CN117821468A - Lung-targeted soluble PD-L1mRNA lipid nanoparticle and application thereof - Google Patents

Abstract

The invention discloses lung targeting soluble PD-L1mRNA lipid nano particles and application thereof. The lung targeting soluble PD-L1mRNA lipid nanoparticle comprises a nucleic acid molecule encoding soluble PD-L1 having an amino acid sequence as shown in SEQ ID NO. 1, wherein the nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO. 2 or SEQ ID NO. 3. The lipid nanoparticle can be used for controlling excessive inflammation, improving inflammation symptoms, reducing the level of inflammatory factors, effectively relieving the inflammation condition of ARDS, prolonging the survival rate and having good clinical application prospect.

Description

Lung-targeted soluble PD-L1mRNA lipid nanoparticle and application thereof

Technical Field

The invention belongs to the field of biological medicine, and in particular relates to lung targeting soluble PD-L1mRNA lipid nanoparticles and application thereof.

Background

Acute respiratory distress syndrome (Acute respiratory distress syndrome, ARDS) is a severe respiratory disease characterized by non-cardiac pulmonary edema, bilateral chest opacities and severe hypoxia, the etiology of which includes lung and extrapulmonary factors such as bacterial and viral pneumonia, aspiration, lung contusion and severe systemic infections. Traditional ARDS treatment methods, such as pulmonary protective ventilation and fluid-restricted resuscitation, mainly provide artificial support without addressing the underlying lung injury. These methods typically involve invasive injuries and reliance on medical equipment. Thus, there is a need for new anti-inflammatory strategies with high specificity and low off-target effects to be effective against ARDS.

Recent studies underscore the critical role of chemotaxis and activation of pro-inflammatory immune cells in the development of ARDS-related lung lesions. Programmed death ligand-1 (PD-L1) proteins have shown great potential in the treatment of immune related diseases. It inhibits the activation signal of T cells by interacting with PD-1 receptors on activated T cells, promoting immune evasion. While the PD-L1-PD-1 axis is widely targeted by a number of clinical trials in human cancer treatment, its original role in maintaining immune homeostasis and suppressing excessive immune responses has not been fully exploited. Previous studies have found that PD-1 deficient mice are susceptible to lupus-like autoimmune diseases and autoimmune myocarditis. The recombinant fusion proteins of PD-L1 and adenoviruses expressing PD-L1 show reduced severity of inflammation in a variety of animal models, including rheumatoid arthritis, colitis, psoriasis and ARDS, underscores the involvement of the PD-1-PD-L1 axis in other immunomodulatory capacity. The soluble form of PD-L1 (sPD-L1) lacks the intracellular and transmembrane domains of PD-L1 and can bind to the PD-1 receptor independent of intercellular contact, expanding its range of action. sPD-L1 has been reported to be associated with mortality in patients with direct ARDS and to exhibit protective effects in mice with acute lung injury. Previous studies by the inventors have further demonstrated that sPD-L1 induces apoptosis in monocyte-derived macrophages (MDMs), contributing to its protective role in ARDS.

Protein therapy has its limitations such as high cost, short half-life, and the possibility of producing antibodies to foreign proteins. In Vitro Transcription (IVT) mRNA therapy has become a promising alternative to proteins and has attracted considerable attention. The innovative method combines key structural elements such as a 5' cap, a poly (A) tail and the like, especially various chemical nucleoside modifications, and has the remarkable advantages of high preparation speed, low immunogenicity, high expression efficiency and the like. IVT mRNA therapy has made impressive progress in various areas of viral vaccine development, cancer treatment and genome editing, highlighting its broad potential in radically altering therapeutic interventions.

mRNA molecules present challenges for therapeutic applications due to their large molecular weight, negative charge, instability and susceptibility to nuclease degradation. The use of Lipid Nanoparticle (LNP) delivery platforms ensures stable delivery of mRNA in vivo and promotes good expression of mRNA. The selective organ targeted (selective organ targeting, SORT) delivery platform achieves specific delivery to lung tissue while achieving mRNA delivery. This tissue-specific delivery is achieved by modifying the LNP formulation to precisely target the affected area where the disease occurs, thereby more effectively controlling the disease and minimizing side effects associated with systemic protein expression. This breakthrough opens up multiple pharmaceutical applications for IVT mRNA therapy.

Disclosure of Invention

The invention aims to solve the technical problem that a lung targeting soluble PD-L1 mRNA lipid nanoparticle and application thereof are provided for overcoming the defect of lack of a pharmaceutically acceptable sPD-L1 form in the prior art. The lipid nanoparticle takes sPD-L1 protein as an immunoregulation effector, and through lung targeting delivery of chemically modified sPD-L1 mRNA based on SORT LNP, the lipid nanoparticle can be used for excessive inflammation control, improving inflammation symptoms, reducing the level of inflammatory factors and effectively relieving the inflammation condition of ARDS. In addition, LNP using DOTAP can effectively prolong survival rate of ARDS model-producing mice while reducing acute immune response of lung tissue compared with LNP using DLin-MC 3-DMA.

The invention solves the technical problems through the following technical proposal.

In a first aspect the invention provides a nucleic acid molecule comprising a nucleotide encoding a soluble PD-L1 having an amino acid sequence as set forth in SEQ ID NO. 1;

the nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO. 2 or SEQ ID NO. 3.

In some embodiments of the invention, the nucleic acid molecule further comprises a nucleotide encoding a signal peptide.

In some preferred embodiments of the invention, the nucleotide has a nucleotide sequence as set forth in SEQ ID NO. 5 or SEQ ID NO. 6.

In a second aspect the invention provides a composition comprising a nucleic acid according to the first aspect and a delivery vehicle.

In some embodiments of the invention, the nucleic acid is mRNA.

In some embodiments of the invention, the nucleic acid is a modified nucleic acid.

In some preferred embodiments of the invention, the modification is an N1-methyl-pseudolaridine (m1ψ) modification.

In some embodiments of the invention, the delivery vehicle is a lipid nanoparticle.

In some preferred embodiments of the invention, the lipid nanoparticle comprises cholesterol, a cationic lipid, and a non-cationic lipid; the cationic lipid is selected from DLin-MC3-DMA and 1, 2-dioleoyl-3-trimethylaminopropane (DOTAP); the non-cationic lipid is selected from phospholipids and/or lipid conjugates.

In the present invention, the mole ratio of the ionizable cationic lipid is 20-50%, the mole ratio of the cholesterol is 30-50%, the mole ratio of the phospholipid is 10-25%, and the mole ratio of the lipid conjugate is 1-5%.

In the lipid nanoparticle, the molar ratio of the ionizable cationic lipid is, for example, 20%, 25%, 30%, 35%, 40%, 45%, or 50%.

In the lipid nanoparticle, the molar ratio of cholesterol is, for example, 30%, 35%, 40%, 45% or 50%; or 35%, 35.2%, 35.4%, 35.6%, 35.8%, 36%, 36.2%, 36.4%, 36.6%, 36.8%, 37%, 37.2%, 37.4%, 37.6%, 37.8%, 38%, 38.2%, 38.4%, 38.6%, 38.8%, 39%, 39.2%, 39.4%, 39.6%, 39.8% or 40%.

In the lipid nanoparticle, the molar ratio of the phospholipids is, for example, 10%, 12%, 14%, 16%, 18%, 20%, 22%, 24%, or 25%.

In the lipid nanoparticle, the molar ratio of the lipid conjugate is, for example, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5% or 5%.

In some preferred embodiments of the invention, the phospholipid is distearoyl phosphatidylcholine (DSPC).

In some preferred embodiments of the invention, the lipopolymer is a polyethylene glycol modified lipid molecule, such as PEG2000-DMG.

In some embodiments of the invention, the lipid nanoparticle comprises DLin-MC3-DMA, DSPC, cholesterol, and PEG2000-DMG.

In other embodiments of the invention, the lipid nanoparticle comprises DOTAP, DLin-MC3-DMA, DSPC, PEG2000-DMG, and cholesterol;

in some embodiments of the invention, in the lipid nanoparticle, DLin-MC3-DMA: DSPC: cholesterol: the molar ratio of PEG2000-DMG was 50% to 10% to 38.5% to 1.5%.

In other embodiments of the invention, in the lipid nanoparticle, DOTAP: DLin-MC3-DMA: DSPC: cholesterol: the molar ratio of PEG2000-DMG was 50% 25% 5% 192% 08%.

In a third aspect the present invention provides a pharmaceutical composition comprising a nucleic acid molecule as described in the first aspect and/or a composition as described in the second aspect, together with a pharmaceutically acceptable carrier and/or adjuvant.

A fourth aspect of the invention provides a lipid nanoparticle comprising cholesterol, a cationic lipid and a non-cationic lipid; the cationic lipid is selected from DLin-MC3-DMA and 1, 2-dioleoyl-3-trimethylaminopropane (DOTAP); the non-cationic lipid is selected from phospholipids and/or lipid conjugates.

In the present invention, the molar ratio of the ionizable cationic lipid may be 20-50%, the molar ratio of the cholesterol may be 30-50%, the molar ratio of the phospholipid may be 10-25%, and the molar ratio of the lipid conjugate may be 1-5%.

In the present invention, the molar ratio of the ionizable cationic lipid may also be 20-75%, the molar ratio of the cholesterol is 15-30%, the molar ratio of the phospholipid is 5-10%, and the molar ratio of the lipid conjugate is 0.5-1.5%.

In the lipid nanoparticle, the molar ratio of the ionizable cationic lipid is, for example, 20%, 25%, 30%, 35%, 40%, 45% or 50%; or for example 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% or 75%.

In the lipid nanoparticle, the molar ratio of cholesterol is, for example, 30%, 35%, 40%, 45% or 50%; or 35%, 35.2%, 35.4%, 35.6%, 35.8%, 36%, 36.2%, 36.4%, 36.6%, 36.8%, 37%, 37.2%, 37.4%, 37.6%, 37.8%, 38%, 38.2%, 38.4%, 38.6%, 38.8%, 39%, 39.2%, 39.4%, 39.6%, 39.8% or 40%; or 15%, 15.2%, 15.4%, 15.6%, 15.8%, 16%, 16.2%, 16.4%, 16.6%, 16.8%, 17%, 17.2%, 17.4%, 17.6%, 17.8%, 18%, 18.2%, 18.4%, 18.6%, 18.8%, 19%, 19.2%, 19.4%, 19.6%, 19.8% or 20%.

In the lipid nanoparticle, the molar ratio of the phospholipids is, for example, 10%, 12%, 14%, 16%, 18%, 20%, 22%, 24%, or 25%; or for example 5%, 6%, 7%, 8%, 9% or 10%.

In the lipid nanoparticle, the molar ratio of the lipid conjugate is, for example, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5% or 5%; or for example 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4% or 1.5%.

In some preferred embodiments of the invention, the phospholipid is distearoyl phosphatidylcholine (DSPC).

In some preferred embodiments of the invention, the lipopolymer is a polyethylene glycol modified lipid molecule, such as PEG2000-DMG.

In some embodiments of the invention, the lipid nanoparticle comprises DLin-MC3-DMA, DSPC, cholesterol, and PEG2000-DMG.

In other embodiments of the invention, the lipid nanoparticle comprises DOTAP, DLin-MC3-DMA, DSPC, PEG2000-DMG, and cholesterol;

in some embodiments of the invention, in the lipid nanoparticle, DLin-MC3-DMA: DSPC: cholesterol: the molar ratio of PEG2000-DMG was 50% to 10% to 38.5% to 1.5%.

In other embodiments of the invention, in the lipid nanoparticle, DOTAP: DLin-MC3-DMA: DSPC: cholesterol: the molar ratio of PEG2000-DMG was 50% 25% 5% 19.2% 0.8%.

In a fifth aspect the invention provides the use of a nucleic acid molecule as described in the first aspect, a composition as described in the second aspect, a pharmaceutical composition as described in the third aspect, and/or a lipid nanoparticle as described in the fourth aspect in the manufacture of a medicament for the treatment of excessive inflammation caused by acute respiratory distress syndrome.

A sixth aspect of the invention provides a composition for use in the treatment of excessive inflammation caused by acute respiratory distress syndrome, the composition comprising a nucleic acid molecule according to the first aspect, a composition according to the second aspect, a pharmaceutical composition according to the third aspect, and/or a lipid nanoparticle according to the fourth aspect.

A seventh aspect of the invention provides a method of treating excessive inflammation caused by acute respiratory distress syndrome, the method comprising the step of administering to a subject in need thereof an effective amount of a nucleic acid molecule according to the first aspect, a composition according to the second aspect, a pharmaceutical composition according to the third aspect, and/or a lipid nanoparticle according to the fourth aspect.

On the basis of conforming to the common knowledge in the field, the above preferred conditions can be arbitrarily combined to obtain the preferred examples of the invention.

The reagents and materials used in the present invention are commercially available.

The invention has the positive progress effects that:

the lipid nanoparticle takes sPD-L1 protein as an immunoregulation effector, and through lung targeting delivery of chemically modified sPD-L1 mRNA based on SORT LNP, the lipid nanoparticle can be used for excessive inflammation control, improving inflammation symptoms, reducing the level of inflammatory factors and effectively relieving the inflammation condition of ARDS. In addition, LNP using DOTAP can effectively prolong seven-day survival rate of ARDS model mice while reducing acute immune response of lung tissue compared with LNP using DLin-MC 3-DMA. The lipid nanoparticle has good clinical application prospect.

Drawings

FIGS. 1A-1J are graphs showing physicochemical properties of sPD-L1 mRNA expression and mRNA-MC3-LNP and mRNA-DOTAP-LNP in vitro;

different nucleotide modifications were used to express HA-tagged sPD-L1 mRNA in HEK293T (fig. 1A) and AML12 (fig. 1B) cell lines. A non-modified nucleotide of Unmod; mo ⁵ U, 5-methoxyuridine; m is m ⁵ C/ψ, 5-methylcytosine and pseudo-uracil; psi, pseudo uracil; m is m ¹ Psi, N1-methyl pseudo uracil. IP-IB: HA, the sPD-L1-HA protein was immunoprecipitated in cell culture supernatants using anti-HA magnetic beads, followed by immunoblotting detection with anti-HA antibodies. (FIG. 1C) formulation of mRNA-MC3-LNP and mRNA-DOTAP-LNP. The percentages in brackets represent the molar ratios of the components. DSPC,1, 2-distearoyl-sn-glycero-3-phosphorylcholine; PEG, polyethylene glycol; DOTAP,1, 2-dioleoyl-3-trimethylaminopropane. (FIG. 1D) HEK293T and AML12 have m therein ¹ Expression of the ψ modified HA-tagged sPD-L1 mRNA-LNP. (FIG. 1E) representative images showing co-localization of sPD-L1 mRNA-DOTAP-LNP (25% Cy3-UTP modification) with A549 cell lysosomes (FITC-lysotracker) within 18 hours after transfection. Scale bar, 10 μm. (FIG. 1F) frozen transmission electron microscope images of sPD-L1 mRNA-DOTAP-LNP and mRNA-MC 3-LNP. Scale bar, 200nm. (FIG. 1G) particle size distribution of sPD-L1 mRNA-MC3-LNP and mRNA-DOTAP-LNP. Each data was recorded 3 times. d.nm, diameter (nm). (fig. 1H) encapsulation efficiency of Luc/sPD-L1 mRNA-MC3-LNP and mRNA-DOTAP-LNP (n=3). (FIG. 1I) zeta potential of Luc/sPD-L1 mRNA-MC3-LNP and mRNA-DOTAP-LNP. Results represent mean ± SEM (n=3). (FIG. 1J) Luc/sPD-L1 mRNA-MC3-LNP and mRNA-DOTAP-LNP dispersibility index (PDI). Results represent mean ± SEM (n=3).

FIGS. 2A-2F are schematic diagrams of lung cell targeting by mRNA-DOTAP-LNP;

fig. 2A: representative images of whole body bioluminescence images of mice at various time points (6 hours, 24 hours, 48 hours) after intravenous injection of 0.4mg/kg Luc mRNA-MC3-LNPs or mRNA-DOTAP-LNP. The lighting scales for different time points and groups are different.

Fig. 2B: quantitative analysis of bioluminescence intensity of FIG. 2A. Results represent mean ± SEM (n=4).

Fig. 2C: schematic representation of ZsGreen expression in Ai6 transgenic mice using DOTAP-LNPs to deliver Cre mRNA.

Fig. 2D: representative confocal images of DAPI stained zsgreen+ lung sections. Scale bar, 50 μm.

Fig. 2E: the percentage of zsgreen+ cells in different cell populations in the lung was measured by flow cytometry. Immune Cells (ICs) were stained with the PerCP/Cy5.5-CD45 antibody. Macrophages (MΦs) were stained with BV421-F4/80 antibody. Endothelial Cells (ECs) were stained with PE-CD31 antibody and epithelial cells (EpiCs) were stained with APC-CD326 antibody. Results represent mean ± SEM (n=3).

Fig. 2F: percentage of zsgreen+ cells in liver and spleen. Results represent mean ± SEM (n=3).

FIGS. 3A-3F are schematic representations of in vivo expression of sPD-L1 mRNA-MC3-LNP and mRNA-DOTAP-LNP;

Fig. 3A: PD-L1 concentration in the circulatory system at various time points (0 hours, 4 hours, 8 hours, 12 hours, 24 hours, 48 hours) after intravenous injection of sPD-L1 mRNA-MC3-LNP (0, 004 or 02 mg/kg).

Fig. 3B: PD-L1 expression levels in lung tissue at various time points (0 hours, 4 hours, 8 hours, 12 hours, 24 hours, 48 hours) after intravenous injection of sPD-L1 mRNA-DOTAP-LNPs (0.2 mg/kg). PD-L1 expression levels in lung tissue lysates were detected by immunoblotting.

Fig. 3C: after intravenous injection of sPD-L1 mRNA-MC3-LNPs (0.2 mg/kg) or PD-L1-Fc recombinant protein (0.8 mg/kg) into mice (n=4), blood samples were taken at various time points (0 hours, 4 hours, 8 hours, 12 hours, 24 hours, 48 hours) and protein expression levels were determined by ELISA kits.

Fig. 3D: half-lives of sPD-L1 mRNA-MC3-LNPs (0.2 mg/kg) and PD-L1-Fc chimeras (0.8 mg/kg).

Fig. 3E: immunoblot detection detects the expression level of PD-L1 in lung tissue. Tissues were harvested 4 hours after intravenous injection of Luc mRNA-DOTAP-LNPs (0.2 mg/kg), sPD-L1 mRNA-DOTAP-LNPs (0.2 mg/kg) or sPD-L1 mRNA-MC3-LNPs (0.2 mg/kg).

Fig. 3F: comparison of PD-L1 abundance in lung tissue between different groups. Results represent mean ± SEM (n=3). * p <0.05. And (5) t-test analysis.

FIGS. 4A-4H are schematic illustrations of PAO-induced ARDS mouse models;

fig. 4A: schematic of the experimental procedure.

Fig. 4B: time profile of White Blood Cell (WBC) counts in alveolar lavage fluid (BALF). White blood cells were counted using a cytometer. Results represent mean ± SEM (n=5).

Fig. 4C: time profile of BALF protein concentration. Protein concentration was determined using Bradford method. Results represent mean ± SEM (n=5).

Fig. 4D: time profile of wet weight/dry weight ratio of lung. The wet weight data of the tissue was immediately weighed and the dry weight data was collected after 48 hours of drying. Results represent mean ± SEM (n=3).

Fig. 4E: PD-1 expression in lung immunocytes (CD45+) was plotted against time. PD-1 was stained with BV421-CD279 antibody and CD45 was stained with APC-CD45 antibody. Results represent mean ± SEM (n=5). MFI, mean fluorescence intensity.

Fig. 4F: histograms of average fluorescence intensity at different time points PD-1.

Fig. 4G: representative pathological slice images of normal lung (left) and ARDS lung (right, at 12 hour time point). Scale bar, 200 μm.

Fig. 4H: lung injury score comparison between PAO treated and untreated groups (n=5). * P <0.0001.

FIGS. 5A-5G are graphs showing the in vivo therapeutic effects of sPD-L1 mRNA-MC 3-LNP.

Fig. 5A: schematic of the experimental procedure.

Fig. 5B: white Blood Cell (WBC) counts in alveolar lavage fluid (BALF). White blood cells were counted using a cytometer. Results represent mean ± SEM (n=3-12).

Fig. 5C: BALF protein concentration. Protein concentration was determined using Bradford method. Results represent mean ± SEM (n=3-9).

Fig. 5D: wet weight/dry weight ratio of upper right leaf lung tissue. The wet weight data of the tissue was immediately weighed and the dry weight data was collected after 48 hours of drying. Results represent mean ± SEM (n=3-11).

Fig. 5E: concentration of inflammatory factors (TNF-. Alpha., IL-6) in BALF. The concentration of inflammatory cytokines was determined using ELISA. Results represent mean ± SEM (n=3-5).

Fig. 5F: lung injury score of HE stained sections (n=3-5). * p <0.05, < p <0.01, < p <0.001, < p <0.0001. And (5) t-test analysis.

Fig. 5G: representative pathological slice images of ARDS lungs treated with different drugs. Scale bar, 50 μm.

FIGS. 6A-6L are graphs showing the in vivo therapeutic effects of sPD-L1 mRNA-DOTAP-LNP.

FIG. 6A shows white blood cell counts, FIG. 6B shows protein concentration, FIG. 6C shows wet/dry weight ratio of upper right leaf, FIG. 6D shows the concentration of inflammatory factor TNF- α/IL-6 in BALF, and FIG. 6E shows lung injury score of HE stained sections. Results represent mean ± SEM (n=3-5). * p <0.05, < p <0.01, < p <0.001, < p <0.0001. And (5) t-test analysis.

FIG. 6F shows white blood cell counts, FIG. 6G shows protein concentration, FIG. 6H shows wet/dry weight ratio of upper right leaf, FIG. 6I shows the concentration of inflammatory factor TNF- α/IL-6 in BALF, and FIG. 6J shows lung injury score of HE stained sections. Results represent mean ± SEM (n=3-8). * p <0.05, < p <0.01, < p <0.001, < p <0.0001. And (5) t-test analysis.

Fig. 6K is the percentage of different immune cell populations in spleen (left) and thymus (right). Spleen cells and thymus cells were harvested from mice injected with PBS, PD-L1-Fc (0.8 mg/kg), sPD-L1 mRNA-MC3-LNPs (0.2 mg/kg), or sPD-L1 mRNA-DOTAP-LNPs (0.2 mg/kg). Flow cytometry analysis of cd4+ T cells (cd4+ T), cd8+ T cells (cd8+ T), cd4+cd25+ regulatory T cells (Tregs), dendritic Cells (DCs) and macrophages (mΦs) in each group. * p <0.05, p <0.01. And (5) t-test analysis.

FIG. 6L is 7 day survival of ARDS mice treated with different drugs, including sham, PBS, PD-L1-Fc (0.8 mg/kg), sPD-L1 mRNA-MC3-LNPs (0.2 mg/kg) or sPD-L1 mRNA-DOTAP-LNPs (0.2 mg/kg) (n=15). log-rank test, ×p <0.01.

FIG. 7 is a schematic diagram showing particle size distribution of Luc mRNA-LNPs.

Particle size distribution of Luc mRNA-MC3-LNPs and mRNA-DOTAP-LNPs. Each data was recorded 3 times. d.nm, diameter (nm).

Fig. 8 is a representative histological image of lung injury scores.

The sham group (left, score=0) showed thin alveolar septal walls and most cell-free alveolar spaces. In the group subjected to PAO treatment modeling (right, score=0.77), the black arrow represents alveoli with >5 neutrophils, score=2. Red arrows indicate the interstitial space with >5 neutrophils, fraction = 2. Asterisks indicate protein fragments filling one alveolar space, fraction = 1. Alveolar septal thickening was almost 2 times that of the original, with a score=1. Total score = [ (20×2) + (14×2) + (7×0) + (7×1) + (2×1) ]/100=0.77. Scale bar, 50 μm.

Fig. 9A-9B are representative histological images of lung injury scores for different drug treatment groups.

(fig. 9A) representative images of HE stained sections from fig. 6E, showing the following treatment groups: sham surgery, PBS, sPD-L1mRNA-MC3-LNPs (0.2 mg/kg) and sPD-L1 mRNA-DOTAP-LNPs (0.2 mg/kg). Scale bar, 50 μm. (fig. 9B) representative images of HE stained sections from fig. 6J, showing the following treatment groups: sham surgery, PBS, PD-L1-Fc (0.8 mg/kg), luc mRNA-DOTAP-LNPs (0.2 mg/kg) and sPD-L1 mRNA-DOTAP-LNPs (0.2 mg/kg). Scale bar, 50 μm.

FIGS. 10A-10D are schematic diagrams of the safety of sPD-L1 mRNA-DOTAP-LNP. (FIG. 10A) the effect of sPD-L1mRNA-DOTAP-LNP administration on pulmonary bacterial clearance was examined. 4 hours after PAO model, PBS or sPD-L1mRNA-DOTAP-LNP (0.2 mg/kg) was injected via the tail vein. After 12 hours bronchoalveolar lavage (BALF) was collected and spread on agar plates. The plates were then placed in a bacterial incubator at 37 ℃ and incubated for one day to assess bacterial colony count. Results represent mean.+ -. SEM (n.gtoreq.3). (FIG. 10B) concentration of inflammatory factors (TNF-. Alpha., IL-6) in BALF at various time points (0 hours, 6 hours, 24 hours, 48 hours) after intravenous injection of sPD-L1 mRNA-DOTAP-LNPs (0.2 mg/kg). Results represent mean ± SEM (n=4). (FIG. 10C) pathological analysis of lung tissue at various time points (0 hours, 6 hours, 24 hours, 48 hours) after intravenous injection of sPD-L1 mRNA-DOTAP-LNPs (0.2 mg/kg). Scale bar, 100 μm. (FIG. 10D) hearts, livers, spleens and kidneys were HE stained from PBS control and sPD-L1mRNA-DOTAP-LNP treated groups (0.2 mg/kg) at a time point of 12 hours. Scale bar, 200 μm.

Detailed Description

Terminology

Unless otherwise indicated, the terms of the present invention are defined below.

The term "signal peptide" includes the N-terminal 15-60 amino acids of a protein, and generally requires transmembrane transport over the secretory pathway, thus controlling the entry of most proteins into the secretory pathway in eukaryotes and prokaryotes is common. The signal peptide generally comprises three regions: an N-terminal region of different length, typically comprising positively charged amino acids; a hydrophobic region; and a short carboxy terminal peptide region. In eukaryotes, the signal peptide of a nascent precursor protein directs the ribosome to the rough Endoplasmic Reticulum (ER) membrane and transports the growing peptide chain to the membrane for processing, after which the signal peptide is cleaved from the precursor protein to yield the mature protein. The signal peptide may also promote localization of the protein on the cell membrane. However, the signal peptide is not responsible for the final destination of the mature protein. Secreted proteins without an additional address tag in their sequence are defaults to secretion into the external environment. In one example of the present invention, the amino acid sequence of the signal peptide is shown in SEQ ID NO. 4.

The term "sequence optimization" refers to a process or series of processes by which bases in a reference nucleic acid sequence are replaced with alternative bases, thereby producing a nucleic acid sequence with improved properties, e.g., improved protein expression or reduced immunogenicity. Generally, the goal of sequence optimization is to produce a synonymous nucleotide sequence that is identical to the polypeptide sequence encoded by the encoded reference nucleotide sequence. Thus, in polypeptides encoded by codon-optimized nucleotide sequences, there are no amino acid substitutions relative to polypeptides encoded by reference nucleotide sequences.

In the context of sequence optimisation, the term "codon substitution" refers to the replacement of a codon in a reference nucleic acid sequence with another codon. One codon may be replaced in the reference nucleic acid sequence, for example, by chemical peptide synthesis or by recombinant methods known in the art. Thus, reference to a "substitution" or "substitution" at a position in a nucleic acid sequence (e.g., an mRNA) or in a region or subsequence of a nucleic acid sequence (e.g., an mRNA) means that the codon at that position or region is replaced. As used herein, the term "coding region" refers to an Open Reading Frame (ORF) in a polynucleotide that, when expressed, produces a polypeptide or protein.

As used herein, the term "isolated" refers to a substance or entity that has been separated from at least some of the components associated therewith (whether in nature or in an experimental setting). The isolated materials (e.g., polynucleotides or polypeptides) may be of varying degrees of purity relative to the materials from which they were isolated. The isolated substance and/or entity may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more of the other components with which it was originally associated. In some embodiments, the isolated material is more than about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is "pure" if it is substantially free of other ingredients.

As used herein, the term "isolated" polynucleotide, vector, polypeptide, cell, or any composition refers to a polynucleotide, vector, polypeptide, cell, or composition, the form of which is not found in nature. Isolated polynucleotides, vectors, polypeptides, or compositions include those that have been purified to no longer exist in the form of nature. In certain aspects, the isolated polynucleotide, vector, polypeptide, or composition is substantially pure.

The term "nucleic acid" or "nucleic acid molecule" includes any compound and/or substance that consists of a polymer of nucleotides. These polymers are commonly referred to as polynucleotides. Exemplary nucleic acids or polynucleotides include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), threose Nucleic Acid (TNA), sugar nucleic acid (GNA), peptide Nucleic Acid (PNA), locked Nucleic Acid (LNA), ethylene Nucleic Acid (ENA), cyclohexyl nucleic acid (CeNA), or mixtures or combinations thereof. "Polynucleotide" includes triple, double and single stranded DNA or RNA. It also includes modified, e.g., by alkylation, and/or by capping, and unmodified forms of the polynucleotide. More specifically, the term "polynucleotide" includes polydeoxynucleotides (containing 2-deoxy-D-ribose), polynucleotides (containing D-ribose), including tRNA, rRNA, hRNA, siRNA and mRNA.

In particular aspects, "polynucleotide," "nucleic acid," or "nucleic acid molecule" includes mRNA. In one aspect, the mRNA is a synthetic mRNA. In certain aspects, the synthetic mRNA includes at least one unnatural base. In certain aspects, all nucleobases of a class are replaced with unnatural bases (e.g., all uridine in the polynucleotides disclosed herein can be replaced with unnatural bases, e.g., 5-methoxyuridine). In certain aspects, the polynucleotide (e.g., synthetic RNA or synthetic DNA) includes only natural bases, i.e., a (adenosine), G (guanosine), C (cytidine), and T (thymidine) in the case of synthetic DNA, or A, C, G and U (uridine) in the case of synthetic RNA.

Those skilled in the art will appreciate that T in the codon map (codon map) disclosed herein is present in DNA, and that T will be replaced by U in the corresponding RNA. For example, a codon nucleotide sequence in the form of DNA disclosed herein, such as a vector or an In Vitro Translation (IVT) template, whose T will be transcribed into U in its corresponding transcribed mRNA. In this regard, both the codon-optimized DNA sequence (including T) and its corresponding mRNA sequence (including U) are considered codon-optimized nucleotide sequences. In addition, equivalent codon patterns can be generated by replacing one or more bases with non-natural bases. Thus, for example, the TTC codon (DNA map) corresponds to the UUC codon (RNA map), which in turn corresponds to the ψ -C codon (RNA map, where U is replaced by pseudouridine).

The term "nucleotide sequence encoding" refers to a nucleic acid (e.g., mRNA or DNA molecule) encoding a polypeptide. The coding sequence may further comprise initiation and termination signals, including promoters and polyadenylation signals, operably linked to the regulatory elements, capable of directing expression in the cells of the individual or mammal to which the nucleic acid is administered. The coding sequence may further comprise a sequence encoding a signal peptide.

In addition, an untranslated region, called 5'UTR and 3' UTR, is present at each end of the ORF (Open Reading Frame ) of mRNA. "5' untranslated region" (5 ' UTR) refers to the region of mRNA immediately upstream (i.e., 5 ') from the start codon (i.e., the first codon of an mRNA transcript translated by a ribosome) that does not encode a polypeptide. "3' untranslated region" (3 ' UTR) refers to the region of mRNA immediately downstream (i.e., 3 ') from the stop codon (i.e., the codon that signals the termination of translation in an mRNA transcript) that does not encode a polypeptide. An "open reading frame" is a continuous stretch of DNA beginning with a start codon (e.g., methionine (ATG)), ending with a stop codon (e.g., TAA, TAG, or TGA) and encoding a polypeptide. The untranslated region is not capable of translating amino acids, but can bind to RNA-binding proteins, thereby regulating the degradation and translation efficiency of mRNA products. The 5'-UTR or 3' -UTR may be homologous or heterologous to the open reading frame in the polynucleotide. Multiple 5 '-UTRs or 3' -UTRs may be included in the flanking regions and may be identical or different sequences.

"polyA" or "poly (A)" is a region of mRNA that is downstream of the 3'UTR, e.g., immediately downstream (i.e., 3'), and contains a plurality of consecutive adenosine monophosphates. One polyA tail may contain 10 to 300 adenosine monophosphates. For example, a polyA tail may comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenosine monophosphates. In some embodiments, one poly (a) tail contains 50 to 250 adenosine monophosphates. In a related biological environment (e.g., in cells, in vivo), the poly (a) tail functions to protect mRNA from enzymatic degradation, e.g., in the cytoplasm, and to aid in transcription termination, export of mRNA from the nucleus, and translation.

The term "cationic lipid" is of ordinary significance in the art and may refer to a lipid comprising one or more positively charged groups. As used herein, "positively charged group" refers to a chemical group that has a positron charge, e.g., monovalent (+1), divalent (+2), trivalent (+3), and so forth. Examples of positron charge groups include amine groups, ammonium groups, pyridyl groups, guanidine groups, and imidazole groups. In certain embodiments, the ionizable lipid molecule may comprise an amine group, and may be referred to as an ionizable amino lipid. In the present invention, cationic lipids include, but are not limited to, RL151 and/or Dlin-MC3.

As used herein, the term "pegylated lipid" or "pegylated lipid" refers to polyethylene glycol (PEG) modified lipids (PEG-lipids). Non-limiting examples of PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC 20), PEG-modified dialkylamines, and PEG-modified 1, 2-dicyanoxypropane-3 amines. For example, the PEG-lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

In some embodiments, the PEG-lipid includes, but is not limited to, 1, 2-dimyristoyl-sn-glycerogethoxy polyethylene glycol (PEG-DMG), 1, 2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [ amino (polyethylene glycol) ] (PEG-DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglycol (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-1, 2-dimyristoyloxy propyl-3amine (PEG-c-DMA).

In some embodiments, the PEG-lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the lipid molecules of the PEG-lipid include those having a length from about C14 to about C22, preferably from about C14 to about C16. In some embodiments, the PEG molecule, e.g., mPEG-NH2, is about 1000, 2000, 5000, 10000, 15000, or 20000 daltons in size. In some embodiments, the PEG-lipid is PEG2000-DMG.

Herein, "lipid nanoparticle" or "LNP" (lipid nanoparticle) is used for delivery of mRNA. In some embodiments, the LNP consists essentially of (i) at least one cationic lipid; (ii) A neutral lipid selected from DSPC, DPPC, POPC, DOPE and SM; (iii) sterols, such as cholesterol; and (iv) PEG-lipid, such as PEG2000-DMG, in a molar ratio of 45-55% cationic lipid to 35-40% neutral lipid to 8-12% sterol to 1-2% PEG-lipid.

As used herein, the term "synthetic" refers to the process of production, preparation, and/or manufacture by hand. The synthesis of polynucleotides or other molecules may be chemical or enzymatic. As used herein, "expression" of a nucleic acid sequence refers to translation of a polynucleotide (e.g., mRNA) into a polypeptide or protein and/or post-translational modification of a polypeptide or protein. Methods of transfection include, but are not limited to, chemical methods, physical treatments, and cationic lipids or mixtures.

The term "transcription" refers to a method of producing mRNA (e.g., an mRNA sequence or template) from DNA (e.g., a DNA template or sequence). "transfection" refers to the introduction of a polynucleotide (e.g., an exogenous nucleic acid) into a cell, wherein the polypeptide encoded by the polynucleotide is expressed (e.g., mRNA) or the polypeptide modulates a cellular function (e.g., siRNA, miRNA). For example, transfection may occur in vitro, or in vivo.

"modification" refers to altering any substance, compound or molecule in some way. The molecule may undergo a series of modifications, each of which may serve as a "unmodified" starting molecule for subsequent modification. Herein, the modification includes converting cytosine (C) to 5-methylcytidine (m 5C), uracil (U) to pseudouridine (psicoside), N1-methylpseudouridine (m 1 psicoside), 5-methoxyuridine (mo 5U), or an integration of 5-methylcytidine and pseudouridine (m 5C/psicose).

As used herein, the term "immune response" refers to the action of, for example, lymphocytes, antigen presenting cells, phagocytes, granulocytes, and soluble macromolecules produced by such cells or livers, including antibodies, cytokines, and complements, as a result of which invasive pathogens, cells or tissues of infected pathogens, cancer cells, or in the case of autoimmune or pathological inflammation, normal human cells or tissues are selectively damaged, destroyed, or excluded from the human body. In some cases, administration of nanoparticles composed of a lipid component and an encapsulated therapeutic agent can elicit an immune response that can be caused by (i) the encapsulated therapeutic agent (e.g., mRNA), (ii) an expression product of such an encapsulated therapeutic agent (e.g., a polypeptide encoded by mRNA), (iii) the lipid component of the nanoparticle, or (iv) a combination thereof.

As used herein, the term "treatment" refers to the partial or complete alleviation, amelioration, improvement, alleviation, delay of onset, inhibition of progression, reduction of severity, and/or reduction of the incidence of one or more symptoms or features of a particular infection, disease, disorder, and/or condition. For example, "treating" a cancer may refer to inhibiting the survival, growth, and/or spread of a tumor. Subjects exhibiting no signs of the disease, disorder, and/or condition and/or subjects exhibiting only early signs of the disease, disorder, and/or condition may be treated to reduce the risk of pathological development associated with the disease, disorder, and/or condition.

The term "therapeutic agent" or "prophylactic agent" refers to any agent that has a therapeutic, diagnostic, and/or prophylactic effect and/or causes a desired biological and/or pharmacological effect when administered to a subject. Therapeutic agents include, but are not limited to, cytotoxins, radioions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.

In some embodiments, the therapeutic agent is a polynucleotide or nucleic acid (e.g., ribonucleic acid or deoxyribonucleic acid). Exemplary polynucleotides for use in accordance with the present disclosure include, but are not limited to, one or more of deoxyribonucleic acid (DNA), ribonucleic acid (RNA) including messenger mRNA (mRNA) or hybrids thereof, RNAi-inducing agents, RNAi agents, siRNA, shRNA, miRNA, antisense RNAs, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, and the like. In some embodiments, the therapeutic and/or prophylactic agent is an RNA. RNAs useful in the compositions and methods described herein include, but are not limited to, ribozymes, small interfering RNAs (siRNAs), asymmetric interfering RNAs (aiRNAs), microRNA (miRNA), dicer-substrate RNAs (dsRNAs), small hairpin RNAs (shRNAs), transfer RNAs (tRNA), messenger RNAs (mRNAs), and mixtures thereof. In certain embodiments, the RNA is mRNA.

In certain embodiments, the therapeutic and/or prophylactic measure is an mRNA. The mRNA may encode any polypeptide of interest, including any naturally or non-naturally occurring or otherwise modified polypeptide. The polypeptide encoded by the mRNA can be of any size and can have any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA may have a therapeutic effect when expressed in a cell.

As used herein, "and/or" should be taken to specifically disclose each of the two particular features or components, whether or not the other. Thus, the term "and/or" as used herein in phrases such as "a and/or B" is intended to include "a and B", "a or B", "a" (alone) and "B" (alone). Also, the term "and/or" one or more "as used in a phrase such as" A, B and/or C "or" one or more of A, B and C "is intended to include the following: A. b and C; A. b or C; a or C; a or B; b or C; a and C; a and B; b and C; a (alone); b (alone); and C (alone).

It should also be noted that the term "comprising" is intended to be open-ended and allowed, but does not require the inclusion of additional elements or steps. When the term "comprising" is used, the terms "consisting essentially of …" and "consisting of …" are also included. When a composition is described as having, comprising or containing a particular ingredient, it is contemplated that the composition also consists essentially of or consists of the ingredient. Also, when a method or process is described as having, including, or comprising a particular step, the method or process also consists essentially of, or consists of, that step. Furthermore, it should be understood that the order of steps or order of performing certain actions is not important so long as the invention remains operable. Furthermore, two or more steps or actions may be performed simultaneously.

The invention is further illustrated by means of the following examples, which are not intended to limit the scope of the invention. The experimental methods, in which specific conditions are not noted in the following examples, were selected according to conventional methods and conditions, or according to the commercial specifications.

Example 1: in vitro Synthesis of soluble programmed death ligand-1 mRNA

Codon optimization (SEQ ID NO: 2) of the coding region of the mouse soluble programmed death ligand-1 (sPD-L1) gene, synthesis of the DNA sequence of the coding region in vitro, addition of HAtag at the 3' end and cloning into the T7 promoter on the PCDNA3.1 vectorDownstream, the in vitro transcribed DNA template was obtained by PCR using a reverse primer with a Poly (A) tail added to the universal primer for the linear DNA template. In vitro transcription Using T7RNA polymerase, while 5' -end capping of the synthesized RNA with the inverted Cap analogue EZ-Cap, is carried out by adding nucleotides carrying different chemical modifications (unmodified), 5-methoxyuracil (mo) ⁵ U), 5-methylcytosine and pseudouracil (m) ⁵ C/ψ), pseudo uracil (ψ) and N ₁ Methyl pseudouracil (m) ¹ ψ)) to obtain mRNA carrying chemical modifications to reduce immunogenicity and increase expression levels, where the introduction of chemically modified nucleotides is 100% substitution. After digestion of the template with DNase, mRNA was finally recovered by purification (SEQ ID NO: 3).

Codon-optimized sPD-L1 coding region (SEQ ID NO: 1):

atgaggatatttgctggcattatattcacagcctgctgtcacttgctacgggcgtttactatcacggctccaaaggacttgtacgtggtggagtatggcagcaacgtcacgatggagtgcagattccctgtagaacgggagctggacctgcttgcgttagtggtgtactgggaaaaggaagatgagcaagtgattcagtttgtggcaggagaggaggaccttaagcctcagcacagcaacttcagggggagagcctcgctgccaaaggaccagcttttgaagggaaatgctgcccttcagatcacagacgtcaagctgcaggacgcaggcgtttactgctgcataatcagctacggtggtgcggactacaagcgaatcacgctgaaagtcaatgccccataccgcaaaatcaaccagagaatttccgtggatccagccacttctgagcatgaactaatatgtcaggccgagggttatccagaagctgaggtaatctggacaaacagtgaccaccaacccgtgagtgggaagagaagtgtcaccacttcccggacagaggggatgcttctcaatgtgaccagcagtctgagggtcaacgccacagcgaatgatgttttctactgtacgttttggagatcacagccagggcaaaaccacacagcggagctgatcatcccagaactgcctgcaacacatcctccacagaacaggactcac

the results are shown in FIGS. 1A and 1B, where the result is shown by N ₁ Methyl pseudouracil (m) ¹ Psi) modified mRNA expressed the sPD-L1 protein in HEK293T and AML12 cell culture media showed the highest abundance. Thus, by evaluating the expression level and secretion efficiency, N1-methyl-pseudouciodine (m) having the highest expression and secretion efficiency was selected ¹ ψ) 100% substitution of modified nucleotide as the modification strategy employed in all subsequent experiments.

Example 2: use of lipid entrapped mRNA to obtain traditional lipid nanoparticles (MC 3-LNP) and lung-targeted lipid nanoparticles (DOTAP-LNP)

To achieve efficient mRNA presentation in vivo, LNP was selected using lipid entrapment, because the major organ targeted by LNP in vivo is the liver and secreted proteins are released into the blood circulation, the inventors synthesized lung-targeted lipid nanoparticles using selective organ targeting (SORT) techniques in order to achieve lung tissue-specific immunosuppression. As shown in fig. 1C, lipid molecules used herein include five types: 1, 2-dioleoyl-3-trimethylaminopropane (DOTAP), cationic lipid (DLin-MC 3-DMA), cholesterol, distearoyl phosphatidylcholine (DSPC), and polyethylene glycol modified lipid molecules (PEG 2000-DMG), DLin-MC3-DMA for conventional MC3-LNP nanoparticles: cholesterol: DSPC: PEG2000-DMG four lipids were dissolved in ethanol at a molar ratio of 50:10:38.5:1.5, whereas for lung-targeted DOTAP-LNP nanoparticles, DOTAPD: lin-MC3-DMA: cholesterol: DSPC: PEG2000-DMG was dissolved in ethanol at a molar ratio of 50:25:5:19.2:0.8. The lipid dissolved in ethanol and the in vitro transcribed mRNA are rapidly and evenly mixed through a T tube, and the lipid nanoparticle with the diameter of about 100nm is obtained by self-packaging.

As shown in FIG. 1D, the results indicate that the delivery of expression levels using mRNA-DOTAP-LNP is generally lower compared to mRNA-MC 3-LNP. To investigate the uptake mechanism of DOTAP-LNP, the inventors synthesized in vitro Cy3 fluorescent-labeled mRNA and encapsulated it in DOTAP-LNP. Transfection was performed on the a549 lung cancer cell line. As shown in FIG. 1E, co-localization of mRNA with lysosomes was observed after 18 hours, providing evidence for entry of DOTAP-LNP into cells by endocytosis.

Furthermore, to evaluate the physicochemical properties of LNP, the inventors performed measurements of encapsulation efficiency, size and zeta potential for both types of mRNA-LNP. The LNP was morphologically analyzed using a Transmission Electron Microscope (TEM) to reveal its shape and size (fig. 1F). By measuring protein size using Markov Zetasizer Nano ZS, it was confirmed that both mRNA-MC3-LNP and mRNA-DOTAP-LNP exhibited similar size distribution, with diameters of about 100nm (FIG. 1G, FIG. 7). In addition, mRNA-DOTAP-LNP exhibited very high encapsulation efficiency, up to 100% (FIG. 1H), and had a positive charge with zeta potential ranging between 2-4mV (FIG. 1I). On the other hand, the encapsulation efficiency of mRNA-MC3-LNP was about 85% and had a negative charge in the range of-15 to-5 mV (FIG. 1H-I). The polydispersity index (PDI) of mRNA-MC3-LNP was 0.1-0.3, while the PDI of mRNA-DOTAP-LNP was slightly higher, ranging from 0.3 to 0.4 (FIG. 1J).

The inventors then evaluated the expression of both lipid nanoparticles in vivo, and used a mouse in vivo imaging system to characterize the delivery location of the nanoparticles. A dose of 0.4mg/kg encoding luciferase mRNA (Luc mRNA) was administered to Balb/c mice by intravenous injection, and these mRNAs were encapsulated in both types of LNP. After intraperitoneal injection of the Luciferin substrate Luciferin, the expression of luciferase protein was evaluated at different time points (6 hours, 12 hours, 24 hours, 48 hours), respectively. As expected, the delivery of Luc mRNA by mRNA-DOTAP-LNP resulted mainly in pulmonary expression, whereas mRNA-MC3-LNP promoted significant expression in the liver (fig. 2A). Bioluminescence signals in the target organ peaked 6 hours after LNP injection and were detected for more than 48 hours (fig. 2A). Quantitative analysis of fluorescence values revealed that at the 6 hour time point, the expression level of Luc mRNA delivered by mRNA-MC3-LNP was more than 10-fold higher in the liver than that of mRNA-DOTAP-LNP in the lung. Over time, the signal intensity decayed more than 100-fold over 48 hours (fig. 2B). The above experiments confirm that MC3-LNP is delivered to the liver, while DOTAP-LNP is delivered to lung tissue.

To confirm the specific lung cell subpopulation transfected with DOTAP-LNP, a genetically engineered Cre/LoxP Ai6 reporter mouse line was used to allow Cre to drive specific expression of ZsGreen protein. Ai6 transgenic mice were given 0.8mg/kg Cre mRNA-DOTAP-LNP (FIG. 2C). After 2 days, zsGreen fluorescence signal was observed by confocal microscopy (fig. 2D). The lung cell suspension was then analyzed by flow cytometry using specific cell type markers. The results showed that 0.7% of Immune Cells (ICs) and 2% of macrophages (mΦs) were transfected, while 43.8% of Endothelial Cells (EC) exhibited ZsGreen fluorescence with a proportion of epithelial cells (EpiC) of 2.6% (fig. 2E). In addition, the expression of ZsGreen fluorescent protein in liver and spleen was also examined. The results of the study showed that 4.1% hepatocytes and 0.2% splenocytes were transfected (fig. 2F).

To investigate sPD-L1 protein expression of sPD-L1 mRNA-LNP after intravenous injection, the inventors administered both LNPs to C57BL/6 mice by intravenous injection at a dose of 0.2mg/kg, respectively. Soluble proteins expressed in the liver are known to be released into the blood circulation and transported through the circulation to the site of inflammation of the lung tissue. Thus, by ELISA detection method, sPD-L1 levels in plasma were monitored at various time points (0 hours, 4 hours, 8 hours, 12 hours, 24 hours, 48 hours) after sPD-L1 mRNA-MC3-LNP injection, confirming that sPD-L1 protein expressed by sPD-L1 mRNA-MC3-LNP could be released into the blood circulation and thereby transported to lung tissue.

The results showed a dose-dependent effect of sPD-L1 mRNA-MC3-LNP, with plasma protein levels reaching 100ng/mL at a dose of 0.2mg/kg. The expression level peaked at 4 hours after injection and gradually decreased over 48 hours (fig. 3A). In contrast, no sPD-L1 protein was detected in plasma after sPD-L1 mRNA-DOTAP-LNP injection (results not shown). Subsequently, pulmonary tissue proteins were extracted at different time points (0 hours, 4 hours, 8 hours, 12 hours, 24 hours, 48 hours, 72 hours) after injection, and by Western Blot it was confirmed that the sPD-L1 mRNA-DOTAP-LNP could be expressed in pulmonary tissue with the highest abundance observed in 8-12 hours, and expression of sPD-L1 continued to exist for 72 hours (FIG. 3B), with significantly higher abundance of protein delivered to the lung by sPD-L1 mRNA-MC 3-LNP.

Example 3: traditional lipid nanoparticles (MC 3-LNP) and lung-targeted lipid nanoparticles (DOTAP-LNP) expression of PD-L1 in lung tissue

The PD-L1-Fc recombinant protein is a glycosylated protein and is formed by connecting an extracellular domain of PD-L1 with a fragment crystallization region (Fc) of mouse IgG 1. Fusion of the Fc fragment can reduce complement activation effects and increase the half-life of the protein to extend circulation time. Such PD-L1-Fc recombinant proteins have been shown to be effective in alleviating acute immune responses. To compare the therapeutic effect of the protein and mRNA-LNP, the inventors also evaluated the half-life of PD-L1-Fc recombinant protein (Biolegend) after injection in vivo, at a dose of 0.8mg/kg, by intravenous injection. The inventors compared the abundance and half-life in the blood circulation of PD-L1-Fc and sPD-L1 mRNA-MC3-LNP expressed sPD-L1 in mouse serum after injection at different time points (0 hours, 4 hours, 8 hours, 12 hours, 24 hours, 48 hours). The results showed that the half-life curve of sPD-L1 mRNA-MC3-LNP at a dose of 0.2mg/kg was similar to the half-life of PD-L1-Fc at a dose of 0.8mg/kg (FIGS. 3C-3D).

To alleviate the symptoms of ARDS, local expression of sps-L1 in the lung is critical. Thus, the difference in target protein expression in lung tissue was compared for the two LNPs. The level of sPD-L1 delivered to lung tissue by mRNA-DOTAP-LNP and mRNA-MC3-LNP was compared by extraction of lung tissue proteins and Western blot analysis, while Luc mRNA-DOTAP-LNP (Luc mRNA from atlas) was also used as a control. The expression of sPD-L1 delivered by mRNA-MC3-LNP was observed to be relatively low in lung tissue. However, in situ expression of sPD-L1 promoted by mRNA-DOTAP-LNP resulted in 6-fold higher expression levels than endogenous PD-L1 (FIGS. 3E-3F). Luc mRNA-DOTAP-LNP showed lower levels of PD-L1, indicating that the increase in PD-L1 expression was caused by sPD-L1mRNA rather than nonspecific SORT mRNA-LNP (fig. 3E-F). This result suggests that the use of mRNA-DOTAP-LNP can significantly increase the expression level of sPD-L1 in lung tissue.

Example 4: construction of PAO-induced Acute Respiratory Distress Syndrome (ARDS) mouse model

To evaluate the therapeutic effect of sPD-L1 mRNA-LNP, an ARDS mouse model was established and evaluated. To simulate human ARDS disease, 8 week old C57BL/6 male mice (shanghai ling biosciences) were non-invasively perfused with Pseudomonas Aeruginosa (PAO) by endotracheal instillation (2 x 10) ⁶ CFU/mL,40 μl/min) to induce symptoms similar to ARDS caused by bacterial infection in humans. To assess the severity of lung injury and acute response, white Blood Cell (WBC) counts and protein concentration, inflammatory factor TNF- α, IL-6 concentrations, and wet weight/dry weight ratios (characterizing oedema) of mice lungs at different time points (0 hours, 4 hours, 8 hours, 12 hours, 24 hours) were measured in bronchoalveolar lavage (BALF) (fig. 4A). WBC count, protein concentration and wet/dry weight ratio increased rapidly after PAO administration, peaking at 8-12 hours (fig. 4B-fig. 4D). In addition, the expression of PD-1 (receptor for PD-L1) started to rise 4 hours after PAO perfusion and peaked at 12 hours (fig. 4E-4F). Histological analysis of lung inflammation 12 hours after PAO modeling confirmed the accumulation of proteins and erythrocytes, alveolar wall thickening, and recruitment of immune cells (fig. 4G). To assess the severity of lung injury in mice following the PAO model, lung injury scores were performed on HE stained sections of lung tissue before and after modeling according to the ARDS animal scoring table (table 1). The scores confirm the presence of severe lung injury in mice after PAO modeling (fig. 4H, fig. 8).

TABLE 1 pulmonary injury scoring Table

Score = [ (20×a) + (14×b) + (7×c) + (7×d) + (2×e) ]/100

Example 5: sPD-L1mRNA-MC3-LNP reduces pulmonary inflammatory response in ARDS mice

To evaluate the therapeutic effect of sPD-L1mRNA-MC3-LNP, four hours after PAO induction of ARDS by intratracheal instillation were performed by intravenous injection, and equal volumes of PBS, PD-L1-Fc protein (0.8 mg/kg), luc mRNA-MC3-LNP (0.2 mg/kg) and sPD-L1mRNA-MC3-LNP (0.2 mg/kg) were administered, respectively. At the 12 hour time point, key inflammatory indicators were measured, including White Blood Cell (WBC), protein concentration, inflammatory factor level, and lung tissue dry-to-wet weight ratio in BALF. From this evaluation, the efficacy of sPD-L1mRNA-MC3-LNP can be evaluated at the peak inflammatory response time observed in the early experiments (FIG. 5A). Compared to PBS or Luc mRNA-MC3-LNP control, sps-L1 mRNA-MC3-LNP showed significant effects in reducing WBC counts and protein concentration in BALF (fig. 5B-5C) and alleviating pulmonary edema (fig. 5D). In addition, levels of inflammatory factors TNF- α and IL-6 in BALF were measured, and slight downregulation was observed after administration of sPD-L1mRNA-MC3-LNP (FIG. 5E). In addition, lung injury scoring was performed and histological staining provided evidence of reduced inflammatory pathology (fig. 5F). After induction of ARDS, treatment with sps d-L1mRNA-MC3-LNP showed an effect of effectively reducing immune cell aggregation in alveolar space and blood leakage at 12 hours time point (fig. 5G).

Example 6: verification of the Effect of sPD-L1 mRNA-DOTAP-LNP in mice in inhibiting excessive immune response to acute respiratory distress syndrome

For ARDS-induced mice, the same dose (0.2 mg/kg) of sPD-L1 mRNA-MC3-LNP or mRNA-DOTAP-LNP was injected intravenously. The inventors measured various inflammatory indicators including white blood cell count, protein concentration, wet/dry weight ratio, and inflammatory factor (e.g., TNF- α, IL-6) levels in BALF (fig. 6A-6D). In addition, the inventors assessed the extent of lung injury observed in pathological sections (fig. 6E, fig. 9A). The inventors observed that both types of sPD-L1 mRNA-LNP exhibited similar effects in inhibiting inflammatory responses in all these indicators.

Next, the inventors evaluated the therapeutic effect of sPD-L1 mRNA-DOTAP-LNP (0.2 mg/kg) in ARDS, which was compared with PBS, PD-L1-Fc recombinant protein (0.8 mg/kg) and Luc mRNA-DOTAP-LNP (0.2 mg/kg). Treatment with sPD-L1 mRNA-DOTAP-LNP showed an effect of reducing protein accumulation, leukocyte recruitment, extent of edema, cytokine levels compared to all of these control groups (FIGS. 6F-6J, 9B). Based on the above findings, a single dose of sPD-L1 mRNA-DOTAP-LNP resulted in an increase in sPD-L1 expression within 3 days after injection, effectively alleviating the acute immune response.

To confirm the specific immunosuppressive effects of sPD-L1 mRNA-DOTAP-LNP in lung tissue, the inventors analyzed the effect of an injection dose of 0.2mg/kg of sPD-L1 mRNA-DOTAP-LNP on immune cell populations in thymus and spleen of mice. Compared with the control group, the intervention of sPD-L1 mRNA-DOTAP-LNP did not significantly affect the proportion of immune cells in spleen and thymus. However, dendritic cells in the spleen increased approximately 1-fold after administration of 0.8mg/kg PD-L1-Fc, whereas a large number of macrophages were detected in the spleen after injection of 0.2mg/kg sPD-L1 mRNA-MC 3-LNP. The results indicate that local immunosuppression by sPD-L1 mRNA-DOTAP-LNP can reduce the effect on immune cells in other tissues (FIG. 6K).

To confirm the effect of sPD-L1 intervention on survival of ARDS model mice, the inventors monitored the effect of single doses of PD-L1-Fc (0.8 mg/kg), sPD-L1 mRNA-MC3-LNP (0.2 mg/kg) and sPD-L1 mRNA-DOTAP-LNP (0.2 mg/kg) on the 7 day survival of ARDS mice (FIG. 6L). PBS groups showed rapid death within 3 days with only 30% of the mice surviving. The single dose of sPD-L1 mRNA-DOTAP-LNP administration significantly prolonged the survival rate of mice, reaching 87% after 7 days. Meanwhile, the survival rates of mice treated with PD-L1-Fc and sPD-L1 mRNA-MC3-LNP were similar, 60% and 67%, respectively (FIG. 6L). These results provide a powerful support for the effective protection of mice from death due to acute inflammation by local pulmonary expression of sPD-L1.

Furthermore, the inventors assessed the in vivo safety of mRNA-DOTAP-LNP by measuring changes in Colony Forming Units (CFU) of lung tissue bacteria. Compared to PBS-treated groups in PAO-induced mice, lung tissue after injection of sps d-L1mRNA-DOTAP-LNP (0.2 mg/kg) showed that in situ expression of sps d-L1 did not interfere with bacterial clearance in lung tissue (fig. 10A). To evaluate the potential immune response caused by DOTAP-LNP, the inventors measured the concentrations of TNF- α and IL-6 in BALF after injection of sPD-L1mRNA-DOTAP-LNP (0.2 mg/kg) and performed histopathological analyses of vital organs. The results showed no apparent immune response, which is manifested by small changes in TNF- α and IL-6 levels, and no histopathological abnormalities in vital organs (fig. 10A-10C). Furthermore, DOTAP-LNP was reported to not adversely affect lung, liver and spleen cells (fig. 10D). Together, these comprehensive findings demonstrate the safety of mRNA-DOTAP-LNP, confirming their potential as a safe and effective option for the treatment of acute inflammatory diseases.

In summary, the inventors chose to perfuse pseudomonas aeruginosa fluid through an endotracheal tube and administer 5 μg of sPD-L1mRNA-DOTAP-LNP 4 hours later. Five groups were set up for sham, PBS, PD-L1-Fc protein positive control, luc mRNA-DOTAP-LNP control, and sPD-L1mRNA-DOTAP-LNP experimental. Comparing sPD-L1mRNA-DOTAP-LNP group with PBS group and Luc mRNA-DOTAP-LNP group, the sPD-L1mRNA-DOTAP-LNP intervention significantly reduces protein and leukocyte accumulation in alveolar space, and pulmonary edema condition is improved, and inflammatory factor level is reduced to a certain extent. And the lung tissue HE staining and color detection result is consistent with the indexes, the sPD-L1mRNA-DOTAP-LNP intervention effectively reduces neutrophil chemotaxis and hemoglobin permeation, and maintains the normal structure of alveoli. These results demonstrate that sPD-L1mRNA-DOTAP-LNP can alleviate the inflammatory conditions of ARDS. In addition, sPD-L1mRNA-DOTAP-LNP can reduce the acute immune response of lung tissue and effectively prolong the seven-day survival rate of mice model acute respiratory distress syndrome.

Reference to the literature

1.Andries O,Mc Cafferty S,De Smedt SC,Weiss R,Sanders NN,Kitada T.N(1)-methylpseudouridine-incorporated mRNA outperforms pseudouridine-incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice.J Control Release.2015；217:337-44.

2.M,Boros G,Muramatsu H,Mahiny A,Vlatkovic I,Sahin U,et al.A Facile Method for the Removal of dsRNA Contaminant from In Vitro-Transcribed mRNA.Mol Ther Nucleic Acids.2019；15:26-35.

3.Cheng Q,Wei T,Farbiak L,Johnson LT,Dilliard SA,Siegwart DJ.Selective organ targeting(SORT)nanoparticles for tissue-specific mRNA delivery and CRISPR-Cas gene editing.Nat Nanotechnol.2020；15:313-20.

4.Gilleron J,Querbes W,Zeigerer A,Borodovsky A,Marsico G,Schubert U,et al.Image-based analysis of lipid nanoparticle-mediated siRNA delivery,intracellular trafficking and endosomal escape.Nat Biotechnol.2013；31:638-46.

5.Wittrup A,Ai A,Liu X,Hamar P,Trifonova R,Charisse K,et al.Visualizing lipid-formulated siRNA release from endosomes and target gene knockdown.Nat Biotechnol.2015；33:870-6.

6.Madisen L,Zwingman TA,Sunkin SM,Oh SW,Zariwala HA,Gu H,et al.A robust and high-throughput Cre reporting and characterization system for the whole mouse brain.Nat Neurosci.2010；13:133-40.

7.Zhang Y,Xi X,Yu H,Yang L,Lin J,Yang W,et al.Chemically modified in-vitro-transcribed mRNAencoding thrombopoietin stimulates thrombopoiesis in mice.Mol Ther Nucleic Acids.2022；29:657-71.

8.Czajkowsky DM,Hu J,Shao Z,Pleass RJ.Fc-fusion proteins:new developments and futureperspectives.EMBO Mol Med.2012；4:1015-28.

9.Xu J,Wang J,Wang X,Tan R,Qi X,Liu Z,et al.Soluble PD-L1 improved direct ARDS by reducingmonocyte-derived macrophages.Cell Death Dis.2020；11:934.

10.LoPresti ST,Arral ML,Chaudhary N,Whitehead KA.The replacement of helper lipids with chargedalternatives in lipid nanoparticles facilitates targeted mRNA delivery to the spleen and lungs.J Control Release.2022；345:819-31。

Claims (10)

1. A nucleic acid molecule comprising a nucleotide encoding a soluble PD-L1 having an amino acid sequence as set forth in SEQ ID No. 1;

the nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO. 2 or SEQ ID NO. 3.

2. The nucleic acid molecule of claim 1, wherein said nucleic acid molecule further comprises a nucleotide encoding a signal peptide;

preferably, the nucleotide has a nucleotide sequence as shown in SEQ ID NO. 5 or SEQ ID NO. 6.

3. A composition comprising the nucleic acid of claim 1 or 2 and a delivery vector.

4. The composition of claim 3, wherein the nucleic acid is mRNA;

and/or, the nucleic acid is a modified nucleic acid;

preferably, the modification is an N1-methyl-pseudolaridine (m 1 ψ) modification.

5. The composition of claim 3 or 4, wherein the delivery vehicle is a lipid nanoparticle;

preferably, the lipid nanoparticle comprises cholesterol, a cationic lipid and a non-cationic lipid; the cationic lipid is selected from DLin-MC3-DMA and 1, 2-dioleoyl-3-trimethylaminopropane (DOTAP); the non-cationic lipid is selected from phospholipids and/or lipid conjugates;

More preferably, the phospholipid is distearoyl phosphatidylcholine (DSPC); and/or the lipopolymer is a polyethylene glycol modified lipid molecule, such as PEG2000-DMG.

6. The composition of claim 5, wherein the molar ratio of the ionizable cationic lipid is 20-50%, the molar ratio of cholesterol is 30-50%, the molar ratio of phospholipid is 10-25%, and the molar ratio of the lipid conjugate is 1-5%; and/or the lipid nanoparticle comprises DLin-MC3-DMA, DSPC, PEG2000-DMG and cholesterol; or the lipid nanoparticle comprises DOTAP, DLin-MC3-DMA, DSPC, PEG2000-DMG and cholesterol;

for example, in the lipid nanoparticle, DLin-MC3-DMA: DSPC: cholesterol: the molar ratio of PEG2000-DMG is 50 percent to 10 percent to 38.5 percent to 1.5 percent; alternatively, in the lipid nanoparticle, DOTAP: DLin-MC3-DMA: DSPC: cholesterol: the molar ratio of PEG2000-DMG was 50% 25% 5% 19.2% 0.8%.

7. A pharmaceutical composition comprising a nucleic acid molecule according to claim 1 or 2 and/or a composition according to any one of claims 3-6, together with a pharmaceutically acceptable carrier and/or adjuvant.

8. A lipid nanoparticle, characterized in that the lipid nanoparticle comprises cholesterol, a cationic lipid, and a non-cationic lipid; the cationic lipid is selected from DLin-MC3-DMA and 1, 2-dioleoyl-3-trimethylaminopropane (DOTAP); the non-cationic lipid is selected from phospholipids and/or lipid conjugates;

preferably, the phospholipid is distearoyl phosphatidylcholine (DSPC); and/or the lipopolymer is a polyethylene glycol modified lipid molecule, such as PEG2000-DMG;

more preferably, the molar ratio of the ionizable cationic lipid is 20-50%, the molar ratio of the cholesterol is 30-50%, the molar ratio of the phospholipid is 10-25%, and the molar ratio of the lipid conjugate is 1-5%; and/or the lipid nanoparticle comprises DLin-MC3-DMA, DSPC, PEG2000-DMG and cholesterol; or the lipid nanoparticle comprises DOTAP, DLin-MC3-DMA, DSPC, PEG2000-DMG and cholesterol;

for example, in the lipid nanoparticle, DLin-MC3-DMA: DSPC: cholesterol: the molar ratio of PEG2000-DMG is 50 percent to 10 percent to 38.5 percent to 1.5 percent; alternatively, in the lipid nanoparticle, DOTAP: DLin-MC3-DMA: DSPC: cholesterol: the molar ratio of PEG2000-DMG was 50% 25% 5% 19.2% 0.8%.

9. Use of a nucleic acid molecule according to claim 1 or 2, a composition according to any one of claims 3-6, a pharmaceutical composition according to claim 7, and/or a lipid nanoparticle according to claim 8 for the manufacture of a medicament for the treatment of excessive inflammation caused by acute respiratory distress syndrome.

10. A composition for use in the treatment of excessive inflammation caused by acute respiratory distress syndrome, comprising a nucleic acid molecule according to claim 1 or 2, a composition according to any one of claims 3-6, a pharmaceutical composition according to claim 7, and/or a lipid nanoparticle according to claim 8.