CN1178558A - Amplification of nucleic acids and detection of a new non-A, non-B, non-C, non-E hepatitis virus - Google Patents

Abstract

The invention relates to a primer for carrying out a reverse transcriptase-polymerase chain reaction (RT-PCR) for the detection of the hepatitis G virus (HGV).

Description

The nucleic acid amplification and the detection of new non-A, non-B, non-C,non-D,non-E hepatitis virus

Theme of the present invention is a kind of reagent that is used for amplicon virus nucleic acid and utilizes this reagent to detect the method for virus, and described virus is a kind of and the relevant virus of non-A, non-B, non-C,non-D,non-E (N-ABCDE) hepatitis.

Except known and certified hepatitis A virus (HAV) (HAV) and hepatitis B virus (HBV), recently, other are several relevant with hepatitis, but the virus that forms independent virus groups is also come out by evaluation.The general name like this of these virus groups: be about to the group and press the arrangement of successive capitalization.Every kind of newfound virus relevant with hepatitis is that with the difference of first provirus it does not belong to the virus groups of previously known.Here it is, and hepatitis C virus (HCV) also is known as the reason of non A non B hepatitis virus.The present invention relates to a kind of like this virus, it does not obviously belong to HAV, HBV, HCV, HDV and HEV virus groups.

WO 94/18217 has described a kind of virus, and it does not belong to five virus groups listing above.It is different that the nucleotide sequence that the present invention relates to is proved the sequence of describing with WO 94/18217.

WO 95/21922 has also described a kind of hepatitis reagent that does not belong to five virus groups listing above.

Hereinafter, the virus groups relevant with hepatitis of the present invention's qualification is known as HGV.Available data about HGV shows that this virus belongs to flaviviridae at present.

Theme of the present invention is a kind of reagent of the HGV specificity nucleotide sequence that is used to increase, wherein HGV is restricted to a kind of like this virus, its genome is made of RNA, and the 5 ' terminal sequence of this RNA and the Nucleotide of SEQ.ID.NO.1 have at least 80%, preferred 90% homology; It comprises two kinds of HGV Auele Specific Primers, and every kind of primer all has extendible end, and wherein a kind of primer contains 15 to 30 bases, and the continuous base of the Nucleotide of it and SEQ.ID.NO.1 has up to more than 80%, preferred at least 90% complementarity; Another kind of primer contains 15 to 30 bases, and it has up to more than 80% with the continuous base of the Nucleotide of SEQ.ID.NO.1, preferably at least 90% homology.The extensible end of primer is so selected, and makes when primer extension, and each primer can be hybridized with the extension products of another primer, and each extension products can be used as the required template of another primer extension.

In the present invention, amplification should be understood that to prepare the method for a large amount of copies of base sequence.Known method, US-A-4 for example, the polymerase chain reaction of describing in 683,202 is available.

Primer should be understood to be in the molecule that has the certain number nucleic acid base on its main chain.Main chain is the basic structure of a kind of polymkeric substance.The sugar phosphoric ester basic structure of nucleic acid (as DNA and RNA) for example that known especially is.Can form heterogeneous ring compound and these main chain covalent attachment of hydrogen bond with the interworking heterocycle.They typically refer to naturally occurring VITAMIN B4, guanine, cytosine(Cyt), thymus pyrimidine and uridylic base.But, naturally occurring other bases are also arranged.The sequence of these bases is so selected, and makes it and the continuous base of the nucleotide sequence that will increase that the complementarity more than 90% be arranged.These molecules have at least one extensible end separately.Extension should be interpreted as especially that the base unit enzyme-catalyzed change that carries out adds under the help of triphosphoric acid monokaryon glycosides or oligonucleotide.When finishing extension with triphosphoric acid monokaryon glycosides unit, preferred enzyme is an archaeal dna polymerase.The nucleic acid that contains the nucleotide sequence that will be amplified can be used as the template that base specific mixes.Template sequence has determined the base sequence that is connected with primer.

Is favourable with the molecule that 15 to 30 bases are arranged as primer, because their chemosynthesis is finished comparatively speaking easily.

When using archaeal dna polymerase, preferably with 3 ' terminal as extensible end.When reagent is used for from the direct amplification of nucleotide acid sequence of the geneome RNA of HGV, preferably use reversed transcriptive enzyme (RNA dependent dna-polymerases).Because reversed transcriptive enzyme also has DNA dependent dna-polymerases activity, so at first generate a large amount of DNA from the cDNA that so obtains.Generate after the DNA, can use another kind of DNA dependent dna-polymerases, for example derive from the archaeal dna polymerase of intestinal bacteria or thermus aquaticus.

According to the PCR principle, can be with the method for reversed transcriptive enzyme (RT-PCR) amplification of nucleotide acid sequence from for example US-A-5,310,652 or WO 91/09944 know.For determining reaction conditions, be incorporated herein the content of these patent applications.

These the two kinds chain complementary primers different with nucleotide sequence are used to generate a kind of like this nucleic acid, and its length determines that by two ends away from each other of two primers these two primers are preferably non-extensible.Generally speaking, the length of these nucleic acid (also can be known as amplified material) can comprise and promptly reaches 348 bases by all zones of SEQ.ID.NO.1.The preferred length of amplified material is greater than 100 bases.In particularly preferred mode, the length range of amplified material is between 150 to 200 Nucleotide (nt).Except primer sequence, amplified material also contains the newly-generated zone by mixing triphosphoric acid mononucleotide or polynucleotide.

Preferably, primer of the present invention is not hybridized with other hepatitis correlated virus groups' member, specifically, and not with hepatitis A, hepatitis B, third liver, fourth liver or viral hepatitis type E viral hybridization.And, they preferably not with human blood in other nucleic acid hybridizations.

Preferred primer can with complete complementation of the partial sequence of SEQ.ID.NO.1 or homology.Yet practice shows, can select some Nucleotide so in some cases, and they have a mispairing with respect to the sequence of SEQ.ID.NO.1.But mispairing preferably is not positioned at 3 of primer ' end.

HGV specificity nucleotide sequence should be understood that such one section sequence, and this sequence is present among the HGV, but is not present in other viruses or the eukaryotic cell.

HGV hypospecificity nucleotide sequence should be understood that such one section HGV specific sequence, and this sequence is not present in all HGV hypotypes.The HGV hypotype is meant a kind of like this virus, and this virus has whole phenotypic characteristics of HGV, but its nucleotide sequence is different with other HGV.Departure is at least 10%, and is preferably located in the Nucleotide 64-348 of SEQ.ID.NO.1.The fact shows that the HGV hypotype differs from one another, and particularly in Nucleotide zone 74-92,186-223,255-283 and 303-306, and they are more particularly different with SEQ.ID.NO.1.In hypospecificity detected, preferably at least one primer or probe were so selected, so that make its sequence cover in these zones one wholly or in part.

Suppose that SEQ.ID.NO.1 is first hypotype of HGV, can determine hypotype 2a and 2b according to the arrangement of Fig. 1 so.Fig. 1 has only shown its sequence and those different Nucleotide of sequence among the SEQ.ID.NO.1.

In the hypospecificity testing process, can select a primer is the HGV hypospecificity, and another primer is that the HGV hypotype is nonspecific.

Fig. 1 shows the HGV Nucleotide corresponding to the Nucleotide 64-348 of SEQ.ID.NO.1 from different experimenters, as can be seen, according to the definition that provides above, a HGV (Sa1134 to Sa1172) belongs to first hypotype (2a), and remaining HGV belongs to the hypotype (2b) of himself.Notice that compare with SEQ.ID.NO.1, there is a disappearance at 255 places in the position.Fig. 1 has also shown conserved regions and variable region.

The non-specific sequence of HGV hypotype is more such HGV specific sequences, and these sequences can be hybridized with all known HGV hypotypes.They are particularly including the conservative region of SEQ.ID.NO.1, preferably between 92 and 186,223 and 255 and 315 and 348.

HGV detects the method that should be understood that to determine HGV existence in the sample.Preferred sample is a blood sample.The method of determining the HGV hypotype both can be to determine the method for hypotype, also can be the method for certain HGV self.

Except that HGV specificity nucleotide sequence, primer of the present invention also can contain such nucleotide sequence, and they are neither HGV is specific, can not with the nucleic acid hybridization that is present in usually in the sample.They preferably are present in the non-extensible end of primer.These additional nucleotide sequences can be used for catching amplified material.

But can detect or the further Mdification primer of immobilization group by connecting.These groups comprise the group that for example can directly or indirectly detect, for example radioactivity, painted or fluorophor.But the group of indirect detection comprises immunity or enzymatic activity compound, as haptens or enzyme.They are detected in follow-up reaction or reaction sequence.EP-B-0324474 (digoxigenin) is particularly preferred.But the immobilization group that vitamin H is proved to be is because it can be at bag by fixing well on avidin and the proteic surface of streptavidin.This makes and both can catch amplified material on solid phase and remove sample component, also can detect the material that influences amplified reaction.

Particularly preferred primer contains sequence or its complementary sequence of six continuous bases, and described six continuous bases are contained in the sequence of SEQ.ID.NO.2 or 3 or 5 to 20.Particularly preferred primer as SEQ.ID.NO.2 3 or 5-20 shown in.

SEQ.ID. the Nucleotide Y and the R that occur in are meant that described primer relates to a kind of mixture, and this mixture meets the implication of alphabetical Y and R.

Another theme of the present invention is the test kit that is used for specific detection HGV, it contains the reagent of one of claim 1 to 4, and the probe that contains a kind of like this base sequence, described base sequence is located at the extension products inside that forms in the amplified reaction, promptly between the end that is extended of primer.Probe should be understood that with the same molecule that has the certain number nucleic acid base on main chain of primer.But probe not necessarily has extensible end.Probe is characterised in that it contains discernible group.But discernible group can be detection moiety or be fixed or fixable group.The definition of such group in relating to the part of primer, this paper is provided.In particularly preferred mode, probe has can immobilized residue, promptly in follow-up or reaction simultaneously can with the residue of solid phase or solid bond.If but the immobilization group is a biotin residue, then solid phase can be streptavidin or the microtitration flat board of avidin bag quilt or the surface of test tube.

In optimal way, test kit contains primer and probe, and they are in the discrete container.In addition, test kit can contain amplification and detect essential or useful other components, such as reversed transcriptive enzyme, and triphosphoric acid monokaryon glycosides, it preferably is labeled so that detect; Be used to catch the solid phase of the hybrid of forming by probe and amplified material, and the resiliency material.

Therefore, another theme of present method is the method that detects HGV in sample, it is characterized in that generating cDNA by the part of HGV RNA, and is utilizing the reagent amplification cDNA of one of claim 1 to 4; Amplified production is contacted with the probe that contains such base sequence: described base sequence is between the extensible end of primer; Determine the formation of the hybrid of probe and amplified production, thereby show the existence of HGV in the sample.

The present invention has advantageously provided a kind of specificity method that is used to detect HGV, and it also can be used for analyzing patient's sample, and described patient it is believed that it is the HGV hypotype positive that has nothing in common with each other, but the end demonstrates the existence of HCV.In addition, the inventive method can be carried out high-sensitivity detection to HGV.Specificity in the Southern trace is also very high.

And reliable diagnostic if desired can combine the detection carried out according to the inventive method with RNA detection method at another site of HGV genome; Specifically, combine with RT-PCR on coding non-structure HGV proteic zone.The sequence in non-structure zone can be measured according to the method for describing among the EP-B-0318216.For finishing sequencing, can primer be extended along genomic 3 ' direction from the SEQ.ID.NO.1 sequence; Measure the sequence of extension products subsequently.This sequence is used to prepare a primer subsequently, and this primer is used to another extension along genomic 3 ' direction, and so goes on.Successfully finish after at least one in two amplified reactions, can determine whether HGV exists.

The following examples are illustrated the present invention in more detail: embodiment 1HGV specific detection reagent-QIAamp, HCV test kit (QIAgen Cat.NO.29504)-M-MuL V-reversed transcriptive enzyme (Bao Ling Man, 1062603)-PCR mixture of ribonucleotides (Bao Ling Man, 1581295)-sexamer random mixture (Bao Ling Man, 1277081)-RNase inhibitor (Bao Ling Man, 799017)-aseptic redistilled water-primer 1 (SEQ.ID.NO.2)-primer 2 (SEQ.ID.NO.3)-biotinylated probe nucleic acid (SEQ.ID.NO.4), the biotinylation by amino linker (Applied Biosystems, Inc.),-PCR ELISA (DIG labelling kit, Bao Ling Man, 1636120) (or single reagent RCR-DIG-mark mixture (Bao Ling Man, 1585550) and Taq-DNA polysaccharase (Bao Ling Man, 1146165))-Enzymun-Test ^DNA detection (Bao Ling Man, 1447777) is general to be introduced

All processes should carry out three different working spaces, and promptly one of them is used for the RNA separation, and one is used for preparing and carrying out reverse transcription and amplified reaction, a detection that is used for amplified production.Each working space should be equipped with independent some cover whole pipets (pipette).For avoiding polluting, use the airtight whole pipet of aerosol or the special P CR whole pipet of sealing.Every day is reagent preparation again, removes the pollutent on all whole pipets according to a conventional method.New gloves are used in each working space.Specimen preparation

Specification sheets according to manufacturers prepares total RNA with QIAamp HCV test kit from human serum.Can be with other RNA preparation methods, as the sour phenol extraction process of Chomczynski or with different sulphur cyanoguanidine.CDNA synthesizes (reverse transcription)

The preparation of reverse transcription and amplification mixture is in independent working space, finishes with a cover whole pipet independently.Agents useful for same is listed in the table below in the reaction.Table 1

Reagent	Stock solution	Volume/reaction	Final concentration in the RT damping fluid
				5x reversed transcriptive enzyme damping fluid	??5x	????4μl	????1x
??PCR?dNTP-Mix	??je?10mM	????0.2μl	????100μM
				Sexamer at random	??20μM	????0.5μl	????200nM
The RNase inhibitor	??40U	????0.5μl	????1U
				??H 2O	??…	????3.8μl	?????…
M-MuL V-reversed transcriptive enzyme	??20U/μl	????1μl	The 20U/ reaction
				??RNA		10 μ l/ reaction

10 μ l RT mix are added in the PCR reaction tubes.Subsequently, add 10 μ l RNA solution.With mixture of short duration processing on vortex mixer, at room temperature be incubated 10 minutes after centrifugal, 42 ℃ of insulations 30 minutes down, 95 ℃ of insulations 5 minutes down.Subsequently reaction mixture is preserved down at 4 ℃, until further handling.Labeled reactant

The preparation of amplification mixture is in independent working space, finishes with a cover whole pipet independently.Will not increase to mix and add on ice.Agents useful for same is listed in the table below.

Table 2

Reagent	Stock solution	Volume/reaction	Final concentration
				The 10xPCR incubation buffering liquid	????10x	????5μl	????1x
PCR Dig-mark mixture dATP dCTP dGTP dTTP Dig-11-dUTP	????2mM ????2mM ????2mM ????1.9mM ????0.1mM	5 μ ldes Dig-mark mixtures	????200μM ????200μM ????200μM ????190μM ????10μM
				Primer 1 (SEQ.ID.NO.2)	????5μM	????2μl	????200nM
Primer 2 (SEQ.ID.NO.3)	????5μM	????2μl	????200nM
				The Taq archaeal dna polymerase	????5U/μl	????0.5μl	2.5U/ reaction
H 2O		Complement to 40 μ l
				CDNA-solution		????10μl

Preparation 40 μ l amplification mixture in reaction tubes.Add 10 μ l cDNA resulting solutions.With mixture of short duration mixing on vortex mixer, centrifugal then.Subsequently, reaction tubes is placed Perkin-Elmer thermal cycler (PE 9600), carry out 40 circulations (94 ℃ 15 seconds, 55 ℃ 30 seconds, 72 ℃ 30 seconds).Subsequently, reaction mixture is preserved down at 4 ℃, until carrying out detection reaction.If desired with the mixture prolonged preservation, it should be kept at-20 ℃.The detection of amplified production

The detection of the amplified production of digoxigenin mark is carried out with Enzymun-Tests DNA detection method (with Bao Lingman ES instrument) or with PCR ELISA method of testing (with Bao Lingman microtitration flat board).The adding of amplified production and their detection are carried out in the 3rd working space.Before opening reaction tubes, that reactant is of short duration centrifugal.With the denaturing soln in the test kit of listing above solution is carried out dilution in 1: 10.The concentration of capture probe in hybridization solution is preferably 75ng/ml.

The detailed protocol that detects the amplified reaction thing in the above the ES system (ES300, ES600, ES700) and the PCR ELISA test kit (Enzymun-Test DNA detection) that is used for the dull and stereotyped mode of microtitration provide.By means of primer 2/3 and 2/8, can reach and be lower than 10 to 30 copy/sedimentary sensing ranges.Optional primer

According to the present invention, SEQ.ID.NO.5,6,7,8 and 9 primer have been proved to be effectively, particularly when 5/6,5/7 and 2/9 combination.

For combination of primers 2/8, can detect three kinds of different genotype; Therefore this is that a kind of HGV hypospecificity detects.Embodiment 2HGV hypotype classification (HGV-Subtypisierung)

Except that primer, the full terms of listing in the Application Example 1.

Some doublet (SEQ.ID.NO./SEQ.ID.NO.) is used as primer; The result is provided by table 1.Numerical value (absorption value) above 100 is counted as positive test result.This shows can be by selecting the hypotype (as 2/14,2/15 and 2/16) of some primer to optionally detecting each.Table 3

The numerical value that has gray shade is different with expected value; But when repeating to test under the rigorous condition of revising, numerical value is (2/12 feminine gender of coupling; 2/20 positive).

Table 4 is primer sequence and their specific tabulations of HGV separately.

Table 4

SEQ.ID.NO.	Genotypic identification	Sequence (5 '-3 ')
			2	All	CGG?CCA?AAA?GGT?GGT?GGA?TG
8	All	AAC?ACC?TGT?GGA?CCG?TGC?G
			10	1	CAA?TGA?CTC?GGC?GCC?GAC
11	2a+b	TGA?TGG?CCC?YGC?GCC?RAA
			12	1	AGA?GGA?ATC?TTA?ACC?TTC?TC
13	2a+b	AGA?GGG?ACC?GTA?GCC?TCC?C
			14	1	GGT?CTC?GCC?GCA?GGC?ACA
15	2a	CGT?TCT?CGC?CAC?GGG?CAT?T
			16	2b	CTT?TCY?CTC?CRT?AAG?CGC?G
17	1	TCG?GGC?CCT?TAT?TCA?CAC?C
			18	2a+b	CCG?GGY?CCT?TAT?TAC?ACC
19	1+2a	TAA?CGA?CGA?GCC?TGA?CGT?C
			20	2b	TAA?CGG?CGT?GCC?TAG?CGC?C
3	1+2a	CGA?CGA?GCC?TGA?CGT?CGG?G

Sequence (1) physical data:

(i) applicant:

(A) name: Boehringer Mannheim GmbH

(B) street: Sandhoferstr.116

(C) city: Mannheim

(E) country: DE

(F) postcode: 68305

(G) phone: 0,621 759 4348

(H) fax: 0,621 759 4457

(ii) denomination of invention: Reagenz und Verfahren zum Nachweis vonNonA, NonB, NonC, NonD, NonE-Virus

(iii) sequence number: 20

(iv) computer-reader form:

(A) media type: floppy disk

(B) computer: IBM PC compatible type

(C) operation system: PC-DOS/MS-DOS

(D) software: PatentIn Release#1.0, the data of Version#1.30 (EPA) (2) SEQ ID NO:1:

(i) sequence signature:

(A) length: 348 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: genome-RNA

(iii) hypothetical sequence: non-

(iv) antisense: be

(the viii) position in the genome:

(A) karyomit(e)/fragment: non-translational region

(xi) sequence description: the data of SEQ ID NO:1:ACGTGGGGGA GTTGATCCCC CCCCCCCGGC ACTGGGTGCA AGCCCCAGAAACCGACGCCT 60ATCTAAGTAG ACGCAATGAC TCGGCGCCGA CTCGGCGACC GGCCAAAAGGTGGTGGATGG 120GTGATGACAG GGTTGGTAGG TCGTAAATCC CGGTCACCTT GGTAGCCACTATAGGTGGGT 180CTTAAGAGAA GGTTAAGATT CCTCTTGTGC CTGCGGCGAG ACCGCGCACGGTCCACAGGT 240GTTGGCCCTA CCGGTGGGAA TAAGGGCCCG ACGTCAGGCT CGTCGTTAAACCGAGCCCGT 300TACCCACCTG GGCAAACGAC GCCCACGTAC GGTCCACGTC GCCCTTCA348 (2) SEQ ID NO:2:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:2:

The data of CGGCCAAAAG GTGGTGGATG 20 (2) SEQ ID NO:3:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: the data of SEQ ID NO:3:CGACGAGCCT GACGTCGGG 19 (2) SEQ ID NO:4:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(ix) feature:

(A) title/key: misc feature

(B) site: 1..19

(D) out of Memory :/note=" G am 5 '-Ende ist ueber Aminolink

kovalent?mit?Biotin?verbunden”

(xi) sequence description: SEQ ID NO:4:

The data of GGTAGCCACT ATAGGTGGG 19 (2) SEQ ID NO:5:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:5:

The data of CCAGAAACCG ACGCCTATC 19 (2) SEQ ID NO:6:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:6:

The data of CTTATTCCCA CCGGTAGGGC 20 (2) SEQ ID NO:7:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:7:

The data of CAAGAGAGAC ATTGAAGGGC 20 (2) SEQ ID NO:8:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:8:

The data of AACACCTGTG GACCGTGCG 19 (2) SEQ ID NO:9:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:9:

The data of CCACTGGTCC TTGTCAACTC 20 (2) SEQ ID NO:10:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:10:

The data of CAATGACTCG GCGCCGAC 18 (2) SEQ ID NO:11:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:11:

The data of TGATGGCCCY GCGCCRAA 18 (2) SEQ ID NO:12:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:12:

The data of AGAGGAATCT TAACCTTCTC 20 (2) SEQ ID NO:13:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:13:

The data of AGAGGGACCG TAGCCTCCC 19 (2) SEQ ID NO:14:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:14:

The data of GGTCTCGCCG CAGGCACA 18 (2) SEQ ID NO:15:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:15:

The data of CGTTCTCGCC ACGGGCATT 19 (2) SEQ ID NO:16:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:16:

The data of CTTTCYCTCC RTAAGCGCG 19 (2) SEQ ID NO:17:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:17:

The data of TCGGGCCCTT ATTCACACC 19 (2) SEQ ID NO:18:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:18:

The data of CCGGGYCCTT ATTACACC 18 (2) SEQ ID NO:19:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:19:

The data of TAACGACGAG CCTGACGTC 19 (2) SEQ ID NO:20:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(A) describe :/desc=" oligodeoxynucleotide "

(iii) hypothetical sequence: non-

(xi) sequence description: SEQ ID NO:20:

TAACGGCGTG?CCTAGCGCC??????????????????????19

Claims (13)

1. the reagent of the HGV specificity nucleotide sequence that is used to increase, wherein HGV is defined as a kind of virus, this viral genome is made up of RNA, described RNA contains the nucleotide sequence that at least 80% homology is arranged with SEQ.ID.NO.1 at its 5 ' end, this reagent contains two HGV Auele Specific Primers, each primer has an extendible end, one of them primer contains the sequence of 15 to 30 bases, the continuous base of this sequence and SEQ.ID.NO.1 has the complementarity above 80%, another primer also contains the sequence of 15 to 30 bases, the continuous base of this sequence and SEQ.ID.NO.1 has the homology above 80%, the extensible end of primer is so selected, make when each primer extension, this primer can be hybridized with the extension products of corresponding another primer, and corresponding extension products plays the effect of the required template of another primer extension.

2. the reagent of claim 1 is characterized in that in the primer at least one contains the sequence of 6 continuous bases, and this sequence is included among the sequence or its complementary sequence of SEQ.ID.NO.1.

3. claim 1 or 2 reagent is characterized in that in the primer at least one contains SEQ.ID.NO.2 or 3 or the sequence of 5-20.

4. the reagent of arbitrary claim during aforesaid right requires is characterized in that at least one quilt in the primer can be detected ground mark.

5. the reagent of arbitrary claim during aforesaid right requires is characterized in that in the primer one or several is that the HGV hypotype is nonspecific.

6. the reagent of arbitrary claim in the claim 1 to 4 is characterized in that in the primer one or several is the HGV hypospecificity.

7. claim 5 or 6 reagent is characterized in that a primer is that the HGV hypotype is nonspecific, and another is the HGV hypospecificity.

8. the test kit that is used for specific detection HGV, it comprises reagent and the probe of arbitrary claim in the aforesaid right requirement, this probe comprises the base sequence that is located in the extension products that forms between the primer extension end.

9. the test kit of claim 8 is characterized in that base sequence contains at least 6 successive bases, and these bases are included among the sequence or its complementary sequence of SEQ.ID.NO.2-20.

10. the test kit that is used for specific detection HGV, it comprises the reagent and the another kind of reagent that contains additional primer of arbitrary claim in the claim 1 to 7, the described additional primer HGV nucleotide sequence that is used to increase.

11. the test kit of claim 10, it all comprises the probe that is used to detect extension products at every pair of primer.

12. detect the method for HGV sample, it is characterized in that forming cDNA by the part of HGV-RNA, the extension of the primer of the reagent by claim 1 to 7 this cDNA that increases, when forming amplified production, amplified production is contacted with a probe, this probe contains the base sequence between the extensible end of primer, and the formation of hybridizing between conclusive evidence probe and the amplified production is with existing of HGV in the validation sample.

13. the method for HGV in the detection sample is characterized in that:

-form cDNA by two or more parts of HGV-RNA, with the reagent of arbitrary claim in the claim 1 to 4 and additional HGV Auele Specific Primer to the cDNA that increases,

-probe of amplified production with each amplification part contacted,

The formation of hybridizing between-conclusive evidence probe and the amplified production,

-estimate the formation of hybridizing between probe and the amplified production, wherein, then can determine to exist in the sample HGV if an amplified production forms hybrid.

Images