CN117802071A - Protein yCas12a and related biological material and application thereof - Google Patents

Abstract

The invention discloses a protein yCas12a, wherein the protein yCas12a is protein of the following A1), A2) or A3): a1 A protein having an amino acid sequence of SEQ ID No. 2; a2 A protein which is obtained by substituting and/or deleting and/or adding the amino acid residues in the amino acid sequence shown in the A1) and has the same function, is derived from the A1) or has more than 80% of the same function as the protein shown in the A1); a3 Fusion proteins obtained by ligating protein tags at the N-terminus or/and the C-terminus of A1) or A2). The invention also discloses a protein yCas12a related biological material and application thereof in gene editing and the like.

Description

Protein yCas12a and related biological material and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a protein yCas12a, related biological materials and application thereof.

Background

Molecular diagnostics is a molecular biological technique that detects specific genetic information of an organism. The application of this technology has stimulated explosive developments in various fields of medicine and biology. Molecular diagnostic techniques have been advanced from molecular hybridization, fluorescent quantitative PCR to biochips, and high throughput sequencing. These methods have shown their utility in various molecular diagnostic applications. However, these methods have disadvantages of long time consumption, high cost, and the like. However, with the advent of revolutionary CRISPR-Cas systems, the level and scope of molecular diagnostic tool applications has been greatly increased, rendering the conformation of instant molecular diagnostics realistic.

CRISPR is an aggregated, regularly spaced short palindromic repeat in the bacterial and archaeal genomes that constitutes its adaptive immune system protecting them from foreign mobile genetic elements. CRISPR-Cas immunization involves three main sequential steps: adaptation, expression/maturation and interference, each step requires a specific Cas protein encoded by a Cas gene in the vicinity of the CRISPR array, as well as other accessory proteins. When an exogenous nucleic acid invades a bacterium or archaea, it is recognized by the Cas protein and integrated into the CRISPR array. When the exogenous nucleic acid re-infects, the CRISPR adaptive immune system is activated, expressing CRISPR RNA (crRNA) and Cas proteins, and forming effector complexes. After the effector complex recognizes the PAM (protospacer adjacent motif) sequence adjacent to the target DNA, complementarity is formed between the crRNA and the target sequence, and finally specific cleavage of the target DNA is achieved.

CRISPR-Cas systems fall into two broad categories (category 1 and category 2) and six subtypes (types I to VI) according to the complexity of effector proteins. Class 1 (type I, type III, and type IV) CRISPR-Cas systems use multiple Cas proteins to destroy foreign nucleic acids, while class 2 systems (type II, type V, and type VI) require only a single Cas protein. Class 1 CRISPR-Cas systems are most commonly found in bacteria and archaebacteria, accounting for about 90% of all identified CRISPR-Cas loci, with the remaining about 10% of class 2 CRISPR-Cas systems almost entirely present in bacteria. Currently, cas12 Sup>A belonging to class 2V-Sup>A type is mainly used in the field of molecular diagnostics. LbCAs12a is the Cas12a protein most commonly used today for molecular diagnostic applications, has been widely used in the field of pathogenic microorganism detection, and has derived a number of related biotechnology. Although techniques for molecular diagnostics using LbCas12a have demonstrated great advantages, including convenience, rapidity, low cost, etc., there is room for performance improvement. Screening and identifying the novel Cas12a protein with excellent performance has important significance for the field of molecular diagnosis.

Disclosure of Invention

The technical problem to be solved by the invention is how to provide a novel Cas12a protein with excellent performance.

In order to solve the above technical problems, the present invention provides a protein named yCas12a, wherein the protein yCas12a is a protein of A1), A2) or A3) as follows:

a1 A protein having an amino acid sequence of SEQ ID No. 2;

a2 A protein which is obtained by substituting and/or deleting and/or adding the amino acid residues in the amino acid sequence shown in the A1) and has the same function, is derived from the A1) or has more than 80% of the same function as the protein shown in the A1);

a3 Fusion proteins obtained by ligating protein tags at the N-terminus or/and the C-terminus of A1) or A2).

Among the above proteins, the amino acid sequence of the fusion protein of A3) may be SEQ ID No.2.

The invention also provides related biological materials of the protein yCas12 a; the biological material is any one of the following B1) to B5):

b1 A nucleic acid molecule encoding said protein;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);

b4 A recombinant microorganism comprising the nucleic acid molecule of B1), a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3).

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

In the biological material, the coding sequence of the nucleic acid molecule B1) is shown as 196-3999 of SEQ ID No.1 in a sequence table.

In order to solve the technical problems, the invention also provides a kit for detecting nucleic acid, which contains the protein yCas12a and crRNA, wherein the target sequence of the crRNA is 5' -PAM N _19-20 -3', said N _19-20 19-20N, wherein the PAM is 5'-TTTN-3', wherein N is A, T, G or C.

In the above kit, the kit further contains a Reporter DNA with a fluorescent signal label, wherein the Reporter DNA with a fluorescent signal label is ssDNA Reporter, and the sequence can be: 5'-FAM-TTTTTT-BHQ1-3', wherein FAM is a fluorescent group and BHQ1 is a quenching group.

In order to solve the technical problems, the invention also provides a nucleic acid detection method, which comprises the steps of reacting the protein yCas12a, crRNA, report DNA with fluorescent signal marks and an object to be detected, and judging the result by utilizing the color development condition of a fluorescent report group; the target sequence of the crRNA is 5' -PAM N _19-20 -3', said N _19-20 19-20N, wherein the PAM is 5'-TTTN-3', wherein N is A, T, G or C.

In the above method for detecting nucleic acid, the Reporter DNA labeled with fluorescent signal is ssDNA Reporter, and the sequence may be: 5'-FAM-TTTTTT-BHQ1-3', wherein FAM is a fluorescent group and BHQ1 is a quenching group.

In the above nucleic acid detection method, the result determination is performed by using the color development of the fluorescent reporter group, and the criteria are as follows: if the fluorescent signal is available, the target sequence containing crRNA in the sample to be tested is indicated, and if the fluorescent signal is not available, the target sequence not containing crRNA in the sample to be tested is indicated. The content of the target sequence of crRNA in the sample to be tested can also be determined by the magnitude of the fluorescent signal.

In the above kit or the above nucleic acid detection method, Q1, the nucleic acid is a novel coronavirus nucleic acid, theThe nucleotide sequence of crRNA is 5')GUGAAUUUUGUGUCAGACAUCUACACACAGUAGAAAUU-3' (shown in SEQ ID No. 5).

The invention also provides a method for editing genes, which comprises the following steps: mixing the protein yCas12a, the sgRNA and a DNA molecule with a sgRNA target sequence, and carrying out gene editing on the DNA with the sgRNA target sequence; the target sequence of the sgRNA is 5' -PAM N _19-20 -3', said N _19-20 19-20N, wherein the PAM is 5'-TTTN-3', wherein N is a base A, T, G or C.

In the above method for gene editing, the gene editing is preferably performed at positions 1 to 6 after PAM.

In order to solve the technical problems, the invention also provides application of the protein yCas12a, or the nucleic acid molecule, or the expression cassette, or the kit, or the nucleic acid detection method, or the gene editing method in any one of the following steps:

p1, application in nucleic acid detection or application in preparing nucleic acid detection products;

p2, application in gene editing or application in preparing gene editing products;

p3, application in preparing disease diagnosis products;

p4, application in preparing gene therapy products.

The above-described applications or methods are non-disease diagnostic applications or methods. The above applications or methods are not directed to obtaining disease diagnosis results or health status of a living human or animal body. The sample to be tested may be a sample from a non-living human or animal body, such as an environmental sample (e.g. air), a food (e.g. frozen food or fresh food).

The sample to be tested for the above application may be a sample from a non-living human or animal body, such as an environmental sample (e.g. air), a food (e.g. frozen food or fresh food).

The yCas12a protein can be used as a Cas protein, and forms an effector complex with CRISPR RNA (crRNA), and after the effector complex recognizes a PAM (protospacer adjacent motif) sequence adjacent to target DNA, complementation is formed between the crRNA and the target sequence, so that the specific cutting of the target DNA is finally realized, and the aim of gene editing is fulfilled. When the yCas12a protein is subjected to gene editing, the PAM sequence is preferably of a TTTN type, and the 1 st to 6 th positions after PAM have higher specificity than LbCAs12 a.

Drawings

FIG. 1 is a phylogenetic tree of yCas12a homologous proteins.

FIG. 2 shows the results of prokaryotic expression and purification of yCas12a in example 1 of the present invention. From left to right, lane 1 is protein Marker, lane 2 is uninduced whole mycoprotein (labeled uninduced), lane 3 is IPTG-induced whole mycoprotein (labeled supernatant), lane 4 is first eluted yCas12a protein (labeled elution 1) after purification by nickel column, lane 5 is second eluted yCas12a protein (labeled elution 2) after purification by nickel column, lane 6 is third eluted yCas12a protein (labeled elution 3) after purification by nickel column, and lane 7 is fourth eluted yCas12a protein (labeled elution 4) after purification by nickel column.

FIG. 3 shows the results of molecular diagnostic activity verification of yCas12a in example 1 of the present invention. Wherein, lbCAs12a is LbCAs12a protein control and NG is negative control.

FIG. 4 shows crRNA optimization results for yCas12a in example 2 of the present invention.

FIG. 5 shows the result of detecting novel coronavirus RNA with yCas12a in example 3 of the present invention.

Fig. 6 is a PAM sequence of yCas12a in example 4 of the present invention.

FIG. 7 shows the results of in vitro editing activity verification of yCas12a in example 5 of the present invention. Wherein the strand that is not cleaved into the strand that is not cleaved by the target DNA fragment is cleaved into the strand that is cleaved by the target DNA fragment.

Fig. 8 is a molecular diagnostic specificity verification of yCas12a in example 6 of the present invention.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The quantitative tests in the following examples were all performed in triplicate, and the results were averaged.

In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

All plasmids were obtained from the university of Beijing, future technical institute molecular medicine institute, cardiovascular development laboratory.

The synthesis of the yCas12a gene sequence was performed by Biotechnology Inc. of the family Bose.

IPTG (A100487, ind.), ampicillin (A100339, ind.), kanamycin (A100408, ind.), oligo primers were all purchased from Ind Biotechnology (Shanghai).

The rapid plasmid miniprep kit (DP 105, tiangen), the endotoxin-free plasmid miniprep kit (DP 118, tiangen), DH 5. Alpha. Competent cells (CB 101, tiangen), BL21 (DE 3) competent cells (CB 105, tiangen) were all purchased from Tiangen Biochemical technology (Beijing) Co.

PCR product purification kit (28104, qiagen) was purchased from Qiagen.

High fidelity DNA polymerase (P515, vazyme), taq DNA polymerase (P222, vazyme), DNA library construction kit (ND 617, vazyme) were all purchased from Nannoo Renzan Biotech Co., ltd.

HiScribe ^TM T7 Rapid and efficient RNA Synthesis kit (E2050S, NEB) and restriction enzymes were purchased from NEB (Beijing) Inc.

Example 1 preparation of yCas12a protein and functional verification

1. And constructing a Cas12a phylogenetic tree.

The amino acid sequence of the yCas12a protein is shown in SEQ ID No. 2:

SEQ ID No.2：

MTYNNFTGIAQCSKTIRNEIIPVGWTKQLIKNNEILESDEKRDEKSEELKKLMDDYYRTYIDGKLSPVRDLDWSELFEVLDVALKRGAKKEDRTTLQKVRKNMLEKVYAKLDVKANKEMLGGKMVTKILPDFIKNNAEYTDEEKEQYFETIKLFKGFTTSLKKFLKTRENVFSDKDIPTSICYRIVWENADIFYKNIKAFEKIKESAAQEIEKLEEECRQQSAEHSASQMFSAEFYNCVLTQTGIEFYNDVCGRINKHMNLYYQQTKEKTGRYLMKKLHKQILSISSTRYEVPHMYENDDEVYDSINSFVKRLKDDSKLKSMIGNLLKKSQLYDYDEIFVDAKRYESVSTTISGSWDTVVRCITRYYDDNTVTKKDRQKKIENKVKNEKYRSLTGIYKVVMSYESREKFKSTNEYEYLHELEKIYNDDKLQLIEHYGSKKLIEDDVKIAEIKEMLDMLLKVRHFLDTFIEPEYENIDVDFYNEREEILEILDGIVALYNRVRNYVTQKPYSKDKYKLNFNCSSLGTGWSRNTEHSYKTIILRKNGLYYLGIYNAMNMPDEEIMEGNLGDVGDSYEKMVYGALPTRKLLNWCVTSDEAVKKYNPPQNIIDGCNNGRQGGNNFDINFCHELIDYLKVCIKTNPKWSELKFNFSDTNKYGSLKDFYDEISEQGYKVSWVNIPKEDIERLNREGQIYLFQIYNKDFSDKSTGTPNLHTMYFKNIFSEENMREEVIMLNGGAELFFRKASIENKIEHKEGTVLVNKTYKEMMGGEEVRVPVPEKEYVEIYTYLNNGKSTKLSDSAQKLFDSGKIEYREAKKNITKDRRYTEDKFFLHIPITLNYKVTKNNIRLNEQVLDYISEQKNLHIIGIDRGERNLIYVSVIDMNGRIVKQKSYNIVSGYDYQKKLVEREIARDDARKSWKEVGKITDLKEGYLSQVVHEISQMVLEYNAVIAMEELNYGFKRGRFKVERQVYQKFETMLISKLNYLVDKKKKVDEPGGVLKGYQLTYVPEKVTDVGKQCGIIFYVPPAYTSKIDPTTGFVDLFDFKADKPRKFLSRFDSIRYVKAGEEQDMFAFSFDYDNFAIHNTTPVIKKWIAYTYGSRIKKKPDIKNGKRVYSYEKLELTDEMKKLLNQNEISYCDGHNIVDDIKALDDKEKEALTDGIFNLFRLTVQLRNSMSEAEDYDMIVSPIRNDSGEFFDSSKYKNDDFGKESVDMPKDADANGAYCIAMKCLFEMKKVQQGWSESDKKNFDFLTVTNEDWFDFMQNKRYL

different Cas12a protein sequences are collected from the existing database, yCas12a protein sequences (shown as SEQ ID No. 2) are added to construct a phylogenetic tree, and the affinity relationship between yCas12a and known Cas12a proteins is analyzed and compared.

The results are shown in FIG. 1: the protein amino acid sequence analysis result shows that the relatedness of the yCas12a and the EeCAs12a (Eubbacterium sp, eeCPf 1) is nearest, the identity (identity) of the amino acid sequence of the yCas12a and the EeCAs12a is 59%, and the similarity (similarity) is 73%.

The nucleotide sequence for encoding the yCas12a protein is shown in positions 196-3999 of SEQ ID No. 1.

2. yCas12a prokaryotic expression and purification

First, the yCas12a gene (the sequence of which is shown as 196-3999 of SEQ ID No. 1) is cloned on a pET-28a (+) vector to obtain a plasmid pET28a-yCas12a, and the primers used for constructing the vector are as follows:

forward primer:

5’-ATGGGTCGCGGATCCGAATTCATGACCTACAACAACTTCACCGG-3' (underlined sequence identical to SEQ ID No.1 at positions 175-218);

reverse primer:

5’-GTGGTGGTGGTGGTGCTCGAGCAGATACCGCTTGTTCTGCATGAAAT-3' (the underlined sequence is reverse complementary to positions 3974-4020 of SEQ ID No. 1).

Plasmid pET28a-yCas12a contains a yCas12a expression cassette, the DNA sequence is shown as SEQ ID No.1, wherein positions 1-19 are T7 promoters, positions 20-44 are lac operators, positions 59-81 are ribosome binding sites, positions 100-117 are 6×his tags, positions 127-144 are thrombin recognition and cleavage sites, positions 196-3999 are DNA sequences encoding yCas12a, and positions 4006-4023 are 6×his tags.

SEQ ID No.1：

5’-TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAATTCATGACCTACAACAACTTCACCGGAATCGCCCAGTGCAGCAAGACCATCCGGAACGAGATCATCCCTGTCGGCTGGACCAAGCAGCTGATCAAGAACAACGAGATCCTGGAAAGCGACGAGAAGCGGGACGAGAAGTCCGAGGAACTGAAGAAACTGATGGACGACTACTACCGGACCTACATCGACGGCAAGCTGAGCCCCGTCAGAGATCTGGATTGGAGCGAGCTGTTCGAGGTGCTGGATGTGGCCCTGAAGAGAGGCGCCAAGAAAGAGG

ACAGAACCACACTGCAGAAAGTGCGGAAGAACATGCTGGAAAAGGTGTACG

CCAAGCTGGACGTGAAGGCCAACAAAGAGATGCTCGGCGGCAAGATGGTCA

CCAAGATCCTGCCTGACTTCATCAAAAACAACGCCGAGTACACCGACGAGGA

AAAAGAGCAGTACTTCGAGACAATCAAGCTGTTCAAGGGCTTCACAACCAGC

CTGAAGAAGTTCCTGAAAACCCGCGAGAACGTGTTCAGCGACAAGGACATCC

CCACCAGCATCTGCTACCGGATCGTGTGGGAGAACGCCGACATCTTCTACAAG

AACATCAAGGCCTTCGAGAAGATCAAAGAGAGCGCCGCTCAAGAGATCGAGA

AGCTGGAAGAGGAATGCCGGCAGCAGTCTGCCGAACACTCTGCCAGCCAGAT

GTTCAGCGCCGAGTTCTACAACTGCGTGCTGACCCAGACCGGCATCGAGTTTT

ACAACGACGTGTGCGGCCGGATCAACAAGCACATGAACCTGTACTACCAGCA

GACCAAAGAGAAAACCGGCCGCTACCTGATGAAGAAGCTGCACAAGCAGAT

CCTGAGCATCAGCAGCACCAGATACGAGGTGCCCCATATGTACGAGAACGAC

GACGAGGTGTACGACAGCATCAACAGCTTCGTGAAGCGGCTGAAGGACGACT

CCAAGCTGAAGTCCATGATCGGCAACCTGCTGAAGAAAAGCCAGCTGTACGA

CTACGACGAGATCTTCGTGGACGCCAAGCGCTACGAGAGCGTGTCCACAACA

ATCAGCGGCAGCTGGGATACCGTCGTGCGGTGCATCACACGGTACTACGATGA

CAACACCGTGACCAAGAAGGACCGGCAGAAGAAAATCGAGAACAAAGTGAA

GAACGAGAAGTATCGGAGCCTGACCGGAATCTACAAGGTGGTCATGAGCTAC

GAGTCCCGGGAAAAGTTCAAGAGCACCAACGAGTACGAGTACCTGCACGAG

CTGGAAAAAATCTACAATGACGACAAGCTCCAGCTGATCGAGCACTACGGCA

GCAAGAAGCTGATTGAGGACGACGTGAAGATCGCCGAAATCAAAGAAATGCT

TGACATGCTGCTGAAAGTCCGGCACTTCCTGGACACCTTCATCGAGCCCGAGT

ATGAGAACATCGACGTGGACTTCTACAACGAGCGGGAAGAGATTCTGGAAAT

CCTGGACGGCATCGTGGCCCTGTACAACAGAGTGCGGAACTACGTGACCCAG

AAGCCTTACAGCAAGGACAAGTACAAGCTGAACTTCAACTGCAGCAGCCTCG

GCACCGGCTGGTCCAGAAATACCGAGCACAGCTACAAGACAATCATCCTGAG

AAAGAACGGCCTCTACTACCTGGGCATCTACAACGCCATGAACATGCCCGACG

AAGAGATCATGGAAGGCAACCTGGGCGACGTGGGCGACAGCTATGAGAAGAT

GGTGTATGGCGCCCTGCCTACCAGAAAGCTGCTGAATTGGTGCGTGACCAGC

GACGAGGCCGTGAAGAAGTACAACCCTCCTCAGAACATCATCGACGGATGCA

ACAACGGCCGGCAAGGCGGCAACAATTTCGACATCAATTTCTGCCACGAACT

GATCGACTACCTGAAAGTGTGCATCAAGACAAACCCCAAGTGGAGCGAACTG

AAGTTCAACTTCTCCGACACCAACAAATACGGCTCCCTGAAGGACTTCTATGA

CGAGATCAGCGAGCAGGGCTATAAGGTGTCCTGGGTCAACATCCCCAAAGAG

GATATCGAGAGGCTGAACAGAGAGGGCCAGATCTACCTGTTTCAGATCTACAA

CAAGGACTTTAGCGACAAGTCCACCGGCACACCCAACCTGCACACCATGTAC

TTCAAGAATATCTTCAGCGAGGAAAACATGCGCGAGGAAGTCATCATGCTGAA

CGGCGGAGCCGAACTGTTCTTCAGAAAGGCCAGCATTGAGAACAAGATTGAG

CACAAAGAGGGCACCGTCCTGGTTAACAAGACCTACAAAGAAATGATGGGCG

GCGAGGAAGTGCGGGTCCCCGTTCCAGAGAAAGAATACGTGGAAATCTACAC

CTACCTGAACAACGGGAAGTCCACCAAGCTGTCCGACAGCGCCCAGAAGCTG

TTTGACTCCGGCAAGATCGAGTACAGAGAGGCCAAGAAGAATATCACCAAGG

ACAGACGCTATACCGAGGACAAGTTCTTCCTGCACATCCCCATCACGCTGAAC

TACAAAGTGACGAAGAACAACATCCGGCTGAACGAGCAGGTCCTGGACTACA

TCTCCGAGCAGAAGAACCTGCATATCATCGGCATCGACCGGGGCGAGAGAAA

CCTGATCTACGTGTCCGTGATCGACATGAACGGCAGGATCGTGAAGCAGAAA

AGCTACAACATCGTGTCCGGCTACGATTACCAGAAAAAGCTGGTGGAAAGAG

AGATCGCCCGGGACGACGCCAGAAAGTCTTGGAAAGAAGTGGGCAAGATCA

CCGACCTGAAAGAGGGCTACCTGAGCCAGGTGGTGCACGAGATCTCTCAGAT

GGTGCTCGAGTACAACGCCGTGATTGCCATGGAAGAACTGAACTACGGCTTC

AAGCGGGGCAGATTCAAAGTGGAAAGACAGGTGTACCAGAAATTCGAAACCA

TGCTCATCAGCAAGCTCAACTACCTGGTGGACAAGAAGAAGAAGGTCGACGA

GCCTGGCGGCGTGCTGAAGGGATACCAGCTGACATACGTGCCCGAGAAAGTG

ACCGATGTGGGCAAGCAGTGCGGCATCATCTTTTACGTGCCACCAGCCTACAC

CTCCAAGATCGATCCTACCACCGGCTTCGTGGATCTGTTCGACTTCAAGGCCG

ACAAGCCCAGAAAGTTCCTGTCCAGATTCGACTCCATCCGCTATGTGAAGGCT

GGCGAGGAACAGGACATGTTCGCCTTCAGCTTCGACTACGATAACTTCGCCAT

CCACAACACCACACCGGTCATCAAGAAGTGGATCGCCTACACATACGGCTCTC

GGATTAAGAAGAAGCCCGACATCAAGAACGGCAAGCGGGTGTACTCCTACGA

GAAACTGGAACTGACCGACGAGATGAAGAAATTGCTGAACCAGAATGAGATC

AGCTACTGCGACGGCCACAATATCGTGGACGATATCAAGGCCCTGGACGACAA

AGAAAAAGAGGCCCTGACAGACGGCATCTTCAACCTGTTCAGACTGACCGTG

CAGCTGCGGAACAGCATGTCTGAGGCCGAGGACTACGACATGATCGTGTCCC

CAATCAGAAACGACTCCGGCGAGTTCTTCGACAGCAGCAAGTACAAAAACGA

CGACTTCGGCAAAGAAAGCGTGGACATGCCCAAGGACGCCGATGCCAATGGC

GCCTACTGTATCGCCATGAAGTGCCTGTTCGAAATGAAGAAAGTCCAGCAAG

GCTGGAGCGAGAGCGATAAGAAGAACTTCGACTTCCTGACCGTGACGAACGA

GGATTGGTTCGATTTCATGCAGAACAAGCGGTATCTGCTCGAGCACCACCACC

ACCACCAC

Chemically transforming plasmid pET28a-yCas12a into BL21 (DE 3) competent cells (CB 105, tiangen) to construct yCas12a expression strain; the yCas12a expression strain was inoculated into kanamycin-resistant (final concentration 50. Mu.g/mL) LB liquid medium, and the bacteria were cultured to OD at 37℃and 220rpm ₆₀₀ 0.6 to 0.8; adding IPTG (final concentration 50 mug/mL) to induce the protein expression of the strain, adjusting the culture condition to 20 ℃ and the rotating speed of 120rpm, and continuously culturing for 20 hours; using a high-speed refrigerated centrifuge at a temperature of 4 DEG CCollecting thalli under the conditions of 8000rpm of rotation speed and 5min of centrifugation time, washing the thalli once by using precooled PBS, and re-suspending the thalli by using a binding buffer; using a cell high-pressure breaker to lyse the thalli at the temperature of 4 ℃ and the pressure of 700Mp until the thalli are clarified; separating supernatant (i.e. IPTG induced whole mycoprotein) and precipitate with a high-speed refrigerated centrifuge at 4deg.C, 8000rpm and centrifugation time of 10 min; purifying the supernatant by using a nickel affinity chromatographic column, purifying and replacing the buffer by using a sephadex molecular sieve, adding glycerol (the final concentration is 50%) and storing the mixture in a refrigerator at-40 ℃.

The prokaryotic expression and purification experimental results of the yCas12a are shown in fig. 2, wherein, lane 1 is a protein Marker, lane 2 is an uninduced whole bacterial protein, lane 3 is an IPTG induced whole bacterial protein, lane 4 is a first eluted yCas12a protein after being purified by a nickel column, lane 5 is a second eluted yCas12a protein after being purified by a nickel column, lane 6 is a third eluted yCas12a protein after being purified by a nickel column, and lane 7 is a fourth eluted yCas12a protein after being purified by a nickel column. The result shows that the purified yCas12a protein has high purity and meets the use of the invention.

3. yCas12a in vitro functional verification

The nucleotide sequence of the EMX1 gene used in the embodiment is shown as SEQ ID No.3, and the target sequence is TCATCTGTGCCCCTCCCTCC, namely the 161 th to 180 th positions of the SEQ ID No. 3.

SEQ ID No.3：

CCATCCCCTTCTGTGAATGTTAGACCCATGGGAGCAGCTGGTCAGAGGGGACCCCGGCCTGGGGCCCCTAACCCTATGTAGCCTCAGTCTTCCCATCAGGCTCTCAGCTCAGCCTGAGTGTTGAGGCCCCAGTGGCTGCTCTGGGGGCCTCCTGAGTTTCTCATCTGTGCCCCTCCCTCCCTGGCCCAGGTGAAGGTGTGGTTCCAGAACCGGAGGACAAAGTACAAACGGCAGAAGCTGGAGGAGGAAGGGCCTGAGTCCGAGCAGAAGAAGAAGGGCTCCCATCACATCAACCGGTGGCGCATTGCCACGAAGCAGGCCAATGGGGAGGACATCGATGTCACCTCCAATGACTAGGGTGGGCAACCACAAACCCACGAGGGCAGAGTGCTGCTTGCTGCTGGCCAGGCCCCTGCGTGGGCCCAAGCTGGACTCTGGCCACTCCCTGGCCAGGCTTTGGGGAGGCCTGGAGTCATGGCCCCACAGGGCTTGAAGCCCGGGGCCGCCATTGACAGAGGGACAAGCAATGGGCTGGCTGAGGCCTGGGACCACTTGGCCTTCTCCTCGGAGAGCCTGCCTGCCTGGGCGGGCCCGCCCGCCACCGCAGCCTCCCAGCTGCTCTCCGTGTCTCCAATCTCCCTTTTGTTTTGATGCATTTCTGTTTTAATTTATTTTCCAGGCACCACTGTAGTTTAGTGAT

The primer sequences used for amplifying the EMX1 gene fragment are as follows:

forward primer: 5'-CCATCCCCTTCTGTGAATGT-3' (identical to SEQ ID No.3 at positions 1-20);

reverse primer: 5'-ATCACTAAACTACAGTGGTGCCTG-3' (complementary to SEQ ID No.3 at positions 677-700).

Under the conditions of in vitro reaction, cas12a (100 nM), crRNA (100 nM), EMX1 gene fragment (1 ng, sequence shown in SEQ ID No. 3), reaction Buffer (10×), ssDNA reporter (100 nM, sequence: 5'-FAM-TTTTTT-BHQ 1-3') were added, and pure water was made up to 50. Mu.L. Cas12a added to the positive control group was LbCas12a, cas12a added to the experimental group was yCas12a, and Cas12a protein was not added to the negative control group (NG group in fig. 3). Fluorescence changes were detected using a Roche light cycler96 real-time fluorescent quantitative PCR instrument (Roche LightCycler 96) at 37 ℃.

3 replicates were set.

As shown in fig. 3, the results indicate that yCas12a has a stronger detection activity.

Example 2 crRNA optimization by yCas12a

In total, 15 crrnas were screened in this example, and all crrnas were synthesized using the T7 RNA Pol transcription kit (neb#e2050). First, primer T7-promoter-F and primer crRNA-R are annealed to form a transcription template. Annealing system:

T7-promoter-F(100μM)	1μL
		crRNA-R(100μM)	1μL
10×T7 RNAPol Reaction Buffer	1μL
		Nuclease-free water	7μL

annealing procedure: 95 ℃ for 10 minutes; cooling to 2 ℃ per second at 95-85 ℃; the temperature is reduced by 1 ℃ every 10 seconds at 85-25 ℃. T7 RNAPol transcription RNA reaction System:

the transcription reaction system is placed in a constant temperature drying incubator at 37 ℃ for overnight reaction. mu.L DNaseI was added and reacted at 37℃for 2 hours to remove Template DNA, followed by the use ofRNA Cleanp Kit (50. Mu.g) was used to purify RNA. Adding 100 mu L of absolute ethyl alcohol into the reaction liquid, fully and uniformly mixing, adding into a purification column, centrifuging at 12000rpm for 2min, discarding waste liquid, adding 500 mu L of 75% ethyl alcohol into the purification column, washing impurities twice, naturally drying to remove residual ethyl alcohol, adding 50 mu L of purified water without nuclease, and eluting to obtain high-purity RNA.

Primer information for crRNA synthesis is shown below:

1、4n96 crRNA

T7-promter-F (nucleotide sequence: TAATACGACTCACTATAGG, the same applies hereinafter)

4n96 crRNA-R：

GGAGGGAGGGGCACAGATGAATCTACCATAGTAGAAATTCCTATAGTGAGT CGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

2、Fn crRNA

Amplification of Fn crRNA with a primer pair consisting of T7-precursor-F and Fn crRNA-R:

Fn crRNA-R：

GGAGGGAGGGGCACAGATGAATCTACAACAGTAGAAATTCCTATAGTGAGT CGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

3、LB3 crRNA

Amplification of LB3 crRNA with a primer pair consisting of T7-promoter-F and LB3 crRNA-R:

LB3 crRNA-R：

GGAGGGAGGGGCACAGATGAGCATGAGAACCATGCTTTCCCTATAGTGAGT CGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

4、Bp crRNA

Amplification of Bp crRNA with a primer pair consisting of T7-promoter-F and Bp crRNA-R:

Bp crRNA-R：

GGAGGGAGGGGCACAGATGAACCTAATTACTAGGTAATTCCTATAGTGAGT CGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

5、Pe crRNA

Amplification of PecrRNA with a primer pair consisting of T7-promter-F and PecrRNA-R:

Pe crRNA-R：

GGAGGGAGGGGCACAGATGAATCTACAAAAGTAGAAATCCCTATAGTGAGT CGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

6、Pb crRNA

Amplification of Pb crRNA with a primer pair consisting of T7-precursor-F and Pb crRNA-R:

Pb crRNA-R：

GGAGGGAGGGGCACAGATGAATCTACAAAAGTAGAAATTCCTATAGTGAGT CGTATTA (1-20 of which is the region targeted to the EMX1 gene, 21-39 of the region of the DR sequence of crRNA, and 40-58 of which is the region complementary to T7-promoter-F).

7、Ss crRNA

Amplification of Ss crRNA with a primer pair consisting of T7-precursor-F and Ss crRNA-R:

Ss crRNA-R：

GGAGGGAGGGGCACAGATGAGTCGCGCCCCGCGTGGGCGCCCTATAGTGA GTCGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

8、Lb2 crRNA

Amplification of Lb2 crRNA with a primer pair consisting of T7-promoter-F and Lb2 crRNA-R:

Lb2 crRNA-R：

GGAGGGAGGGGCACAGATGAATCTACAAGAGTAGAAATTCCTATAGTGAGT CGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

9、Cmt crRNA

Amplification of Cmt crRNA with primer pair consisting of T7-promter-F and Cmt crRNA-R:

Cmt crRNA-R：

GGAGGGAGGGGCACAGATGAATCTACAATAGTAGAAATTCCTATAGTGAGT CGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

10、Ee crRNA

Amplification of Ee crRNA with a primer pair consisting of T7-precursor-F and Ee crRNA-R:

Ee crRNA-R：

GGAGGGAGGGGCACAGATGAATCTACAAAGTAGAAATTCCTATAGTGAGTC GTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

11、Mb crRNA

Amplification of Mb crRNA with a primer pair consisting of T7-promter-F and Mb crRNA-R:

Mb crRNA-R：

GGAGGGAGGGGCACAGATGAATCTACAAACAGTAGAAATTCCTATAGTGAG TCGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

12、Lb crRNA

Amplification of Lb crRNA with a primer pair consisting of T7-promoter-F and Lb crRNA-R:

Lb crRNA-R：

GGAGGGAGGGGCACAGATGAATCTACACTTAGTAGAAATTCCTATAGTGAG TCGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

13、Pd crRNA

Amplification of Pd crRNA with a primer pair consisting of T7-promoter-F and Pd crRNA-R:

Pd crRNA-R：

GGAGGGAGGGGCACAGATGAATCTACCGAAGTAGAAATTCCTATAGTGAGT CGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

14、Ma crRNA

Amplification of MacrRNA with a primer pair consisting of T7-promter-F and MacrRNA-R:

Ma crRNA-R：

GGAGGGAGGGGCACAGATGAATCTACACTAGTAGAAATTCCTATAGTGAGT CGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

15、Lp crRNA

Amplification of Lp crRNA with a primer pair consisting of T7-promoter-F and Lp crRNA-R:

Lp crRNA-R：

GGAGGGAGGGGCACAGATGAATCTACACACAGTAGAAATTCCTATAGTGAG TCGTATTA (region targeted to EMX1 gene at positions 1-20, region of DR sequence of crRNA at positions 21-39, and region complementary to T7-promoter-F at positions 40-58).

yCas12a (100 nM), crRNA (100 nM) using the 15 crRNAs, EMX1 gene fragment (1 ng, nucleotide sequence shown in SEQ ID No. 3),Buffer mixing, incubating at 37deg.C for 5min, adding 1 μl ssDNA reporter (100 nM), and real-time fluorescence using Roche light cycler96A photo quantitative PCR instrument (Roche LightCycler, 96) detects fluorescence change at 37 ℃.3 replicates were set. The experimental results showed that the detection activity of yCas12a was best when pbcrna was used (fig. 4), indicating that pb-type backbones matched most closely to yCas12 a.

Example 3 application of yCas12a to novel coronavirus detection

And (3) carrying out in vitro transcription by using a T7 RNA synthesis kit and taking DNA (shown as SEQ ID No. 4) carrying a novel coronavirus Orf1ab gene as a template, and obtaining high-quality RNA by using an RNA purification kit, namely the Orf1ab-4pb crRNA, measuring the concentration of RNA by using Nanodrop, and converting into copy number according to the molecular weight to obtain the RNA of the novel coronavirus Orf1ab gene.

SEQ ID No.4：

TAATACGACTCACTATAGGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAATACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACACCATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTGATGAGCTGGAGCCAGAGACCGACACACGGGAGCCACTGACTCGGATCCGCAACAACTCAGCCATCCACATCCGAGTCTTCAGGGTCACACCCAAGTAATTGAAAAGACACTCCTCCACTTATCCCCTCCGTGATATGGCTCTTCGCATGCTGAGTACTGGACCTCGGACCAGAGCCATGTAAGAAAAGGCCTGTTCCCTGGAAGCCCAAAGGACTCTGCATTGAGGGTGGGGGTAATTGTCTCTTGGTGGGCCCAGTTAGTGGGCCTTCCTGAGTGTGTGTATGCGGTCTGTAACTATTGCC

Orf1ab-4pb crRNA was amplified with a primer set consisting of T7-promter-F (nucleotide sequence: TAATACGACTCACTATAGG) and Orf1ab-4pb crRNA-R:

Orf1ab-4pb crRNA-R：

GTGAATTTTGTGTCAGACATCTACACACAGTAGAAATTCCTATAGTGAGTCGTATTA (targeting novel coronavirus orf1ab gene at positions 1-18, crRNA DR sequence region at positions 19-38, T7-promoter-F complementation region at positions 39-57).

The sequence of the obtained Orf1ab-4pb crRNA is as follows:

Orf1ab-4pb crRNA：

5’-GUGAAUUUUGUGUCAGACAUCUACACACAGUAGAAAUU-3' (shown as SEQ ID No. 5);

in the yCas12a detection System, RNA of the novel coronavirus Orf1ab gene, yCas12a (100 nM) and crRNA (Orf 1ab-4pb crRNA) (100 nM) are added, mixed uniformly and incubated for 5min at 37 ℃, ssDNA Reporter (100 nM, sequence: 5'-FAM-TTTTTT-BHQ 1-3') is added, and an ABI Real-Time fluorescence quantitative PCR instrument 7500 (ABI 7500Real-Time PCR System) is used for detection at 37 ℃. NG group was negative control, without addition of yCas12a protein.

As shown in FIG. 5, the lowest detection limit for novel coronavirus RNA detection using yCas12a was 200copies/mL.

PAM sequence identification of example 4, yCas12a

In order to identify the PAM sequence recognizable by yCas12a, random mutation is performed on a sequence such as a PAM region sequence of a target DNA fragment, and a library is created by performing second generation sequencing on the mutated target DNA fragment, wherein the library sequence for PAM sequence identification is shown as SEQ ID No.6 in the sequence table, positions 1 to 69 are Adapter-for Illumina (sequence indicated by underline), positions 169 to 172 are PAM (sequence indicated by bold italics), N is base A, T, G or C, positions 173 to 192 are target DNA (sequence indicated by wavy line), and positions 302 to 366 are Adapter-for Illumina (sequence indicated by double underline).

SEQ ID No.6：

Under the condition of in vitro reaction, yCas12a (200 nM), crRNA (200 nM, pb crRNA is used in the example), DNA library (500 ng) and CutSmart Buffer are mixed uniformly, incubated at 37 ℃ for 60min, and inactivated at 65 ℃ for 5min; adding all reaction products into agarose gel, and recovering uncleaved fragments after electrophoresis; performing second generation sequencing on the fragments which are not cut, wherein the total data is 2G; analyzing the second generation sequencing data, and comparing the cutting efficiency of different types of PAM; and drawing a PAM sequence motif diagram recognizable by the yCas12 a.

The motif diagram is shown in fig. 6, indicating that the PAM sequence of yCas12a is approximately of the "kTTN" type.

Example 5 edit Activity verification of yCas12a

yCas12a (200 nM), pb crRNA (200 nM), EMX1 gene fragment (1 μg, nucleotide sequence shown in SEQ ID No. 3),Mixing the materials uniformly, incubating at 37 ℃ for 60min, and inactivating at 65 ℃ for 5min; 10. Mu.L was taken for agarose gel analysis. The agarose gel analysis results are shown in fig. 7, where "uncleaved" is the band of the target DNA fragment that was not sheared and "cleaved" is the band of the target DNA fragment that was sheared, indicating that yCas12a was able to effectively cleave the target DNA fragment at 37 ℃.

Example 6 molecular diagnostic specificity validation of yCas12a

The off-target fragment nucleotide sequence adopted in the embodiment is shown as SEQ ID No.7, wherein positions 218-221 are PAM, and positions 222-242 are target sequences.

SEQ ID No.7：

5’-GCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGT AAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCTTTCTCATCTGTGCCCCTCCCTCCCTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTGCGCCAATTCTGCAGACAAATGGCTCTAGAGGTACCCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTC-3’

Treatment with the yCas12a detection system using yCas12a, control with the LbCas12a detection system using LbCas12 a:

in the yCas12a detection System, yCas12a (100 nM), pb-crRNA (100 nM), cutSmart Buffer (1×), off-target fragment (10 ng) were added, mixed, incubated at 37℃for 5min, ssDNA Reporter (100 nM) was added, and detection was performed at 37℃using ABI 7500Real-Time PCR System.

In the LbCAs12a detection System, lbCAs12a (100 nM), crRNA (100 nM), cutSmart Buffer (1×), off-target fragment (10 ng) were added, mixed, incubated at 37℃for 5min, ssDNA Reporter (100 nM) was added, and detection was performed at 37℃using ABI 7500Real-Time PCR System.

Discriminztion factor(DF)＝([FPM]-background)/([FMM]-background)

As a result, as shown in fig. 8, the position of yCas12a at positions 1-6 after PAM has higher specificity than LbCas12 a.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims (10)

1. A protein characterized in that: the protein is protein yCas12a, and the protein yCas12a is a protein of A1), A2), or A3) as follows:

a1 A protein having an amino acid sequence of SEQ ID No. 2;

a2 A protein which is obtained by substituting and/or deleting and/or adding the amino acid residues in the amino acid sequence shown in the A1) and has the same function, is derived from the A1) or has more than 80% of the same function as the protein shown in the A1);

a3 Fusion proteins obtained by ligating protein tags at the N-terminus or/and the C-terminus of A1) or A2).

2. The protein of claim 1, wherein: a3 The amino acid sequence of the fusion protein is SEQ ID No.2.

3. A nucleic acid molecule encoding the protein of claim 1.

4. A nucleic acid molecule according to claim 3, wherein: the coding sequence of the nucleic acid molecule is shown as 196 th-3999 th position of SEQ ID No.1 in a sequence table.

5. An expression cassette comprising the nucleic acid molecule of claim 3 or 4.

6. A kit for nucleic acid detection, characterized in that: comprising the protein of claim 1 and crRNA, saidThe target sequence of crRNA is 5' -PAM N _19-20 -3', said N _19-20 19-20N, wherein the PAM is 5'-TTTN-3', wherein N is A, T, G or C.

7. A method for detecting nucleic acid, characterized by: comprises reacting the protein, crRNA, reporter DNA with fluorescent signal mark and the object to be tested, and judging the result by using the color development condition of the fluorescent reporter group; the target sequence of the crRNA is 5' -PAM N _19-20 -3', said N _19-20 19-20N, wherein the PAM is 5'-TTTN-3', wherein N is A, T, G or C.

8. The kit according to claim 7 or the nucleic acid detection method according to claim 8, characterized in that: the nucleic acid is a novel coronavirus nucleic acid, and the nucleotide sequence of the crRNA is 5')GUGAAUUUUGUGUCAGACAUCUACACACAGU AGAAAUU-3' (shown in SEQ ID No. 5).

9. A method of gene editing comprising the steps of: mixing the protein of claim 1 with crRNA, a DNA molecule having a crRNA target sequence, and performing gene editing on the DNA having the sgRNA target sequence; the target sequence of the crRNA is 5' -PAM N _19-20 -3', said N _19-20 19-20N, wherein the PAM is 5'-TTTN-3', and N is a base A, T, G or C.

10. Use of the protein of claim 1 or 2, or the nucleic acid molecule of claim 3 or 4, or the expression cassette of claim 5, or the kit of claim 6 or 8, or the nucleic acid detection method of claim 7 or 8, or the method of gene editing of claim 9, in any of the following:

p1, application in nucleic acid detection or application in preparing nucleic acid detection products;

p2, application in gene editing or application in preparing gene editing products;

p3, application in preparing disease diagnosis products;

p4, application in preparing gene therapy products.