 7) cells were maintained in DMEM complete medium containing 10% FCS. On the day of the assay, cells were trypsinized (0.1% trypsin-EDTA), washed, and infected with dengue serotype 2 xinguinea C (NGC) strain in serum-free DMEM with moi=0.1 with gentle agitation at 37 ℃ for 2 hours. After 2 hours, the cells were washed with serum-free medium and suspended in DMEM (Gibco, supplemented with sodium pyruvate, NEAA, penicillin-streptomycin) containing 10% FCS. 10-5 cells were plated in triplicate in 96-well plates, where the compounds were distributed in graded doses (Hewlett-Packard D300 digital distributor). All wells were normalized to 0.25% DMSO. At 48 hours, cells were washed with 1×pbs and all supernatant removed. Total RNA was extracted using RNeasy 96 plate (Qiagen) and was generated using XLT cDNA 5X Supermix (QuantaBio). The cDNA was used as a template in Taqman qPCR duplex reactions specific for the expression of the DENV2 virus and GAPDH genes. Determination of EC using Prism Graphpad software 50 Values, normalized to positive control and no complex negative control wells.
50 EXAMPLE D Huh-7 CC
Human liver cancer 7 (Huh 7) cells were maintained in complete DMEM containing 10% FCS. On the day of assay, cells were trypsinized with 0.1% trypsin-EDTA, washed, and cultured in triplicate in 96-well plates at 1-2X 10-4 cells/well, with compounds distributed in fractionated doses (Hewlett-Packard D300 digital distributor). All wells were normalized to 0.25% DMSO. After 48 hours, cellTiter Glo (Promega) was added and incubated for 10min at room temperature before reading on a photometer. The% viability curve was calculated relative to the compound-free and cell-free control wells. CC determination Using Prism Graphpad software 50 Values.
50 EXAMPLE E RSV HEp-2 EC
Antiviral activity against RSV was determined in HEp-2 cells using an infectious cytopathic cytoprotective assay. In this assay, compounds that inhibit viral infection and/or replication produce cytoprotective effects against virus-induced cell killing, which can be quantified using cell viability reagents. The technique used here is a novel adaptation of the method described in the publication (Chapman et al, antimicrob Agents chemother.2007,51 (9): 3346-53).
HEp-2 cells were obtained from ATCC (Manassas, VI) and maintained in MEM medium supplemented with 10% fetal bovine serum and penicillin/streptomycin. Cells were passaged twice a week and maintained in the sub-confluent stage. Commercial stock of RSV strain A2 (Advanced Biotechnologies, columbia, MD) was titrated prior to compound testing to determine the appropriate dilution of the viral stock that produced the desired cytopathic effect in HEp-2 cells.
For antiviral testing, HEp-2 cells were grown to near confluence, but not full confluence, in large cell flasks. Compounds to be tested were pre-diluted in DMSO in 384 Kong Huage dilution plates in standardized dose-response format of 8 or 40 samples/plate. A 3-fold serial dilution increment of each test compound was prepared in the plate and the test samples were transferred via an acoustic transfer device (Echo, labcyte) into a 384 well plate for cell culture assays at 100 nL/well. Dilutions of each compound were transferred to dry assay plates in single or quadruplicate samples and stored until ready for assay. The positive and negative controls are arranged in vertical blocks (1 column) at opposite ends of the plate.
Subsequently, an infectious mixture was prepared using an appropriate dilution factor of the virus stock previously determined by titration with cells having a density of 50,000/ml, and 20 μl/well was added to the compound-containing test plate via automation (uplow, biotek). Each plate included negative and positive controls (16 replicates each) to generate 0% and 100% virus inhibition standards, respectively. After infection with RSV, the test plates were incubated for 4 days at 37 ℃ in a cell incubator. After incubation, the Cell viability reagent Cell titer glo (Promega, madison, WI) was added to the assay plates, incubated briefly, and luminescence readings (Envision, perkin Elmer) were measured in all assay plates. The RSV-induced cytopathic effect (percent inhibition) is determined by the level of residual cell viability. These values were calculated for each test concentration relative to the 0% and 100% inhibition controls, and for each compound EC 50 Values were determined by nonlinear regression to be concentrations that inhibited RSV-induced cytopathic effects by 50%. Various potent anti-RSV tool compounds were used as positive controls for antiviral activity.
50 EXAMPLE F HEp-2 CC
Cytotoxicity of test compounds was measured in parallel with antiviral activity in uninfected HEp-2 cells using cell viability reagents in a similar manner as described previously for other cell types (Cihlar et al Antimicrob Agents chemther. 2008,52 (2): 655-65). In contrast, the same density of uninfected cell mixtures was added at 20 ul/well to the plate containing the pre-diluted compound (also 100 nL/sample). The assay plates were then incubated for 4 days, followed by a cell viability test measured using the same CellTiter Glo reagent addition and luminescence readings. Untreated cells and cells treated with 2 μm puromycin (Sigma, st.louis, MO) were used as 100% and 0% cell viability controls, respectively. The percent cell viability for each test compound concentration was calculated relative to the 0% and 100% controls, and CC 50 Values were determined by nonlinear regression as the concentration of compound that reduced cell viability by 50%.
50 Examples G.HEp-2 and MT4 CC
Cytotoxicity of compounds was determined in uninfected cells using cell viability reagents in a similar manner as described previously for other cell types (Cihlar et al Antimicrob Agents chemther. 2008,52 (2): 655-65.) HEp-2 cells (1.5X103 cells/well) and MT-4 cells (2X 103 cells/well) were plated in 384 well plates and incubated with appropriate medium containing 3-fold serial dilutions of the compounds (ranging from 15nM to 100,000 nM). Cells were cultured at 37℃for 4-5 days. After incubation, cells were equilibrated to 25 ℃, and Cell viability was determined by adding Cell-Titer Glo viability reagent. The mixture was incubated for 10 minutes and the luminescence signal was quantified using an Envision microplate reader. Untreated cells and treated with 2. Mu.M puromycin (Sigma, st. Louis, MO)Cells were used as 100% and 0% cell viability controls, respectively. The percent cell viability was calculated for each tested compound concentration relative to the 0% and 100% controls, and CC was determined by nonlinear regression according to the compound concentration that reduced cell viability by 50% 50 Values.
50 EXAMPLE H RSV NHBE EC
Normal Human Bronchial Epithelial (NHBE) cells were purchased from Lonza (Walkersville, MD, catalog No. CC-2540) and cultured in bronchial epithelial cell growth medium (BEGM) (Lonza, walkersville, MD, catalog No. CC-3170). Cells were passaged 1-2 times per week to maintain <80% confluency. NHBE cells were discarded after 6 passages of culture.
For RSV A2 antiviral assay, NHBE cells were plated in BEGM in 96 well plates at a density of 7,500 cells/well and allowed to adhere overnight at 37 ℃. After adherence, 100 μl of cell culture medium was removed and 3-fold serial dilutions of the compound were added using a Hewlett-Packard D300 digital partitioning apparatus. The final concentration of DMSO was normalized to 0.05%. After addition of the compound, by adding the compound in an amount of 1X 10 4.5 Titers of individual tissue culture infectious dose/mL 100 μl of RSV A2 was added to BEGM to infect NHBE cells, followed by incubation at 37 ℃ for 4 days. The NHBE cells were then equilibrated to 25℃and Cell viability was determined by removing 100. Mu.L of medium and adding 100. Mu.L of Cell-Titer Glo viability reagent. The mixture was incubated at 25℃for 10min and the luminescence signal was quantified on an Envision luminescence plate reader.
50 EXAMPLE I RSV NHBE FLuc EC
Normal Human Bronchial Epithelial (NHBE) cells were purchased from Lonza (Walkersville, MD, catalog No. CC-2540) and maintained in bronchial epithelial cell growth medium (BEGM) with all supplements provided in the BulletKit (Lonza, walkersville, MD, catalog No. CC-3170). Cells were passaged 2-3 times per week to maintain sub-confluent density and used for experiments at passage 2-4.
Recombinant respiratory syncytial virus strain A2 (RSV-Fluc, 6.3X10) containing firefly luciferase reporter gene between P and M genes 6 TCID(s) 50 Per mL) from viraree (Durham, NC, catalog No. R145).
NHBE cells (5X 10) 3 Well) was inoculated in 100 μl white wall/clear bottom 96 well plate (Corning) with medium and incubated at 37 ℃ and 5% CO 2 Incubation was performed for 24 hours. The next day, three-fold serial dilutions of compounds prepared in DMSO were added to wells using an HP D300e digital dispenser, normalized to the highest concentration of DMSO in all wells. Cells were then infected with RSV-Fluc diluted with BEGM medium at moi=0.1, with a final volume of 200 μl medium/well. Uninfected and untreated wells were included as controls to determine the efficacy of the compounds on RSV-Fluc. At 37℃and 5% CO 2 After three days following incubation with the compounds and viruses, 100. Mu.L of culture supernatant was removed from each well and replaced with 100. Mu.L of ONE-Glo luciferase reagent (Promega, madison, wis., catalog number E6110). The plates were gently mixed by shaking at 21℃for 10 minutes and the luminescence signal was measured using an Envision microplate reader (Perkinelmer). Values were normalized to uninfected and infected DMSO controls (0% and 100% infection, respectively). Using XLfit4 insert of (a), non-linear regression analysis was applied to determine the concentration of compound (EC) at which the luminescence signal was reduced by 50% 50 ). All experiments were performed in duplicate and the technique was repeated twice each time.
50 EXAMPLE J RSV NHBE CC
NHBE cells were treated at 2X10 3 Individual cells/wells were seeded in black 384-TC treated plates (Corning) with a final volume of 20 μl bebm+ supplement (Lonza). The next day, 0.1 μl of compound was added to the test plate using an Echo sound dispenser. The plates were exposed to 5% CO at 37 ℃ 2 Incubate for an additional 3 days. On day 3 of treatment, 20 μl CellTiter Glo (Promega) was added to each well using a Biotek dispenser. After incubation for 10 minutes, the luminescence signal was measured with an EnVision (Perkin-Elmer) plate reader at an integration time of 0.1 seconds. Values were normalized to DMSO and puromycin treated controls (0% and 100% cell death, respectively). Using non-linearitiesRegression analysis fits the data, then CC 50 The value was determined as the concentration that reduced the luciferase signal by 50%. The compiled data was generated based on at least two independent experimental replicates, each replicate containing four replicates of the technique for each concentration.
50 EXAMPLE K RSVHAE EC
HAE cells are cultured at an air-liquid interface and have a topside exposed to air and a basal side in contact with the culture medium. Prior to the experiment, HAE was removed from the agar-based shipping package and was conditioned in 1ml HAE assay medium (AIR-100-MM, mattek Corp) at 37 ℃/5% CO 2 Overnight. HAE was prepared for infection by washing the top surface twice with 400 μl of PBS (either by direct pipetting or by running each transwell through a tank containing PBS) to remove the mucus layer. The top chamber PBS was vented and tapped onto the absorbent material to remove as much PBS as possible. After washing, cells were transferred to fresh HAE maintenance medium containing 4-fold serial dilutions of the compound, delivered to the basal side of the cell monolayer, and diluted 1:600 with 100 μl of RSV a strain A2 x 1000x stock (ABI, columbia, MD, catalog No. 10-124-000) at 37 ℃ with 5% CO in HAE assay medium 2 Middle top infection for 3 hours. The viral inoculum was removed and the top surface of the cells was washed 3 times with PBS using the method described previously. The cells were then incubated at 37℃for 3 days in the presence of the compound. After incubation, total RNA was extracted from HAE cells using MagMAX-96 viral RNA isolation kit (Applied Biosystems, foster City, calif., catalog number AM 1836) and intracellular RSV RNA was quantified by real-time PCR. Approximately 25ng of purified RNA was added to a PCR reaction mixture (Applied Biosystems, foster City, calif., catalog No. 4392938) containing 0.9. Mu.M RSV N forward primer and RSV N reverse primer, 0.2. Mu.M RSV N probe, and 1x Taqman RNA-to-Ct 1 step kit. RNA levels were normalized using Taqman GAPDH control primer set (Applied Biosystems, foster City, calif., catalog number 402869). Real-time PCR primers and probes used in RSV A2 HAE antiviral assay: RSV N forward primer CATCCAGCAAATACACCATCCA (SEQ ID NO: 1), RSV N reverse primer TTCTGCACATCATAATTAGGAGTATCAA (SE) Q ID NO: 2), RSV N probe FAM-CGGAGCACAGGAGAT-BHQ (SEQ ID NO: 3).
Example L.HRV16 HELA EC 50
The day before compound dosing and infection, H1-HeLa cells cultured in complete DMEM medium containing 10% heat-inactivated FBS and 1% penicillin/streptomycin were seeded at 3000 cells/well in 96-well plates. Antiviral activity of each compound was measured in triplicate. Immediately prior to infection, compounds were added directly to cell cultures in serial 3-fold dilutions using a HP300 digital dispenser (Hewlett Packard, palo Alto, CA). Plates were transferred to BSL-2 containers and appropriate dilutions of viral stock, previously determined by titration and prepared in cell culture medium, were added to test plates containing cells and serial dilutions of compounds. Each plate included 6 wells of infected untreated cells and 6 wells of uninfected cells, which served as 0% and 100% virus inhibition controls, respectively. After infection, the test plate was set at 33 ℃/5% CO 2 Is incubated for 96 hours in a tissue incubator. After incubation, H1-HeLa cells were removed from the incubation and equilibrated to 25 ℃. Cell viability was determined by removing 100 μl of medium and adding 100 μl of Cell-Titer Glo viability reagent. The mixture was incubated for 10min at 25℃on a shaker and the luminescence signal was quantified on an Envision luminescence plate reader. The percent inhibition of viral infection was calculated for each tested concentration relative to the 0% and 100% inhibition controls, and EC for each compound 50 The values were determined by 4-parameter nonlinear regression as effective compound concentrations that inhibited cytopathic effects by 50%.
50 Example M.HRV1A HELA EC
The day before compound dosing and infection, H1-HeLa cells cultured in complete RPMI 1640 medium containing 10% heat-inactivated FBS and 1% penicillin/streptomycin were seeded at 5000 cells/well in 96-well plates. Antiviral activity of each compound was measured in triplicate. Immediately prior to infection, compounds were added directly to cell cultures in serial 3-fold dilutions using a HP300 digital dispenser (Hewlett Packard, palo Alto, CA). Transfer of plates to BSL-2 limitAnd 100 μl of 1/4000 dilution of HRV1a virus stock was added to each well containing cells and serially diluted compounds. Each plate contained 6 infected untreated cell wells and 6 cell wells containing 5 μm Rupintrivir, which served as 0% and 100% virus inhibition controls, respectively. After infection, the test plate was set at 37 ℃/5% CO 2 Is incubated for 96 hours in a tissue culture incubator. After incubation, H1-HeLa cells were removed from the incubation and equilibrated to 25 ℃. Cell viability was determined by removing 100 μl of medium and adding 100 μl of Cell-Titer Glo viability reagent. The mixture was incubated for 10min at 25℃on a shaker and the luminescence signal was quantified on an Envision luminescence plate reader. The percent inhibition of viral infection was calculated for each tested concentration relative to the 0% and 100% inhibition controls, and EC for each compound 50 The values were determined by 4-parameter nonlinear regression as effective compound concentrations that inhibited cytopathic effects by 50%.
50 Example N.HRV14 HELA EC
The day before compound dosing and infection, H1-HeLa cells cultured in complete RPMI 1640 medium containing 10% heat-inactivated FBS and 1% penicillin/streptomycin were seeded at 5000 cells/well in 96-well plates. Antiviral activity of each compound was measured in triplicate. Immediately prior to infection, compounds were added directly to cell cultures in serial 3-fold dilutions using a HP300 digital dispenser (Hewlett Packard, palo Alto, CA). Plates were transferred into BSL-2 restriction and 100 μl of 1/4000 dilution of HRV14 virus stock was added to each well containing cells and serially diluted compounds. Each plate contained 6 infected untreated cell wells and 6 cell wells containing 5 μm Rupintrivir, which served as 0% and 100% virus inhibition controls, respectively. After infection, the test plate was set at 37 ℃/5% CO 2 Is incubated for 96 hours in a tissue culture incubator. After incubation, H1-HeLa cells were removed from the incubation and equilibrated to 25 ℃. Cell viability was determined by removing 100 μl of medium and adding 100 μl of Cell-Titer Glo viability reagent. The mixture was warmed at 25℃on a shaker Incubated for 10min and luminescence signals were quantified on an Envision luminescence plate reader. The percent inhibition of viral infection was calculated for each tested concentration relative to the 0% and 100% inhibition controls, and EC for each compound 50 The values were determined by 4-parameter nonlinear regression as effective compound concentrations that inhibited cytopathic effects by 50%.
50 Examples O.HRVc15 and HRVc25 EC
First, HRV replicon RNA was prepared. 5ug of DNA template (HRVc 15 or HRVc 25) was linearized with 2. Mu.L of MluI enzyme in NEB buffer-3 at a final volume of 25. Mu.L for 3 hours at 37 ℃. After incubation, the linearized DNA was purified on a PCR purification column and the following in vitro transcription was performed using the following conditions: 10. Mu.L of RiboMAX Express T7 2 Xbuffer, 1. Mu.L-8. Mu.L of linear DNA template (1. Mu.g), 0. Mu.L-7. Mu.L of nuclease-free water, 2. Mu.L of enzyme mix T7express. Mix final volume of 20 μl and incubate at 37 ℃ for 30 minutes. After incubation, 1 μl of RQ1 dnase free of rnase was added and the mixture incubated at 37 ℃ for 15 minutes. The resulting RNA was then purified using MegaClear kit (Gibco Life Technologies catalog No. 11835-030) and eluted twice with 50. Mu.L of elution buffer at 95 ℃. The day before transfection, H1-HeLa cells cultured in complete RPMI 1640 medium containing 10% heat-inactivated FBS and 1% penicillin/streptomycin were inoculated into T-225 flasks at a concentration of 2E6 cells/bottle and at 37 ℃/5% CO 2 Incubate overnight. On the day of transfection, cells were trypsinized according to standard cell culture protocols and washed twice with PBS. After washing, cells were resuspended in PBS at a concentration of 1E7 cells/mL and the suspension was stored on wet ice. Replicon RNAs were introduced into H1-HeLa cells using electroporation. mu.L final volumes containing 10. Mu.g replicon c15 or 1. Mu. g c25 replicon RNA, respectively, were pipetted into 4mm electroporation cuvette. H1-HeLa cell stock was mixed by gentle spin and 0.5mL of the cell stock previously prepared was transferred to a cuvette containing replicon RNA. The combined solutions were flicked to mix. Immediately after mixing, cells were electroporated using the following setup: 900V, 25uF, infinite resistance, 1 pulse. The cuvette was left to stand on ice for 10 minutes. Incubation methodAfter 10 minutes of incubation, 19mL of RPMI 1640 with 10% heat-inactivated FBS, without phenol red and without antibiotics, at ambient temperature was added per electroporation. 150 μl (4E 4 cells) of the electroporated cell suspension was inoculated into each well of a 96-well clear bottom, white cell culture plate and incubated at 25 ℃ for 30 minutes. Compounds were added directly to cell cultures in serial 3-fold dilutions and tested in triplicate using a HP300 digital dispenser (Hewlett Packard, palo Alto, CA). After addition of the compound, the plates were incubated at 33 ℃ for 48 hours. Replicon activity was then measured by a Renilla-Glo luciferase assay system. Plates were removed from the incubator prior to signal quantification and equilibrated to 25 ℃ after 50uL from each well. A1:100 dilution of Renill-Glo substrate and buffer was prepared according to the manufacturer's protocol, and 100uL of the Renill-Glo luciferase mixture was added to each well. Plates were then incubated at 25 ℃ for 20 minutes with gentle agitation, and luciferase signals were determined using an EnVision luciferase quantitation reader with a 0.1 second detection setup. The percent inhibition of replicon inhibition was calculated for each test concentration relative to the 0% and 100% inhibition controls included in the experiment, and EC for each compound was determined by 4-parameter nonlinear regression as the effective concentration of the compound that inhibited luciferase signal by 50% 50 Values.
50 EXAMPLE P DENV-2 Huh-7Rep EC
In 384 well plates (Greiner, cat. No. 781091), compounds were acoustically transferred at 200 nl/well in 8 compound dose-response patterns (4 replicates) or 40 compound dose-response patterns (3 replicates). For all plates tested, balapinavir (balapinavir), GS-5734 and NITD008 were included as positive inhibition controls, also including 0% inhibition, DMSO only negative control wells. Following the addition of the compounds, huh-7 cells containing the DENV2 replicon construct were harvested following standard cell culture procedures and adjusted to a concentration of 1.25E5 cells/mL in cell culture medium consisting of cDMEM without gentamicin. Then 40 μl of cell stock was added to each well to give a final cell density of 5,000 cells/well. The cells and compound mixture were mixed at 37℃C/5% CO 2 Incubate for 48 hours. Prior to harvesting cells, an EnduRen viable cell substrate (Promega, catalog No. E6481) was prepared by suspending 3.4mg in 100uL DMSO to produce a 60mM stock solution. Stock solutions were then diluted 1:200 in preheated cDMEM and 10uL of this diluted solution was added to each well of 384 well plates. The plates were then briefly centrifuged at 500rpm and placed on a plate shaker for 2min. After mixing, the plates were incubated at 7deg.C/5% CO 2 Incubate for 1.5 hours and then measure luminescence on an Envision photometer. The percent inhibition of replicon signals was calculated for each test concentration relative to 0% and 100% inhibition controls, and EC for each compound 50 The values were determined by 4-parameter nonlinear regression as effective compound concentrations that inhibited cytopathic effects by 50%.
50 EXAMPLE Q HCV Rep 1B and 2A EC
The compounds were serially diluted in 384 well plates in ten steps at 1:3 dilution. All serial dilutions were performed in four replicates of each compound in the same 384 well plate. 100. Mu.M of the HCV protease inhibitor ITMN-191 was added as a 100% inhibition control of HCV replication, while 10mM puromycin was included as a 100% cytotoxicity control. To each well of a black polystyrene 384-well plate (Greiner Bio-one, monroe, NC) 90 μl of cell culture medium (geneticin-free) containing 2000 HCV replicon cells in suspension was added using a Biotek μ Flow station. To transfer the compounds into the cell culture plates, 0.4 μl of compound solution from the compound serial dilution plate was transferred into the cell culture plates on the Biomek FX workstation. The DMSO concentration in the final assay wells was 0.44%. The plates were incubated at 37℃with 5% CO 2 And incubated at 85% humidity for 3 days. HCV replicon assays are multiplex assays that allow simultaneous assessment of cytotoxicity and anti-replicon activity from the same well. First, CC is performed 50 And (5) measuring. The medium in 384 well cell culture plates was aspirated and the wells were washed four times with 100 μl PBS each using a Biotek ELX405 plate washer. A volume of 50. Mu.L of a solution containing 400nM calcein acetyl methyl ester (Anaspec, fremont, calif.) in 1 XPBS was added to each well of the plate using a Biotek. Mu. Flow station. The plates were incubated for 30min at room temperature, then with PerThe kin-Elmer Envision plate reader measures fluorescence signals (excitation 490nm, emission 520 nm). EC (EC) 50 Measured at the same time as CC 50 The same wells were measured. The calcein-PBS solution in 384-well cell culture plates was aspirated using a Biotek ELX405 plate washer. A volume of 20. Mu.L of Dual-Glo luciferase buffer (Promega, madison, wis.) was added to each well of the plate using a Biotek. Mu.flow station. Plates were incubated for 10min at room temperature. A volume of 20. Mu.L was prepared with a Biotek. Mu.Flow workstation containing Dual-Glo Stop&Glo substrates (Promega, madison, wis.) and Dual-Glo Stop&A solution of a 1:100 mixture of Glo buffer (Promega, madison, wis.) was added to each well of the plate. The plates were then incubated at room temperature for 10min, followed by measurement of luminescence signals using a Perkin-Elmer Envision plate reader.
EXAMPLE R HEp-2 RSV-Luc5 384 well assay (EC 50_RSVFLUC_Hep2-384)
HEp-2 cell lines were purchased from ATCC (Manassas, va., catalog number CCL-23) and maintained in Dulbecco's Minimal Essential Medium (DMEM) (Corning, new York, NY, catalog number 15-018 CM) supplemented with 10% Fetal Bovine Serum (FBS) (Hyclone, logan, UT, catalog number SH 30071-03) and 1X penicillin-streptomycin-L-glutamine (Corning, new York, NY, catalog number 30-009-CI). Cells were passaged 2 times per week to maintain sub-confluent density and used for experiments at passage 5-20. Respiratory syncytial virus recombinants with luciferase (RSV-Luc 5) direct particle virus (. Gtoreq.1X 107TCID 50/ml) were purchased from microbiology (Saint Cloud, MN). Viral replication in HEp-2 cells was determined as follows.
Compounds were prepared in 384 well polypropylene plates (Greiner, monroe, NC, cat# 784201), 8 compounds per plate, divided into 4 replicates at 10 serial dilution concentrations (1:3).
HEp-2 cells were suspended in DMEM (supplemented with 10% FBS and 1 Xpenicillin-streptomycin-L-glutamine) and 60. Mu.L 4,000 cells/well were seeded into 384-well plates (Greiner, monroe, NC, cat. 781080) using a Biotek MultiFlo dispenser. At 37℃and 5% CO 2 After overnight incubation, 0.4 μl of triplicate serial dilutions of compound were added to each well using a Biomek FX pipetting station. RSV-Luc5 virus was diluted at moi=0.5In DMEM (supplemented with 10% fbs and 1X penicillin-streptomycin-L-glutamine). Viral suspensions were added to each 384-well compound plate at 20 μl per well using a Biotek MultiFlo dispenser. The assay plate was incubated at 37℃with 5% CO 2 Incubate for 3 days. At the end of incubation, one-Glo reagent (Promega, madison, WI, catalog No. E6120) was prepared. The assay plate and reagents were equilibrated to room temperature for 30 minutes. mu.L of medium was removed from each well of the assay plate and 40. Mu.L of One-Glo reagent per well was added to each plate by Biomek FX. The plate was allowed to stand at room temperature for 15 minutes. Viral replication was then assessed by measuring the luminescence signal using an Envision microplate reader. Adefovir was used as a positive control and DMSO was used as a negative control. Values were normalized to positive and negative controls (0% and 100% replicates, respectively) and data were fitted by Gilead dose response tool using nonlinear regression analysis. EC of each compound is then applied 50 The value was determined as the concentration that reduced viral replication by 50%.
50 Examples S.HEp-2 and MT4 CC
Cytotoxicity of compounds was determined in uninfected cells using cell viability reagents in a similar manner as described previously for other cell types (Cihlar et al Antimicrob Agents chemther. 2008,52 (2): 655-65.) HEp-2 cells (1.5X103 cells/well) and MT-4 cells (2X 103 cells/well) were plated in 384 well plates and incubated with appropriate medium containing 3-fold serial dilutions of the compounds (ranging from 15nM to 100,000 nM). Cells were cultured at 37℃for 4-5 days. After incubation, cells were equilibrated to 25 ℃, and Cell viability was determined by adding Cell-Titer Glo viability reagent. The mixture was incubated for 10 minutes and the luminescence signal was quantified using an Envision microplate reader. Untreated cells and cells treated with 2 μm puromycin (Sigma, st.louis, MO) were used as 100% and 0% cell viability controls, respectively. The percent cell viability was calculated for each tested compound concentration relative to the 0% and 100% controls, and CC was determined by nonlinear regression according to the compound concentration that reduced cell viability by 50% 50 Values.
Example T.H1-Hela anti-HRV assay
H1-HeLa cells and human rhinovirus 16 (HRV-16) were purchased from ATCC.
The H1-HeLa maintenance medium consisted of DMEM supplemented with 10% FBS and 1% Penn/Strep. The Virus Infection Medium (VIM) consisted of dmem+2% fbs.
In H1-HeLa maintenance solution, H1-HeLa cells were seeded into 96-well black/transparent plates at 5000 cells/well and 100. Mu.L/well, and incubated at 37℃and 5% CO 2 Incubate for 24 hours. The next day, the medium was aspirated and replaced with 100 μl of VIM, and three-fold serial dilutions of the compound prepared in DMSO were then added to wells using HP D300e digital dispenser, normalized to the highest concentration of DMSO in all wells. HRV-16 was diluted with VIM to moi=0.05 and added to the cells at 100 μl/well. On each plate, uninfected and infected DMSO controls were included to determine the efficacy of the compounds on HRV. When at 37 ℃ and 5% CO 2 When extensive cell denaturing effects were observed in the positive control following incubation (typically 3-6 days post infection), the plates were cooled to room temperature. The medium was removed and 200. Mu.L CellTiter Glo (1:2 dilution in PBS) was added to each well. Plates were stirred on a shaker for 10 minutes at room temperature and luminescence signals were measured using an EnVision plate reader (PerkinElmer). Values were normalized to uninfected and infected DMSO controls (0% and 100% infection, respectively). Using XLfit4 insert of (a), non-linear regression analysis was applied to determine the concentration of compound (EC) at which the luminescence signal was reduced by 50% 50 ). All experiments were performed in duplicate and the technique was repeated twice.
EXAMPLE U.NHBE RSV-Luc5384 well assay (EC50_RSVFLUC_NHBE-384)
Normal Human Bronchial Epithelial (NHBE) cells were purchased from LonzaWalkersville, MDCat # CC2540 and maintained in BEGM bronchial epithelial cell growth medium BulletKit (Lonza CC-3170).
Cells were thawed, expanded and used in the generation 2 experiments. Recombinant respiratory syncytial virus (RSV-Luc 5) (. Gtoreq.1X10) with luciferase 7 Infection units per ml (IU/ml), by TCID 50 Assay) was purchased from microbiology (Saint Cloud, MN). Viral replication in NHBE cells was determined as follows.
Compounds were prepared in 384 well polypropylene plates (Greiner, monroe, NC, cat# 784201), 8 compounds per plate, divided into 4 replicates at 10 serial dilution concentrations (1:3). Serially diluted compounds were transferred to low dead volume Echo plates (labcyto, sunnyvale, CA, cat#lp-0200).
Test compounds were spotted onto 384 well assay plates (Greiner, monroe, NC, cat# 781091) at 200 nL/well. NHBE cells were harvested and suspended in BEGM bronchial epithelial cell growth medium BulletKit and seeded at 5000 cells/well in 30. Mu.L on pre-spotted assay plates. RSV-Luc5 was diluted at 500000 Infectious Units (IU)/mL in BEGM bronchial epithelial cell growth medium BulletKit and 10. Mu.L per well was added to assay plates containing cells and compounds with an MOI of 1. The assay plate was incubated at 37℃with 5% CO 2 Incubate for 3 days. At the end of incubation, one-Glo reagent (Promega, madison, WI, catalog No. E6120) was prepared. The assay plate and One-Glo reagent were equilibrated to room temperature for at least 15 minutes. Add 40. Mu.L/well of One-Glo reagent, incubate the plate at room temperature for 15 minutes, and then read the luminescence signal on an EnVision multimode plate reader (Perkin Elmer, waltham, mass.). Adefovir was used as a positive control and DMSO was used as a negative control. Values were normalized to positive and negative controls (0% and 100% replicates, respectively) and data were fitted by Gilead dose response tool using nonlinear regression analysis. EC of each compound is then applied 50 Values are defined as the concentration that reduces viral replication by 50%.
Example V: hep-2 RSV-Luc5 384 well assay (EC50_RSVFLUC_Hep2-384_v2
HEp-2 cell lines were purchased from ATCC (Manassas, va., catalog number CCL-23) and maintained in Dulbecco's Minimal Essential Medium (DMEM) (Corning, new York, NY, catalog number 15-018 CM) supplemented with 10% Fetal Bovine Serum (FBS) (Hyclone, logan, UT, catalog number SH 30071-03) and 1X penicillin-streptomycin-L-glutamine (Corning, new York, NY, catalog number 30-009-CI). Cells were passaged 2 times per week to maintain sub-confluent density and used for experiments at passage 5-20. Respiratory syncytial virus recombinants with luciferase (RSV-Luc 5) (. Gtoreq.1X107 TCID 50/ml) were purchased from microbiology (Saint Cloud, MN). Viral replication in HEp-2 cells was determined as follows.
Compounds were prepared in 384 well polypropylene plates (Greiner, monroe, NC, cat# 784201), 8 compounds per plate, divided into 4 replicates at 10 serial dilution concentrations (1:3). Serially diluted compounds were transferred to low dead volume Echo plates (labcyto, sunnyvale, CA, cat#lp-0200).
Test compounds were spotted onto 384 well assay plates (Greiner, monroe, NC, cat# 781091) at 200 nL/well. HEp-2 cells were harvested and suspended in DMEM (supplemented with 10% FBS and 1 Xpenicillin-streptomycin-L-glutamine) and seeded at 4000 cells/well in 30. Mu.L on pre-spotted assay plates. RSV-Luc5 virus was diluted in DMEM (supplemented with 10% fbs and 1X penicillin-streptomycin-L-glutamine) at 200000 Infection Units (IU)/mL and added at 10 μl per well to assay plates containing cells and compounds, moi=0.5. The assay plate was incubated at 37℃with 5% CO 2 Incubate for 3 days. At the end of incubation, one-Glo reagent (Promega, madison, WI, catalog No. E6120) was prepared. The assay plate and One-Glo reagent were equilibrated to room temperature for at least 15 minutes. Add 40. Mu.L/well of One-Glo reagent, incubate the plate at room temperature for 15 minutes, and then read the luminescence signal on an EnVision multimode plate reader (Perkin Elmer, waltham, mass.). Adefovir was used as a positive control and DMSO was used as a negative control. Values were normalized to positive and negative controls (0% and 100% replicates, respectively) and data were fitted by Gilead dose response tool using nonlinear regression analysis. EC of each compound is then applied 50 The value was determined as the concentration that reduced viral replication by 50%.
50 Example W dengue virus-2 Huh-7 EC
Huh7 hepatoma cells were seeded onto 96-well plates and incubated with 5% CO at 37 ℃C 2 Incubation was carried out overnight. To generate in each well after overnight incubation>Cell concentration seeding level of 70% confluent monolayersA plate. 8 3-fold serial dilutions of the compounds were diluted in test medium (MEM supplemented with 2% FBS and 50. Mu.g/mL gentamicin). The highest test compound concentration was 50 μg/mL. 100 μl of each concentration was added to 5 test wells on a 96-well plate. Of these 5 test wells, 3 wells of each dilution were infected with dengue virus type 2, diluted in test medium (about 2000CCID per well 50 MOI of 0.07). Virus-free test medium (100 μl) was added to 2 wells to represent an uninfected cytotoxicity assay. The other 6 infected wells received only 100 μl of medium as untreated virus control. Furthermore, only 100 μl of medium was added to 6 uninfected wells as an uninfected untreated control. The culture was incubated at 37℃with +5% CO 2 Incubation until it is observed>80% cpe. After observing the cell denaturing effect (CPE) under a microscope, 0.011% neutral red dye was added for about 2 hours. The neutral red dye was removed and the wells were rinsed once with PBS to remove residual unbound dye. 50:50 Sorensen citrate buffer/ethanol solution was added and incubated at room temperature with stirring >The neutral red dye was then measured at 540nm using a spectrophotometer for 30 minutes. The resulting optical density measurements were converted to percent signal for the infected untreated cell control, which was normalized to the virus control. Determination of EC by linear regression analysis 50 And CC 50 Values.
50 EXAMPLE X hMPV H1-Hela EC
The human metapneumovirus (hMPV) antiviral assay is an antinuclear protein ELISA performed on infected H1-HeLa cells. H1-HeLa cells were maintained in Dulbecco's modified Eagle medium with high glucose (Gibco, cat#: 11995073) supplemented with 10% FBS (HyClone, cat#: SH 303396.03), 100 units/mL penicillin, and 100 μg/mL streptomycin (Gibco, cat#: 15140122). The day before infection, H1-HeLa cells were plated at 0.1 mL/well at 1.5X10 5 cells/mL were seeded into Opti-MEM (Gibco, cat. # 31985070) supplemented with 2% FBS in 96-well plates (Corning, cat. # 3903) and incubated at 37℃with 5% (v/v) CO 2 Incubate overnight in 100% humid atmosphere. The next day, CAN97-83-GFP1 (A2 a) hMPV was used to contain 200. Mu.g/mL CaCl 2 And 2 μg/mL TPCK treated trypsin in Opti-MEM medium and distributed into 96-well plates at 0.1 mL/well, moi=0.1. Test compounds were dispensed into each well using an HP D300e digital dispenser with a final volume of 200 μl/well. After centrifugation of the plates at 700g for 1 hour at room temperature, they were kept at 37℃with 5% (v/v) CO 2 For 96 hours in a humidity chamber. After incubation, the medium was removed and the plates were fixed with 0.1 mL/well 1% formaldehyde at room temperature for 15 minutes. The fixative was removed and the plates were air dried for 30-60 minutes and then permeabilized with 0.1 mL/well of 0.5% Triton X-100 in PBS for 5 minutes at room temperature. After permeabilization, the plates were washed once with 0.1 ml/well of blocking buffer (PBS solution containing 10% FBS (Hyclone, cat#: SH 303396.03), 5% milk powder (American Bio, cat#: AB 10109-01000) and 0.1% Tween 20 (EMD Millipore, cat# 655204). Plates were then blocked with 0.1 mL/well blocking buffer for 60 min at 37 ℃. The blocking buffer was removed, and a 1:500 dilution of human metapneumovirus nucleocapsid antibody (Sigma, cat#MAB80121) in blocking buffer was added at 0.05 mL/well and incubated for 2 hours at 37 ℃. Then washed 5 times with 0.2 mL/well 0.1% Tween 20/PBS followed by 0.05 mL/Kong Lagen peroxidase (HRP) -conjugated goat anti-mouse IgG antibody (Fisher Scientific, cat # 501077607) diluted 1:2000 in blocking buffer. After incubation for 1 hour at 37 ℃, the plates were washed 5 times with 0.2 mL/well of 0.1% tween 20 in PBS. HRP signal was generated by adding 0.1 mL/well of TMB reagent (Thermo Scientific, cat#: ENN 301) and incubating at room temperature until positive control was evident. At this point, the reaction was stopped by adding 0.1 mL/well TMB stop solution (SeraCare, cat#: 5150-0021). Absorbance was measured at 450nm using an EnVision plate reader. The relative absorbance was calculated by normalizing the absorbance of the compound-treated group to the absorbance of the DMSO-treated group (set to 100%). Calculation of EC using nonlinear four-parameter variable slope regression model 50 Values.
50 EXAMPLE Y hMPV H1-Hela CC
UsingLuminescent cell viability assay kit (Promega, catalog number G7573) H1-HeLa cell viability was measured according to the manufacturer's protocol. H1-HeLa cells were maintained in Dulbecco's modified Eagle medium with high glucose (Gibco, cat#: 11995073) supplemented with 10% FBS (HyClone, cat#: SH 303396.03), 100 units/mL penicillin, and 100 μg/mL streptomycin (Gibco, cat#: 15140122). The day before compound treatment, H1-HeLa cells were plated at 1.5x10 cells per well 5 Individual cells were seeded in Opti-MEM (Gibco, cat# 31985070) supplemented with 2% FBS in 96-well plates (Corning, cat# 3904) and incubated at 37℃with 5% (v/v) CO 2 Is cultured in a 100% humid atmosphere. After overnight incubation, cells were treated with three-fold serial dilutions of the compounds. At 96 hours post-treatment, cellTiter-Glo reagent was added to each well and the luminescence signal was recorded by an EnVision plate reader. Relative viability was calculated by normalizing the absorbance of the compound treated group to that of the DMSO treated group (set to 100% viability) and the 10 μm puromycin treated group (set to 0% viability). Calculation of CC Using nonlinear regression model (four parameters) 50 (concentration of compound which reduces cell viability by 50%).
50 EXAMPLE Z H1-HeLa HRV-CTG EC
The H1-Hela cell line (ATCC, manassas, VA, cat#CRL-1958) was maintained in Dulbecco's Minimal Essential Medium (DMEM) (Corning, new York, NY, catalog No. 15-018 CM) supplemented with 10% Fetal Bovine Serum (FBS) (Hyclone, logan, UT, catalog No. SH 30071-03) and 1X penicillin-streptomycin-L-glutamine (Corning, new York, NY, catalog No. 30-009-CI). Cells were passaged 2 times per week to maintain sub-confluent density and used for experiments at passage 5-30. Human rhinovirus 1B (HRV 1B) (ATCC, manassas, VA, cat#VR-1645), human rhinovirus 14 (HRV 14) (ATCC, manassas, VA, cat#VR-284) and human rhinovirus 16 (HRV 16) (ATCC, manassas, VA, cat#BR-283) were obtained by ATCC. Viral infection was monitored by measuring the viability of H1-HeLa cells as follows.
Test molecules were prepared in 384 well polypropylene plates (Greiner, monroe, NC, catalog number 784201), 8 compounds per plate, divided into 4 replicates at 10 serial dilutions (1:3). Serially diluted compounds were transferred to low dead volume Echo plates (labcyto, sunnyvale, CA, cat#lp-0200).
Test compounds were spotted at 200 nL/well onto 384 well assay plates (Greiner, monroe, NC, cat# 781091) using an Echo sound dispenser (labzone, sunnyvale, CA). H1-HeLa cells were harvested and suspended in DMEM (supplemented with 2% FBS and 1 Xpenicillin-streptomycin-L-glutamine) and seeded onto pre-spotted assay plates at 5000 cells/well in 30. Mu.L. HRV1B, HRV and HRV16 were diluted in DMEM (supplemented with 2% fbs and 1X penicillin-streptomycin-L-glutamine) at 97,100,000 Infection Units (IU)/mL, 151,000,000IU/mL and 221,000,000IU/mL, respectively. mu.L of virus per well was added to assay plates containing cells and compounds at MOI of 0.5, 1.0 and 0.25, respectively. The assay plate was incubated at 37℃with 5% CO 2 Incubate for 4 days. At the end of incubation, celltiter-Glo (Promega, madison, wis., cat #G7573) was prepared. The assay plate and Celltiter-Glo reagent were equilibrated to room temperature for at least 15 minutes. Add 40. Mu.L/well Celltiter-Glo reagent, incubate the plate at room temperature for 15 minutes, and then read the luminescence signal on an EnVision multimode plate reader (Perkin Elmer, waltham, mass.). Lu Ping Tewei was used as positive control and DMSO was used as negative control. Values were normalized to positive and negative controls (0% and 100% replicates, respectively) and data were fitted by Gilead dose response tool using nonlinear regression analysis. EC of each compound is then applied 50 Values are defined as the concentration that reduces viral replication by 50%.
E. Biological data
Data relating to the compounds disclosed herein are provided in table 42 below.
TABLE 42 biological data for the compounds disclosed herein
/>
TABLE 43 biological data for the compounds disclosed herein
/>
TABLE 44 biological data for the compounds disclosed herein
TABLE 45 biological data for the compounds disclosed herein
/>
TABLE 46 biological data for the compounds disclosed herein
TABLE 47 biological data for the compounds disclosed herein
/>
The present disclosure provides references to various embodiments and techniques. However, it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the disclosure. The description is by way of illustration of an example that is considered to be the claimed subject matter and is not intended to limit the appended claims to the specific embodiments illustrated.

Claims (280)

1. A compound of formula I:
or a pharmaceutically acceptable salt thereof, wherein:
R 1 is C 3 -C 10 Cycloalkyl, C 6 -C 10 Aryl or a 5-10 membered heteroaryl containing one, two or three N; wherein R is 1 Optionally one, two or three of the cycloalkyl, aryl or heteroaryl groups are independently selected from R 1A and-NR 13A R 14A Is substituted by a group of (2);
wherein each R is 1A Independently halogen, cyano, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy or a 5-10 membered heteroaryl group containing one, two or three heteroatoms selected from N and O;
wherein each R is 13A Independently H or C 1 -C 3 An alkyl group; and is also provided with
Wherein each R is 14A Independently H or C 1 -C 3 An alkyl group;
R 2 is H or C 1 -C 3 An alkyl group;
R 3 is C 1 -C 3 An alkyl group;
each R 4 Independently is a bond, H, halogen, C 1 -C 3 Alkyl, C 1 -C 3 Haloalkyl or C 3 -C 6 A cycloalkyl group,
each R 5 Independently of which is a bond or H,
wherein two or more adjacent (CR) 4 R 5 ) The groups are optionally linked by double bonds;
R 6 is H or-C (O) C 1 -C 6 An alkyl group;
R 7 is H or-C (O) C 1 -C 6 An alkyl group;
m is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21;
l is-O- (CR) 12A R 12B ) n -、-O(CR 12A R 12B ) n -、-(CR 12A R 12B ) n -O-、-(CR 12A R 12B ) n -O-(CR 12A R 12B ) n -；
Wherein the method comprises the steps of
Each R 12A Independently H or C 1 -C 6 An alkyl group;
each R 12B Independently H or C 1 -C 6 An alkyl group; and is also provided with
n is 1 or 2;
q is a bond or phenylene;
t is a bond or-O-;
X is a bond or C 1 -C 3 An alkylene group; and is also provided with
Z is-O-, -O- (C) 1 -C 6 ) Alkylene or NR 15 -(C 1 -C 6 ) -an alkylene group;
wherein R is 15 Is H or C 1 -C 3 An alkyl group.
2. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein the compound has formula Ia:
3. the compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein the compound has formula Ib:
4. a compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein
When R is 1 Is C 6 -C 10 Aryl, R 2 Is H, R 3 Methyl, each R 4 Is H, each R 5 Is H, L is-O-or-O (CR) 12A R 12B ) n X is-CH 2 -, T is-O-, and Q is a bond,
R 1 is aryl of one to three R 1A And (3) group substitution.
5. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is not
6. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Optionally one, two or three of the cycloalkyl, aryl or heteroaryl groups are independently selected from R 1A Is substituted with a group of (a).
7. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is optionally selected from one, two or three independently from R 1A and-NR 13A R 14A C substituted by a group of (C) 3 -C 10 Cycloalkyl groups.
8. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is optionally selected from one, two or three independently from R 1A and-NR 13A R 14A C substituted by a group of (C) 6 -C 10 Cycloalkyl groups.
9. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is optionally selected from one, two or three independently from R 1A and-NR 13A R 14A C substituted by a group of (C) 5 -C 7 Cycloalkyl groups.
10. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is optionally selected from one, two or three independently from R 1A and-NR 13A R 14A C substituted by a group of (C) 3 -C 6 Cycloalkyl groups.
11. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is optionally selected from one, two or three independently from R 1A and-NR 13A R 14A A monocyclic cycloalkyl group substituted with a group of (a).
12. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is optionally selected from one, two or three independently from R 1A and-NR 13A R 14A A cyclohexyl group substituted with a group of (a).
13. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is cyclohexyl.
14. A compound or according to any preceding claimPharmaceutically acceptable salts thereof, wherein R 1 Is optionally selected from one, two or three independently from R 1A and-NR 13A R 14A C substituted by a group of (C) 6 -C 10 Aryl groups.
15. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is optionally selected from one, two or three independently from R 1A and-NR 13A R 14A Phenyl substituted by a group of (a).
16. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl.
17. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is a 5-10 membered heteroaryl group containing one N, wherein R 1 Optionally one, two or three are independently selected from R 1A and-NR 13A R 14A Is substituted with a group of (a).
18. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is optionally selected from one, two or three independently from R 1A and-NR 13A R 14A A monocyclic heteroaryl group substituted with a group (a).
19. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is optionally selected from one, two or three independently from R 1A and-NR 13A R 14A A pyridyl group substituted with a group of (a).
20. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is optionally selected from one, two or three independently from R 1A and-NR 13A R 14A Pyridin-2-yl substituted with a group of (c).
21. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is optionally selected from one, two or three independently from R 1A and-NR 13A R 14A Pyridin-3-yl substituted with a group of (c).
22. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is a 5-10 membered heteroaryl group containing two N.
23. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is pyrimidinyl.
24. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is a 5-10 membered heteroaryl group containing three N, wherein R 1 Optionally one, two or three are independently selected from R 1A and-NR 13A R 14A Is substituted with a group of (a).
25. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is cyclohexyl, phenyl, pyridinyl or pyrimidinyl, R 1 Optionally one, two or three of the cyclohexyl, phenyl, pyridinyl or pyrimidinyl groups are independently selected from R 1A and-NR 13A R 14A Is substituted with a group of (a).
26. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, pyridyl or pyrimidinyl, R 1 Optionally one, two or three of the phenyl, pyridyl or pyrimidinyl groups are independently selected from R 1A and-NR 13A R 14A Is substituted with a group of (a).
27. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, pyridin-2-yl, pyridin-3-yl or pyrimidinyl, R 1 Optionally one, two or three of the phenyl, pyridin-2-yl, pyridin-3-yl or pyrimidinyl groups are independently selected from R 1A and-NR 13A R 14A Is substituted with a group of (a).
28. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Optionally one, two or three are independently selected from R 1A and-NR 13A R 14A Is substituted with a group of (a).
29. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is unsubstituted.
30. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Cycloalkyl, aryl or heteroaryl of (A) is substituted with one R 1A And (3) substitution.
31. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Cycloalkyl, aryl or heteroaryl groups of (2) are substituted by two R 1A And (3) substitution.
32. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is cycloalkyl, aryl or heteroaryl with three R 1A And (3) substitution.
33. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is unsubstituted cyclohexyl; unsubstituted phenyl; is independently selected from cyano, halogen, one, two or threePhenyl substituted with substituents such as methoxy, isopropoxy, trifluoromethoxy, triazolyl and oxadiazolyl; pyridyl substituted with one, two or three substituents independently selected from cyano and halogen; or pyrimidinyl substituted with cyano.
34. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is cyclohexyl, phenyl substituted with cyano and fluoro, phenyl substituted with cyano and chloro, phenyl substituted with cyano and methoxy, phenyl substituted with cyano and isopropoxy, phenyl substituted with cyano and trifluoromethoxy, phenyl substituted with cyano and two methoxy, phenyl substituted with cyano and triazolyl, phenyl substituted with fluoro and oxadiazolyl, pyridyl substituted with cyano, pyridyl substituted with chloro or pyrimidinyl substituted with cyano.
35. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is that
36. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is that
37. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is halogen.
38. A compound according to any one of the preceding claimsOr a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is fluorine.
39. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is chlorine.
40. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is cyano.
41. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is C 1 -C 3 An alkoxy group.
42. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is methoxy.
43. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is isopropoxy.
44. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is C 1 -C 3 Haloalkoxy groups.
45. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is C 1 -C 3 Fluoroalkoxy groups.
46. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is trifluoromethoxy.
47. According to the foregoing weightsThe compound of any one of claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is a 5-10 membered heteroaryl group containing one, two or three heteroatoms selected from N and O.
48. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is a 5-10 membered heteroaryl group containing one N.
49. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is a 5-10 membered heteroaryl group containing two N.
50. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is a 5-10 membered heteroaryl group containing two N and one O.
51. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is a 5 membered heteroaryl.
52. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is triazolyl.
53. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is oxadiazolyl.
54. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is C 1 -C 3 An alkyl group.
55. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 1A Is C 1 -C 3 A haloalkyl group.
56. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1A Independently selected from halogen, cyano, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkoxy and 5-10 membered heteroaryl containing one, two or three heteroatoms selected from N and O.
57. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein each R 1A Independently selected from halogen, cyano, methoxy, isopropoxy, triazolyl and oxadiazolyl.
58. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein one R 1A Is cyano and is R 1A Is halogen.
59. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein one R 1A Is cyano and is R 1A Is fluorine.
60. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein one R 1A Is cyano and is R 1A Is chlorine.
61. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein one R 1A Is cyano and is R 1A Is C 1 -C 3 An alkoxy group.
62. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein one R 1A Is cyano and is R 1A Is methoxy.
63. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein one R 1A Is cyano and is R 1A Is an isopropoxy group.
64. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein one R 1A Is cyano and two R 1A Is methoxy.
65. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein one R 1A Is cyano and is R 1A Is triazolyl.
66. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein one R 1A Is cyano and is R 1A Is oxadiazolyl.
67. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is covered by a-NR 13A R 14A And (3) substitution.
68. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is covered by two-NR 13A R 14A And (3) substitution.
69. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 1 Is covered by three-NR 13A R 14A And (3) substitution.
70. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 13A H.
71. A method according to any preceding claimWherein R is a compound of formula (I) or a pharmaceutically acceptable salt thereof 13A Is C 1 -C 3 An alkyl group.
72. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 13B H.
73. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 13B Is C 1 -C 3 An alkyl group.
74. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 2 H.
75. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1 -C 3 An alkyl group.
76. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 2 Is methyl.
77. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 3 Is methyl.
78. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 3 Is ethyl.
79. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 3 Is propyl.
80. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 3 Is n-propyl.
81. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 3 (CR 4 R 5 ) m Is unsubstituted C 11 -C 24 An alkyl group.
82. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 3 (CR 4 R 5 ) m Is straight-chain C 11 -C 24 An alkyl group.
83. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 3 (CR 4 R 5 ) m Is unsubstituted straight chain C 11 -C 24 An alkyl group.
84. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 3 (CR 4 R 5 ) m Is unsubstituted C 11 -C 24 Alkenyl groups.
85. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 3 (CR 4 R 5 ) m Is straight-chain C 11 -C 24 Alkenyl groups.
86. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 3 (CR 4 R 5 ) m Is unsubstituted straight chain C 11 -C 24 Alkenyl groups.
87. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 4 Is a key.
88. A method according to any preceding claimThe compound or a pharmaceutically acceptable salt thereof, wherein R 4 H.
89. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 4 Is halogen.
90. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 4 Is fluorine.
91. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 4 Is chlorine.
92. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 4 Is C 1 -C 3 An alkyl group.
93. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 4 Is C 1 -C 3 A haloalkyl group.
94. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 4 Is C 1 -C 3 A fluoroalkyl group.
95. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein at least one R 4 Is C 3 -C 6 Cycloalkyl groups.
96. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 5 H.
97. According to any of the preceding claimsThe compound or a pharmaceutically acceptable salt thereof, wherein at least one R 5 Is a key.
98. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein two or more adjacent (CR 4 R 5 ) The groups are linked by double bonds.
99. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 6 H.
100. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 6 is-C (O) C 1 -C 6 An alkyl group.
101. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 7 H.
102. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 7 is-C (O) C 1 -C 6 An alkyl group.
103. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein m is 11, 12, 13, 14, 15, 16, 17, or 18.
104. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein m is 15, 16, 17, or 18.
105. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein L is-O-.
106. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereofWherein L is- (CR) 12A R 12B ) n -。
107. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein L is- (CR) 12A R 12B ) n -。
108. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein L is- (CR) 12A R 12B ) n -O-。
109. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein L is- (CR) 12A R 12B ) n -O-(CR 12A R 12B ) n -。
110. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein L is-O-CH 2 -。
111. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein L is-CH 2 -O-。
112. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein L is-CH 2 -O-CH 2 -。
113. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein L is-O-CH 2 -CH 2 -。
114. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein L is-CH 2 -CH 2 -O-。
115. A compound according to any one of the preceding claimsOr a pharmaceutically acceptable salt thereof, wherein L is-CH 2 -CH 2 -。
116. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein for each (CR 12A R 12B )，R 12A Is H or R 12B H.
117. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 12A H.
118. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 12A Is C 1 -C 6 An alkyl group.
119. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 12A Is methyl.
120. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 12A Is ethyl.
121. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 12A Is propyl.
122. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 12A Is isopropyl.
123. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 12A Is C 1 -C 6 An alkyl group.
124. A compound according to any one of the preceding claims or a pharmaceutically acceptable thereofWherein R is 12A Is C 4 -C 6 An alkyl group.
125. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 12B Is methyl.
126. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 12B Is ethyl.
127. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 12B Is propyl.
128. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 12B Is C 4 -C 6 An alkyl group.
129. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein n is 1.
130. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein n is 2.
131. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein Q is a bond.
132. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein Q is phenylene.
133. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein Q is
134. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein T is a bond.
135. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein T is-O-.
136. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein X is a bond.
137. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein X is C 1 -C 3 Hydrocarbylene groups.
138. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein X is a bond, -CH 2 -、-CH 2 -CH 2 -or-CH (CH) 3 )-。
139. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein Z is-O- (C) 1 -C 6 ) -an alkylene group.
140. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein Z is-O- (C) 1 -C 3 ) -an alkylene group.
141. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein Z is NR 15 -(C 1 -C 6 ) -an alkylene group.
142. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein Z is NR 15 -(C 1 -C 3 ) -an alkylene group.
143. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein Z is-O-CH 2 -、-NH-CH 2 -or-N (CH) 3 )-CH 2 -。
144. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 15 H.
145. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 15 Is C 1 -C 3 An alkyl group.
146. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 15 Is methyl.
147. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 3 (CR 4 R 5 ) m -Q-T-X-is
148. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R 3 (CR 4 R 5 ) m -Q-T-X-is
149. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein
R 1 Is unsubstitutedA cyclohexyl group; unsubstituted phenyl; phenyl substituted with one, two or three substituents independently selected from cyano, halogen, methoxy, isopropoxy, trifluoromethoxy, triazolyl and oxadiazolyl; pyridyl substituted with one, two or three substituents independently selected from cyano and halogen; or pyrimidinyl substituted with cyano;
R 2 is H or methyl;
R 3 methyl, ethyl or n-propyl;
each R 4 And R is 5 Independently H or a bond;
R 6 is H;
R 7 is H;
m is 11, 12, 13, 14, 15, 16, 17 or 18;
l is-O-, -O-CH 2 -、-CH 2 -O-、-CH 2 -O-CH 2 -、-O-CH 2 -CH 2 -、-CH 2 -CH 2 -O-or-CH 2 -CH 2 -；
Q is a bond or phenylene;
t is a bond or-O-;
x is a bond, -CH 2 -、-CH 2 -CH 2 -or-CH (CH) 3 ) -; and is also provided with
Z is-O-CH 2 -、-NH-CH 2 -or-N (CH) 3 )-CH 2 -。
150. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein
R 1 Is cyclohexyl, phenyl substituted with cyano and fluoro, phenyl substituted with cyano and chloro, phenyl substituted with cyano and methoxy, phenyl substituted with cyano and isopropoxy, phenyl substituted with cyano and trifluoromethoxy, phenyl substituted with cyano and two methoxy, phenyl substituted with cyano and triazolyl, phenyl substituted with fluoro and diazolyl, pyridinyl substituted with cyano, pyridinyl substituted with chloro or pyrimidinyl substituted with cyano;
R 2 Is H or AA base;
R 3 methyl, ethyl or n-propyl;
each R 4 And R is 5 Independently H or a bond;
R 6 is H;
R 7 is H;
m is 11, 12, 13, 14, 15, 16, 17 or 18;
l is-O-, -O-CH 2 -、-CH 2 -O-、-CH 2 -O-CH 2 -、-O-CH 2 -CH 2 -、-CH 2 -CH 2 -O-or-CH 2 -CH 2 -；
Q is a bond or phenylene;
t is a bond or-O-;
x is a bond, -CH 2 -、-CH 2 -CH 2 -or-CH (CH) 3 ) -; and is also provided with
Z is-O-CH 2 -、-NH-CH 2 -or-N (CH) 3 )-CH 2 -。
151. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 1 and table 1A.
152. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 2.
153. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 3.
154. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula II
155. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 4.
156. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula IIa
157. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 5.
158. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula lib
159. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 6.
160. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula III
161. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 7.
162. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula IIIa
163. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 8.
164. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula IIIb:
165. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 9.
166. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula IV:
167. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 10.
168. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula IVa:
169. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 11.
170. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula IVb:
171. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 12.
172. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula V:
173. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 13.
174. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula Va:
175. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 14.
176. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula Va:
177. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 15.
178. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula VI:
179. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 16.
180. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula VIa:
181. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 17.
182. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula VIb:
183. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 18.
184. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula VII:
185. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 19.
186. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula VIIa
187. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 20.
188. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula VIIb:
189. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 21.
190. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula VIIc
191. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 22.
192. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula VIII:
193. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 23.
194. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula VIIIa
195. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 24.
196. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula VIIIb:
197. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 25.
198. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula VIIIc:
199. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 26.
200. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula IX:
201. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 27.
202. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula IXa:
203. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 28.
204. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula IXb:
205. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 29.
206. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula IXc:
207. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 30.
208. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula X:
209. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 31.
210. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula Xa:
211. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 32.
212. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula Xb:
213. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 33.
214. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula XI:
215. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 34.
216. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula XIa:
217. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 35.
218. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula XIb:
219. the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 36.
220. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula XII:
Wherein w+v is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19.
221. The compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein w+v is an integer from 14 to 18.
222. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein w is an integer from 1-20.
223. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein w is an integer from 7-11.
224. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein w is 7.
225. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein v is an integer from 7-11.
226. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein v is 8 or 10.
227. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 37.
228. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula XIIa
229. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula XIIb
230. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula XIII
231. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 38.
232. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has formula XIIIa
233. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 39.
234. The compound of any one of the preceding claims 1 to 38, or a pharmaceutically acceptable salt thereof, wherein the compound has formula XIIIb
235. The compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of table 40.
236. A compound or a pharmaceutically acceptable salt thereof selected from the group consisting of:
/>
237. a compound or a pharmaceutically acceptable salt thereof selected from the group consisting of:
/>
/>
238. a compound or a pharmaceutically acceptable salt thereof, as follows:
239. A compound or a pharmaceutically acceptable salt thereof, as follows:
240. a pharmaceutical formulation comprising a pharmaceutically effective amount of a compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient.
241. The pharmaceutical formulation according to any one of the preceding claims, wherein the pharmaceutical formulation is for subcutaneous administration.
242. The pharmaceutical formulation according to any one of the preceding claims, wherein the pharmaceutical formulation is for intravenous administration.
243. The pharmaceutical formulation according to any one of the preceding claims, wherein the pharmaceutical formulation is for oral administration.
244. The pharmaceutical formulation according to any one of the preceding claims, wherein the pharmaceutical formulation is for inhaled administration.
245. A method of treating or preventing a viral infection in a subject in need thereof, wherein the method comprises administering to the subject a therapeutically effective amount of the pharmaceutical formulation of any one of the preceding claims.
246. The method of any one of the preceding claims, wherein the pharmaceutical formulation is administered to the subject by oral, intravenous, subcutaneous, or inhalation administration.
247. The method of any one of the preceding claims, wherein the method comprises administering at least one additional therapeutic or prophylactic agent to the subject.
248. The method of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises an influenza a therapeutic agent.
249. The method of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises an influenza b therapeutic agent.
250. The method of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises oseltamivir phosphate.
251. The method of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises an agent for treating coronavirus.
252. The method of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises an agent for treating covd-19.
253. The method of any one of the preceding claims, wherein the viral infection is a pneumoviridae viral infection.
254. The method of any one of the preceding claims, wherein the pneumoviridae viral infection is a respiratory syncytial virus infection.
255. The method of any one of the preceding claims, wherein the pneumoviridae viral infection is a human metapneumovirus infection.
256. The method of any one of the preceding claims, wherein the viral infection is a picornaviridae viral infection.
257. The method of any one of the preceding claims, wherein the picornaviridae viral infection is a human rhinovirus infection.
258. The method of any one of the preceding claims, wherein the viral infection is a flaviviridae viral infection.
259. The method of any one of the preceding claims, wherein the flaviviridae virus infection is a dengue virus infection, a yellow fever virus infection, a west nile virus infection, a tick-borne encephalitis, a kunjin japanese encephalitis, a san lewisi encephalitis, a murray valley encephalitis, a jak hemorrhagic fever, a bovine viral diarrhea, a zika virus infection, or an HCV infection.
260. The method of any one of the preceding claims, wherein the viral infection is a filoviridae viral infection.
261. The method of any one of the preceding claims, wherein the filoviridae infection is an ebola virus infection or a marburg virus infection.
262. The method of any one of the preceding claims, wherein the viral infection is a paramyxoviridae viral infection.
263. The method of any one of the preceding claims, wherein the viral infection is a human parainfluenza virus, nipah virus, hendra virus, measles or mumps infection.
264. A method of treating a subject exhibiting symptoms of a coronavirus, influenza, and/or RSV infection, wherein the method comprises administering a therapeutically effective amount of a compound or pharmaceutically acceptable salt according to any one of the preceding claims, a therapeutically effective amount of an agent for treating coronavirus, a therapeutically effective amount of an agent for treating influenza, or a combination thereof.
265. The method of the preceding claim, wherein the symptoms of coronavirus, influenza, and/or RSV comprise fever, chills, cough, sneeze, nasal obstruction, nasal discharge, fatigue, headache, body pain, sore throat, vomiting, diarrhea, conjunctivitis, loss of taste, loss of smell, rash, finger discoloration, toe discoloration, dyspnea, shortness of breath, chest pain, intrathoracic pressure, wheezing, shortness of breath, loss of language, loss of movement, or a combination thereof.
266. A method of treating a patient suffering from coronavirus and RSV, wherein the method comprises administering a therapeutically effective amount of a compound or pharmaceutically acceptable salt according to any one of the preceding claims and a therapeutically effective amount of an agent for treating coronavirus.
267. A method of treating a patient suffering from covd-19 and RSV, wherein the method comprises administering a therapeutically effective amount of a compound or pharmaceutically acceptable salt according to any one of the preceding claims and a therapeutically effective amount of an agent for treating covd-19.
268. A method of manufacturing a medicament for treating or preventing a viral infection in a human in need thereof, the method characterized by using a compound according to any one of the preceding claims or a pharmaceutically acceptable salt thereof.
269. Use of a compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the treatment or prevention of a viral infection in a human in need thereof.
270. The use of any one of the preceding claims, wherein the medicament is for use with at least one additional therapeutic agent.
271. The use of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises an influenza a therapeutic agent.
272. The use of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises an influenza b therapeutic agent.
273. The use of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises an agent for treating coronavirus.
274. The use of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises an agent for treating covd-19.
275. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, for use in the treatment or prevention of a viral infection in a human in need thereof.
276. The compound of any one of the preceding claims, wherein the compound is used with at least one additional therapeutic agent.
277. The compound of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises an influenza a therapeutic agent.
278. The compound of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises an influenza b therapeutic agent.
279. The compound of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises an agent for treating coronavirus.
280. The compound of any one of the preceding claims, wherein the at least one additional therapeutic agent comprises an agent for treating covd-19.
CN202280056233.6A 2021-08-18 2022-08-16 Phospholipid compounds and methods of making and using the same Pending CN117858881A (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US63/234,515 2021-08-18
US202263313633P 2022-02-24 2022-02-24
US63/313,633 2022-02-24
PCT/US2022/075036 WO2023023527A1 (en) 2021-08-18 2022-08-16 Phospholipid compounds and methods of making and using the same

Publications (1)

Publication Number Publication Date
CN117858881A true CN117858881A (en) 2024-04-09

Family

ID=90548465

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202280056233.6A Pending CN117858881A (en) 2021-08-18 2022-08-16 Phospholipid compounds and methods of making and using the same

Country Status (1)

Country Link
CN (1) CN117858881A (en)

Similar Documents

Publication Publication Date Title
JP7461489B2 (en) Antiviral Compounds
AU2021330835B2 (en) Phospholipid compounds and uses thereof
TWI794742B (en) Antiviral compounds
JP2023531524A (en) 1&#39;-Cyanonucleoside analogues and uses thereof
US11963967B2 (en) Phospholipid compounds and uses thereof
US20230212199A1 (en) Phospholipid compounds and methods of making and using the same
KR20220143064A (en) antiviral compounds
CN117858881A (en) Phospholipid compounds and methods of making and using the same
KR20240049311A (en) Phospholipid compounds and methods of making and using the same
TW202345787A (en) Antiviral compounds and methods of making and using the same
TW202400592A (en) Antiviral compounds and methods of making and using the same

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination