CN117844988B

CN117844988B - RT-qPCR detection primer and kit for porcine reproductive and respiratory syndrome virus and application of RT-qPCR detection primer and kit

Info

Publication number: CN117844988B
Application number: CN202410251889.4A
Authority: CN
Inventors: 赵红日; 孙亚娟; 尹锐; 李鹏; 刁磊; 刘岩松; 陈惠杰
Original assignee: Sairuisi Biotechnology Jilin Co ltd
Current assignee: Sairuisi Biotechnology Jilin Co ltd
Priority date: 2024-03-06
Filing date: 2024-03-06
Publication date: 2024-05-14
Anticipated expiration: 2044-03-06
Also published as: CN117844988A

Abstract

The invention provides a RT-qPCR detection primer and a kit for porcine reproductive and respiratory syndrome virus and application thereof, and belongs to the technical field of virus detection. The RT-qPCR detection primers of the porcine reproductive and respiratory syndrome virus are shown as SEQ ID NO.1 and SEQ ID NO.2, and the probe is shown as SEQ ID NO. 3. The reaction system of the RT-qPCR detection kit for the porcine reproductive and respiratory syndrome virus is designed according to the target gene fragment amplification and the specific primer probe sequence, has higher detection sensitivity, completes RT-qPCR amplification within 30min, and has the detection sensitivity as high as 0.312 copies/. Mu.L. The kit has the advantages of good quantitative linear range, strong anti-interference capability of detection, high detection precision and strong stability.

Description

RT-qPCR detection primer and kit for porcine reproductive and respiratory syndrome virus and application of RT-qPCR detection primer and kit

Technical Field

The invention relates to the technical field of virus detection, in particular to a RT-qPCR detection primer and kit for porcine reproductive and respiratory syndrome virus and application thereof.

Background

Porcine reproductive and respiratory syndrome, also known as porcine reproductive and respiratory syndrome, is a disease that causes viral infection after infection of pigs with Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), which is one of the most serious diseases currently jeopardizing the pig industry. The infection of the pig can cause Porcine Reproductive and Respiratory Syndrome (PRRS), and is mainly represented by reproductive disorders such as abortion of sows, mummy births, weaknesses and the like, respiratory symptoms of pigs of all ages, and the infected pigs can expel toxin through various ways such as feces, urine, saliva, nasal secretion and the like, so that feed, drinking water, surrounding environment and the like are polluted, and huge economic loss is caused for the global pig industry. PRRSV is an enveloped single-stranded positive RNA virus of the genus arterivirus, the family arterividae, and has a viral genome size of about 15.4 Kb, with significant genetic and antigenic diversity. PRRSV emergence and prevalence has been recently 30 years, with continued variation leading to new strains, but control of PRRSV has not been substantially progressed worldwide to date, with the effects and hazards remaining. In actual production, diagnosis of strains of different lineages of PRRSV is important for establishment of epidemic prevention and control strategies.

The real-time fluorescent quantitative PCR (qPCR) method is the most commonly used method in PRRSV detection at present due to simple operation and rapid detection. For example Wang Fangzhou, a PRRSV one-step multiplex RT-PCR detection method is established, and European and American strains can be detected simultaneously (establishment and application of a one-step multiplex RT-PCR detection method for porcine reproductive and respiratory syndrome virus, china veterinary science, 2022.04.12). Cha Fan et al established a fluorescent quantitative PCR method for detecting American Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) while detecting classical PRRSV, highly pathogenic PRRSV and NADc-like PRRSV (establishment of a fluorescent quantitative PCR method for American porcine reproductive and respiratory syndrome virus, chinese Protect veterinarian journal, 2022.07.15). Meanwhile, in order to meet the market demand of PRRSV detection, some enterprises utilize fluorescent quantitative PCR technology to develop commercial kits for PRRSV detection. However, the existing PRRSV QPCR detection technology and detection kit have uneven technical levels, and have the defects of complex operation process, long detection time, low detection accuracy, poor pollution resistance and the like to a certain extent, so that the requirements of PRRSV nucleic acid detection are difficult to meet. Therefore, development and establishment of an ultrafast and high-precision RT-qPCR detection method are of great significance in controlling and blocking PRRSV propagation.

Disclosure of Invention

The invention aims to provide a primer and a kit for detecting Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) through RT-qPCR and application thereof. The RT-qPCR detection kit for the porcine reproductive and respiratory syndrome virus has the characteristics of simple operation, short detection time, high detection accuracy and strong anti-pollution capability.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a combination of a RT-qPCR detection primer and a fluorescent probe of a porcine reproductive and respiratory syndrome virus, which comprises a forward primer PRRSV-F1, a reverse primer PRRSV-R1 and a fluorescent probe PRRSV-P1;

The nucleotide sequence of the forward primer PRRSV-F1 is shown in SEQ ID NO. 1;

the nucleotide sequence of the reverse primer PRRSV-R1 is shown in SEQ ID NO. 2;

the nucleotide sequence of the fluorescent probe PRRSV-P1 is shown in SEQ ID NO. 3.

Preferably, the 5' end of the fluorescent probe carries a reporter fluorescent group, and the reporter fluorescent group is one of 6-FAM, HEX, TET, TAMRA, cy, cy5, cy 5.5, texas Red, yakima Yellow or VIC; the 3' -end of the fluorescent probe carries a quenching fluorescent group, and the quenching fluorescent group is selected from MGB, BHQ-1, BHQ-2 or BHQ-3.

The invention also provides a kit for detecting the porcine reproductive and respiratory syndrome virus RT-qPCR, wherein the kit comprises an RT-qPCR detection primer, a fluorescent probe and qPCR enzyme premix.

Preferably, the qPCR enzyme premix comprises a PCR buffer and an enzyme mix. The PCR buffer and enzyme mixture may be formulated using a formulation that will be understood and used by those skilled in the art.

In the RT-qPCR detection kit, RT-qPCR detection primers, fluorescent probes and qPCR enzyme premix exist in the kit in a fully premixed mode. In actual detection, the RT-qPCR reaction is carried out by directly adopting a kit with full premix (comprising RT-qPCR detection primer, fluorescent probe and qPCR enzyme premix), and each component in the primer and qPCR enzyme premix is not required to be put in sequence. Therefore, the RT-qPCR detection kit greatly simplifies the operation steps and shortens the detection time.

Preferably, in the RT-PCR detection kit, the concentration of each primer is independently 0.20-0.80 mu mol/L, and the concentration of the specific probe is 0.10-0.30 mu mol/L.

In the actual operation process, the whole reaction process is as follows: and (3) adding RNA or DNA of the virus to be detected into the RT-qPCR detection kit to detect. The reaction system is as follows: the total amount of RNA or DNA of the virus to be detected, RT-qPCR detection primer, fluorescent probe and qPCR enzyme premix is 20. Mu.L.

Specifically, in the RT-qPCR detection primer and the fluorescent probe set, the concentration of the two primers in a 25 mu L reaction system is 10 mu mol/L respectively, and the dosage is 1.0 mu L respectively; the concentration of the specific probe was 10. Mu. Mol/L, and the amount was 0.25. Mu.L.

The qPCR enzyme premix included 7.5. Mu.L of PCR buffer and 4.75. Mu.L of enzyme mix, and ddH ₂ O (5.5. Mu.L) for the remainder. Wherein, more specifically, the PCR Buffer comprises the following components in concentration: tris 0.2~0.3 M,KCl 45~55mM,MgCl ₂ 23~25 mM,dNTP 0.2~0.5 mM,dUTP 0.2~0.3 mM-5 mug/mL of Niu Ningxie enzyme, 0.4-0.6M of tetrahydropyrimidine, 1-8 ng/. Mu.L of single-chain binding protein, 6-10 mM of dithiothreitol, 0.5-2.5 mM of TAA (thioacetamide), 0.25-1% of sucrose and 2-3% of DMSO; the percentages of DMSO and sucrose are volume percentages. The enzyme mixed solution comprises the following components in concentration: 2.3-2.5U/. Mu.L of RNase inhibitor; uracil glycosylase 0.4-0.6U/. Mu.L, and efficient reverse transcriptase 15-17U/. Mu.L; quick Taq enzyme is 0.1-0.2U/. Mu.L. The above-described raw materials may be adjusted within a certain range, and the present invention is not limited to the specific concentration herein.

The RT-qPCR full premix provided by the invention comprises RT-qPCR detection primers, fluorescent probe combinations and qPCR enzyme premix. In the detection process, RT-qPCR amplification can be realized by adopting a one-step method (each component is not required to be added step by step), so that the detection time is shortened, and the detection effect is good. The full premix of the invention has simple and convenient operation, good stability and amplification sensitivity not lower than the conventional step-by-step operation.

In the actual use process of the kit, the volume of the RT-qPCR full premix is three times that of the negative quality control product and the positive quality control product. For example, in a specific kit, the RT-qPCR total premix has a specification of 1100. Mu.L/tube X1, the negative quality control has a specification of 350. Mu.L/tube X1, and the positive quality control has a specification of 350. Mu.L/tube X1.

The kit is assembled as follows:

Table 1 composition of the kit

The invention also provides application of the combination of the RT-qPCR detection primer and the fluorescent probe for detecting the porcine reproductive and respiratory syndrome virus in a kit for detecting the virus.

Preferably, the application comprises the steps of: using the RT-qPCR detection primer and fluorescent probe combination, carrying out RT-qPCR amplification by taking RNA of a sample to be detected as a template, and judging the result according to an amplification curve and a reaction Ct value, wherein the judgment standard is as follows:

when Ct in the FAM fluorescence channel is less than or equal to 40, judging that the sample is PRRSV positive;

repeating the experiment once when Ct is 40 < Ct is less than or equal to 45 in the FAM fluorescence channel, judging that the sample is PRRSV positive if Ct is within the range or smaller than 40, otherwise judging that the sample is PRRSV negative;

And when the FAM fluorescent channel has no amplification curve, judging that the sample is PRRSV negative.

Preferably, the RT-qPCR reaction procedure is: 5min at 50 ℃; 10 s at 95 ℃;95℃1 s, 60℃20 s,45 cycles.

Preferably, during the RT-qPCR reaction, fluorescent signals are collected starting at 60 ℃.

By adopting the technical scheme, the invention has the following beneficial effects:

1. according to the invention, primers and detection probes are designed according to the reported and recently reported gene conservation regions of each strain of the American-type and European-type porcine reproductive and syndrome viruses, and the sources, types and ranges of the strains covered by the detection primers and the probes are wider, so that the defect of insufficient detection coverage of the existing PRRSV kit on new variant strains or recombinant strains of PRRSV can be effectively solved, and the possibility of false negative omission is reduced.

2. In the prior art, the primer, enzyme mixture and PCR buffer in the RT-qPCR reaction system are generally stored separately, and the components are mixed in sequence for use when in use, because the reaction system is unstable due to the fact that a plurality of components are mixed in advance, the detection result and the detection sensitivity are reduced or the fluorescence value is reduced. In the invention, the primer, the enzyme mixed solution and the PCR buffer are mixed together in the RT-qPCR full premix which is independently researched and developed, so that the use is more convenient. The RT-qPCR full premix formula is obtained by optimizing the amplification target gene fragment and the specific primer probe sequence according to the invention, and has higher detection sensitivity. In the detection process, the RNA sample to be detected can be tested on-machine only by adding the RNA sample to be detected into the full premix liquid in one step. And under the condition of ultra-fast qPCR reaction, RT-qPCR amplification can be completed within 30min, which saves nearly half of time compared with the traditional qPCR detection; the detection sensitivity is as high as 312 copies/mL. The method can perform qualitative analysis of viruses and simultaneously perform quantitative analysis of the viruses, has a good quantitative linear range (the slope of a standard curve of a specific real-time fluorescent quantitative PCR reaction system is-3.309, the intercept is 38.279, the R2=0.999 amplification efficiency is 100.537%), and has strong anti-interference capability, high detection precision and strong stability.

3. In the invention, a UNG enzyme anti-pollution system is added in an RT-qPCR amplification system, so that false positives of detection results caused by nucleic acid amplicon aerosol are avoided.

4. Compared with the traditional qPCR detection kit, the kit has higher positive detection rate; there are significant advantages in terms of handling steps, detection time and contamination resistance.

Drawings

FIG. 1 is a graph showing the experimental results of the primer screening of the present invention in example 1; wherein A is an amplification curve; b is a melting curve.

FIG. 2 is an amplification plot of RT-qPCR amplification using the reagents of the invention with A, B sets of reagents in example 2.

FIG. 3 is a standard graph of RT-qPCR amplification using the reagents of the invention and A, B sets of reagents in example 2.

FIG. 4 is an amplification plot of RT-qPCR amplification performed at different primer concentrations in example 3; a1, A2, A3 and A4 are amplification plots at primer concentrations of 0.2. Mu.M, 0.4. Mu.M, 0.6. Mu.M and 0.8. Mu.M, respectively.

FIG. 5 is an amplification plot of RT-qPCR amplification performed at different probe concentrations; b1, B2 and B3 are amplification curves at probe concentrations of 0.1. Mu.M, 0.2. Mu.M and 0.3. Mu.M, respectively.

FIG. 6 is a graph showing amplification at different annealing temperatures when RT-qPCR amplification is performed; c1, C2 and C3 are amplification curves at 58 ℃,60 ℃ and 62 ℃ respectively.

FIG. 7 is a graph showing the results of the kit-specific experiments of the present invention in example 4, and A-C are the results of three replicates.

FIG. 8 is the result of RT-qPCR amplification in the lowest limit of detection experiment of example 5, wherein FIG. 1 represents American type NADc-30 strains; 2 represents the American type strain JXA 1-R; 3 represents a American CH-1R strain; 4 represents the European HKEU strain; 5 represents the american R98 strain; 6 represents a CH-1a strain; 7 represents negative.

FIG. 9 shows the results of RT-qPCR amplification in the lowest limit of detection experiment of example 6.

FIG. 10 shows the amplification standard curve of the kit RT-qPCR of the present invention.

FIG. 11 shows the sensitivity test results of the kits of the invention and control kits; wherein,

A is an amplification curve and a standard curve of the kit;

And B is an amplification curve and a standard curve of the control kit.

FIG. 12 shows the results of the precision assay of the kit of the present invention in example 7; wherein,

A is the precision in the batch, and B is the precision between batches.

FIG. 13 is a graph showing the results of the interference test for the kits of the invention and control kits of example 8; wherein A is the interference experimental result of the kit; b is the experimental result of the interference item of the control kit.

FIG. 14 shows the results of the clinical sample test of the test agent of the present invention in example 10; wherein, A is 82 serum samples to be tested (14 positive detections), B is 36 fecal swabs and 48 pharyngeal swabs (15 positive detections), and C is 60 lymph samples (7 positive detections).

FIG. 15 shows the results of a comparative test agent clinical sample; wherein, A is 82 serum samples to be tested (12 positive detections), B is 36 fecal swabs and 48 pharyngeal swabs (14 positive detections), and C is 60 lymph samples (6 positive detections). Wherein the negative control comprises detecting a negative control, extracting a negative control, and extracting an open tube negative control.

Fig. 16 is a graph showing the results of the additional tests of 4 suspected positive samples in example 10.

Detailed Description

The 5' end of the fluorescent probe carries a reporting fluorescent group, wherein the reporting fluorescent group is one of 6-FAM, HEX, TET, TAMRA, cy, cy5, cy 5.5, texas Red, yakima Yellow or VIC; the 3' -end of the fluorescent probe carries a quenching fluorescent group, and the quenching fluorescent group is selected from one of MGB, BHQ-1, BHQ-2 or BHQ-3.

The invention also provides a kit for detecting the porcine reproductive and respiratory syndrome virus RT-qPCR, which comprises RT-qPCR full premix liquid, wherein the RT-qPCR full premix liquid comprises the following reagents:

(1) The primer and the fluorescent probe are combined;

(2) qPCR enzyme premix;

The qPCR enzyme premix also comprises a PCR Buffer, an enzyme mixed solution and RNASE FREE H ₂ O;

The PCR Buffer comprises the following components in concentration: tris 0.2~0.3M,KCl 45~55mM,MgCl ₂ 23~25mM,dNTP 0.2~0.5 mM,dUTP 0.2~0.3mM-5 mug/mL of Niu Ningxie enzyme, 0.4-0.6M of tetrahydropyrimidine, 1-8 ng/. Mu.L of single-chain binding protein, 6-10 mM of dithiothreitol, 0.5-2.5 mM of TAA (thioacetamide), 0.25-1% of sucrose and 2-3% of DMSO.

In the PCR Buffer, the concentration of Tris is 0.2-0.3M, more preferably 0.23-0.27M, and still more preferably 0.25M;

The concentration of KCl is 45 to 55mM, more preferably 48 to 52mM, still more preferably 50mM;

The concentration of MgCl ₂ is 23 to 25mM, more preferably 23.5 to 24.5mM, still more preferably 24mM;

The concentration of dNTPs is 0.2 to 0.5 mM, more preferably 0.3 to 0.4mM, still more preferably 0.35 mM mM;

The concentration of dUTP is 0.2 to 0.3 mM, more preferably 0.22 to 0.28 mM, still more preferably 0.25mM;

the concentration of bovine thrombin is 0.5 to 5. Mu.g/mL, more preferably 0.5 to 2.0. Mu.g/mL, still more preferably 1. Mu.g/mL;

The concentration of tetrahydropyrimidine is 0.4 to 0.6M, more preferably 0.45 to 0.55M, still more preferably 0.5M;

The concentration of the single-chain binding protein (gp 32) is 1 to 8 ng/. Mu.L, more preferably 1 to 3 ng/. Mu.L, still more preferably 2 ng/. Mu.L;

The dithiothreitol concentration is 6 to 10 mM, more preferably 7 to 9 mM, still more preferably 8 mM;

The concentration of TAA (thioacetamide) is 0.5 to 2.5 mM, more preferably 0.5 to 0.8 mM, still more preferably 0.5 mM;

The percentage content of sucrose in the reaction system is 0.25-1%, more preferably 0.5-0.8%, and still more preferably 0.5%;

the volume percentage of DMSO in the reaction system is 2-3%, more preferably 2.2-2.7%, and even more preferably 2.5%.

The enzyme mixed solution comprises the following components in concentration: 2.3-2.5U/. Mu.L of RNase inhibitor; uracil glycosylase 0.4-0.6U/. Mu.L, and efficient reverse transcriptase 15-17U/. Mu.L; quick Taq enzyme is 0.1-0.2U/. Mu.L;

In the enzyme mixed solution, the concentration of the RNase inhibitor is 2.3-2.5U/mu L, more preferably 2.35-2.45U/mu L, and still more preferably 2.4U/mu L;

The concentration of uracil glycosylase (UDG enzyme) is 0.4 to 0.6U/. Mu.L, more preferably 0.45 to 0.55U/. Mu.L, still more preferably 0.5U/. Mu.L;

The concentration of the efficient reverse transcriptase is 15-17U/mu L, more preferably 15.5-16.5U/mu L, and still more preferably 16U/mu L;

the concentration of the Taq enzyme is 0.1-0.2U/. Mu.L, more preferably 0.13-0.17U/. Mu.L, and still more preferably 0.15U/. Mu.L.

The above-mentioned components may be adjusted within a protective range, but are not limited to the above-mentioned concentrations.

The RT-qPCR detection kit for the porcine reproductive and respiratory syndrome virus also comprises a positive reference substance and a negative reference substance; wherein the positive reference substance is a plasmid containing an amplification sequence of porcine reproductive and respiratory syndrome virus PRRSV, and the concentration is 10 ⁸ copies/mL; the negative control is RNASE FREE H ₂ O.

The invention also provides application of the combination of the RT-qPCR detection primer and the fluorescent probe for detecting the porcine reproductive and respiratory syndrome virus in a kit for detecting the virus. The detection of porcine reproductive and respiratory syndrome virus comprises the following steps: using the primer and fluorescent probe combination, carrying out RT-qPCR amplification by taking DNA or RNA of a sample to be detected as a template, and judging the result according to an amplification curve and a reaction Ct value, wherein the judgment standard is as follows:

In the present invention, the RT-qPCR reaction procedure is: 5 min at 50 ℃; 10 s at 95 ℃; fluorescence signals were collected from 95℃at 1s, 60℃at 20 s,45 cycles.

In the examples of the present invention, except for example 1, the RT-qPCR was performed by using the RT-qPCR whole premix to perform the "one-step" detection, and it was not necessary to sequentially mix the various components.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

In the examples of the present invention, detection was performed using a fluorescent quantitative PCR instrument of the full-automatic medical PCR analysis system Tianlong Gentier R (Siami Tianlong technologies Co.).

EXAMPLE 1 Gene-specific primer screening

2 Pairs of primers were designed for screening according to the whole gene sequences of PRRSV european-type representative strain and isolate and american-type representative strain and isolate published in GeneBank (american-type gene No. ：JN654459.1 ,KP998431.1 ,EF536003.1,EF112445.1,FJ548855.1,AB288356.1,AF184212.1,AF494042.1,EF536000.1,KF724404.1,AF331831.1,KJ143621.1,EU807840.1,JQ308798.1,JN662424.1,MN046240.1,MN648449.1,MG913987.1,KP861625.1, MF326985.1, european-type gene No. ：EU076704.1,KF287129.1,KF287128.1,GU047345.1,JF276433.1,JF802085.1,KX668221.1,AY588319.1,KC862570.1,KP889243.1,KP860912.1,KT159249.1,KY434184.1 ,KY767026.1,MF346695.1,MG251833.1,MK876228.1 ,MN175678.1 ,MZ417465.1, OM893851.1 ,OM893855.1） for the conserved region (M gene) of the whole gene sequence at different positions (table 2).

TABLE 2 PRRSV primer, probe sequences

The primer set 2 (PRRSV-F1/R1 and PRRSV-F2/R2) was initially screened using PRRSV (JXA 1-R strain; strain source see example 5) cDNA as a template, and the Ct values and melting curves were analyzed to evaluate primer suitability and primer dimer conditions using SYBR Green dye method [ 2X RealStar SYBR Mixture (with ROX), shenzhen Huinobio-tech Co., ltd.) and its instructions.

The results show that the amplification of the two groups of primers obtains a typical S-shaped amplification curve, and no primer dimer and non-specific amplification are generated; however, the primer set 1 (PRRSV-F1/R1) amplified gave a smaller detection Ct value and a higher fluorescence value than the primer set 2 (FIG. 1). Therefore, the 1 st pair of primers is selected as the primer of the present invention, and a detection probe PRRSV-P1 is designed.

Example 2 RT determination of the composition of the PCR Buffer and enzyme mixture in the qPCR Whole premix

The optimum PCR Buffer formulation components and enzyme cocktail formulation components of the present invention are shown in tables 3 and 4, respectively, as explored.

Table 3 PCR Buffer recipe Components

Table 4 enzyme cocktail formulation components

TABLE 5 RT-qPCR full premix formula Components

The preferred primer (PRRSV-F1/R1) and the probe (PRRSV-P1) are adopted, the RT-qPCR full premix liquid in the table 5 is used for amplifying recombinant plasmid DNA (5 mu L) carrying target genes, the copy number of the recombinant plasmid gene is set to be 3.12X10 ³copies/µL、3.12×10² copies/μL、3.12×10¹ copies/mu L, and the preparation method of the recombinant plasmid is shown in the example 6); meanwhile, the primer and the probe are adopted, two types of Master Mix with better industry evaluation are used for amplifying recombinant plasmid DNA, and the two types of Master Mix are divided into A, B groups:

Group A reagents were purchased from Nanjinouzan biotechnology Co., ltd., HISCRIPT II U ⁺ One Step qRT-PCR Probe Kit (non-fully premixed format commodity, i.e., primer Probe and enzyme cocktail were stored separately);

group B reagents were purchased from Abelmoschus manihot gold ligand biotechnology Co., ltd., qRT-PCR Kit [ v6] (UDG System) (non-fully premixed format commodity, i.e., primer probes and enzyme cocktail were stored separately);

The reagent of the group C is the RT-qPCR detection reagent, namely RT-qPCR full premix.

The results of the detection are shown in FIG. 2, FIG. 3 and Table 6.

TABLE 6 detection comparison of the full premix of the invention with other Master Mix

The result shows that the RT-qPCR full premix provided by the invention is obviously superior to other two reaction systems in detection sensitivity, amplification efficiency, R ² and detection repeatability, and the optimal detection result can be obtained.

Example 3 PRRSV determination of primer, probe and annealing temperature

The invention uses 3.12X10 ³ copies/μL、3.12×10² copies/μL、3.12×10¹ copies/. Mu.L standard plasmid as template, sets the primer concentration to 0.2. Mu.M, 0.4. Mu.M, 0.6. Mu.M, 0.8. Mu.M, and the probe concentration to be unchanged.

RT-qPCR amplification was performed at different primer concentrations, the amplification system is shown in Table 7, and the average Ct values and amplification efficiencies obtained are shown in Table 8.

TABLE 7 amplification system (25. Mu.L)

The PCR Buffer comprises the following components in concentration: 0.25 M Tris, ph=8.6, 50 mM KCl,24 mM MgCl ₂; 0.25 mM dNTP,0.25 mM dUTP;2.5% DMSO,0.5% sucrose, 1. Mu.g/mL Niu Ningxie enzyme, 0.5M tetrahydropyrimidine, 2 ng/. Mu.L single-stranded binding protein (gp 32), 8mM dithiothreitol, 0.5 mM TAA (thioacetamide).

The enzyme mixed solution comprises the following components in concentration: 2.4 U/. Mu.L of RNase inhibitor; 0.5 U/25. Mu.L uracil glycosylase (UDG enzyme), 16U/. Mu.L efficient reverse transcriptase; rapid Taq enzyme 0.15U/. Mu.L.

The RT-qPCR reaction procedure was: 5 min at 50 ℃; 10 s at 95 ℃; fluorescence signals were collected from the 60℃step at 95℃for 1 s, 60℃for 20 s,45 cycles. The results are shown in Table 8 and FIG. 4.

TABLE 8 Ct mean and amplification efficiency after amplification at different primer concentrations

As is clear from Table 8 and FIG. 4, the fluorescence detection signal intensity was low at a primer concentration of 0.2. Mu.M, and the detection Ct value and amplification efficiency were not significantly different when the primer concentration was increased to 0.4. Mu.M, 0.6. Mu.M and 0.8. Mu.M, so that the primer concentration was determined to be 0.4. Mu.M.

RT-qPCR amplification was performed with primer concentration set to 0.4. Mu.M, probe concentration set to 0.1. Mu.M, 0.2. Mu.M, and 0.3. Mu.M, and the average Ct and amplification efficiency obtained by the same amplification system and amplification procedure are shown in Table 9.

TABLE 9 Ct mean and amplification efficiency after amplification at different probe primer concentrations

As is clear from Table 9 and FIG. 5, the amplification curve has a good linear relationship between the probe concentration of 0.1. Mu.M and 0.3. Mu.M, and the amplification efficiency is higher than 0.3. Mu.M at the probe concentration of 0.1. Mu.M, so the probe concentration was determined to be 0.1. Mu.M.

The primer concentration was set to 0.4. Mu.M, the probe concentration was set to 0.1. Mu.M, and amplification was performed by the same amplification system as in the above, and the denaturation and extension temperatures and the temperature rise procedures were the same as in the RT-qPCR amplification, and the annealing temperatures were set to 58℃at 60℃at 62℃respectively, and the Ct average values and the amplification efficiencies at the different annealing temperatures were as shown in Table 10 and FIG. 6.

TABLE 10 Ct mean and amplification efficiency at different annealing temperatures

As can be seen from table 10 and fig. 6, when the degradation temperature is 60 ℃, the amplification reaction has a good linear relationship and the amplification efficiency is also within a qualified range, so the annealing temperature is finally determined to be 60 ℃.

Example 4 kit specificity verification

Taking positive samples or simulated positive samples of 18 swine susceptibility pathogens, wherein the pathogens comprise: pseudorabies virus (PRV), porcine Parvovirus (PPV), porcine circovirus type 2 (PCV 2), porcine circovirus type 3 (PCV 3), swine fever virus (CSFV), porcine encephalitis b virus (JEV), transmissible gastroenteritis virus (TGEV), epidemic diarrhea virus (PEDV), porcine rotavirus (PoRV), swine Influenza Virus (SIV), foot and Mouth Disease Virus (FMDV), streptococcus Suis (SS), haemophilus parasuis (Hps), escherichia coli (ED), erysipelas pig bacillus (Ery), actinobacillus pleuropneumoniae (APP), mycoplasma hyopneumoniae (Mp), porcine infectious Atrophic Rhinitis (AR) and pasteurella suis (PRDC), viral or bacterial nucleic acid is extracted using a viral DNA/RNA extraction kit or a bacterial DNA extraction kit, both purchased from the company of schlight biotechnology (jilin). After extracting sample DNA/RNA, RT-qPCR amplification was performed using the kit of the present invention in an amplification system of 25. Mu.L, including 5. Mu.L of sample DNA or RNA template, 10. Mu. Mol/L PRRSV-P1.25. Mu.L, 10. Mu. Mol/L PRRSV-F1 1. Mu.L, 10. Mu. Mol/L PRRSV-R1 1. Mu.L, PCR Buffer 7.5. Mu.L, enzyme mix solution 4.75. Mu.L and RNASE FREE H ₂ O5.5. Mu.L. The components of the PCR Buffer and the enzyme mixture are shown in tables 3 and 4, respectively. The amplification procedure was: 5 min at 50 ℃;10 s at 95 ℃;95℃1 s, 60℃20 s,45 cycles. Fluorescence signals were collected from the 60℃step, and the amplification results are shown in FIG. 7. As shown in FIG. 7, the kit provided by the invention has no amplification on positive samples of 18 swine susceptibility pathogens, and shows that the kit provided by the invention has good specificity.

In the embodiment, the pseudorabies virus (PRV) is derived from a porcine pseudorabies live vaccine, and specifically adopts a conventional porcine pseudorabies live vaccine (HB-98 strain) with the commercial specification of 10 parts per bottle produced by the Ministry of the middle-grazing industry, and the production batch number is 2212022;

porcine Parvovirus (PPV) is derived from porcine parvovirus inactivated vaccine, and is specifically a conventional porcine parvovirus inactivated vaccine (WH-1 strain) with the commercial specification of 20 mL/bottle produced by the pre-organism stock company of the Wuhan family, and the production batch number is 20220817;

The porcine circovirus type 2 (PCV 2) is derived from porcine circovirus type 2 inactivated vaccine, and specifically adopts a porcine circovirus type 2 inactivated vaccine (SH strain) with the conventional commercial specification of 20 mL/bottle produced by Protect bioengineering Co., ltd, and the production batch number of 072110006;

The whole gene sequence of the circular ring 3 virus is synthesized according to the whole gene sequence of the porcine circular ring 3 virus (29160 strain, genebank NO: KT 869077.1), and is synthesized by general biology (Anhui) stock, inc., and stored at-20 ℃ for later use;

the swine fever virus (CSFV) is derived from a swine fever live vaccine, and specifically adopts a conventional swine fever live vaccine (passage cell source) with the commercial specification of 10 parts per bottle produced by the Ministry of China industry, co., ltd.) to contain a swine fever lapinized virulent strain (CVCC AV1412 strain), and the production batch number is 2201011;

The pig Japanese Encephalitis Virus (JEV) is derived from pig Japanese encephalitis live vaccine, and specifically adopts 10 parts per bottle of pig Japanese encephalitis live vaccine (SA 14-14-2 strain) with the production batch number of 20220721 which is produced by the general commercial specification of the Wuhan family pre-organism Co., ltd;

Transmissible gastroenteritis virus (TGEV), epidemic diarrhea virus (PEDV) and porcine rotavirus (PoRV) are derived from porcine transmissible gastroenteritis, porcine epidemic diarrhea and porcine rotavirus (G5 type) triple live vaccine, and the conventional commercial porcine transmissible gastroenteritis, porcine epidemic diarrhea and porcine rotavirus (G5 type) triple live vaccine (attenuated Hua strain+attenuated CV777 strain+NX strain) with the specification of 1 head part/bottle produced by Harbin Utility biotechnology Co., ltd is specifically adopted, and the production batch number is 2022020. I.e. in the course of the actual experiment, transmissible gastroenteritis virus (TGEV), epidemic diarrhea virus (PEDV) and porcine rotavirus (PoRV are both provided by the triple live vaccine;

The Swine Influenza Virus (SIV) is derived from an inactivated vaccine of H1N1 subtype of swine influenza virus, and specifically adopts a conventional inactivated vaccine (TJ strain) of H1N1 subtype of swine influenza virus with the commercial specification of 20 mL/bottle, which is produced by the pre-organism stock company of Wuhan, and the production batch number of 20220502;

Foot-and-mouth disease virus (FMDV) is derived from a foot-and-mouth disease type 0 and type A bivalent 3B protein epitope deletion inactivated vaccine, and specifically adopts a conventional foot-and-mouth disease type 0 and type A bivalent 3B protein epitope deletion inactivated vaccine (O/rV-1 strain+A/rV-2 strain) with the commercial specification of 20 mL/bottle produced by the inner Mongolian antai biotechnology Co-Ltd to produce batch number of 0AA220618;

Streptococcus Suis (SS) is derived from a streptococcus suis propolis inactivated vaccine, and specifically adopts a conventional and commercially available streptococcus suis propolis inactivated vaccine (streptococcus suis group C BHZZ-L1 strain+streptococcus suis type 2 BHZZ-L4 strain) with the specification of 20 mL/bottle produced by Shandong Hua Hong biological engineering Co., ltd, and the production batch number is 202209009;

Haemophilus parasuis (Hps) is derived from haemophilus parasuis disease tetravalent propolis inactivated vaccine, and specifically adopts a conventional haemophilus parasuis disease tetravalent propolis inactivated vaccine (4 type SD02 strain +5 type HN02 strain +12 type GZ01 strain +13 type JX03 strain) with a commercial specification of 20 mL/bottle produced by Shandong Hua Hong biological engineering Co., ltd.) to produce lot number 202209003;

The escherichia coli (ED) is derived from a trivalent inactivated vaccine of the escherichia coli disease of the piglets, and specifically adopts a conventional trivalent inactivated vaccine of the escherichia coli disease of the piglets (containing K88, K99 and 987P cilia antigens) with the commercial specification of 10 mL/bottle, which is produced by Shandong Hua Hong biological engineering Co., ltd, and the production batch number of 202209006;

The swine erysipelas bacillus (Ery) and the swine pasteurellosis bacillus (PRDC) are derived from swine fever, swine erysipelas and swine pasteurellosis triple live vaccines, and the production batch number of the conventional commercial triple live vaccines (cell source +G4T10 strain +EO630 strain) with the commercial specification of 10 parts per bottle produced by the middle-grazing industry Co., ltd is 2208037; during the experiment, erysipelothrix rhusiopathiae (Ery) and pasteurella suis (PRDC) were both provided by the triple live vaccine;

actinobacillus pleuropneumoniae (APP) is derived from a porcine infectious pleuropneumonia trivalent inactivated vaccine, and specifically adopts a conventional porcine infectious pleuropneumonia trivalent inactivated vaccine (a serum type 1 9901 strain, a serum type 2 XT9904 strain, a serum type 7 GZ9903 strain) with the commercial specification of 20 mL/bottle produced by the pre-organism division company of the martial arts, and the production batch number is 20220706;

Mycoplasma hyopneumoniae (Mp) is derived from a Mycoplasma hyopneumoniae inactivated vaccine, and is specifically adopted to be a Mycoplasma hyopneumoniae inactivated vaccine (J strain) with the production batch number of 20220808, wherein the conventional commercial specification of the Mycoplasma hyopneumoniae inactivated vaccine (J strain) is 20 mL/bottle, and the Mycoplasma hyopneumoniae inactivated vaccine is produced by Shandong Hua Hong biological engineering Co., ltd;

The porcine infectious Atrophic Rhinitis (AR) is derived from an inactivated vaccine for porcine atrophic rhinitis, and specifically adopts a conventional commercial inactivated vaccine for porcine atrophic rhinitis (Bo bacillus JB5 strain) with the specification of 20 mL/bottle produced by the Probiotics Co., ltd.) of the Wuhan family, and the production batch number is 20220602.

Example 5 detection of different strains

6 Popular PRRSV strains stored in the laboratory, including JXA1-R strain, CH-1a strain, R98 strain, american plasmid carrying NADc-30 target gene and European plasmid carrying HKEU strain target gene, were tested. The results of RNA extraction and RT-qPCR amplification of the above strains are shown in FIG. 8. As shown in FIG. 8, the RT-qPCR detection kit has wide detection coverage, solves the problem of insufficient detection coverage of the existing PRRSV kit on new variant strains or recombinant strains of PRRSV, and reduces the possibility of false negative omission.

In the embodiment, the porcine reproductive and respiratory syndrome virus JXA1-R strain is derived from a highly pathogenic porcine reproductive and respiratory syndrome live vaccine, and specifically adopts a highly pathogenic porcine reproductive and respiratory syndrome live vaccine (JXA 1-R strain) with the conventional commercial specification of 10 parts per bottle produced by the middle-grazing practice Co., ltd., and the production batch number of 2304002;

the porcine reproductive and respiratory syndrome live vaccine (CH-1R strain) is produced by the pharmaceutical Co-Ltd of Chengdu Sch Ji Shengwu, and has the conventional commercial specification of 10 parts per bottle, and the production batch number of 202303;

The porcine reproductive and respiratory syndrome inactivated vaccine (CH-1 a strain) with the standard of 20 mL/bottle is produced by the pre-organism stock company of the Wuhan family, and the production batch number is 20230909;

The porcine reproductive and respiratory syndrome live vaccine (R98 strain) is produced by the PRIOR, and the production batch number of the porcine reproductive and respiratory syndrome live vaccine (R98 strain) is 20230301, wherein the conventional commercial specification of the PRIOR is 10 parts/bottle;

The target gene of the porcine reproductive and respiratory syndrome virus NADc-30 strain is provided in the form of a recombinant plasmid, specifically, the target gene is synthesized according to the complete gene sequence of NADC-30 strain (Genebank NO: JN 654459.1), 196bp target fragment to be detected is inserted into a pUCm-T vector, and the recombinant plasmid is used for preservation, wherein the copy number of the target gene in the plasmid is 3.12 multiplied by 10 ⁴ copies/. Mu.L;

The European HKEU strain target gene of the porcine reproductive and respiratory syndrome virus is provided in the form of recombinant plasmid, specifically, the gene synthesis is carried out on a 196bp target fragment to be detected according to the gene sequence of European HKEU strain (Genebank NO: EU 076704.1), and the target gene is inserted into a pUCm-T vector, and is preserved through the recombinant plasmid, wherein the plasmid concentration is 100 ng/. Mu.L.

Example 6 sensitivity verification of kit

Reference molecular cloning guidelines fourth edition (translation: he Fuchu, authors: M.R. Green J. Sambucus, ruck; publishing company: beijing science publishing company; publication date: 2017.09), inserting the desired fragment on pUCm-T plasmid vector [ purchased from Shanghai Biotechnology Co., ltd. ], to form recombinant plasmid as plasmid standard; the plasmid standard substance comprises PRRSV specific gene fragment as shown in SEQ ID NO.6

SEQ ID NO.6:

TACATTCTGGCCCCTGCCCACCACGTTGAAAGTGCCGCAGGCTTTCATCCGATAACGGCAAGTGATAACCACGCATTTGTCGTCCGGCGTCCCGGTTCCACTACGGTCAACGGCACACTGGTGCCCGGGTTTAAAAGCCTCGTGTTGGGTGGCAGAAGAGCTGTTAAACGAGGAGTGGTGAACCTTGTTAAATATG

The plasmid concentration was determined to be 100 ng/. Mu.L according to the formula: y (copies/. Mu.L) = (6.02X10 ²³ copies/mol) × (Xng/. Mu.L. Times.10 ^-9)/(DNA length. Times.660), the copy number of the gene was calculated.

The standard plasmid was diluted at 10-fold gradient concentration to obtain 3.12X10 ⁶copies/μL - 3.12×10^-1 copies/. Mu.L of plasmid, respectively, and RT-qPCR amplification was performed using the kit of the present invention with the plasmids of different concentrations as templates, and the reaction system and the reaction procedure were the same as in example 3, and the amplification curve was shown in FIG. 9. FIG. 9 shows that the minimum limit of detection of the kit of the present invention for the plasmid containing the target gene of PRRSV is 3.12X10 ^-1 copies/. Mu.L (312 copies/mL).

FIG. 10 is a fluorescent quantitative PCR standard curve using plasmid standards ranging in concentration from 3.12X10 ⁶copies/μL~3 .12×10^-1 copies/. Mu.L. FIG. 10 shows that the log-value of positive plasmid copy number shows a good log-linear relationship with Ct value. Specifically, the slope of the standard curve of the real-time fluorescence quantitative PCR reaction system is-3.309, the intercept is 38.279, R ² =0.999, and the amplification efficiency is 100.537%. The standard concentration curve equation is: y= -3.53x+46.18, where x is the log value of the concentration and y is the Ct value.

The R ² value reflects the linearity of a standard curve, the linearity relation fitting degree between the Ct value and the copy number of a plasmid standard substance is higher according to the above parameters of the standard curve, and R ² =0.999.

The invention adopts a commercial kit with better evaluation in industry, namely a universal real-time fluorescent RT-qPCR detection kit for porcine reproductive and respiratory syndrome virus (purchased from Beijing Shijiheng animal epidemic prevention technology Co., ltd.) as a contrast, and compares the sensitivity and amplification efficiency of the kit.

The RT-qPCR reaction system of the control kit was 25. Mu.L, wherein the sterile nuclease-free water was 2.0. Mu. L, RT-12.5. Mu.L, the enzyme mix was 1.0. Mu.L, the fluorescent probe was 4.5. Mu.L and the RNA template was 5. Mu.L. The RT-qPCR reaction procedure was: 42 ℃ for 5min, 95 ℃ for 10 s, 95 ℃ for 5 s, 60 ℃ for 35 s 45 cycles.

RNA of PRRSV (JXA 1-R strain) was extracted and diluted 10-fold, gene amplification was performed using 10 ⁴~10⁸ -fold dilution of RNA as a template (ddH ₂ O as a negative control) by the methods provided by the kit and RT-qPCR method of the present invention and the control kit, respectively, and the detection was repeated twice, and the results are shown in Table 11 and FIG. 11.

Table 11 comparison of the inventive kit with the control kit

The results show that the control reagent can detect the nucleic acid dilution which is 10 ⁶ times diluted of PRRSV at the lowest, the amplification efficiency of the standard curve is 86.595% in the gradient range of 10 ⁴~10⁶, and the correlation coefficient R ² is more than 0.998; the kit and the detection method can detect the nucleic acid dilution of the PRRSV of 10 ⁷ at the lowest, the amplification efficiency of a standard curve is 100.395% in the dilution gradient range of 10 ⁴~10⁶, and the correlation coefficient R ² is more than 0.999.

The kit and the detection method of the invention are obviously superior to those of a control kit in detection sensitivity and amplification efficiency.

EXAMPLE 7 precision test

In order to evaluate the stability of the detection method, the experimental study of the precision in the batch and the precision between batches is carried out by adopting an optimized reaction system and an optimized procedure. The in-batch precision of the detection reagent is determined by using medium positive to weak positive standard plasmids (3.12X10 ³copies/μL、3.12×10²copies/μL、3.12×10¹ copies/. Mu.L) as templates, ddH ₂ O as a negative control, and RT-qPCR full premix prepared in the same batch, and performing RT-qPCR amplification by setting 4 times for each template. In addition, 5 batches of RT-qPCR full premix solutions are respectively prepared in 5 working days in a week for researching the precision between batches of the detection method, and each template is set for 2 times of repetition to carry out RT-qPCR amplification; the formula for calculating the coefficient of variation is as follows: coefficient of Variation (CV) =standard deviation SD/mean×100%. The results are shown in Table 12 and FIG. 12.

Table 12 results of precision experiments

As shown by the results in Table 12, the Ct average values of the in-batch precision test were 21.428, 25.322 and 28.859, respectively; coefficient of Variation (CV) of 0.150%, 0.268% and 0.081% respectively, which are less than 0.3%, ct average values of 21.468, 25.337 and 28.866 respectively in the inter-batch precision test; the Coefficient of Variation (CV) is respectively 0.362%, 0.265% and 0.089%, which are less than 0.5%, and the established detection method is proved to have good stability.

Example 8 anti-tamper verification of kit

100. Mu.L of 3.12X10 ³ copies/. Mu.L of positive plasmid was mixed with 100. Mu.L of endogenous and exogenous interfering substances to form simulated samples, and each group of samples was tested in 2 replicates. RT-qPCR amplification was performed using the kit of the present invention and commercial kit, respectively, using the extracted nucleic acid as a template, and the amplification system and amplification procedure were the same as in example 4.

The experiments were divided into fifteen groups, the first to fifth groups being supplemented with exogenous interferents. The first group contains ceftiofur sodium for injection (300 mu L), florfenicol powder (30 mu L), tilmicosin premix (30 mu L) and normal saline (240 mu L), the second group contains amoxicillin for injection (300 mu L), doxycycline hydrochloride soluble powder (150 mu L), tiamulin fumarate soluble powder (150 mu L), the third group contains dexamethasone acetate tablet (2.5 mu L), gentamicin sulfate (30 mu L), normal saline (567.5 mu L), the fourth group contains ribavirin particles (10 mu L), amantadine hydrochloride tablet (15 mu L) and normal saline (575 mu L), and the fifth group is feed residues.

The sixth to thirteenth groups are supplemented with endogenous interferents; the sixth group is a throat swab sample, the seventh group is a pig liver sample, the eighth group is a pig lung sample, the ninth group is a pig small intestine sample, the tenth group is a pig manure swab, the eleventh group is pig milk, the twelfth group is pig blood, the thirteenth group is mucin (270 mu L), physiological saline (270 mu L), and the kit further comprises a positive control group and a negative control, wherein 100 mu L of 3.12 multiplied by 10 ³ copies/mu L positive plasmid is mixed with 100 mu L of ddH ₂ O to be used as the positive control, and the negative control is ddH ₂ O. Five to twelve groups of sample processing methods are detailed in: community standard T/CVMA-2018.

The results are shown in Table 13 and FIG. 13.

TABLE 13 results of interference test for Ct value detection

Note that: t1 and T2 respectively represent 2 test results of one sample

As can be seen from Table 13, the detection kit of the present invention can accurately detect porcine reproductive and respiratory syndrome virus even when exogenous interferents are added to a detection sample, and has a high anti-interference capability.

Example 9 thermal stability verification of kit

For evaluating the stability of the detection reagent, a thermal acceleration experiment is adopted, the RT-qPCR full premix prepared by the invention is stored for 7 days at 37 ℃, then RT-qPCR amplification is carried out, continuous test is carried out by taking 3.12X10 ² copies/. Mu.L positive plasmid as a template, and the Ct value is recorded. The results of the control group were shown in Table 14, which was a full premix stored at-20 ℃.

TABLE 14 thermal acceleration test results

As shown in Table 14, the CT values detected in consecutive days 1, 3, 5, and 7 are uniformly distributed between 25.5 and 26.5, and the coefficient of variation CV is less than 0.5. Therefore, the RT-qPCR full-premix working solution disclosed by the invention has higher stability and can meet the detection requirement.

Example 10 true sample detection

In order to accurately compare the detection effect of the kit and the detection effect of the existing commercial reagent, the kit is subjected to parallel comparison detection with the commercial reagent of commercial animal epidemic prevention technology company Limited in Beijing era. The kit is used for detecting 226 parts of samples in parallel according to the detection method, the control group kit and the control method, wherein the samples are collected from 6 pig farms around Jilin in Jilin of Jilin province, and the samples to be detected comprise 82 parts of pig serum, 48 parts of nasopharynx swab, 36 parts of fecal swab, 60 parts of lymph and other tissue samples.

To ensure the accuracy of the detection result, a positive control provided in the kit is set, a negative control for nucleic acid extraction is set to monitor the nucleic acid extraction process, an open-tube control is set to monitor the extraction environment, a negative control for PCR is set, and the PCR reaction process is monitored. The results are shown in fig. 14 and 15.

As can be seen from fig. 14 and 15, 36 cases of PRRSV positives were detected by the method of the present invention, and 32 cases of PRRSV positives were detected by the control kit; wherein 4 samples are positive in detection (Ct values are 33, 34.5, 35 and 37 respectively) and negative in detection by the control reagent; for the 4 samples, the primers and probes provided by GB/T35912-2018 porcine reproductive and respiratory syndrome virus fluorescent RT-PCR detection method were used for nucleic acid amplification, and the amplification result was positive (FIG. 16). The result shows that 4 cases of weak positive samples detected by the PRRSV gene detection reagent provided by the invention are positive to PRRSV.

The detection reagent has a PRRSV positive detection rate of 16%, but the competitive product reagent has a PRRSV positive detection rate of 14%. The method provided by the invention has the advantages that the detection of the real sample is quicker, the positive detection rate of the real sample is higher, and the method is suitable for early and accurate detection of PRRSV (porcine reproductive and respiratory syndrome virus) which is a major infection.

As can be seen from the above examples, the present invention provides a primer for detecting porcine reproductive and respiratory syndrome virus RT-qPCR, a kit and applications thereof. The detection kit has the advantages of rapid detection, high detection sensitivity, good quantitative linear range, strong anti-interference capability of detection, high detection precision, strong stability and high detection rate.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

1. The RT-qPCR detection kit is characterized by comprising a forward primer PRRSV-F1, a reverse primer PRRSV-R1, a fluorescent probe PRRSV-P1 and qPCR enzyme premix;

The nucleotide sequence of the fluorescent probe PRRSV-P1 is shown in SEQ ID NO. 3;

The qPCR enzyme premix comprises PCRbuffer and an enzyme mixed solution; PCRbuffer and enzyme mixed solution in a volume ratio of 1.5-3:1;

In the RT-qPCR detection kit, a detection primer, a fluorescent probe and the qPCR enzyme premix exist in a full premix form;

The PCR Buffer comprises the following components in concentration: tris 0.2-0.3M, KCl 45-55 mM, mgCl ₂ -25 mM, dNTP 0.2-0.5 mM, dUTP 0.2-0.3 mM, bovine thrombin 0.5-5 μg/mL, tetrahydropyrimidine 0.4-0.6M, single-chain binding protein 1-8 ng/μL, dithiothreitol 6-10 mM, thioacetamide 0.5-2.5 mM, sucrose 0.25-1%, DMSO 2-3%; the percentage of sucrose and DMSO is volume percentage;

the enzyme mixed solution comprises the following components in concentration: 2.3 to 2.5U/. Mu.L of RNase inhibitor; uracil glycosylase 0.4-0.6U/. Mu.L, high efficiency reverse transcriptase 15-17U/. Mu.L; quick Taq DNA polymerase 0.1-0.2U/. Mu.L.

2. The kit for detecting the porcine reproductive and respiratory syndrome virus RT-qPCR according to claim 1, wherein the 5' -end of the fluorescent probe carries a reporter fluorescent group, and the reporter fluorescent group is 6-FAM, HEX, TET, TAMRA, cy, cy5, cy5.5, texas Red, yakimaYellow or VIC; the 3' -end of the fluorescent probe carries a quenching fluorescent group, and the quenching fluorescent group is MGB, BHQ-1, BHQ-2 or BHQ-3.

3. The kit for detecting the porcine reproductive and respiratory syndrome virus RT-qPCR according to claim 1 or 2, wherein in the kit for detecting the RT-qPCR, the concentration of each primer is independently 0.20-0.80 mu mol/L, and the concentration of the specific probe is 0.10-0.30 mu mol/L.

4. The kit for detecting Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) RT-qPCR according to claim 3, further comprising a positive control and a negative control;

the positive reference substance is a plasmid containing a specific gene fragment of porcine reproductive and respiratory syndrome virus PRRSV;

The negative control is RNASE FREE H ₂ O.