CN117843735A - Novel coronavirus S1 whole protein group screening specific CD4T cell epitope peptide and application thereof - Google Patents
Novel coronavirus S1 whole protein group screening specific CD4T cell epitope peptide and application thereof Download PDFInfo
- Publication number
- CN117843735A CN117843735A CN202311130011.7A CN202311130011A CN117843735A CN 117843735 A CN117843735 A CN 117843735A CN 202311130011 A CN202311130011 A CN 202311130011A CN 117843735 A CN117843735 A CN 117843735A
- Authority
- CN
- China
- Prior art keywords
- cell
- epitope peptide
- novel coronavirus
- antigen presenting
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108090000765 processed proteins & peptides Proteins 0.000 title claims abstract description 47
- 241000711573 Coronaviridae Species 0.000 title claims abstract description 22
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 21
- 238000012216 screening Methods 0.000 title claims abstract description 20
- 102000004169 proteins and genes Human genes 0.000 title abstract description 11
- 210000004027 cell Anatomy 0.000 claims abstract description 42
- 210000000612 antigen-presenting cell Anatomy 0.000 claims abstract description 13
- 108010026552 Proteome Proteins 0.000 claims abstract description 4
- 210000001744 T-lymphocyte Anatomy 0.000 claims description 24
- 108020001507 fusion proteins Proteins 0.000 claims description 4
- 102000037865 fusion proteins Human genes 0.000 claims description 4
- 230000003213 activating effect Effects 0.000 claims description 3
- 241000702421 Dependoparvovirus Species 0.000 claims description 2
- 101000968028 Homo sapiens HLA class II histocompatibility antigen, DRB1 beta chain Proteins 0.000 claims description 2
- 125000003275 alpha amino acid group Chemical group 0.000 claims description 2
- 210000003719 b-lymphocyte Anatomy 0.000 claims description 2
- 230000001939 inductive effect Effects 0.000 claims description 2
- 210000002540 macrophage Anatomy 0.000 claims description 2
- 210000001616 monocyte Anatomy 0.000 claims description 2
- 239000002773 nucleotide Substances 0.000 claims description 2
- 125000003729 nucleotide group Chemical group 0.000 claims description 2
- 230000004936 stimulating effect Effects 0.000 claims description 2
- 241000701161 unidentified adenovirus Species 0.000 claims description 2
- 230000035755 proliferation Effects 0.000 claims 1
- 229960005486 vaccine Drugs 0.000 abstract description 10
- 102000004196 processed proteins & peptides Human genes 0.000 abstract description 8
- 229920001184 polypeptide Polymers 0.000 abstract description 7
- 230000028993 immune response Effects 0.000 abstract description 5
- 238000012827 research and development Methods 0.000 abstract description 4
- 239000012642 immune effector Substances 0.000 abstract description 3
- 229940121354 immunomodulator Drugs 0.000 abstract description 3
- 102000007056 Recombinant Fusion Proteins Human genes 0.000 abstract description 2
- 108010008281 Recombinant Fusion Proteins Proteins 0.000 abstract description 2
- 108700010904 coronavirus proteins Proteins 0.000 abstract description 2
- 201000010099 disease Diseases 0.000 abstract description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 abstract description 2
- 239000003814 drug Substances 0.000 abstract description 2
- 150000001875 compounds Chemical class 0.000 abstract 1
- 108010067902 Peptide Library Proteins 0.000 description 12
- 230000000638 stimulation Effects 0.000 description 10
- 238000001514 detection method Methods 0.000 description 8
- 210000003819 peripheral blood mononuclear cell Anatomy 0.000 description 8
- 108010058597 HLA-DR Antigens Proteins 0.000 description 7
- 102000006354 HLA-DR Antigens Human genes 0.000 description 7
- 101710172711 Structural protein Proteins 0.000 description 6
- 230000005867 T cell response Effects 0.000 description 6
- 239000000427 antigen Substances 0.000 description 6
- 108091007433 antigens Proteins 0.000 description 6
- 102000036639 antigens Human genes 0.000 description 6
- 230000000903 blocking effect Effects 0.000 description 6
- 101001100327 Homo sapiens RNA-binding protein 45 Proteins 0.000 description 5
- 101001028244 Onchocerca volvulus Fatty-acid and retinol-binding protein 1 Proteins 0.000 description 5
- 102100038823 RNA-binding protein 45 Human genes 0.000 description 5
- 238000003556 assay Methods 0.000 description 5
- 238000011161 development Methods 0.000 description 5
- 208000015181 infectious disease Diseases 0.000 description 5
- 108091026890 Coding region Proteins 0.000 description 4
- 102100031673 Corneodesmosin Human genes 0.000 description 4
- 101710139375 Corneodesmosin Proteins 0.000 description 4
- 238000000338 in vitro Methods 0.000 description 4
- 108700028369 Alleles Proteins 0.000 description 3
- 210000001266 CD8-positive T-lymphocyte Anatomy 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 3
- 238000002255 vaccination Methods 0.000 description 3
- 230000003612 virological effect Effects 0.000 description 3
- 101100284398 Bos taurus BoLA-DQB gene Proteins 0.000 description 2
- 241001678559 COVID-19 virus Species 0.000 description 2
- 108020004414 DNA Proteins 0.000 description 2
- 102100038132 Endogenous retrovirus group K member 6 Pro protein Human genes 0.000 description 2
- 102100040485 HLA class II histocompatibility antigen, DRB1 beta chain Human genes 0.000 description 2
- 108010039343 HLA-DRB1 Chains Proteins 0.000 description 2
- 101710085938 Matrix protein Proteins 0.000 description 2
- 101710127721 Membrane protein Proteins 0.000 description 2
- 101710110284 Nuclear shuttle protein Proteins 0.000 description 2
- 101710141454 Nucleoprotein Proteins 0.000 description 2
- 108700026244 Open Reading Frames Proteins 0.000 description 2
- 102100029831 Reticulon-4 Human genes 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000000684 flow cytometry Methods 0.000 description 2
- 230000007124 immune defense Effects 0.000 description 2
- 238000009169 immunotherapy Methods 0.000 description 2
- 230000007246 mechanism Effects 0.000 description 2
- 238000000034 method Methods 0.000 description 2
- 108020003175 receptors Proteins 0.000 description 2
- 102000005962 receptors Human genes 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 230000004044 response Effects 0.000 description 2
- 102100031658 C-X-C chemokine receptor type 5 Human genes 0.000 description 1
- 208000025721 COVID-19 Diseases 0.000 description 1
- 208000001528 Coronaviridae Infections Diseases 0.000 description 1
- 108090000695 Cytokines Proteins 0.000 description 1
- 102000004127 Cytokines Human genes 0.000 description 1
- IAZDPXIOMUYVGZ-UHFFFAOYSA-N Dimethylsulphoxide Chemical group CS(C)=O IAZDPXIOMUYVGZ-UHFFFAOYSA-N 0.000 description 1
- 101710091045 Envelope protein Proteins 0.000 description 1
- 101710204837 Envelope small membrane protein Proteins 0.000 description 1
- 108010075704 HLA-A Antigens Proteins 0.000 description 1
- 101710189078 Helicase Proteins 0.000 description 1
- 241000282412 Homo Species 0.000 description 1
- 101000922405 Homo sapiens C-X-C chemokine receptor type 5 Proteins 0.000 description 1
- 108010002350 Interleukin-2 Proteins 0.000 description 1
- 101710145006 Lysis protein Proteins 0.000 description 1
- 108010090054 Membrane Glycoproteins Proteins 0.000 description 1
- 102000012750 Membrane Glycoproteins Human genes 0.000 description 1
- 241000192656 Nostoc Species 0.000 description 1
- 108090001074 Nucleocapsid Proteins Proteins 0.000 description 1
- 101150001779 ORF1a gene Proteins 0.000 description 1
- 101710193592 ORF3a protein Proteins 0.000 description 1
- 108091005804 Peptidases Proteins 0.000 description 1
- 239000004365 Protease Substances 0.000 description 1
- 229940096437 Protein S Drugs 0.000 description 1
- 101710188315 Protein X Proteins 0.000 description 1
- 101710118046 RNA-directed RNA polymerase Proteins 0.000 description 1
- 101710198474 Spike protein Proteins 0.000 description 1
- 208000036142 Viral infection Diseases 0.000 description 1
- 241000700605 Viruses Species 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 230000000840 anti-viral effect Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 230000020411 cell activation Effects 0.000 description 1
- 230000005859 cell recognition Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 230000008878 coupling Effects 0.000 description 1
- 238000010168 coupling process Methods 0.000 description 1
- 238000005859 coupling reaction Methods 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 238000007499 fusion processing Methods 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 239000002955 immunomodulating agent Substances 0.000 description 1
- 230000001976 improved effect Effects 0.000 description 1
- 230000006698 induction Effects 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 238000010212 intracellular staining Methods 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 230000034217 membrane fusion Effects 0.000 description 1
- 210000003071 memory t lymphocyte Anatomy 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 239000013641 positive control Substances 0.000 description 1
- 230000000284 resting effect Effects 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 229940126585 therapeutic drug Drugs 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 230000009385 viral infection Effects 0.000 description 1
Landscapes
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a novel coronavirus S1 whole proteome screening specific CD4T cell epitope peptide and application thereof, relating to the technical field of biological medicine, and the technical key points are as follows: the proposal of the invention provides a novel coronavirus CD4T cell epitope polypeptide, a gene for encoding the epitope polypeptide, a recombinant protein or a compound containing the epitope polypeptide, a sensitized antigen presenting cell and a specific immune effector cell aiming at the epitope polypeptide, and the functions of the antigen presenting cell and the specific immune effector cell in the research and development of novel coronavirus vaccines and the treatment of diseases. The specific CD4T cell epitope peptide screened by the novel coronavirus S1 whole protein group can safely and effectively induce the CD4T cell immune response aiming at the novel coronavirus protein, and has important significance for the research and development of novel coronavirus vaccines.
Description
Technical Field
The invention relates to the technical field of biological medicines, in particular to a novel specific CD4T cell epitope peptide for screening coronavirus S1 whole protein group and application thereof.
Background
Development of new coronavirus efficient vaccines and therapeutic drugs is still continuing. Specific T cell responses play a critical role in the antiviral infection of the body. Thus, the study of T cell immune responses induced in the body following viral infection, and in particular the characteristics of T cell epitopes, is critical for understanding the immune defense mechanisms, and is a prerequisite for the development of vaccines and immunotherapies.
The basis of T cell recognition and activation is the recognition of HLA-presented viral antigen peptides, T cell epitopes, and therefore, the study of the characteristics of viral T cell epitopes is crucial for understanding the immune defense mechanisms, as well as a prerequisite for the development of vaccines and immunotherapies. Meanwhile, due to the high polymorphism of HLA, SARS-CoV-2T cell epitope and corresponding HLA are identified, which has the following important significance:
(1) Can help predict the condition of race or specific geographical area population to the induced T cell response after natural infection or vaccination of SARS-CoV-2, which is related to the HLA allele composition prevalent in that population;
(2) The development of the vaccine can be guided, and the effect of the vaccine is improved by utilizing specific dominant epitopes to improve T cell response;
(3) May also help monitor whether potential viral mutations escape the T cell response;
(4) And may promote the development of memory T cell based diagnostics for distinguishing convalescent from uninfected individuals.
The SARS-CoV-2 genome comprises a structural protein coding region and a non-structural protein coding region. The structural protein coding region mainly codes for Spike protein (S protein), nucleocapsid protein (N protein), membrane glycoprotein (M protein) and Envelope protein (E protein). Wherein the S protein comprises two subunits of S1 and S2, the S1 mainly comprises a Receptor Binding Domain (RBD), is responsible for recognizing a receptor of a cell, and the S2 contains basic elements required by a membrane fusion process. The non-structural protein coding region mainly includes open reading frame (open reading frame, ORF) 1a and ORF1b genes encoding 16 non-structural proteins (NSP proteins), NSP 1-16.
Recently, researchers analyzed and summarized the SARS-CoV-2T cell epitope (test data from 852 COVID-19 healers) identified in 18 studies. These studies used methods of in vitro stimulation of PBMCs using bioinformatically predicted peptide libraries (megapos) or overlapping peptide libraries (most commonly 15AA,5 steps) together identified 711T cell epitopes and their corresponding HLA genotypes, including 635 cd8+ T epitopes and 76 cd4+ T cell epitopes. Of these 208 epitopes are distributed in the S protein and 250 epitopes are located in the ORF1 protein. Of these epitopes, 20 epi-HLApmers were identified in different studies, suggesting that these may be dominant epitopes. 6 of these 20 epitopes were derived from the N protein and the ORF1a protein, 4 from the S protein, 3 from the ORF3a protein, and one from the M protein.
The epitope peptide bound by the epitope peptide cannot be predicted more accurately on the basis of a given HLA genotype like the epitope of CD8+ T cells, and the research on the epitope of CD4+ T cells is mainly conducted through the stimulation of a peptide library at present. However, our study of cd4+ T cell epitopes was greatly limited due to the limited nature of human PBMC samples.
There is currently less research on dominant cd4+ T epitopes induced by vaccination and induced by natural infection. Thus, determining the potential dominant cd4+ T epitopes in the population will help to more fully understand T cell responses in humans after vaccination and after natural infection.
At present, no report on screening specific CD4T cell epitope peptide based on a whole protein peptide library exists in the novel coronavirus S1 protein.
For this reason, the present invention aims to provide a novel specific CD4T cell epitope peptide for coronavirus S1 whole proteome screening and application thereof, so as to solve the above-mentioned problems.
Disclosure of Invention
The invention aims to solve the problems and provide a novel specific CD4T cell epitope peptide for screening coronavirus S1 whole proteome and application thereof.
In order to achieve the above purpose, the technical scheme of the invention is as follows:
the invention provides a novel specific CD4T cell epitope peptide screened by coronavirus S1 whole protein group, wherein the amino acid sequence of the epitope peptide is shown in SEQ ID NO. 1.
SEQ ID NO.1：
PAYTNSFTRGVYYPD
The invention also provides a complex or fusion protein containing the epitope peptide.
The invention also provides a gene for encoding the epitope peptide, which has a nucleotide sequence shown as SEQ ID NO. 2.
SEQ ID NO.2：
CCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGAC
The invention also provides a recombinant vector containing the gene.
Further, the recombinant vector is selected from a recombinant adenovirus vector, a recombinant adeno-associated virus vector or a lentiviral vector.
The invention also provides an antigen presenting cell sensitized by the epitope peptide or the complex or fusion protein; or antigen presenting cells modified by the gene or the recombinant vector.
Further, the antigen presenting cells are expressing human HLA-DRB1 x 09:01:02, monocytes, mononuclear macrophages and B cells.
The invention also provides a CD4+T lymphocyte capable of specifically recognizing the epitope peptide, wherein the CD4+T lymphocyte is a CD4+T cell which is obtained by repeatedly stimulating, inducing and activating the antigen presenting cell.
In the scheme of the invention, the novel coronavirus-derived HLA-DRB090102 restricted CD4T cell epitope peptide is provided, and the invention also provides application of the specific CD4T cell epitope peptide in preparing a novel coronavirus infected person screening and detecting reagent.
The specific CD4T cell epitope peptide can also provide detection antigens for evaluating the immunoprotection endurance of novel coronavirus vaccines.
The specific CD4T cell epitope peptide can also provide detection antigens for detecting immune response evaluation induced by virus variants.
The specific CD4T cell epitope peptide can also provide detection antigens for detecting the specific T cell immune response level of a new coronary patient.
The specific CD4T cell epitope peptide can also provide antigens for in vitro induction of specific T cells.
Based on the scheme, the invention also provides a Tetramer for detecting the specific T cells.
The invention also provides an active immunotherapeutic agent against a novel coronavirus infection, comprising the specific CD4T cell epitope peptide described above.
Compared with the prior art, the beneficial effect of this scheme:
the invention provides a novel coronavirus S1 protein whole protein group screening specific CD4T cell epitope peptide, provides human HLA allele information capable of identifying the epitope peptide, and can be applied to preparing tetramers to verify the epitope and HLA.
Drawings
FIG. 1 is a peptide library screening strategy of example 1 in an example of the present invention;
FIG. 2 is a flow chart of the second (A) and third (B) rounds of screening of samples I-226 of example 1 of the present invention;
FIG. 3 is a graph showing the detection of the blocking efficiency of the S6 and S16 monopeptides by HLA_DR antibodies (A.HLA_DR antibody blocking efficiency of the S6 monopeptides by CD4+ T cells; B.HLA_DR antibody blocking efficiency of the S16 monopeptides by CD4+ T cells) according to example 3 of the present invention;
FIG. 4 shows the results of the flow of the Tetramer assays I_72 (responders) and I_73 (non-responders) in the examples of the invention (A: tetramer assay was performed 4 hours after PBMC were resuscitated and resting; B: tetramer assay was performed 9 days after PBMC were amplified by S1 peptide pool stimulation).
Detailed Description
In order that those skilled in the art will better understand the present invention, a more particular description of the invention will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings, wherein it is to be understood that the illustrated embodiments are merely exemplary of some, but not all, of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the present invention without making any inventive effort, shall fall within the scope of the present invention.
It should be noted that, without conflict, the embodiments of the present invention and features of the embodiments may be combined with each other. The present invention will be described in detail with reference to examples.
The scheme provided by the embodiment of the invention is as described in the above summary, and provides a novel coronavirus S1 whole protein group screening specific CD4T cell epitope peptide, a gene for encoding the epitope polypeptide, a recombinant protein or a complex containing the epitope polypeptide, a sensitized antigen presenting cell and the effect of a specific immune effector cell aiming at the epitope polypeptide in the research and development of novel coronavirus vaccines and the treatment of diseases.
Example 1: screening of CD4T cell dominant epitope peptide aiming at S1 protein
Information of 1.1S1 protein peptide library
Peptide library synthesis protocol: 15AA,5 steps. The S1 protein (1-681 AA) comprises 135 strips, the S1-S135 and the S2 protein (682-1273 AA) peptide library comprises 117 strips S137-S253. S136 has both S1 and S2, and its sequence is TQTNSPRRARSVASQ. The following table 1 shows the information of the S1 protein peptide library.
Table 1: s1 protein peptide library information
1.2 short-term expansion of antigen-specific T cells in vitro
After cell resuscitating and counting, 3 x 105 cells per well are placed in a 96-well round bottom plate, and 40 units/ml of IL-2 are prepared after the S1 peptide library is added for stimulation for 72 hours, and half amount of liquid is changed. On day 6, it was seen that the cells were significantly expanded, and after a second half-change of fluid, the cells were divided into two cells per well for expansion culture. Half the amount was changed on day 9.
1.3 selection of dominant epitopes
First round screening: we divided the S1 peptide pool into 5 sub-pools, respectively: s1-1, S1-2, S1-3, S1-4, S1-5. PBMCs of a rehabilitation person after infection for one month are selected, after the PBMCs are subjected to in vitro expansion for 9 days through S1, cells are collected and counted, 200000 cells in each hole are placed in a 96-hole round bottom plate, the sub-libraries are added for stimulation for 6 hours respectively (BFA is added to block cytokine transport after 1 hour of stimulation), and expression of IFNgamma in CD4+, CD8+ T cells is detected by flow cytometry. An S1 stimulation group and a Dmso group were simultaneously set as positive and negative controls.
Second round screening: the above 5 sub-libraries were divided into 6 secondary sub-libraries, namely A, B, C, D, E, F, respectively. For the first round of screened sub-libraries, a second round of assays was performed.
Third round screening: selecting a sample which is responded after two rounds of sub-library stimulation, placing 200000 cells in each hole in a 96-hole round bottom plate, adding corresponding single peptide, and detecting the expression of IFN gamma in CD4+, CD8+ T cells after 6 hours of stimulation by intracellular staining.
As shown in fig. 1, which is a peptide library screening strategy, it was found that the number of people responding to S6 was large, including: i-46, I-47, I-60, I-145, I-162, I-226, I-181 and I-72. As shown in FIG. 2, the screening results for I-226 are shown.
Example 2: HLA typing detection is carried out on the person with better response to S6 obtained by the screening
And collecting 12×10 samples with good T cell response 6 After the cells are centrifuged, the cells are treated by protease, DNA is extracted, and the DNA is delivered to Nostoc origin company for quality inspection and sequencing. Six genes HLA-A, B, C, DRB1, DQB1 and DPB1 were co-detected. The results are shown in Table 2: all respondents containThere is DRB1 x 09:01:02. The CD4+ T cell epitope of S6 has not been reported, but its corresponding DRB 1:09:01:02 is the most common in Chinese population, 15% of Chinese contains the typing. The epitope is a dominant CD4+T cell epitope of Chinese population, and is worthy of further verification by using tetramers.
Table 2: typing results of DRB1, DQB1 and DPB1
Example 3: analysis of whether S6 was presented by HLA_DR using HLA_DR antibody blocking assay
From the fact that the population currently tested for S6 response all contained the DRB 1:09:01:02 alleles, we speculate that S6 is presented primarily by them. PBMC samples responding to S6 and S16 were selected and plated after 10 days of S1 peptide pool stimulation amplification. HLA-DR blocking antibodies were added in advance and allowed to act for 30Min, and S6 or S16 monopeptides were added to stimulate for 6 hours, and the proportion of IFNγ+ T cells was detected. As a result, it was found that HLA-DR blocking antibodies were able to block the activating effect of S6 with high efficiency, suggesting that S6, the cd4+ T cell epitope, is mainly presented by HLA-DRB (as shown in fig. 3).
Example 4: analysis of binding Capacity of S6-HLA_DRB1:09:01:02
Bioinformatic prediction of MHC binding capacity is a key component of various epitope identification methods. We analyzed the binding capacity of S6 and its corresponding responder HLA genotype using NetMHCIIpan-4.0 (NetMHCIIpan 4.0-DTU HealTh Tech-Bioinformatic Services), and showed that S6 and DRB 1.times.09:01:02 had some binding capacity (as shown in Table 3 below).
Table 3: results of binding Capacity analysis of S6 and DRB1 x 09:01
Example 5: DRA1 x 01:01/DRB1 x 09:01PAYTNSFTRGVYYPD Tetramer detection result
PE coupling was delegated to Proimmune CoMHC Class II Tetramers。
PBMC samples of rehabilitators were labeled with tetramers, then with anti-human CD3, CD4 and CXCR5 antibodies, and then subjected to flow cytometry detection.
As shown in fig. 4, which is a streaming result of the tetra mer detection i_72 (responders) and i_73 (non-responders). The results show that, in comparison with i_73 (non-responder), i_72 (responder) clearly contained CD4T cells recognizing HLA-DRB1 x 09:01:02/S6, especially after expansion culture of the S1 peptide pool.
Conclusion: s6 is a novel coronavirus CD4T cell dominant epitope restricted by HLA-DRB1 x 09:01:02.
Through the embodiment of the invention, the specific CD4T cell epitope peptide provided by the invention can safely and effectively induce the CD4T cell immune response aiming at the novel coronavirus protein, and has important significance for the research and development of novel coronavirus vaccines.
The above specific embodiments are provided for illustrative purposes only and are not intended to limit the invention, and modifications, no inventive contribution, or scope of the claims, may be made by those skilled in the art after reading the description herein.
Claims (8)
1. The novel coronavirus S1 whole proteome screening specific CD4T cell epitope peptide is characterized in that: the amino acid sequence of the epitope peptide is shown in SEQ ID NO. 1.
2. A complex or fusion protein comprising the epitope peptide of claim 1.
3. A gene encoding the epitope peptide of claim 1, wherein: the gene has a nucleotide sequence shown as SEQ ID NO. 2.
4. A recombinant vector comprising the gene according to claim 3.
5. The recombinant vector of claim 4, wherein: the recombinant vector is selected from a recombinant adenovirus vector, a recombinant adeno-associated virus vector or a lentiviral vector.
6. An antigen presenting cell, characterized by: an antigen presenting cell sensitized with the epitope peptide of claim 1 or the complex or fusion protein of claim 2; or an antigen presenting cell modified by the gene according to claim 3 or the recombinant vector according to claim 4.
7. The antigen presenting cell of claim 6, wherein: the antigen presenting cells express human HLA-DRB1 x 09:01:02, monocytes, mononuclear macrophages and B cells.
8. A cd4+ T lymphocyte cell that specifically recognizes the epitope peptide of claim 1, characterized by: the CD4+ T lymphocyte is a CD4+ T cell which is obtained by repeatedly stimulating, inducing and activating the antigen presenting cell according to claim 6 to obtain clone proliferation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311130011.7A CN117843735A (en) | 2023-09-04 | 2023-09-04 | Novel coronavirus S1 whole protein group screening specific CD4T cell epitope peptide and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311130011.7A CN117843735A (en) | 2023-09-04 | 2023-09-04 | Novel coronavirus S1 whole protein group screening specific CD4T cell epitope peptide and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117843735A true CN117843735A (en) | 2024-04-09 |
Family
ID=90542392
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311130011.7A Pending CN117843735A (en) | 2023-09-04 | 2023-09-04 | Novel coronavirus S1 whole protein group screening specific CD4T cell epitope peptide and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117843735A (en) |
-
2023
- 2023-09-04 CN CN202311130011.7A patent/CN117843735A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sohail et al. | In silico T cell epitope identification for SARS-CoV-2: Progress and perspectives | |
| Oh et al. | Engineering T cells specific for a dominant severe acute respiratory syndrome coronavirus CD8 T cell epitope | |
| Kotturi et al. | The CD8+ T-cell response to lymphocytic choriomeningitis virus involves the L antigen: uncovering new tricks for an old virus | |
| Xu et al. | Comprehensive serological profiling of human populations using a synthetic human virome | |
| Scholzen et al. | Promiscuous Coxiella burnetii CD4 epitope clusters associated with human recall responses are candidates for a novel T-cell targeted multi-epitope Q fever vaccine | |
| Cotugno et al. | OMIC technologies and vaccine development: from the identification of vulnerable individuals to the formulation of invulnerable vaccines | |
| Alam et al. | Design of an epitope-based peptide vaccine against the SARS-CoV-2: a vaccine-informatics approach | |
| Pogorelyy et al. | Resolving SARS-CoV-2 CD4+ T cell specificity via reverse epitope discovery | |
| CN105992950A (en) | Methods of t cell epitope profiling, making t cell compositions, and treating diseases | |
| Ferretti et al. | COVID-19 patients form memory CD8+ T cells that recognize a small set of shared immunodominant epitopes in SARS-CoV-2 | |
| Lamb et al. | Prediction and identification of an HLA‐DR‐restricted T cell determinant in the 19‐kDa protein of Mycobacteriurn tuberculosis | |
| CN116444631A (en) | Novel coronavirus T cell epitope peptide and application thereof in preparation of vaccine | |
| CN107216373A (en) | Detect antigen polypeptide pond and its application of mycobacterium tuberculosis infection | |
| Judkowski et al. | GM-CSF production allows the identification of immunoprevalent antigens recognized by human CD4+ T cells following smallpox vaccination | |
| CN113735947A (en) | Specific T cell epitope peptide P48 screened by novel coronavirus S protein holoproteome and application thereof | |
| Poloni et al. | T‐cell activation–induced marker assays in health and disease | |
| Kotturi et al. | Human CD8+ and CD4+ T cell memory to lymphocytic choriomeningitis virus infection | |
| Voic et al. | Identification and characterization of CD4+ T cell epitopes after Shingrix vaccination | |
| Somogyi et al. | A peptide vaccine candidate tailored to individuals' genetics mimics the multi-targeted T cell immunity of COVID-19 convalescent subjects | |
| Moncunill et al. | Transcriptional correlates of malaria in RTS, S/AS01-vaccinated African children: a matched case–control study | |
| Ferreira et al. | Atypical B cells and impaired SARS-CoV-2 neutralization following heterologous vaccination in the elderly | |
| CN116496383A (en) | Thymus-dependent lymphocyte antigen epitope peptide of primary liver cancer related antigen and application thereof | |
| Ning et al. | Identification of two Lpp20 CD4+ T cell epitopes in Helicobacter pylori-infected subjects | |
| CN110257478A (en) | A kind of rapid screening method of effective neoantigen peptide of tumour individuation vaccine | |
| Axelsson-Robertson et al. | Human leukocyte antigens A* 3001 and A* 3002 show distinct peptide-binding patterns of the Mycobacterium tuberculosis protein TB10. 4: consequences for immune recognition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |