CN117802262B - SNP molecular marker closely linked with pumpkin soluble sugar character and application thereof - Google Patents
SNP molecular marker closely linked with pumpkin soluble sugar character and application thereof Download PDFInfo
- Publication number
- CN117802262B CN117802262B CN202311592386.5A CN202311592386A CN117802262B CN 117802262 B CN117802262 B CN 117802262B CN 202311592386 A CN202311592386 A CN 202311592386A CN 117802262 B CN117802262 B CN 117802262B
- Authority
- CN
- China
- Prior art keywords
- pumpkin
- soluble sugar
- molecular marker
- snp molecular
- kasp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 235000000346 sugar Nutrition 0.000 title claims abstract description 63
- 235000000832 Ayote Nutrition 0.000 title claims abstract description 57
- 235000009854 Cucurbita moschata Nutrition 0.000 title claims abstract description 57
- 240000001980 Cucurbita pepo Species 0.000 title claims abstract description 57
- 235000009804 Cucurbita pepo subsp pepo Nutrition 0.000 title claims abstract description 57
- 235000015136 pumpkin Nutrition 0.000 title claims abstract description 57
- 239000003147 molecular marker Substances 0.000 title claims abstract description 35
- 238000000034 method Methods 0.000 claims abstract description 18
- 239000002773 nucleotide Substances 0.000 claims abstract description 14
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 14
- 238000009395 breeding Methods 0.000 claims abstract description 9
- 230000001488 breeding effect Effects 0.000 claims abstract description 9
- 230000035772 mutation Effects 0.000 claims abstract description 7
- 238000012216 screening Methods 0.000 claims abstract description 4
- 238000001514 detection method Methods 0.000 claims description 28
- 238000011144 upstream manufacturing Methods 0.000 claims description 11
- 239000003153 chemical reaction reagent Substances 0.000 claims description 10
- 238000003205 genotyping method Methods 0.000 claims description 8
- 238000012408 PCR amplification Methods 0.000 claims description 5
- 230000003321 amplification Effects 0.000 claims description 5
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 5
- 238000000137 annealing Methods 0.000 claims description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 3
- 238000003752 polymerase chain reaction Methods 0.000 claims description 2
- 235000013399 edible fruits Nutrition 0.000 abstract description 9
- 235000016709 nutrition Nutrition 0.000 abstract description 5
- 230000035764 nutrition Effects 0.000 abstract description 4
- 230000008569 process Effects 0.000 abstract description 4
- 241000196324 Embryophyta Species 0.000 abstract description 3
- 238000012214 genetic breeding Methods 0.000 abstract description 2
- 239000000463 material Substances 0.000 description 14
- 238000012098 association analyses Methods 0.000 description 7
- 238000011161 development Methods 0.000 description 5
- 238000006243 chemical reaction Methods 0.000 description 4
- 238000005516 engineering process Methods 0.000 description 4
- 235000013311 vegetables Nutrition 0.000 description 4
- WEVYAHXRMPXWCK-UHFFFAOYSA-N Acetonitrile Chemical compound CC#N WEVYAHXRMPXWCK-UHFFFAOYSA-N 0.000 description 3
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical class [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 3
- 230000002068 genetic effect Effects 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 2
- 241000219104 Cucurbitaceae Species 0.000 description 2
- 241000726221 Gemma Species 0.000 description 2
- 108010043121 Green Fluorescent Proteins Proteins 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 210000000349 chromosome Anatomy 0.000 description 2
- 238000010276 construction Methods 0.000 description 2
- 238000010219 correlation analysis Methods 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 238000001914 filtration Methods 0.000 description 2
- 238000002373 gas-phase electrophoretic mobility molecular analysis Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 102000054765 polymorphisms of proteins Human genes 0.000 description 2
- 230000001737 promoting effect Effects 0.000 description 2
- 230000001105 regulatory effect Effects 0.000 description 2
- 238000009394 selective breeding Methods 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 150000008163 sugars Chemical class 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- OKTJSMMVPCPJKN-UHFFFAOYSA-N Carbon Chemical compound [C] OKTJSMMVPCPJKN-UHFFFAOYSA-N 0.000 description 1
- 241000408747 Lepomis gibbosus Species 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 238000007844 allele-specific PCR Methods 0.000 description 1
- 150000001720 carbohydrates Chemical class 0.000 description 1
- 235000014633 carbohydrates Nutrition 0.000 description 1
- 229910052799 carbon Inorganic materials 0.000 description 1
- 230000002860 competitive effect Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000004108 freeze drying Methods 0.000 description 1
- 235000012055 fruits and vegetables Nutrition 0.000 description 1
- 238000000227 grinding Methods 0.000 description 1
- 235000004280 healthy diet Nutrition 0.000 description 1
- 238000012165 high-throughput sequencing Methods 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 230000003993 interaction Effects 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 230000004060 metabolic process Effects 0.000 description 1
- 238000005065 mining Methods 0.000 description 1
- 229910052757 nitrogen Inorganic materials 0.000 description 1
- 230000029553 photosynthesis Effects 0.000 description 1
- 238000010672 photosynthesis Methods 0.000 description 1
- 230000008635 plant growth Effects 0.000 description 1
- 239000000843 powder Substances 0.000 description 1
- 235000020236 pumpkin seed Nutrition 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 230000008844 regulatory mechanism Effects 0.000 description 1
- 230000021892 response to abiotic stimulus Effects 0.000 description 1
- 230000011664 signaling Effects 0.000 description 1
- 230000035882 stress Effects 0.000 description 1
- 210000003934 vacuole Anatomy 0.000 description 1
- 239000003643 water by type Substances 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of plant molecular genetic breeding, in particular to a SNP molecular marker closely linked with pumpkin soluble sugar characters and application thereof. The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, and a T/C base mutation is arranged at the 23 bp. The invention also provides a specific primer for detecting the SNP molecular marker and a method for identifying the content of soluble sugar in pumpkin pulp, wherein the specific primer is shown as SEQ ID NO. 2-4. The SNP molecular marker is applied to screening and identifying the content character of the soluble sugar of pumpkin fruits, has the advantages of high accuracy, high efficiency and low cost, and greatly promotes the breeding process of pumpkin nutrition quality.
Description
Technical Field
The invention relates to the field of plant molecular genetic breeding, in particular to a SNP molecular marker closely linked with pumpkin soluble sugar characters and application thereof.
Background
The whole Genome association analysis (GWAS, genome-wide Association Study) performs association analysis based on variation information existing in Genome in the population and the traits, and is helpful for mining new regulatory sites related to the traits, analyzing new biological regulatory mechanisms and promoting precise molecular breeding. The single nucleotide polymorphism (SNP, single Nucleotide Polymorphism) is widely applied to the construction of molecular marker linkage maps or the gene location of whole genome association analysis due to high repeatability and abundant quantity, thereby promoting the development of cucurbitaceae crop genetic location research. The competitive allele-specific polymerase chain reaction (KASP, kompetitive ALLELE SPECIFIC PCR, KASP) is a novel genotyping technology based on Single Nucleotide Polymorphisms (SNPs), can accurately determine SNPs and InDel polymorphisms (indels) at the genomic level, and has been widely used in life science research and medical fields.
Sugar is a major product of photosynthesis, not only an important source of carbon in plants, but also functions as a signaling molecule capable of comprehensively responding to signals from the environment, development and metabolism. Furthermore, as soluble sugars are transported and accumulate in vacuoles, they become critical role players in regulating fruit quality and development of stress tolerance. Thus, soluble sugars play an important role in plant growth, crop yield and quality, and response to abiotic stress.
Pumpkin is a vegetable and grain dual-purpose crop of cucurbitaceae widely cultivated worldwide, and contains abundant carbohydrate. With the development of economy, the living standard of people is obviously improved, vegetables are an indispensable part of healthy diet, the demand is gradually changed from quantity to quality, and consumers are increasingly focusing on the nutrition and taste of the vegetables. The soluble sugar is an important quality character of fruits and vegetables, and the content of the soluble sugar directly influences the acceptance degree of pumpkin by markets and consumers. In addition, soluble sugar is quantitative character controlled by multiple genes, there is interaction between genotype and environment, character expression is greatly affected by environment, and conventional breeding technology based on phenotype identification is difficult to effectively screen variety resources. Therefore, analyzing the regulation and control mechanism of the soluble sugar at the genetic level, and breeding the pumpkin variety with high soluble sugar meeting the market demand is important.
However, so far, there have been few studies on the development of genes and molecular markers for soluble sugar of pumpkin. Therefore, it is necessary to find a molecular marker related to the pumpkin soluble sugar, so as to realize accurate and efficient identification of the pumpkin fruit soluble sugar character.
Disclosure of Invention
The invention aims to provide an SNP molecular marker closely linked with pumpkin soluble sugar characters and application thereof, so as to solve the problems in the prior art. The molecular marker and the pumpkin fruit soluble sugar are highly tightly linked, and SNP typing is obtained by using a KASP technology, so that the pumpkin fruit soluble sugar character can be accurately and efficiently identified. Meanwhile, the molecular marker can be used for pumpkin molecular marker assisted selective breeding, and can accelerate the breeding process of pumpkin nutrition quality.
In order to achieve the above object, the present invention provides the following solutions:
the invention provides an SNP molecular marker closely linked with pumpkin soluble sugar character, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, and the 23 rd position of the nucleotide sequence has a T/C base mutation.
The invention provides a KASP primer group for detecting the SNP molecular marker, which comprises an upstream primer F1 with a nucleotide sequence shown as SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence shown as SEQ ID NO.3 and a downstream primer R with a nucleotide sequence shown as SEQ ID NO. 4.
The invention provides a detection reagent or a detection kit of the SNP molecular marker, which comprises the KASP primer set.
The invention provides application of the SNP molecular marker, the KASP primer set or the detection reagent or the detection kit in identifying the content of soluble sugar in pumpkin pulp.
The invention provides a method for identifying the content of soluble sugar in pumpkin pulp, which comprises the following steps:
taking a pumpkin sample genome to be detected as a template, performing KASP PCR amplification on the template by using the KASP primer group, and genotyping according to the amplification result.
Preferably, if the genotyping result is TT, judging that the pumpkin to be detected is a variety with low soluble sugar content; if the genotyping result is CC, judging that the pumpkin to be detected is a variety with high soluble sugar content.
Preferably, the KASP PCR amplification system comprises, in 10. Mu.L, 0.1. Mu.L of the upstream primer F1, 0.1. Mu.L of the upstream primer F2, 0.2. Mu.L of the downstream primer R, 5. Mu.L of 2X PARMS MASTER Mix, 80ng of genomic DNA and the balance of water;
The KASPPCR amplification procedure was: 94 ℃ for 15min; gradient annealing at 94 ℃ for 20s at 65-57 ℃ for 1min,10 cycles; 94℃for 20s,57℃for 1min,30 cycles.
The invention provides application of the SNP molecular marker, the KASP primer group or the detection reagent or the detection kit in screening or predicting pumpkin varieties with high soluble sugar content.
The invention provides application of the SNP molecular marker, the KASP primer group or the detection reagent or the detection kit in improving pumpkin germplasm resources.
The invention provides application of the SNP molecular marker, the KASP primer group or the detection reagent or the detection kit in pumpkin breeding.
The invention discloses the following technical effects:
According to the invention, 268 parts of pumpkin materials collected in a laboratory are used as natural population materials, and a high-throughput sequencing technology is utilized to perform whole genome association analysis on pumpkin soluble sugar, so that SNP molecular markers closely linked with the content of the soluble sugar are developed, and the 23 rd position of the molecular markers has a T/C base mutation. The molecular marker can be used for establishing an auxiliary selective breeding system for pumpkin soluble sugar characters, and accelerating the breeding process of pumpkin nutritional quality. The invention discloses SNP molecular markers closely linked with pumpkin soluble total sugar for the first time, the molecular markers can carry out genotype identification on pumpkin fruits, pumpkin seeds or seedlings, and pumpkin varieties with high soluble sugar can be accurately and efficiently screened through genotypes.
In addition, when the SNP molecular marker provided by the invention is applied to screening and identifying the soluble sugar content character of pumpkin fruits, the SNP molecular marker has the advantages of high accuracy, high efficiency and low cost, and greatly promotes the breeding process of pumpkin nutrition quality.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a diagram showing a genome-wide association analysis of pumpkin soluble sugar traits, and a Manhattan diagram of soluble sugar on the left side: physical location on chromosome represented by abscissa, smaller value of-log 10P, P represented by ordinate, larger value of ordinate represents stronger correlation; correlation analysis Quantile-Quantile of soluble sugar is shown on the right;
FIG. 2 shows the result of fluorescence signal genotyping of SNP molecular markers in 70 materials with extreme differences in soluble sugar content, wherein green is genotype HEX and blue is genotype FAM.
Detailed Description
Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.
Example 1 acquisition of SNP molecular markers closely linked to the soluble sugar content of pumpkin
1. Construction of genetic populations
(1) Test materials:
268 parts of pumpkin natural population germplasm resources (including high-generation inbred lines, homozygous farms and F 1 hybrids) used in the research are obtained by collection and purification for many years, and are respectively obtained from 11 countries such as China, thailand, india, pakistan, japan, the United states, spanish, russia and the like. Wherein, about 214 parts of germplasm resources come from China and are distributed in 22 provinces. The 268 pumpkin germplasm resources are planted in Bai Yunji field of vegetable institute of academy of agricultural sciences in Guangdong province in the first half of 2019.
(2) Determination of soluble sugar content of pumpkin fruits:
The individual pumpkin fruits in 268 parts of natural populations are collected, smashed by a stirrer, then quickly precooled by liquid nitrogen, placed in a freeze dryer for freeze-drying, ground into powder by grinding freeze-dried samples, the composition and the content of soluble sugar are quantitatively detected by using an HPLC-RI system, a chromatographic column is Waters X bridge BEHAmide (4.6X250 mm,5 mu m), and an extracting solution is 50% acetonitrile (the detection result of the content of the soluble sugar of partial natural populations is shown in table 1).
2. Genome-wide association analysis of soluble sugar content
(1) Extraction of pumpkin genome DNA:
The genome DNA of 268 parts of natural population is extracted by adopting a modified cetyl trimethyl ammonium bromide method (CTAB, cetyltrimethylammonium bromide), the quality and the concentration of pumpkin DNA are detected by 2% agarose gel electrophoresis, and the pumpkin DNA is diluted to 80 ng/. Mu.L for standby.
(2) Analysis of resequencing data
Based on a second-generation resequencing platform Illumina Hi-Seq, carrying out data quality control, comparison on a reference genome, quality inspection after comparison, mutation detection based on different algorithms, and filtering the mutation detection result to obtain CLEAN READS DATA Gb total 1452.15Gb, wherein the average sequencing maximum depth is 5.37Gb for each sample: 30.6, the lowest depth is: 9.28, average sequencing depth for genome reached: 16.58×. The average coverage (one base coverage at least) for all sample alignments is: 96.38%, the lowest coverage is: 68.78%, the highest coverage is: 99.37%, and 1,157,313 high-quality SNP loci are obtained through filtration.
(3) Genome-wide association analysis of soluble sugar content
The invention utilizes GEMMA analysis software to screen potential candidate SNPs, and the threshold condition of GEMMA is set as follows: p.ltoreq.10 10 -6(-log10 p.gtoreq.6) and p.ltoreq.10 10 -7(-log10 p.gtoreq.7) yielding 25 significant SNPs sites associated with soluble sugar content in total (FIG. 1), wherein the site with the highest contribution on chromosome 4 is defined as Sug-SNP1, the polymorphism of this site is T/C, the high soluble sugar content is C, and the low soluble sugar content is T.
EXAMPLE 2KASP technique for detecting genotype of SNP site related to soluble sugar content trait of pumpkin
Based on the genome sequence information of the pumpkin and the correlation analysis result of the whole genome of the soluble sugar, selecting a sequence SEQ ID NO.1, specifically CTTACCATTGGGCTCGTATTGTMTCGGTCATTTGTGAAGGGTTGTTCCAGTTGTATGACT CATCTGTGTATGTTCCCCACCGG, around Sug-SNP1 locus, wherein M represents that the base at the locus is T or C, and the sequence is used as an SNP molecular marker.
The KASP primer is designed according to the sequence shown in SEQ ID NO.1, and the forward primer sequence consists of a general adapter sequence, a common amplification primer sequence and a typing site sequence, and is specifically shown as follows:
Upstream primer F1: GAAGGTGACCAAGTTCATGCTCTTACCATTGGGCTCGTATTGTT, SEQ ID No.2, wherein the italic part is FAM tag sequence and the black bolded part is the difference Sug-SNP1 site;
The upstream primer F2: GAAGGTCGGAGTCAACGGATTCTTACCATTGGGCTCGTATTGTC, SEQ ID No.3, italic part HEX tag sequence, black bolded part difference Sug-SNP1 site;
the downstream primer R: CCGGTGGGGAACATACACAG, SEQ ID No.4.
KASPPCR the amplification reaction system is: 0.2. Mu.L of upstream primer (10. Mu.M, F1 in an amount of 0.1. Mu.M, F2 in an amount of 0.1. Mu.M), 0.2. Mu.L of downstream primer (10. Mu.M), 5. Mu.L of 2X PARMS MASTER Mix,80ng of genomic DNA, water make up 10. Mu.L;
the reaction procedure for the PCR amplification of KASP was: 94 ℃ for 15min; gradient annealing at 94 ℃ for 20s at 65-57 ℃ for 1min,10 cycles; 94℃for 20s,57℃for 1min,30 cycles;
After PCR was completed, the fluorescence signal was read using TECAN INFINITE M1000 microplate reader and then resolved using on-line software snpdecoder (http:// www.snpway.com/snpdecoder /). When the base of Sug-SNP1 is T, the detection sample is combined with a specific FAM detection primer and releases a blue fluorescent group, and the blue fluorescent signal is enhanced along with the increase of the number of PCR reaction cycles, so that the material with low soluble sugar can be judged by the fluorescent color (KASP typing result is defined as FAM); when the base of Sug-SNP1 is C, the detection sample binds to a specific HEX detection primer and releases a green fluorescent group, and as the number of PCR reaction cycles increases, the green fluorescent signal is enhanced, so that a material with high solubility sugar can be judged by the fluorescent color (KASP typing result is defined as HEX). Although the judgment method is based on fluorescence color, it is needless to say that the same object can be achieved by detecting the base at the 23bp position of SEQ ID NO.1 by other known methods to determine the SNP mutation condition.
Of 268 parts of natural population materials, 70 parts of materials with extremely different soluble contents are selected, and the soluble sugar content and genotype are shown in table 1: wherein, 35 parts of materials with high soluble sugar content and 35 parts of materials with low soluble sugar content are subjected to KASP typing analysis by adopting the molecular marker fluorescence signal provided by the invention, so as to prove the detection accuracy of the molecular marker developed by the invention. The typing results of the molecular markers on 70 parts of soluble sugar content extreme materials are shown in the accompanying figure 2 and the table 1: individuals with extremely low soluble sugar content aggregate to the position of the abscissa axis, and individuals with extremely high soluble sugar aggregate to the position of the ordinate axis. The molecular markers developed by the invention are tightly linked with the content character of the soluble sugar.
Table 170 parts of soluble sugar character of pumpkin and genotype corresponding to Sug-SNP1 marker
The same object can be achieved by detecting the molecular marker Sug-SNP1 by other known methods and determining the SNP condition.
The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.
Claims (9)
1. A SNP molecular marker closely linked with pumpkin soluble sugar character is characterized in that the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, and the 23 rd position of the nucleotide sequence has a T/C base mutation.
2. The KASP primer group for detecting the SNP molecular markers as set forth in claim 1, characterized in that the KASP primer group comprises an upstream primer F1 having a nucleotide sequence shown as SEQ ID No.2, an upstream primer F2 having a nucleotide sequence shown as SEQ ID No.3, and a downstream primer R having a nucleotide sequence shown as SEQ ID No. 4.
3. A SNP molecular marker detection reagent or detection kit according to claim 1, comprising the KASP primer set according to claim 2.
4. Use of the SNP molecular marker of claim 1, the KASP primer set of claim 2, or the detection reagent or detection kit of claim 3 for identifying the soluble sugar content of pumpkin pulp.
5. A method for identifying the level of soluble sugar in pumpkin pulp, comprising:
Taking a pumpkin sample genome to be detected as a template, performing KASP PCR amplification on the template by using the KASP primer group according to claim 2, and genotyping according to the amplification result;
If the genotyping result is TT, judging that the pumpkin to be detected is a variety with low soluble sugar content; if the genotyping result is CC, judging that the pumpkin to be detected is a variety with high soluble sugar content.
6. The method of claim 5, wherein the KASP PCR amplification system comprises, in 10 μl, 0.1 μl of upstream primer F1, 0.1 μl of upstream primer F2, 0.2 μl of downstream primer R, 5 μl of 2 x PARMS MASTER Mix, 80ng of genomic DNA, and the balance water;
the KASP PCR amplification procedure was: 94 ℃ for 15min; gradient annealing at 94 ℃ for 20s at 65-57 ℃ for 1min,10 cycles; 94℃for 20s,57℃for 1min,30 cycles.
7. Use of the SNP molecular marker of claim 1, the KASP primer set of claim 2, or the detection reagent or detection kit of claim 3 for screening or predicting a variety of pumpkin with high soluble sugar content.
8. Use of the SNP molecular marker of claim 1, the KASP primer set of claim 2, or the detection reagent or detection kit of claim 3 for improving pumpkin germplasm resources.
9. Use of the SNP molecular marker of claim 1, the KASP primer set of claim 2, or the detection reagent or detection kit of claim 3 in pumpkin breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311592386.5A CN117802262B (en) | 2023-11-27 | 2023-11-27 | SNP molecular marker closely linked with pumpkin soluble sugar character and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311592386.5A CN117802262B (en) | 2023-11-27 | 2023-11-27 | SNP molecular marker closely linked with pumpkin soluble sugar character and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN117802262A CN117802262A (en) | 2024-04-02 |
| CN117802262B true CN117802262B (en) | 2024-06-18 |
Family
ID=90428843
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311592386.5A Active CN117802262B (en) | 2023-11-27 | 2023-11-27 | SNP molecular marker closely linked with pumpkin soluble sugar character and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117802262B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116144819A (en) * | 2022-10-08 | 2023-05-23 | 广东省农业科学院蔬菜研究所 | SNP molecular marker closely linked with main effect QTL of pumpkin pulp carotenoid and application of SNP molecular marker |
| CN116411118A (en) * | 2023-03-09 | 2023-07-11 | 广东省农业科学院蔬菜研究所 | KASP molecular marker linked with pumpkin sucrose content major QTL and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107365835B (en) * | 2017-08-28 | 2018-02-23 | 广东省农业科学院蔬菜研究所 | SNP marker and its application with pumpkin sucrose/glucose ratio main effect QTL compact linkage |
| CN108048595B (en) * | 2017-12-26 | 2018-11-02 | 广东省农业科学院蔬菜研究所 | Indel molecular labelings with pumpkin photoperiod insensitive character close linkage and its application |
| CN116814673A (en) * | 2022-04-27 | 2023-09-29 | 中国农业科学院农业基因组研究所 | Genomic structural variation for regulating and controlling content of soluble solids in tomato fruits, related products and application |
-
2023
- 2023-11-27 CN CN202311592386.5A patent/CN117802262B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116144819A (en) * | 2022-10-08 | 2023-05-23 | 广东省农业科学院蔬菜研究所 | SNP molecular marker closely linked with main effect QTL of pumpkin pulp carotenoid and application of SNP molecular marker |
| CN116411118A (en) * | 2023-03-09 | 2023-07-11 | 广东省农业科学院蔬菜研究所 | KASP molecular marker linked with pumpkin sucrose content major QTL and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117802262A (en) | 2024-04-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2018085971A1 (en) | Cotton whole genome snp chip and application thereof | |
| CN111733281B (en) | Molecular marker for identifying peroxidase activity of wheat grains and application thereof | |
| CN116411118B (en) | KASP molecular marker linked with pumpkin sucrose content major QTL and application thereof | |
| CN109295179B (en) | Method for screening wheat with different zinc content and iron content and special kit thereof | |
| CN111778353B (en) | SNP molecular marker for identifying common wheat variety and SNP molecular marker detection method | |
| CN112592998B (en) | KASP primer combination for constructing grape DNA fingerprint atlas database and application | |
| CN113528703A (en) | Development and application of KASP molecular marker of rice blast resistance gene Pid3-A4 | |
| CN111471790B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-7D.1 and application thereof | |
| CN112725518A (en) | PARMS marker based on SNP mutation of coding region of rice blast resistance gene Pid2 and application | |
| CN116574828B (en) | KASP molecular marker linked with pumpkin soluble solid content major QTL and application thereof | |
| CN117802262B (en) | SNP molecular marker closely linked with pumpkin soluble sugar character and application thereof | |
| CN113981126B (en) | SNP molecular marker KQ8-4472 linked with gene for controlling Vc content of pepper fruits, application and special primer | |
| CN116121445A (en) | KASP molecular marker for detecting grain weight and grain width of wheat in multiple environments and application | |
| CN113881802B (en) | SNP molecular marker KQ8-3918 linked with gene for controlling Vc content of pepper fruits, application and special primer | |
| CN116144816A (en) | KASP molecular marker for identifying orange peel color in seedling stage and application thereof | |
| CN111647677B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-6D and application | |
| CN114058732A (en) | Primer combination for efficiently identifying different alleles of grain weight gene GW5, identification method and application | |
| CN114231651A (en) | Radish whole genome SSR core primer combination suitable for SSR-Seq technology and application thereof | |
| CN112725519A (en) | PARMS marker based on brown planthopper resistance gene Bph14 of rice and application | |
| CN113699220B (en) | Method for identifying honey and tracing honey production area by regional plant sources | |
| KR102477985B1 (en) | SNP genetic markers and primer sets for discriminating the cultivar of 7 certificated species (Saegeumgang, Baekgang, Goso, Suan, Baekjung, Jojo, and Geumgang) which are major domestic wheats and uses thereof | |
| CN118166148A (en) | SNP locus closely linked with pumpkin fruit size major QTL, molecular marker, primer pair and application thereof | |
| CN113817861A (en) | KASP marker related to corn isoorientin content and application thereof | |
| CN112813187A (en) | PARMS marker based on SNP mutation of rice blast resistance gene Pita coding region and application | |
| CN115992289A (en) | Development of KASP (KASP-related fragment thereof) marker related to corn stem rot resistance gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |