CN117821374A - Regulation of cell fate conversion by N4-cytidylic acid acetylation modification of mRNA - Google Patents

Abstract

The present invention relates to the modulation of cell fate conversion by N4-cytidylic acid acetylation modification of mRNA. Specifically, the inventor provides N4-cytidylic acid acetylation (ac 4C) modification and important roles of NAT10 in regulating cell fate transformation for the first time, and discovers that NAT10 knockdown can obstruct the process of differentiation of human embryonic stem cell lineages by utilizing a differentiation system based on human pluripotent stem cells; NAT10 knockdown was found to hinder somatic reprogramming process using the transcription factor OSKM mediated reprogramming system. It was further found that NAT10 affects the ac4C modification level of chromatin regulators, and thus downstream bivalent genes, and plays a role in regulating chromatin landscape. The invention discloses the connection between NAT10 mediated ac4C modification and chromatin signal, which can be applied to develop a new method for controlling cell fate transformation, and promote understanding and application of regenerative medicine.

Description

Regulation of cell fate conversion by N4-cytidylic acid acetylation modification of mRNA

Technical Field

The invention relates to the field of biological medicine, in particular to regulation and control of cell fate conversion by N4-cytidylic acid acetylation modification of mRNA.

Background

The study of cell fate plasticity is critical to the field of biology. The cell fate transition process involves extensive gene network regulation and chromatin landscape changes. While much effort has been devoted to the relevant mechanisms of cell fate switching in the epigenetic and transcriptional regulatory layers, the regulation of cell fate by post-transcriptional modification is currently lacking in relevant research. In addition, the importance of apparent transcriptome regulation on the RNA level for cell fate conversion has only attracted attention in recent years as opposed to widely studied epigenetic regulation on the DNA and histone levels. The study of these different levels of regulation and cross-talk between them allows a better understanding of cell fate conversion, while also driving the development of regenerative medicine.

N4-Cytidylic acid acetylation (ac 4C) modification is a recently discovered modification within messenger RNA, and is the only currently known messenger RNA acetylation modification, but its function in cell fate conversion, especially in stem cell differentiation and somatic reprogramming is still unknown. NAT10 is the primary acetylase of ac4C and its role in stem cell differentiation and somatic reprogramming has not been systematically studied at present. In addition, the current technical method for detecting ac4C modification is single, and in view of the low modification abundance of ac4C and the to-be-improved antibody specificity, a new modification detection method is urgently needed to be developed.

Therefore, there is an urgent need in the art to explore the role of NAT10 and its catalytically formed mRNA ac4C modification in stem cell differentiation and somatic reprogramming, and to develop new methods to control cell fate conversion.

Disclosure of Invention

It is an object of the present invention to provide methods for modulating cell differentiation and reprogramming using mRNA ac4C modifications.

In a first aspect of the invention there is provided the use of an inhibitor of N4-cytidylic acid acetylation (ac 4C) modification for the preparation of a formulation or composition for use in one or more of the uses selected from the group consisting of:

(a) Inhibiting the activity or level of a chromatin regulator selected from the group consisting of: ANP32B, ANP32A, ANP E, ACIN1, HNRNPC, PELP1, PSIP1, RNF20 and PAF1;

(b) Regulating the function of the bivalent gene;

(c) Inhibiting the differentiation process of stem cells;

(d) Inhibit the reprogramming process of somatic cells.

In another preferred embodiment, the inhibitor of N4-cytidylic acid acetylation (ac 4C) modification comprises a NAT10 inhibitor.

In another preferred embodiment, the NAT10 inhibitor comprises siRNA, shRNA, gene editing agent for specifically knocking out NAT10, chemical small molecule inhibitor targeting NAT 10.

In another preferred embodiment, the shRNA sequence is selected from the group consisting of:

(1)GAGATGTATTCACGGAATATG(SEQ ID NO:1)；

(2)CGGCCATCTCTCGCATCTATT(SEQ ID NO:2)。

in another preferred embodiment, the gene editing agent that specifically knocks out NAT10 comprises sgRNA. In another preferred embodiment, the sgRNA sequence is as follows: GTGAGTTCATGGTCCGTAGG (SEQ ID NO: 3).

In another preferred embodiment, the small chemical molecule inhibitor that targets NAT10 comprises Remodelin.

In another preferred embodiment, the bivalent gene is a gene containing both H3K4me3 and H3K27me 3.

In another preferred embodiment, the bivalent gene comprises a gene selected from the group consisting of: SFRP1, NODAL, or combinations thereof.

In another preferred embodiment, the function of regulating a bivalent gene comprises:

(i) Upregulating a divalent gene selected from the group consisting of: NODAL;

(ii) Down-regulating a divalent gene selected from the group consisting of: SFRP1.

In another preferred embodiment, the differentiation of the stem cells comprises spontaneous differentiation, directed differentiation, or a combination thereof.

In another preferred embodiment, the stem cells are human embryonic stem cells.

In another preferred embodiment, the differentiation of the stem cells comprises differentiation of lineages.

In another preferred embodiment, the differentiation comprises spontaneous differentiation of embryonic stem cells into embryoid bodies, directed differentiation of embryonic stem cells into pancreatic precursor cells, or a combination thereof.

In another preferred embodiment, the NAT10 inhibitor down-regulates mRNA or protein levels of pancreatic precursor cells selected from the group consisting of: PDX1, NKX6.1, HNF6, SOX9.

In another preferred embodiment, the NAT10 inhibitor down-regulates mRNA or protein levels of iPSC cells selected from the group consisting of: OCT4, SOX2, NANOG, sall4, CDH1.

In another preferred embodiment, the NAT10 inhibitor upregulates mRNA or protein levels of iPSC cells selected from the group consisting of: CDH2.

In another preferred embodiment, the NAT10 inhibitor upregulates a pathway selected from the group consisting of: a p53 signaling pathway, a TNF signaling pathway, cell adhesion, proteasome, or a combination thereof.

In another preferred embodiment, the NAT10 inhibitor down regulates a pathway selected from the group consisting of: valine, leucine and isoleucine degradation; PI3K-Akt signaling pathway; sphingolipid metabolism; purine metabolism; ras signal pathway; HIF-1 signal pathway; or a combination thereof.

In a second aspect of the invention there is provided the use of a NAT10 protein or an enhancer thereof for the preparation of a formulation or composition for use in one or more of the uses selected from the group consisting of:

(a) Promoting activity or level of a chromatin regulator selected from the group consisting of: ANP32B, ANP32A, ANP E, ACIN1, HNRNPC, PELP1, PSIP1, RNF20 and PAF1;

(b) Regulating the function of the bivalent gene;

(c) Promoting the differentiation process of stem cells;

(d) Promote the reprogramming process of somatic cells.

In another preferred embodiment, the function of regulating a bivalent gene comprises:

(i) Down-regulating a divalent gene selected from the group consisting of: NODAL;

(ii) Upregulating a divalent gene selected from the group consisting of: SFRP1.

In another preferred embodiment, the method comprises:

(1) Providing a polynucleotide sample to be detected for mRNA acetylation, co-immunoprecipitation with an ac4C specific antibody to form an ac4C specific antibody-ac 4C modified mRNA complex;

(2) Isolating the antibody-ac 4C modified mRNA complex;

(3) Performing a competitive elution treatment in the presence of ac4CTP, thereby dissociating the ac 4C-specific antibody from the complex and releasing ac 4C-modified mRNA;

(4) Isolating the released ac4C modified mRNA; and

(5) The site of ac4C modification was identified by Peak analysis for the isolated mRNA.

In another preferred embodiment, in step (3), the final concentration of ac4CTP is 5-20mM, preferably 6-10mM, more preferably about 6-8mM.

In another preferred embodiment, the ac 4C-specific antibody is conjugated to magnetic beads.

In another preferred embodiment, in step (2), the separation is performed by a magnetic field.

In another preferred embodiment, in step (4), the separation is performed by precipitation.

In a third aspect of the invention, there is provided a method of assessing whether an RNA molecule is a substrate for a NAT10 protein, comprising the steps of:

(a) Searching for the sequence of the RNA molecule for the presence of an ac4C modification motif selected from the group consisting of:

(i)CXUCXUCXUCXU

(ii)CXXCXXCXXCXX

x is any nucleotide selected from A, G, C, U;

wherein the presence of the ac4C modification motif indicates a high probability of the RNA becoming a substrate for the NAT10 protein.

In another preferred embodiment, the method further comprises the steps of:

(b) Mixing a polynucleotide with a NAT10 protein and detecting whether an ac4C modification has occurred in a nucleotide sequence corresponding to the ac4C modification motif in the polynucleotide; wherein the occurrence of an ac4C modification indicates that the polynucleotide is a substrate for a NAT10 protein.

In another preferred embodiment, said step (b) is performed in the presence of acetyl CoA.

In a fourth aspect of the invention, there is provided a method of modulating pluripotent stem cell fate in vitro comprising the steps of: culturing pluripotent stem cells in the presence of an inhibitor of N4-cytidylate acetylation (ac 4C) modification, thereby regulating the differentiation process of the pluripotent stem cells.

In another preferred embodiment, the pluripotent stem cells comprise ipscs.

In another preferred embodiment, the inhibitor of N4-cytidylic acid acetylation (ac 4C) modification comprises a NAT10 inhibitor.

In another preferred embodiment, the NAT10 inhibitor comprises siRNA, shRNA, gene editing agent for specifically knocking out NAT10, chemical small molecule inhibitor targeting NAT 10.

In another preferred embodiment, the differentiation comprises spontaneous differentiation of embryonic stem cells into embryoid bodies, directed differentiation of embryonic stem cells into pancreatic precursor cells, or a combination thereof.

In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

Fig. 1 shows the role of NAT10 in shrt and shrat 10 human embryonic stem cell line (hESC). FIG. 1A shows NAT10 expression during RT-qPCR (left panel) and Western blot (right panel) analysis of pluripotency reprogramming; FIG. 1B shows NAT10 expression during differentiation of embryoid bodies by RT-qPCR (left panel) and Western blot (right panel), wherein relative NAT10 expression is a fold change relative to its expression on day 0, D represents days. Fig. 1C is an immunoblot showing knockdown efficiency of NAT10 in hescs. FIG. 1D shows the efficiency of NAT10 knockdown in hESC by immunofluorescence, scale bar, 10 μm. FIG. 1E shows immunofluorescence staining of OCT4 and NANOG at shCTR and shNAT10 hESC, scale bar, 50 μm. Fig. 1F shows RT-qPCR detection of OCT4, NANOG, and SOX2 in shCTR and shNAT10 hESC, n=3. FIG. 1G is a network of NAT 10-interacting proteins obtained by IP-MS. * P <0.05, < P <0.01, < P <0.001.

FIG. 2 shows the change in expression of NAT10 during multipotent reprogramming and embryoid body differentiation, and the effect on multipotent associated gene expression in human embryonic stem cell lines. Fig. 2A is a schematic illustration of an experimental protocol.

FIG. 2B is a bright field image (left) of clones and representative clone morphology (right), scale bar, 500 μm (left) and 1mm (right) for day six of hESC transfected with shCTR or shNAT10, respectively. FIG. 2C shows growth curves of hESCs transfected with shCTR or shNAT 10. N=3. Fig. 2D is a protein synthesis rate assay, n=6. Fig. 2E shows the DNA synthesis rate measurement results, n=6. FIGS. 2F and 2G are graphs of GO-rich pathways showing up-and down-regulated genes. FIGS. 2H and 2I are bubble diagrams showing the KEGG enrichment pathway of up-and down-regulated genes. FIG. 2J is the effect of knockdown NAT10 on H3K4me3 and H3K27me3 histone modifications on embryonic stem cells. FIG. 2K shows the effect of knockdown NAT10 on bivalent genes. * P <0.01, P <0.001, P <0.0001.

Figure 3 shows the phenotype of NAT10 gene knockdown during Embryoid Body (EB) differentiation, pancreatic Precursor (PP) differentiation, and somatic reprogramming. FIG. 3A is a schematic representation of spontaneous and directed differentiation of hESCs. FIG. 3B is a bright field image (left) of Embryoid Body (EB) differentiation on day eight and represents embryoid body morphology (right), scale bar, 500 μm (left) and 1mm (right). FIG. 3C shows immunofluorescent staining of PDX1 and NKX6.1 on day 14 of pancreatic differentiation. Scale bar, 50 μm. Fig. 3D is RT-qPCR analysis of PDX1, NKX6.1, HNF6, SOX9 and FOXA2 on day 14 of pancreatic differentiation, n=3. Fig. 3E is a schematic diagram of shRNA knockdown NAT 10. Fig. 3F is a representative image (left panel) and quantification (right panel) of OCT4 positive clones in shCTR cells and shNAT10 cells, n=3, scale bar, 100 μm. Fig. 3G is a quantitative case of alkaline phosphatase staining in shCTR cells and shNAT10 cells, n=3. FIG. 3H is an RT-qPCR analysis of MET gene expression in cells transfected with OSKM plus shCTR and shNAT10, or shCTR and shNAT10 viruses. N=3. Fig. 3I is an RT-qPCR analysis of multipotent gene expression in cells transfected with OSKM plus shCTR and shNAT10 or shCTR and shNAT10 virus, n=3. * P <0.01, P <0.001, P <0.0001.

FIG. 4 shows the phenotype of NAT10 gene knockdown in Definitive Endoderm (DE) differentiation, NAT10 knockdown using sgRNA and the small molecule inhibitor, recodelin, using NAT10 during reprogramming. FIG. 4A is immunofluorescent staining of SOX17 and FOXA2 on day 3 of definitive endoderm differentiation, scale bar, 50 μm. Fig. 4B is RT-qPCR analysis of fox 17 and FOXA2 on day 3 of definitive endoderm differentiation, n=3. Fig. 4C is a teratoma formation assay for shCTR and shNAT10 hESC in immunodeficient mice, teratoma formation of shCTR and shNAT10 hESC (left), H & E staining of shCTR and shNAT10 hESC teratomas (right), scale bar, 200 μm. Fig. 4D is the quantitative result of FACS of shCTR cells and shNAT10 cells, n=3. FIG. 4E is a schematic diagram of knockdown of NAT10 by sgRNA or Remodelin processing. Fig. 4F is a representative image (left panel) and quantification (right panel) of OCT4 positive clones in sgCTR cells and sgNAT10 cells, scale bar, 100 μm, n=3. Fig. 4G is the quantitative case of alkaline phosphatase staining in sgCTR cells and sgNAT10 cells, n=3. Fig. 4H is FACS quantification in sgCTR cells and sgNAT10 cells, n=3. FIG. 4I is an RT-qPCR analysis of MET-related gene expression in sgCTR and sgNAT10 treated cells. N=3. Fig. 4J is an RT-qPCR analysis of pluripotency-related gene expression in sgCTR and sgNAT10 treated cells, n=3. FIG. 4K is a plot of growth of DMSO and Remodelin treated human fibroblasts. Fig. 4L concentration test of Remodelin during reprogramming, n=3. Fig. 4M is a representative image (left panel) and quantification (right panel) of OCT4 positive clones in DMSO and Remodelin treated cells, scale bar, 100 μm, n=3. Fig. 4N is the alkaline phosphatase staining quantification of DMSO and Remodelin treated cells, n=3. Fig. 4O is FACS quantification of DMSO and Remodelin treated cells, n=3. Figure 4P is an RT-qPCR analysis of MET-related gene expression in DMSO and Remodelin treated cells, n=3. Figure 4Q is an RT-qPCR analysis of pluripotency-related gene expression in DMSO and Remodelin treated cells, n=3. * P <0.05, < P <0.01, < P <0.001, < P <0.0001.

FIG. 5 shows the effect of detecting ac4C modifications in human embryonic stem cells on ac4C modifications in human embryonic stem cells by the establishment of a liquid chromatography-tandem mass spectrometry (LC-MS/MS) system and knocking down NAT 10. FIG. 5A is a representative chromatogram of total RNA, poly (A) RNA, and blank and ac4C standards for hESCs. FIG. 5B is a schematic diagram of NAT10 catalyzed modification of N4-acetylcytidine (ac 4C). Fig. 5C is a determination of poly (a) RNA purity by 18S rRNA RT-qPCR, n=3. Fig. 5D is a relative quantification of ac4C levels in ploy (a) RNAs of fibroblasts, hESCs, on day 10 of spontaneous differentiation, n=3. Fig. 5E shows LC-MS/MS detection of hESCs total RNA and poly (a) RNA, n=4. Fig. 5F is a relative quantification of ac4C modification detection in total RNA of hscs transfected with shCTR or shNAT10, n=3. Fig. 5G is a relative quantitative case of ac4C modification detection in ploy (a) RNA of hscs transfected with shCTR or shNAT10, n=4. FIG. 5H is a representative chromatogram performed in poly (A) RNA of shCTR or shNAT10 transfected hESCs. * P <0.01, P <0.001, P <0.0001.

FIG. 6 shows the characteristics of ac4C modification in human embryonic stem cells, in response to establishment of the acrP-seq system. The difference in the shCTR and shNAT10 (NAT 10 knock-down) human embryonic stem cell line (hESC) of the ac4C modification was detected by acrP-seq. FIG. 6A is an acRIP-seq schematic. FIG. 6B shows that ac4C (+) or C-RNA probes were added to poly (A) RNA and an acrP-RT-qPCR assay was performed, with N=3. Fig. 6C is the number of ac4C modified peaks in shCTR and shNAT10 hESC. Fig. 6D is a venn plot showing the intersection of ac4C peaks in the shCTR and shNAT10 hESC. FIG. 6E is a view of the ac4C modified gene (CCDC 34) and unmodified gene (POU 5F 1) by IGV. Blue and grey represent IP and Input abundances. FIG. 6F is a genomic distribution of ac4C peaks in shCTR and shNAT10 hESC. FIG. 6G is a distribution of ac4C modified peaks in transcripts. Fig. 6H is the most prominent motif in the shCTR and shNAT10hESC modification peaks. FIG. 6I is GO enrichment analysis of the ac4C overlapping peak corresponding genes in shCTR and shNAT10 hESC. Fig. 6J is the case of the splice Percentages (PSI) of shCTR and shNAT10 hESC. Fig. 6K is the case of Percentage of Intron Retention (PIR) for shCTR and shNAT10 hESC. Fig. 6J is a graph and fig. 6K is a graph using the paired Wilcoxon test for significance. Fig. 6L is a plot of scattering density comparing the enrichment of ac4C peaks in shCTR and shNAT10 hESC. Fig. 6M is a differential peak analysis between ac4C peaks in shCTR and shNAT10 hESCs. P <0.0001.

Fig. 7 shows further analysis of the acrp-seq, including reproducibility of the acrp-seq experiment and GO and KEGG analysis of ac4C modified down-peak in shNAT10 hESC. Fig. 7A is an intersection of ac4C peaks in a biological repeat. Fig. 7B is a diagram showing other motifs found in the ac4C modification peaks of shCTR and shNAT10hESC that are similar to "cxxcxxxcxx". Fig. 7C is a graph showing the distribution of the ac4C peak in the shCTR and the ac4C peak in the shNAT10, and the distribution of the ac4C peak in the shCTR and the shNAT10hESC, respectively. Fig. 7D is the GO enrichment pathway of the ac4C modified peak down-regulated gene. FIG. 7E is a KEGG enrichment pathway for the ac4C modified peak down-regulating gene.

FIG. 8 shows the determination of chromatin regulation factor as an important target for NAT10 and of histone chaperone ANP32B as a functional target downstream of the NAT10-ac4C signal axis by quantitative proteomic analysis. FIG. 8A is a correlation between changes in gene expression (x-axis) and changes in protein expression (y-axis). Fig. 8B is a GO enrichment pathway of up-regulated protein. FIG. 8C is a Fisher exact test of chromatin remodeling-related proteins among all downregulated proteins. Fig. 8D is a reprogramming assay of 9 candidate chromatin regulators, n=3. Fig. 8E is a RIP-qPCR analysis of binding of ANP32B mRNA transcripts to NAT10 in hescs, n=3. Fig. 8F and 8G are thermal graphs (fig. 8F) and RT-qPCR analyses (fig. 8G) of MET and pluripotency related genes in cells transfected with OSKM plus shCTR and shANP32B virus, n=3. Fig. 8H is a KEGG enrichment analysis of down-regulated (left) and up-regulated (right) genes in transfected shANP32B cells after reprogramming compared to transfected shrt. Fig. 8I is a growth curve of hescs transfected with shCTR or shANP32B virus, n=3. Fig. 8J and 8K are proliferation (fig. 8J) and differentiation assay cases (fig. 8K) of hescs after transfection with the indicated lentiviruses, n=3. Fig. 8L is the effect of knockdown NAT10 on OCT4 positive clones. * P <0.05, < P <0.01, < P <0.001.

FIG. 9 shows the screening process for NAT10-ac4C axis downstream targets and the role of ANP32B in reprogramming. The effect of ANP32B on cell fate conversion was examined by a back-fill experiment. Fig. 9A is a variation plot of shCTR and shNAT10 hESC protein expression. Fig. 9B is GO enrichment analysis of downregulated proteins. FIG. 9C is a Venn diagram showing the intersection of a down-regulating protein and an ac4C down-regulating peak corresponding gene. Fig. 9D is a heat map of protein expression levels of 12 intersection genes (left) and fold change of peaks in shNAT10 hESC relative to shCTR hESC (right). FIG. 9E is a graph of IGVs used to visualize the ac4C peak (upper) and the intra-gene ac4C representative motif in the chromatin regulator ANP32B (lower). Fig. 9F is an ac4C-RIP-qPCR showing reduced ac4C modification on ANP32B mRNA transcripts in shNAT10 hESC, n=3, compared to shCTR hESC. Fig. 9G is an RNA decay curve of ANP32B in shCTR and shNAT10 hESC, n=3. Fig. 9H is a western blot of ANP32B protein in shCTR and shNAT10 hESC. Fig. 9I is a bright field picture, scale bar, 100 μm, of OCT4 positive clones in shrt cells and shANP32B cells on D12. Fig. 9J is a bright field image, scale bar, 500 μm, of a sixth day clone following hESC transfected with shCTR and shANP 32B. FIG. 9K is embryoid body morphology, scale bar, 500 μm, of embryoid body differentiation of shCTR and shANP32B hESC on day 8. * P <0.05, < P <0.01, < P <0.0001.

FIG. 10 shows the effect of ANP32B on human embryonic stem cell lines (hESCs) by techniques such as transcriptome sequencing (RNA-seq), chromatin accessibility sequencing (ATAC-seq), etc. FIG. 10A is a plot of the change in gene expression between shCTR and shANP32B hESC. Fig. 10B is a volcanic plot showing ATAC-seq difference peaks in shANP32B and shrt hESC. Fig. 10C is a venn plot showing the intersection between the differentially expressed gene in shANP32B and the ATAC-seq differential peak associated gene with the shCTR in hescs. Fig. 10D is a KEGG enrichment pathway analysis of down-regulated (left) and up-regulated (right) genes between shANP32B and shrtrhesc.

FIG. 11 shows the comprehensive analysis of the regulation of chromatin landscape by NAT10-ANP32B signaling axis by transcriptome sequencing (RNA-seq), transposase research chromatin accessibility sequencing (ATAC-seq) and targeted cleavage and transposase (CUT & Tag) techniques. FIG. 11A is a flow chart of a target gene screening procedure downstream of NAT10-ac4C-ANP 32B. FIG. 11B is a Venn diagram showing a comprehensive analysis of identifying potential downstream targets for the NAT10-ANP32B axis. FIG. 11C is a Venn diagram showing the intersection of a differentially expressed gene with a potential ANP32B target. FIG. 11D is a KEGG pathway enrichment analysis of a target downstream of NAT10-ac4C-ANP 32B. FIGS. 11E and 11G are heat maps showing the cases where the ANP32B, ATAC, H3K4me3, and H3K27me3 signals are within the 6kb window of the ANP32B peak. FIGS. 11F and 11H are diagrams of transcription factor binding motifs enriched in C1 (FIG. 11F) and C3 (FIG. 11H). FIG. 11I is an IGV diagram of a representative NAT10-ac4C-ANP32B downstream divalent genes (SFRP 1 and NODAL). Fig. 11J is a graph of CUT & TagqPCR assay for ANP32B binding in shCTR and shNAT10 hESCs and changes in SFRP1 and NODAL loci H3K4me3 and H3K27me3, n=3. Fig. 11K is a multipotent reprogramming assay of shCTR, shSFRP1, or shNODAL lentiviral transfected OTF cells, n=3. * P <0.05, < P <0.01, < P <0.001.

FIG. 12 shows the study of the regulation of cell fate conversion by NAT10-ANP32B by multiple sets of chemical data combinatorial analysis. Fig. 12A is a peak and heat map of ANP32B CUT & Tag in shCTR and shNAT10 hESC. Fig. 12B is a volcanic plot showing the ANP32B CUT & Tag peak differences in shNAT10 and shCTR hESC. Fig. 12C is a genomic profile of shNAT10 down-regulating ANP32B peaks compared to shCTR hESC. Fig. 12D is a volcanic plot showing ATAC-seq difference peaks of shNAT10 and shCTR hESC. FIG. 12E is a genomic profile identifying peaks by comprehensive analysis of ANP32B CUT & Tag and NAT10 ATAC-seq data. Fig. 12F is a venn plot showing the intersection of shNAT10 with shCTR and shANP32B with ATAC-seq difference peaks in shCTR. Fig. 12G is a venn plot showing the overlap of shNAT10 and shCTR in hescs and shrnp 32B and shCTR differentially expressed genes.

Fig. 13 shows that studying the regulation of cell fate conversion by ANP32B through combinatorial analysis of multiple sets of chemical data, ANP32B can play a key role in cell fate conversion in a proximal regulatory manner, etc. FIG. 13A is a genomic distribution of the peak of ANP32B in C1-C4. Fig. 13B and 13C are violin plots showing the difference in abundance of H3K4me3 (fig. 13B) and H3K27me3 (fig. 13C) on the C1-C4 promoter peaks in the shCTR and shNAT10 hESC. FIG. 13D is a heat map of the correlation of changes in the corresponding expressed genes in ANP32B, ATAC, H3K4me3, H3K27me3 and C1-C4. FIGS. 13E and 13F are GO enrichment assays of the genes corresponding to the C1 (FIG. 13E) and C3 (FIG. 13F) peaks. Fig. 13G is a graph of how EZH2 and MLL1 bind to SFRP1 and NODAL gene sites in shCTR, shNAT10 and shANP32B hESC, n=3, as determined by CUT & Tag qPCR. Fig. 13H is a multipotent reprogramming assay of OTF cells treated with DMSO and tgfβ signaling inhibitors, n=3. * P <0.05, P <0.01.

Figure 14 shows the effect of knockdown NAT10 on multiple levels of cell apparent transcriptome modification, chromatin regulation factors, chromatin landscape and cell fate compared to control.

Detailed Description

Through extensive and intensive studies, the present inventors have provided for the first time that N4-cytidylic acid acetylation (ac 4C) modification and NAT10 play an important role in regulating cell fate conversion. Specifically, the invention utilizes a differentiation system based on human pluripotent stem cells, and discovers that NAT10 knockdown can obstruct the process of differentiation of human embryonic stem cell lineages; NAT10 knockdown was found to hinder the process of multipotent reprogramming using the transcription factor OSKM mediated reprogramming system, thereby finding a key role for NAT10 in cell fate regulation. Furthermore, it was found through a large number of experiments that NAT10 knockdown affects the ac4C modification level of chromatin regulators represented by histone chaperone ANP32B, and further affects downstream divalent genes such as SFRP1 and NODAL, thereby achieving a regulation effect on chromatin landscape. Furthermore, to improve the accuracy of detecting ac4C modifications, the inventors developed for the first time to conduct an acrp-seq experiment in a human embryonic stem cell line using a competitive elution format. The present invention has been completed on the basis of this finding.

Description of the terms

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

As used herein, when used in reference to a specifically recited value, the term "about" means that the value can vary no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

As used herein, the term "comprising" or "including" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …," or "consisting of ….

ac4C modification

As used herein, the terms "N4-cytidylic acid acetylation modification", "acetylation modification" and "ac4C modification" are used interchangeably to refer to an acetylation modification at N4 of a cytidylic acid of DNA or RNA. The chemical formula of the N4-cytidylic acid acetylation modification is shown in FIG. 5B.

ac4C modification is the only known acetylation modification of mRNA at present, and studies have shown that ac4C modification improves mRNA stability and translation efficiency. Studies of the present invention show that ac4C modification preferably occurs on a motif of a polynucleotide selected from the group consisting of: (i) cxucxucxucxucu; (ii) CXXCXXCXXCXX; wherein X is any nucleotide selected from A, G, C, U.

NAT10

NAT10 is an ac4C acetyltransferase, the only protein currently demonstrated in human cells to have both acetyltransferase activity and RNA binding capacity.

The research of the invention shows that NAT10 has regulating effect on stem cell differentiation. In one embodiment of the invention, knockdown NAT10 inhibits embryoid body formation during spontaneous differentiation of human embryonic stem cells into embryoid bodies. In another embodiment of the invention, knocking down NAT10 inhibits the differentiation process of pancreatic progenitor cells. In another embodiment of the invention, cells knocked down NAT10 are unable to form teratomas in immunodeficient mice.

Studies of the present invention have also shown that NAT10 plays an important role in multipotent reprogramming. In the invention, based on a transcription factor mediated reprogramming system, the knocking down of NAT10 is found to obviously influence the formation of Induced Pluripotent Stem Cells (iPSC), prevent the induction of CDH1 genes and the inhibition of CDH2 genes in the reprogramming process, lead the failure of the transformation of mesenchyme-epithelium in the reprogramming process and influence the induction of the pluripotent genes.

In the present invention, it was found through extensive quantitative proteomic experimental analysis that NAT10 knockdown mainly affected the expression of 9 chromatin-associated genes, including chromatin regulation factors represented by ANP 32B. Further analysis of regulation of chromatin landscape by the NAT10-ANP32B signaling axis revealed that the bivalent genes SFRP1 and NODAL were important downstream target genes, revealing a link between NAT 10-mediated ac4C modification and ANP 32B-mediated chromatin signaling regulation.

Chromatin regulating factor

Studies of the present invention demonstrate that NAT10 mediated ac4C modification affects cell fate conversion by affecting downstream chromatin regulators. The chromatin regulating factors include ANP32B, ANP32A, ANP32E, ACIN1, HNRNPC, PELP1, PSIP1, RNF20 and PAF1. Studies of the present invention show that transcripts of the chromatin regulator bind to NAT10, and that mRNA stability of the chromatin regulator is affected by NAT10, and that the level or activity of the chromatin regulator is regulated by NAT 10. When NAT10 levels are reduced, the level or activity of the chromatin regulator is down-regulated.

In the invention, through knock-down and re-supplement experiments on the chromatin regulator, the important role of the chromatin regulator in the reprogramming process is revealed, and the chromatin regulator is an important forward regulation factor in the reprogramming process. In the present invention, shRNA whose sequences are shown in table 1 are used to knock down the chromatin regulator.

TABLE 1 shRNA sequences knocking down chromatin regulators

Name of the name	Sequence(s)	Numbering device
			shANP32B	GAAGAATTTGGACTTGATGAA	SEQ ID NO:4
shRNF20	CGGAGGAACTAGACATTAGAA	SEQ ID NO:5
			shANP32A	CCTGAAGATGAGGGAGAAGAT	SEQ ID NO:6
shANP32E	GTATGGCTAATGTGGAACTAA	SEQ ID NO:7

Bivalent gene

As used herein, the term "bivalent gene" is used interchangeably with "bivalent gene" and refers to a gene containing both H3K4me3 and H3K27me3 histone methylation modifications. The research of the invention shows that NAT10 regulates the functions of partial bivalent genes by regulating chromatin regulating factors, including SFRP1, NODAL and other bivalent genes. When NAT10 levels are suppressed, SFRP1 functions are downregulated, while NODAL functions are upregulated.

Inhibition of SFRP1 and NODAL by shRNA was found to affect multipotent reprogramming. shRNA sequences that inhibit SFRP1 and NODAL are shown below:

TABLE 2 shRNA sequence of knockdown bivalent Gene

Name of the name	Sequence(s)	Numbering device
			shSFRP1	CGAGATGCTTAAGTGTGACAA	SEQ ID NO:8
shNODAL	GCGGTTTCAGATGGACCTATT	SEQ ID NO:9

Inhibitors of N4-cytidylic acid acetylation (ac 4C) modification

As used herein, inhibitors of N4-cytidylic acid acetylation (ac 4C) modification are inhibitors capable of reducing the degree of N4-cytidylic acid acetylation modification on a polynucleotide, including, but not limited to, interfering RNAs, gene editing agents, and chemical small molecule inhibitors.

Typically, the ac4C inhibitor is a NAT10 inhibitor, including but not limited to siRNA targeting NAT10, shRNA targeting NAT10, gene editing agents that specifically knock out NAT10, chemical small molecule inhibitors targeting NAT 10.

In one embodiment of the invention, the NAT10 inhibitor is a shRNA targeting NAT 10.

Preferably, the shRNA targeting NAT10 is selected from the group consisting of:

(1)shNAT10-1：GAGATGTATTCACGGAATATG(SEQ ID NO:1)；

(2)shNAT10-2：CGGCCATCTCTCGCATCTATT(SEQ ID NO:2)。

in one embodiment of the invention, the NAT10 inhibitor is a gene editing agent that specifically knocks out NAT10, comprising: cas9 protein and sgrnas. Preferably, the sequence of the sgrnas is as follows: GTGAGTTCATGGTCCGTAGG (SEQ ID NO: 3).

In one embodiment of the invention, the NAT10 inhibitor is a chemical small molecule inhibitor that targets NAT10, such as Remodelin.

Application of

The present invention provides the use of an inhibitor of N4-cytidylic acid acetylation (ac 4C) modification for one or more uses selected from the group consisting of:

(1) Inhibiting activity or level of a chromatin regulating factor;

(2) Regulating the function of bivalent genes;

(3) Inhibiting the differentiation process of stem cells;

(4) Inhibit the reprogramming process of somatic cells.

In the present invention, the ac4C modified inhibitors may down-regulate the activity and level of chromatin regulating factors. In NAT10 knockdown cell lines, the level of ac4C modification on the mRNA of the chromatin regulator was reduced, and the stability of the mRNA was significantly reduced, and the expression level of the chromatin regulator was significantly reduced. Representative of said chromatin regulating factors are selected from the group consisting of: ANP32B, ANP32A, ANP E, ACIN1, HNRNPC, PELP1, PSIP1, RNF20 and PAF1.

In the present invention, the ac4C modified inhibitor may regulate the function of a bivalent gene. Based on the regulation of the chromatin regulator by NAT10, further studies of the relevant role of the representative chromatin regulator ANP32B in chromatin remodeling and transcriptional regulation have found that the NAT10-ANP32B axis can regulate the function of bivalent genes, including but not limited to the SFRP1 and NODAL genes. The ac4C modified inhibitors may up-regulate the function of the NODAL gene and down-regulate the function of the SFRP1 gene.

In the present invention, the ac4C modified inhibitor may inhibit the progress of differentiation of stem cells including, but not limited to, spontaneous differentiation, directed differentiation, lineage differentiation. In one embodiment of the invention, the ac4C modified inhibitor may inhibit spontaneous differentiation of human embryonic stem cells into embryoid bodies. In one embodiment of the invention, the ac4C modified inhibitor may inhibit the directional differentiation of human embryonic stem cells into definitive endoderm and pancreatic precursor cells.

In the present invention, the ac4C modified inhibitor can inhibit the reprogramming process of somatic cells. In transcription factor induced pluripotent reprogramming systems, knocking down NAT10 results in failure of reprogramming intermediate mesenchymal-epithelial transitions, suppressing induction of pluripotent genes, significantly reducing the cloning of induced pluripotent stem cells (ipscs) and the proportion of ipscs.

The invention also provides the use of a NAT10 protein or an enhancer thereof for one or more uses selected from the group consisting of:

(1) Promoting activity or level of a chromatin regulator selected from the group consisting of: ANP32B, ANP32A, ANP E, ACIN1, HNRNPC, PELP1, PSIP1, RNF20 and PAF1;

(2) Regulating the function of bivalent genes; the adjusting includes: down-regulating the function of NODAL gene and up-regulating the function of SFRP1 gene.

(3) Promoting the differentiation process of stem cells;

(4) Promote the reprogramming process of somatic cells.

The invention also provides a method for regulating and controlling the fate of the pluripotent stem cells in vitro, which comprises the following steps: culturing pluripotent stem cells in the presence of an inhibitor of N4-cytidylate acetylation (ac 4C) modification, thereby regulating the differentiation process of the pluripotent stem cells.

Detection of N4-cytidylic acid acetylation of mRNA

N4-Cytidylic acid acetylation (ac 4C) modification is typically determined using an acetylated co-immunoprecipitation (acrP-seq) technique for assay experiments. Detection of ac4C modification of mRNA results in difficult measurement due to low abundance of the modification. The traditional determination method is that the obtained RNA is beaten into small fragments of about 100 nt; performing co-immunoprecipitation using an ac 4C-specific antibody, and extracting an RNA fragment containing the ac4C modification; further library construction, high throughput sequencing and bioinformatics analysis of the recovered RNA was performed to identify ac4C modified sites by peak analysis.

The present invention provides an improved method for detecting N4-cytidylic acid acetylation of mRNA, comprising the steps of:

(1) Providing a polynucleotide sample to be detected for mRNA acetylation, co-immunoprecipitation with an ac4C specific antibody to form an ac4C specific antibody-ac 4C modified mRNA complex; preferably, the ac 4C-specific antibody is conjugated to a magnetic bead.

(2) Isolating the antibody-ac 4C modified mRNA complex; preferably, the separation is carried out by magnetic field

(3) Performing a competitive elution treatment in the presence of ac4CTP, thereby dissociating the ac 4C-specific antibody from the complex and releasing ac 4C-modified mRNA;

(4) Isolating the released ac4C modified mRNA; preferably by precipitation; and

(5) The site of ac4C modification was identified by Peak analysis for the isolated mRNA.

Preferably, in step (3), the final concentration of ac4CTP is 5-20mM, preferably 6-10mM, more preferably about 6-8mM.

A schematic of the method is shown in fig. 6A. In the method, ac4CTP monomer nucleosides are adopted for competitive elution, so that the combination of the antibody and ac4C is more specific, the interference of RNA fragments which are non-specifically combined with the antibody on experiments is effectively reduced, and the accuracy of the identified ac4C modified genes is improved.

The main advantages of the invention include:

(1) The invention discloses the regulation and control effect of NAT10 mediated ac4C modification in the cell differentiation and multipotent reprogramming process for the first time, and provides the application of an ac4C modification inhibitor.

(2) The invention firstly reveals that the chromatin regulating factor is a downstream target gene of NAT10 mediated ac4C modification, the bivalent genes SFRP1 and NODAL are downstream target genes of the chromatin regulating factor, and firstly establishes the connection between the apparent transcriptomic modification represented by the ac4C modification and the chromatin signal regulation mediated by the chromatin regulating factor.

(3) According to the invention, the acRIP-seq experiment is carried out by a competitive elution mode for the first time, so that the interference of the RNA fragment of the non-specific binding of the antibody to the experiment is effectively reduced, and the authenticity of the identified ac4C modified gene is improved, thereby further promoting the research of mRNA ac4C modification.

(4) The invention can be applied to the research of developing a new cell fate conversion method and regenerative medicine.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Percentages and fractions are weight percentages and weight fractions unless otherwise indicated.

Interpretation of the terms

hPSC: human pluripotent stem cells

hESC: human embryonic stem cells

iPSC: induction of pluripotent stem cells

EB: embryoid body

DE: definitive endoderm cells

PP: islet precursor cells

MEF: mouse embryo fibroblast

OTF: human fibroblasts

shNAT10: NAT10 knockdown human embryonic stem cell line

shANP32B: ANP32B knockdown human embryonic stem cell line

tdTomato: tandem dimer tomato fluorescent protein

AP: alkaline phosphatase

KEGG: kyoto Gene and genome encyclopedia

GO: gene ontology

ac4C: n4-acetylcytidine

MET: mesenchymal-epithelial transition

LC-MS/MS: liquid chromatography-tandem mass spectrometry

RT-qPCR: reverse transcription-quantitative polymerase chain reaction

acrp: co-precipitation of acetylated RNA binding proteins

FACS: flow fluorescent cell sorting

Tgfβ: transforming growth factor beta

Method

1. Cell culture

Human embryonic stem cells (hescs) were cultured in hESC medium: DMEM/F12, 20% knockout serum replacement, 1 Xnonessential amino acids, 1 Xpenicillin/streptomycin, 0.055mM 2 mercaptoethanol and 10ng mL ^-1 bFGF. Human fibroblasts were differentiated from the H9hESC cell line containing OCT 4-tandem dimeric tomato fluorescent protein (tdmamato) reporter gene. OTF cells were cultured in DMEM, 10% fetal bovine serum, 1 x penicillin-streptomycin and 250 μm vitamin C. Cells were periodically tested for mycoplasma.

OP-Puro and EdU incorporation assays

To measure protein synthesis or DNA synthesis rates, hESCs were incubated in hESC medium for 1 hour and supplemented with O-propargyl puromycin (OP-Puro) or EdU. After digestion with 0.05% trypsin, the samples were fixed with 4% paraformaldehyde for 10 min at room temperature and washed 3 times with PBST shaking at 1500rpm for 5 min each. According to the description, beyoClick with Alexa Fluor 555 (Beyotime) was used ^TM The EdU cell proliferation kit carries out OP-Puro or EdU labeling and detection on hESCs.

3. Knock-down experiments

Lentiviral vectors (plko.1) carrying target or control shRNA were transfected into HEK293T cells maintained in DMEM medium using Lipofectamine 3000 transfection reagent. Viruses were collected and filtered 48 hours and 72 hours post-transfection. The lentiviral infection method for hESCs is as follows: viruses and basal medium were added to 60% -70% density hESCs at a 1:1 ratio. In addition, the concentration of the added polybrene infecting agent was 5ug mL ^-1 . After 4h, the hESC medium was changed to culture the cells. For cell collection, hescs transfected with different shRNA were digested with 0.05% trypsin. Cell samples were then collected for western blot or RT-qPCR analysis. On day 2 of reprogramming, OTF cells were subjected to lentiviral transfection encoding shRNA of the targeted or control group. The sgRNA sequence was designed by CHOPCHOP and the transfection procedure was identical to shRNA. After 24 hours, OTF cells were re-transfected.

4. Reprogramming and reprogramming efficiency assessment of OTF cells using hRep medium

hRep medium: DMEM basal medium, 10% ksr, 10% fbs1X nonessential amino acids, 1X penicillin/streptomycin, 0.055mM 2-mercaptoethanol, 10ng mL ^-1 bFGF, 0.5mM VPA, 10. Mu.M 616452, 0.5. Mu.M AM580, 5. Mu.M EPZ004777, 5. Mu.M forskolin, 0.2. Mu.M PD0325901 and 2. Mu.g mL ^-1 Doxycycline. The medium was changed every 2 days. After 12 days of reprogramming, the number of OCT 4-tdbitmap positive clones and AP positive clones was counted.

5. Lineage differentiation

For embryoid body differentiation assays, hescs were digested by scraping and blowing and then transferred into low-adsorption 6-well plates.

For definitive endoderm differentiation, hescs were inoculated onto 6-well plates and cultured in differentiation medium for 3 days and used for immunofluorescent staining analysis or sampling for RT-qPCR detection. The differentiation medium was as follows: day 1: RPMI, 1 Xpenicillin-streptomycin, 100ng mL-1activin A and 3uM CHIR99021; day 2: RPMI, 1 Xpenicillin-streptomycin, 0.2% FBS and 100ng mL ^-1 activin a; day 3: RPMI, 1 Xpenicillin-streptomycin, 2% FBS and 100ng mL ^-1 activin A。

Pancreatic differentiation medium was as follows: day 1-3: the culture medium is the same as the definitive endoderm differentiation medium. Day 4-6: RPMI, 0.5 XB 27, 0.5 XN 2, 0.05% BSA, 1 Xpenicillin/streptomycin and 50ng mL-1KGF. Day 7-8: DMEM, 1 XB 27, 0.05% BSA, 1 Xpenicillin/streptomycin, 0.25mM vitamin C, 50ng mL ^-1 KGF, 0.1. Mu.M LDN-193189, 0.1. Mu.M GDC-0449 and 2. Mu.M retinoic acid. Day 9-14: DMEM, 1 XB 27, 0.05% BSA, 1 Xpenicillin/streptomycin, 0.25mM vitamin C, 0.1. Mu.M LDN-193189 and 50ng mL ^-1 EGF。

6. Ac4C detection and quantification by mass spectrometry

In the presence of 20mM CH ₃ COONH ₄ About 1. Mu.g of total RNA or 2. Mu.g of poly (A) RNA was digested by nuclease P1 at 42℃for 2 hours in 30. Mu.L of buffer. Then, 10 Xbacterial alkaline phosphatase buffer and 4U/10. Mu.g bacterial alkaline phosphatase were added and treated at 37℃for 2 hours. After digestion, the sample was subjected to centrifugal filtration to remove the enzyme components. The nucleosides were separated by C18 chromatography column and passed through SCIEX,quadrupole LC mass spectrometers of 6500+lc-MS/MS triple450 detect nucleosides in positive electrospray ionization mode. Nucleosides were quantified by using nucleoside-to-base ion mass transitions of 286.1 to 154.1 (ac 4C) and 244.1 to 112.0 (C). Quantification was performed by standard curves obtained with pure nucleoside standards run on the same batch of samples. The ratio of ac4C to C was calculated from the calibration concentration.

7. In vitro transcription

In vitro transcription was performed by PCR using DNA oligonucleotides with ac4C positive and negative probes of the T7 promoter as templates for in vitro transcription. In vitro transcription was performed according to the HiScribe T7 Yield RNA synthesis kit protocol. When synthesizing ac4C positive probes, ac4CTP was used instead of CTP. The transcript was digested with DNaseI at 37℃for 1 hour to remove the template DNA, and then purified using RNA clean & concentrator-25 kit.

Ac4C acetylation assay of mRNA

The acetylation of mRNA was detected using the improved ac4C detection method of the present invention. Mu.g of ac4℃ antibody was pre-conjugated to 25. Mu.L Dynabeads protein G (Invitrogen) at room temperature, followed by mixing 4pg of ac4℃ positive and ac4℃ negative probes in 4. Mu.g of fragmented mRNA and incubating with antibody pre-coated protein G beads in IP buffer at 4℃for 4 hours (10 mM Tris-HCl,150mM NaCl and 0.1% (v/v) Igepal CA-630). The RNA-antibody-microbead complex was then washed 3 times with IP buffer and finally the RNA containing ac4C was eluted with 7mM ac4CTP nucleoside competition. UsingStranded Total RNA-Seq Kit v2 (Takara) library construction was performed on Inupt and IP samples.

Example 1: NAT10 has wide regulating effect on human embryo stem cell characteristics

To determine the role of NAT10 in stem cell biology, the inventors examined the relative expression levels of NAT10 during multipotent reprogramming and embryoid body differentiation and applied short hairpin RNA (shRNA) -based approaches to knockdown NAT10 in stem cells, as shown in fig. 2A for experimental schematic. And knocking down NAT10 by shRNA shown in SEQ ID NO. 1 and SEQ ID NO. 2 respectively to obtain two stem cell lines knocked down by NAT10, which are named shNAT10-1 and shNAT10-2. And (3) respectively carrying out analysis on clone formation, proliferation, transcription spectrum, epigenetic landscape and the like on the embryo stem cells (shNAT 10-1 and shNAT 10-2) knocked down by NAT10 and the embryo stem cells (shCTR) of a control group which are not knocked down. The results are shown in fig. 1 and 2.

The relative expression levels of NAT10 during differentiation and reprogramming are shown in fig. 1A and 1B, showing that NAT10 expression is very dynamic during cell fate conversion.

After knocking down NAT10 in stem cells with shRNA, the decrease in NAT10 protein level in the shRNA 10 stem cell line was confirmed by immunoblotting (fig. 1C). Further, the decrease in the expression level of NAT10 in the nucleus was confirmed by immunofluorescent staining (fig. 1D).

The detection of the expression levels of the pluripotency marker genes such as OCT4, NANOG and SOX2 revealed that the expression levels of OCT4, NANOG and SOX2 were not significantly changed in the NAT10 knockdown human embryonic stem cell line (fig. 1E and 1F).

Examination of the proliferation potency of each group of embryonic stem cells revealed that knocking down NAT10 resulted in an influence on the clonogenic ability of stem cells and a significant decrease in the proliferation rate of stem cells (fig. 2B and C). In addition, NAT10 knockdown embryonic stem cell lines significantly decreased in DNA and protein synthesis rates, and embryonic stem cells entered a resting-like state (fig. 2D and 2E). Co-immunoprecipitation combined with mass spectrometry experiments further showed that the interaction proteins of NAT10 in embryonic stem cells are enriched in GO pathways such as ribosome synthesis and cell cycle (fig. 1G). The above data shows that knocking down NAT10 in embryonic stem cell lines brings stem cells into a resting-like state.

The function of NAT10 in embryonic stem cells was further identified by transcriptome sequencing (RNA-seq). 1872 up-regulated genes and 1538 down-regulated genes were identified in the NAT10 knockdown cell line. Through KEGG analysis and GO analysis, up-regulated genes were found to be concentrated in the p53 signaling pathway, negative cell cycle regulation and apoptosis (fig. 2F and 2H), partially explaining the effect on embryonic stem cell proliferation caused by inhibition of NAT 10. Down-regulated gene enrichment in glycolysis, the Hippo signaling pathway and the Wnt signaling pathway (FIGS. 2G and 2I), suggests that NAT10 may play a role in cell fate decisions of pluripotent stem cells.

Epigenetic landscape has a great correlation with the developmental capacity of embryonic stem cells, and in particular, H3K4me3 and H3K27me3 are closely related to the activation and inhibition of genes. In addition, the bivalent nature of the gene (the gene containing both H3K4me3 and H3K27me 3) is one of the important epigenetic characteristics of embryonic stem cells, affecting the development of embryonic stem cells. Therefore, the influence of knockdown NAT10 on H3K4me3 and H3K27me3 histone modification on embryonic stem cells is detected, and the influence of knockdown NAT10 on chromatin landscape is found to be closely related to gene expression. Divalent genes are also affected by NAT10 knockdown, and these genes are enriched in GO pathways such as signal transduction, wnt signaling pathway regulation, cell differentiation, etc. (fig. 2J and 2K).

The experimental results show that NAT10 plays an important role in proliferation and epigenetic signal regulation.

Example 2: NAT10 is an important lineage differentiation regulator

In view of the wide influence of NAT10 knockdown on embryonic stem cell gene regulation and histone modification, further research is carried out on the development characteristics of a human embryonic stem cell line knocked down NAT10, and an experimental schematic diagram is shown in fig. 3A, wherein ES is an embryonic stem cell, EB is an embryoid body, DE is a definitive endoderm cell and PP is an islet precursor cell. The results are shown in fig. 3 and 4.

First, NAT10 knockdown was found to severely affect embryo normal formation by embryoid body differentiation, demonstrating the important role of NAT10 on spontaneous differentiation (fig. 3B).

Next, by applying an experimental protocol that directly induced islet precursor cells, it was found that knocking down NAT10 did not affect SOX17 and FOXA2 biscationic cell production at the definitive endoderm differentiation stage (fig. 4A and 4B). Whereas knockdown of NAT10 had a significant effect on pancreatic differentiation after definitive endoderm differentiation (fig. 3C). It was observed that knockdown of NAT10 significantly affected the expression of PDX1 and NKX6.1 in pancreatic progenitor cells. By RT-qPCR, it was further confirmed that the expression of key pancreatic progenitor marker genes, such as PDX1, NKX6.1, SOX9 and HNF6, were significantly down-regulated in NAT10 knockdown cell lines (fig. 3D).

In addition, NAT10 knockdown embryonic stem cell line development potential was further explored by in vivo teratoma formation experiments. The results showed that NAT10 knockdown cells were unable to form teratomas in immunodeficient mice compared to control cells (fig. 4C).

The experimental results show that NAT10 has significant effects on each stage of spontaneous differentiation and directional differentiation.

Example 3: NAT10 is an essential factor for multipotent reprogramming

In order to further explore the important role of NAT10 in cell fate transformation, a transcription factor OSKM-induced multipotent reprogramming system was applied, and the role of NAT10 in multipotent reprogramming was examined, and the experimental schematic diagram is shown in FIG. 3E. The results are shown in fig. 3 and 4.

Inhibition of NAT10 expression by shRNAs significantly affected Alkaline Phosphatase (AP) and OCT4 positive formation of Induced Pluripotent Stem Cell (iPSC) clones (fig. 3F and 3G).

It was further confirmed by fluorescence sorting by flow cytometry (FACS) experiments that the OCT4 positive cell fraction was significantly down-regulated in reprogrammed cells after knocking down NAT10 (fig. 4D).

Knock-down of NAT10 was found to prevent induction of CDH1 gene and inhibition of CDH2 gene during reprogramming by RT-qPCR experiments, demonstrating failure of reprogramming the intermediate mesenchymal-epithelial transition (fig. 3H). In addition, induction of pluripotency genes OCT4, SOX2, NANOG, and SALL4 was also significantly inhibited after NAT10 knockdown (fig. 3I). At the same time, a similar phenotype was also observed with knock-down of NAT10 by sgRNA (fig. 4E to 4J).

Finally, the generation of AP and OCT4 positive clones can be significantly affected as well by targeting the small chemical molecule Remodelin of NAT10 after treatment of the cells, impeding MET transformation, and at the same time, being able to affect the induction of the pluripotency gene (fig. 4K to 4Q).

The above results demonstrate that NAT10 knockdown affects the process of multipotent reprogramming, together with elucidation of the important role that NAT10 plays in multipotent reprogramming.

Example 4: NAT10 regulates ac4C modification level in embryonic stem cell mRNA

To further investigate the presence of ac4C modification in embryonic stem cell mRNA, a stable liquid chromatography-tandem mass spectrometry (LC-MS/MS) platform was established (as shown in fig. 5A). First, the poly (A) RNA was enriched by oligo d (T) twice, contamination of rRNA was removed, and rRNA residue was further verified by 18S rRNA (FIG. 5C).

The results showed that the levels of ac4C modification on total and poly (a) RNAs of human embryonic stem cells were 0.26% and 0.09%, respectively (fig. 5D). The poly (a) RNA ac4C modification level in human embryonic stem cells was higher than that of cells after differentiation of fibroblasts and embryoid bodies (fig. 5E).

The level of ac4C modification on total RNAs was significantly reduced upon NAT10 knockdown by shRNA (fig. 5F and 5G). Consistently, knockdown of NAT10 resulted in a nearly 60% decrease in ac4C modification levels on human embryonic stem cell poly (a) RNA (fig. 4G and 4H).

Example 5: alignment of ac4C modifications in human embryonic stem cells

To identify potential targets for NAT10 and explore the effect of ac4C modification on cell fate decisions, an acrp-seq experiment was performed. The competition elution mode is adopted to carry out an acRIP-seq experiment, and an experimental schematic diagram is shown in FIG. 6A. The experimental results are shown in fig. 6 and 7.

The results showed that ac4C positive probes appeared to be significantly enriched after ac4C co-immunoprecipitation compared to negative probes (fig. 6B). Overall, 2321 and 1492 ac4C modified peaks were identified in the shCTR and shNAT10 human embryonic stem cell lines, respectively, with 889 overlapping peaks (fig. 6C and 6D and fig. 7A). For example, CCDC34 and POU5F1 represent the high and non-acetylated sites, respectively (fig. 6E). In addition, a total of about 75% of the acetylation sites are located in the gene coding region (FIGS. 6F and 6G).

Further analysis found that although the extent of modification of ac4C by NAT10 was different after using shrt and shrat 10, the most significant ac4C modification motif after NAT10 catalysis was essentially identical, being "CXUCXUCXUCXU", and other similar motifs were enriched (fig. 6H and 7B).

The results showed that the distribution of ac4C modifications on the chromosome and the distribution of the gene did not show correlation, and that the ac4C modifications were more stable on the distribution gene, and that most ac4C modification sites remained after NAT10 knockdown (fig. 7C). These ac4C sites were significantly enriched in ribosomes, scissores and proteasomes (fig. 6I).

To explore the effect of NAT10 knockdown on precursor mRNA cleavage, the percent cleavage (PSI) and Percent Intron Retention (PIR) on shrt and shrat 10 embryonic stem cells, respectively, were calculated. A slight decrease in PSI was found in shNAT10 cells, indicating some effect of NAT10 knockdown on exon inclusion/exclusion (fig. 6J). PIR values were found to rise significantly after NAT10 knockdown, indicating that NAT10 knockdown significantly affected the clipping efficiency (fig. 6K). These data indicate that NAT10 can affect pre-mRNA cleavage by targeting cleavage-related genes.

Next, ac4C abundance was found to be significantly reduced in shNAT10 embryonic stem cells, consistent with these previous LC-MS/MS assays (fig. 6L). In addition, the difference peak analysis results showed that there were a total of 143 modified down-peaks and one modified peak after knocking down NAT10 (fig. 6M). Functional enrichment analysis showed that the genes corresponding to these downpeaks were enriched in the pathways of the scissoring, ribosome synthesis etc. (FIGS. 7D and 7E).

Overall, a significant decrease in mRNA ac4C modification levels after NAT10 knockdown was found by the acrp-seq experiment and further affected pre-mRNA cleavage and translation.

Example 6: chromatin regulation factor is an important downstream target gene for NAT10

To further identify functional targets downstream of NAT 10-regulated cell fate conversion, extensive quantitative proteomic experimental analysis was performed. FIG. 9A shows that the protein changes and the gene expression pattern have a correlation, indicating that the protein level changes and the mRNA level changes are correlated. 519 up-regulatory proteins and 541 down-regulatory proteins were identified by differential protein analysis, respectively (fig. 8A and 9B). Downregulated proteins were found to be predominantly enriched in chromatin-associated pathways, such as chromatin tissue, SWI/SNF superfamily complexes, chromatin remodeling and nucleosome tissue, by enrichment pathway analysis (fig. 8B). Further identified were 12 candidate target genes by combinatorial analysis of the down-regulated protein after NAT10 knockdown and ac4C down-regulated peak corresponding genes, 9 of which were chromatin-associated, including ANP32B, ANP32A, ANP32E, ain 1, HNRNPC, PELP1, PSIP1, RNF20 and PAF1 (fig. 8B and 8C and fig. 9C). These targets were further validated by reprogramming experiments. The results showed that, among these several candidate target genes, chromatin regulators represented by ANP32B were the most important forward regulators for reprogramming (fig. 9D).

The consistent phenotype of NAT10 and ANP32B also suggests that ANP32B is an important target downstream of NAT 10. Thus, the effect of ANP32B on cell fate conversion was explored, and the results are shown in fig. 8 and 9.

It was first confirmed that the ANP32B peak signal significantly decreased after NAT10 knockdown (fig. 8D). The decrease in the level of ac4C modification on ANP32B after NAT10 knockdown was further confirmed by ac4C-RIP-qPCR experiments (FIG. 8F). In addition, direct binding of NAT10 protein to ANP32B transcripts was confirmed by NAT10-RIP-qPCR experiments (fig. 9F). Through RNA stability analysis, the mRNA stability of ANP32B was found to drop significantly after NAT10 knockdown (fig. 8G). Immunoblot experiments also further showed a significant decrease in ANP32B levels in NAT10 knockdown cell lines (fig. 8H). Together, these results illustrate the correlation of ac4C modifications on NAT10 and ANP 32B.

To further determine the cell fate transformation of ANP32B in knocking down NAT10, ANP32B knockdown and back-fill experiments were performed. First, it was confirmed that inhibition of ANP32B affected the production of induced pluripotent stem cells after reprogramming (fig. 8I). RNA-seq and RT-qPCR experiments showed that knockdown of ANP32B prevented mesenchymal-epithelial transformation and prevented induction of pluripotency-related genes (FIGS. 9F and 9G). In particular, down-regulated differential genes were enriched in multipotent stem cell regulated, PI3K-Akt signaling pathway (fig. 9H). Knocking down ANP32B also affected proliferation of human embryonic stem cells (fig. 8J and 9I). Next, the effect of knockdown ANP32B on stem cell differentiation potential was further examined by EB differentiation experiments. Knocking down ANP32B was found to block normal embryogenesis, suggesting the importance of ANP32B for embryonic stem cell differentiation (fig. 8K). In addition, ectopic expression experiments showed that over-expression of ANP32B was able to partially rescue the phenotype of knockdown NAT10 in multipotent reprogramming, cell proliferation and differentiation (fig. 8L and fig. 9J and 9K).

The above data indicate that ANP32B is a downstream functional target of NAT10-ac4C axis important in cell fate conversion.

Example 7: NAT10-ac4C-ANP32B axis regulated chromatin landscape

The role of the histone chaperone ANP32B in chromatin remodeling and transcriptional regulation was further investigated. First, through RNA-seq and ATAC-seq, ANP32B was found to play an important role in gene expression and chromatin accessibility regulation in human embryonic stem cells (FIGS. 10A-10D).

To further confirm the role of the NAT10-ac4C-ANP32B axis in chromatin landscape regulation, CUT & Tag, ATAC-seq and RNA-seq data were analyzed in combination (FIG. 11A). First, the chromatin binding of ANP32B in shCTR and shNAT10 hESCs was identified by CUT & Tag. The peak of ANP32B was found to decrease significantly after NAT10 knockdown (fig. 12A and 12B). A total of 5349 ANP32B downpeaks were identified, 60% of which were located in the promoter and genome (fig. 12C), suggesting that ANP32B may be more prone to regulate gene expression in a proximally regulated manner. Subsequently, the effect of ANP32B binding on chromatin accessibility was further studied, and by comprehensive analysis of CUT & Tag data knockdown ANP32B and ATAC-seq data knockdown NAT10, a total of 961 closed sites and 1731 open sites were identified, with approximately 57% closed sites and 55% open sites located in the promoter region (fig. 11B and fig. 12D and 12E), further demonstrating that ANP32B binds primarily to proximal regulatory elements regulating gene expression. Next, 243 down-regulated target genes and 548 up-regulated target genes were identified further in combination with the RNA-seq data (fig. 11C). Wherein, down-regulating target genes are enriched in Wnt signaling pathway and MAPK pathway, while up-regulating target genes are enriched in p53 signaling pathway and TNF signaling pathway, etc. (fig. 11D). It was also observed that ANP32B knockdown human embryonic stem cells and NAT10 knockdown human embryonic stem cells showed a certain correlation in gene expression changes and chromatin accessibility changes, further demonstrating that NAT10 and ANP32B are related in terms of molecules and functions that regulate cell fate transformation (fig. 12F and 12G).

Next, the influence of the NAT10-ac4C-ANP32B axis on the chromatin state and the like was further comprehensively analyzed. The NAT10-ac4C-ANP32B axis downstream sites are classified into four classes based on binding and chromatin state changes of ANP 32B. It was found that in class 1 and class 3 sites, about 80% of the ANP32B binding region was located in the promoter region and showed more pronounced H3K4me3 and H3K27me3 histone modifications and changes in gene expression (fig. 13A to 13D). It was further found that ANP32B mediated, in part, regulation of chromatin landscape by NAT10 (fig. 11E to 11H and fig. 13E and 13F). For example, target genes downstream of NAT10-ANP32B with inhibitory chromatin landscape are enriched for motifs such as KLF4 and LEF1 and are associated with Wnt signaling pathway and epigenetic mediated gene regulation (fig. 11E and 11F and 13E). Whereas target genes downstream of NAT10-ANP32B with activating chromatin landscape are enriched in JUN-AP1 and AP-2gamma and are associated with interferon type one production (FIGS. 11G and 11H and 13F). Importantly, the identification of a range of bivalent genes, including SFRP1 and NODAL (Wnt signaling pathway and important regulator of TGF-beta signaling pathway), is

The downstream gene of NAT10-ac4C-ANP32B axis (FIGS. 11I and 11J and FIGS. 10A and 10C). In addition, the NAT10-ANP32B axis was found to alter the binding of methyltransferases MLL1 and EZH2 of H3K4me3 and H3K27me3 at these sites (FIG. 13G). Functionally, inhibition of SFRP1 and NODAL was found to be able to affect multipotent reprogramming (fig. 11K and 13G). Taken together, these findings are consistent with the role of NAT10 and ANP 32B.

Overall, experimental results indicate that inhibition of NAT10 affects ac4C abundance of chromatin-associated genes (e.g., ANP 32B), and that the NAT10-ac4C-ANP32B axis affects chromatin status and gene regulation networks of downstream target genes (e.g., SFRP1 and NODAL), thereby widely regulating cell fate transitions such as cell reprogramming and stem cell differentiation.

Discussion of the invention

Experiments prove that NAT10 mediated ac4C modification is important for cell fate regulation such as stem cell differentiation and cell reprogramming. The inventors have for the first time found that NAT10 mediated modification of mRNA ac4C is involved in a number of important biological processes such as chromatin remodeling, splicing, ribosomes and metabolism. Furthermore, the inventors have used the important cell fate conversion research system of hESC, and found that NAT10 knockdown affects hESC proliferation as well as spontaneous and committed lineage differentiation. Furthermore, NAT10 plays a critical role in multi-energy reprogramming. Therefore, NAT10 has a wide range of importance for various biological processes.

Notably, the present inventors have also discovered that epigenetic regulators, including ANP32B, are key downstream substrates for NAT 10. Through multiple assays and comprehensive analyses, the NAT10-ac4C-ANP32B axis was found to regulate the chromatin landscape of its downstream genes, including Wnt and TGFβ, which are critical signaling pathways for cell fate decisions, further explaining the broad function of NAT10 in stem cell differentiation and somatic reprogramming.

Overall, the inventors have discovered for the first time that NAT10-ac4C has not previously recognized a role in cell fate switching (including reprogramming and differentiation), can be used to study cell plasticity, and can advance the development of regenerative medicine.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Claims (10)

1. Use of an inhibitor of n 4-cytidylate acetylation (ac 4C) modification for the preparation of a formulation or composition for one or more uses selected from the group consisting of:

   (a) Inhibiting the activity or level of a chromatin regulator selected from the group consisting of: ANP32B, ANP32A, ANP E, ACIN1, HNRNPC, PELP1, PSIP1, RNF20 and PAF1;

   (b) Regulating the function of the bivalent gene;

   (c) Inhibiting the differentiation process of stem cells;

   (d) Inhibit the reprogramming process of somatic cells.
2. 2. The use of claim 1, wherein the inhibitor of N4-cytidylic acid acetylation (ac 4C) modification comprises a NAT10 inhibitor.
3. 3. The use according to claim 1, wherein the bivalent gene is a gene containing both H3K4me3 and H3K27me 3.
4. 4. The use of claim 1, wherein the modulating the function of a bivalent gene comprises:

   (i) Upregulating a divalent gene selected from the group consisting of: NODAL;

   (ii) Down-regulating a divalent gene selected from the group consisting of: SFRP1.
5. 5. The use of claim 1, wherein the differentiation of the stem cells comprises spontaneous differentiation, directed differentiation, or a combination thereof.
6. 6. Use of a NAT10 protein or an enhancer thereof for the preparation of a formulation or composition for use in one or more of the following purposes selected from the group consisting of:

   (a) Promoting activity or level of a chromatin regulator selected from the group consisting of: ANP32B, ANP32A, ANP E, ACIN1, HNRNPC, PELP1, PSIP1, RNF20 and PAF1;

   (b) Regulating the function of the bivalent gene;

   (c) Promoting the differentiation process of stem cells;

   (d) Promote the reprogramming process of somatic cells.
7. 7. A method of detecting N4-cytidylate acetylation (ac 4C) of mRNA, comprising:

   (1) Providing a polynucleotide sample to be detected for mRNA acetylation, co-immunoprecipitation with an ac4C specific antibody to form an ac4C specific antibody-ac 4C modified mRNA complex;

   (2) Isolating the antibody-ac 4C modified mRNA complex;

   (3) Performing a competitive elution treatment in the presence of ac4CTP, thereby dissociating the ac 4C-specific antibody from the complex and releasing ac 4C-modified mRNA;

   (4) Isolating the released ac4C modified mRNA; and

   (5) The site of ac4C modification was identified by Peak analysis for the isolated mRNA.
8. 8. A method of assessing whether an RNA molecule is a substrate for a NAT10 protein comprising the steps of:

   (a) Searching for the sequence of the RNA molecule for the presence of an ac4C modification motif selected from the group consisting of:

   (i)CXUCXUCXUCXU

   (ii)CXXCXXCXXCXX

   x is any nucleotide selected from A, G, C, U;

   wherein the presence of the ac4C modification motif indicates a high probability of the RNA becoming a substrate for the NAT10 protein.
9. 9. The method of claim 8, wherein the method further comprises the step of:

   (b) Mixing a polynucleotide with a NAT10 protein and detecting whether an ac4C modification has occurred in a nucleotide sequence corresponding to the ac4C modification motif in the polynucleotide; wherein the occurrence of an ac4C modification indicates that the polynucleotide is a substrate for a NAT10 protein.
10. 10. A method for regulating pluripotent stem cell fate in vitro comprising the steps of: culturing pluripotent stem cells in the presence of an inhibitor of N4-cytidylate acetylation (ac 4C) modification, thereby regulating the differentiation process of the pluripotent stem cells.