CN117802056A

CN117802056A - Candida tropicalis engineering bacteria for efficiently synthesizing beta-ionone and application

Info

Publication number: CN117802056A
Application number: CN202311770042.9A
Authority: CN
Inventors: 陈献忠; 徐洁; 夏媛媛; 杨海泉; 沈微; 曹钰
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2023-12-21
Filing date: 2023-12-21
Publication date: 2024-04-02

Abstract

The invention discloses candida tropicalis engineering bacteria for efficiently synthesizing beta-ionone and application thereof, belonging to the fields of enzyme engineering and metabolic engineering. According to the invention, carotenoid cleavage dioxygenase gene PhCCD1 from plant petunia is selected, random mutation is carried out on PhCCD1 through error-prone PCR, a candida tropicalis beta-carotene production strain ANT-06 is taken as a chassis cell, phCCD1 enzyme mutants are respectively expressed in peroxisomes and cytoplasm of the candida tropicalis beta-carotene production strain ANT-06, three candida tropicalis engineering strains capable of efficiently synthesizing beta-ionone are screened and obtained, the yield reaches 173.6 +/-7.0 mg/L, 136+/-3.9 m/L and 177.9+/-4.3 mg/L, and the PhCCD1 enzyme mutants are obtained from cloning sequencing of the engineering strains.

Description

Candida tropicalis engineering bacteria for efficiently synthesizing beta-ionone and application

Technical Field

The invention relates to candida tropicalis engineering bacteria for efficiently synthesizing beta-ionone and application thereof, belonging to the fields of enzyme engineering and metabolic engineering.

Background

Beta-ionone (beta-ionone) is a natural plant aromatic volatile with a backbone consisting of thirteen carbons, which is an irregular monoterpene compound. Beta-ionone is the product of the oxygenation cleavage of the double bonds of 9, 10 and 9',10' of beta-carotene, and is a yellowish oily liquid. In nature, it is widely found in various plants such as flowers, osmanthus fragrans, petunia, sunflower, etc.; fruits such as apples, raspberries, figs, and the like; vegetables such as carrot, tomato, etc. The beta-ionone is widely applied to commercial production, such as industries of food, cosmetics, daily necessities and the like, and has higher heat in medical and pharmaceutical industries at present because the beta-ionone has certain effects on bacteriostasis, embryotoxicity resistance, blood fat reduction, tumor resistance, cancer resistance and the like. In the global scope, the market demand is larger, and the method has good application prospect.

The synthesis method of beta-ionone includes chemical synthesis method and plant extraction method. The method is characterized in that a chemical synthesis method is used as a main method, for example, citral is used as a raw material, and after aldol condensation reaction is carried out on the citral and acetone, concentrated sulfuric acid is added for cyclization to produce beta-ionone. Currently consumers prefer natural products such that the products obtained by chemical synthesis are less valuable than natural products; the natural product can be extracted from plants, and the plant extraction method usually takes raspberry as a raw material to extract the beta-ionone, but the obtained product has low concentration, long plant growth period and scarce land resources, so that the naturally extracted beta-ionone is expensive.

In addition to the two methods described above, microbial synthesis of β -ionone is increasingly emerging. The microbial synthesis method has the advantages of short growth period, simple process, high yield and the like, and the terpene perfume produced by the method is already recognized as a natural product by European and American legislation, so that the terpene perfume is a good natural product substitute. At present, many researches on biosynthesis of terpenoid substances are reported, the metabolic pathway is clear, and a good foundation is laid for biosynthesis of beta-ionone. Researchers have produced or increased the yield of beta-ionone in Saccharomyces cerevisiae, E.coli, and yarrowia lipolytica by engineering means such as expression of heterologous genes, reconstruction of metabolic pathways, and modification of key enzymes.

As diploid unconventional yeast, candida tropicalis (Candida tropicalis) has the characteristics of fast cell growth, large biomass, wide substrate range, strong environmental tolerance and the like, and has extremely strong industrialization potential and commercial application prospect. Candida tropicalis has been reported to be industrialized and commercialized in the production of long chain dibasic acids and xylitol. In addition, candida tropicalis has the capacity of high grease production, and is a potential chassis cell for efficiently synthesizing terpenes.

There is no report on the synthesis of beta-ionone by candida tropicalis at present, and no report on the improvement of the beta-ionone yield by the directed evolution of carotenoid cleavage dioxygenase PhCCD1 in yeast. Therefore, the enzyme mutant capable of efficiently synthesizing the beta-ionone and the novel engineering strain capable of efficiently producing the beta-ionone are provided, and the novel engineering strain has great value for further production and application of the beta-ionone.

Disclosure of Invention

According to the invention, carotenoid cleavage dioxygenase gene PhCCD1 from plant petunia is selected, random mutation is carried out on PhCCD1 through error-prone PCR, candida tropicalis is taken as chassis cells, and PhCCD1 enzyme mutants are expressed in peroxisomes and cytoplasm of candida tropicalis respectively, and candida tropicalis engineering strains capable of efficiently synthesizing beta-ionone are obtained through screening.

It is a first object of the present invention to provide a carotenoid-cleaving dioxygenase mutant having one or more mutations at positions 11, 82, 98, 297, 422 of the amino acid sequence shown in SEQ ID NO. 8.

In one embodiment, the glutamic acid at position 297 is mutated to glycine; alternatively, glutamic acid at position 11 is mutated to glycine and glycine at position 82 is mutated to serine and arginine at position 112 is mutated to glycine; alternatively, glycine at position 98 is mutated to serine and tyrosine at position 422 is mutated to histidine.

In one embodiment, the amino acid sequence of the carotenoid cleavage dioxygenase mutant is shown in SEQ ID NO. 9-11.

In one embodiment, the PhCCD1 is derived from a plant petunia, and the nucleotide sequence is set forth in SEQ ID No. 7.

It is a second object of the present invention to provide a gene encoding any of the above carotenoid cleavage dioxygenase mutants.

In one embodiment, the nucleotide sequence of the carotenoid cleavage dioxygenase mutant is shown in SEQ ID NO. 1-3.

The invention also provides a recombinant plasmid carrying the gene.

The invention also provides a host cell carrying the gene or the recombinant plasmid.

In one embodiment, the host may be candida tropicalis or saccharomyces cerevisiae or pichia pastoris or kluyveromyces. Alternatively, the host is candida tropicalis.

It is a third object of the present invention to provide a catalyst comprising any of the above carotenoid cleavage dioxygenase mutants or any of the above host cells.

The invention also provides a method for synthesizing beta-ionone, which uses the catalyst to catalyze beta-carotene to synthesize beta-ionone.

In one embodiment, the enzyme is subjected to random mutation by using an error-prone PCR technology to obtain a PhCCD1 random mutation fragment, and the PhCCD1 mutation fragment is inserted into a pre-constructed gene expression cassette vector to obtain a PhCCD1 random mutation library for candida tropicalis transformation.

In one embodiment, the Mn in the system is altered by using low fidelity Taq enzyme ²⁺ Error-prone PCR is performed by concentration, so that the random mutation of PhCCD1 enzyme is realized, and a PhCCD1 random mutation fragment library is obtained.

In one embodiment, mn in the system ²⁺ The concentration was 0.05/0.1/0.2/0.3/0.4/0.5/0.6mmol/L.

In one embodiment, different concentrations of Mn ²⁺ The obtained PCR products are recovered into one tube, and three groups of parallel PCR products are used for connecting with a carrier.

In one embodiment, the random mutation library building block is "T-carrier-homology arm-selectable marker-promoter-PhCCD 1 random mutant fragment-terminator".

In one embodiment, the reusable screening marker is URA3; the promoter is candida tropicalis endogenous promoter PGAPDH; the terminator is candida tropicalis endogenous TENO1; the homology arm is derived from any endogenous gene in candida tropicalis that does not affect the growth of the yeast.

In one embodiment, the nucleotide sequence of the selectable marker URA3 gene is shown in SEQ ID NO. 4; the nucleotide sequence of the promoter PGAPDH is shown in SEQ ID NO. 5; the nucleotide sequence of the terminator TENO1 is shown in SEQ ID NO. 6.

In one embodiment, the random mutation library for candida tropicalis transformation is obtained by ligating PhCCD1 random mutation fragments with a pre-constructed vector, transforming escherichia coli, and extracting plasmids. Before the candida tropicalis is transformed, the candida tropicalis is subjected to enzyme digestion and linearization.

The invention screens and obtains candida tropicalis engineering bacteria for efficiently synthesizing beta-ionone, integrates the random mutation library into any site which does not influence the growth of candida tropicalis genome, and is obtained by shake flask two-phase fermentation verification after multi-round plate screening.

In one embodiment, the candida tropicalis beta-ionone engineering bacteria have orange precursor beta-carotene, pale yellow beta-ionone product and PhCCD1 enzyme catalyzed beta-carotene to produce beta-ionone, so the candida tropicalis engineering bacteria have lighter color than the original strain, and potential forward mutant strains can be obtained through multiple rounds of plate screening.

In one embodiment, the candida tropicalis engineered bacterium is characterized in that the PhCCD1 enzyme mutant is localized to the peroxisome or cytoplasm; the peroxisome localization signal peptide is codon optimized ePTS, and is derived from Saccharomyces cerevisiae, and the nucleotide sequence of the peroxisome localization signal peptide is shown as SEQ ID NO. 12.

In one embodiment, chromosomal integration of the PhCCD1 enzyme mutant can be achieved using CRISPR-Cas9 gene editing techniques.

The invention provides several PhCCD enzyme mutants for efficiently synthesizing beta-ionone, which are obtained by cloning in vitro by using candida tropicalis engineering bacteria for synthesizing the beta-ionone.

In one embodiment, the PhCCD1 enzyme mutant sequence is obtained by snager sequencing.

In one embodiment, the PhCCD1 enzyme mutants are each designated PhCCD1 ^C61 、PhCCD1 ^E13 、PhCCD1 ^E43 ；

In one embodiment, the PhCCD1 mutant PhCCD1 ^C61 The cytoplasmic expression is adopted, the copy number is 2, and the nucleotide sequence is shown as SEQ ID NO. 1;

in one embodiment, the PhCCD1 mutant PhCCD1 ^E13 The expression of peroxisome is carried out, the copy number is 1, and the nucleotide sequence is shown as SEQ ID NO. 2;

in one embodiment, the PhCCD1 mutant PhCCD1 ^E43 The expression of peroxisome is adopted, the copy number is 2, and the nucleotide sequence is shown as SEQ ID NO. 3;

the invention also provides a method for producing beta-ionone by fermentation, which comprises the steps of adding any candida tropicalis engineering bacteria into a fermentation medium, and carrying out shake flask two-phase fermentation to obtain the beta-ionone.

In one embodiment, beta-ionone is produced by fermentation using Y60 medium.

In one embodiment, the Y60 medium is YPD medium having a glucose content of 60 g/L.

In one embodiment, the strain is streaked onto a 2XYPD plate and incubated at 30℃for 48h;

picking single colony, inoculating into 20mL 2xYPD liquid culture medium, and culturing to obtain seed solution OD ₆₀₀ 8 to 15;

seed solution was inoculated into a 250ml Erlenmeyer flask containing 15ml of Y60 medium to OD ₆₀₀ About 0.1, placing at 30 ℃ and shaking culture at 200rpm for 8 hours;

adding 10% n-dodecane, and fermenting at 30deg.C with shaking table at 200rpm for 96 hr.

The invention also provides the application of any carotenoid cleavage dioxygenase mutant, the gene, the recombinant plasmid or any host cell in the synthesis of beta-ionone.

The invention also provides the application of any carotenoid cleavage dioxygenase mutant or any host cell in the fields of food, chemical industry and medicine. The candida tropicalis engineering bacteria and the PhCCD1 mutant provided by the invention are applied to the fields of food, daily chemicals, chemical industry, medical treatment or pharmacy.

Advantageous effects

According to the invention, carotenoid cleavage dioxygenase gene PhCCD1 from plant petunia is selected, random mutation is carried out on PhCCD1 through error-prone PCR, a candida tropicalis beta-carotene production strain ANT-06 is taken as a chassis cell, phCCD1 enzyme mutants are respectively expressed in peroxisomes and cytoplasm of the candida tropicalis beta-carotene production strain ANT-06, candida tropicalis engineering strains capable of efficiently synthesizing beta-ionone are screened and obtained, and cloning and sequencing are carried out from the engineering strains, so that the PhCCD1 enzyme mutants are obtained.

The candida tropicalis engineering bacteria constructed by the PhCCD1 enzyme mutant obtained by the method of the invention are subjected to shake flask two-phase fermentation, 15mL Y60 liquid medium is subjected to shake flask two-phase fermentation for 96 hours under the condition of 30 ℃ and 200rpm, and engineering bacteria C61 expresses mutant PhCCD1 in cytoplasm ^C61 Copy number 2, beta-viologenThe yield of the lanone is 173.6 +/-7.0 mg/L (5.4+/-0.3 mg/g DCW; dry Cell Weight is the Dry Cell Weight), and compared with the engineering bacteria cytPh-D (83.1+/-2.9 mg/L) of a control group of which the copy number is 2 and which expresses the unmutated PhCCD1 in cytoplasm, the yield is increased by 109%;

engineering bacterium E13 in-vivo expression mutant PhCCD1 of peroxidase ^E13 The copy number is 1, the yield of beta-ionone is 136+/-3.9 m/L (4.1+/-0.1 mg/g DCW), and compared with a control group with the copy number of 1 and in which the peroxidase in vivo expresses non-mutated PhCCD1, the yield of the engineering bacterium Ph-S is increased by 386 percent and 4.9 times compared with the control group with the peroxidase in-vivo expresses non-mutated PhCCD 1;

engineering bacterium E43 in vivo expression mutant PhCCD1 of peroxidase ^E43 The copy number is 2, the yield of beta-ionone is 177.9+/-4.3 mg/L (5.7+/-0.1 mg/g DCW), and the yield is increased by 75 percent compared with the control group Ph-D (101.4+/-7.0 mg/L) of which the copy number is 2 and in which the peroxidase in vivo expresses the unmutated PhCCD1.

According to the invention, the PhCCD1 enzyme mutant capable of efficiently catalyzing and synthesizing the beta-ionone is obtained through the directed evolution of the enzyme, and the candida tropicalis beta-ionone engineering bacterium can efficiently synthesize the beta-ionone by utilizing the simple carbon source glucose, so that the PhCCD1 enzyme mutant has a good application prospect.

Drawings

Fig. 1: the synthesis route of candida tropicalis beta-ionone is schematically shown;

fig. 2: principle of directed evolution of enzymes;

fig. 3: the candida tropicalis beta-ionone engineering bacteria constructed by the invention are subjected to shake flask two-phase fermentation, and the beta-ionone yield is increased;

fig. 4: the constructed plasmid Ts-GRE 3-gda-324-URRA 3-PGAPDH-PhCCD1-TENO1 map;

fig. 5: the plasmid Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-ePTS-TENO1 map constructed by the invention.

Detailed Description

1. MM medium:

20g/L glucose, 10g/L ammonium sulfate, 6.7g/L YNB (Yeast Nitrogen Base Without Amino acids);

2. sources of enzymes

Ordinary Taq enzyme, available from Norflu, 2X Taq Plus Master Mix II (Dye Plus), cat: p213-01;

high fidelity Taq enzyme was purchased from Takara,HSDNA Polymerase，Code No.R010A。

3. expression cassette vector construction

The construction method of the Ts-GRE 3-gda-324-URRA 3-PGAPDH-PhCCD1-ePTS-TENO1 is as follows:

(1) Construction of linearization fragment-PGAPDH-PhCCD 1-ePTS-TENO1-

The carotenoid cleavage dioxygenase gene PhCCD1 derived from plant petunia is synthesized by Tianzhan biotechnology company according to the preference of tropical pseudowire codon after codon optimization (the nucleotide sequence of the sequence is shown as SEQ ID NO. 7), and is connected to a plasmid pUC57, and the synthesized plasmid is named pUC57-PhCCD1. Designing a primer PXPS-F/R (the primer is shown in table 1), taking the plasmid as a template, and carrying out PCR amplification to obtain a linear fragment-PhCCD 1-ePTS-, wherein both ends of the linear fragment contain enzyme cutting sites SacI and XhoI, and also respectively contain a promoter PGAPDH (the nucleotide sequence is shown as SEQ ID NO. 5) and a terminator TENO1 (the nucleotide sequence is shown as SEQ ID NO. 6) partial homologous fragments; the linear fragment is purified by a gel recovery and purification kit for standby.

Taking a plasmid Ts-TPGK1-carB-PFBA1-PGAPDH-carRP-TENO1 constructed in the earlier stage of a laboratory as a template (specifically referred to in the literature of systematic metabolic engineering for producing terpenoid natural products by candida tropicalis), obtaining a fragment-TENO 1-Ts-TPGK1-carB-PFBA 1-PGAPDH-after enzyme digestion and recovery by SalI and NheI, connecting the fragment with a linear fragment-PhCCD 1-ePTS-by a one-step connection kit, converting the fragment into escherichia coli JM109 by a chemical conversion method, coating ampicillin-resistant LB plates, and culturing the fragments at 37 ℃ for 10-12h; colony PCR screening correct transformant, inoculating to ampicillin resistance LB liquid medium, culturing at 37 deg.C and 200rpm for 10-12h; extracting plasmid for enzyme digestion verification;

the plasmid which is verified to be correct is used as a template, a primer guPPT-F/R (the primer is shown in table 1) is designed, and a PCR amplified linear fragment-PGAPDH-PhCCD 1-ePTS-TENO 1-is purified by a gel recovery and purification kit for later use.

(2) Construction of plasmid Ts19-GRE3-gda324-URA3-PGAPDH-PhCCD1-ePTS-TENO1

The plasmid Ts19-GRE3-gda324-URA3 is constructed in the earlier stage in laboratory, and is specifically disclosed in the literature of metabolic engineering modification of candida tropicalis for producing 1,2, 4-butanetriol (the original plasmid is named as Ts UDGRE3-gda-URA3-UDGRE3, and is abbreviated as Ts19-GRE 3-gda-324-URA 3), and the nucleotide sequence of the URA3 is shown as SEQ ID NO. 4. The plasmid T19-GRE3-gda324-URA3 is digested and purified by EcoRI to obtain a linear fragment-Ts 19-GRE3-gda324-URA3-, wherein the two ends of the fragment respectively have 20bp specific sequences, and the sequence at the 3' end is homologous to the 20bp sequence at the end of a terminator TENO1; the 5 'end of the linear fragment-PGAPDH-PhCCD 1-ePTS-TENO 1-has a 20bp sequence which is homologous to the 5' end 20bp sequence of the linear fragment-Ts 19-GRE 3-gda-URA 3-; the two linear fragments are connected by a one-step connection kit and then transformed into escherichia coli JM109, ampicillin resistance LB plates are coated, a colony PCR of a primer GRE3-F/R (the primer is shown in table 1) is used for screening correct transformants, a plasmid Ts19-GRE 3-gda-URA 3-PGAPDH-PhCCD1-ePTS-TENO1 is obtained by extracting the plasmid after culturing by a liquid culture medium and by a plasmid extraction kit, a plasmid map is shown in figure 5, enzyme digestion is carried out to verify whether the plasmid is correct, and sequencing is carried out to verify the target gene and the signal peptide.

TABLE 1 expression cassette vector primers

The construction method of the Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-TENO1 is as follows:

designing primers cytPh-F and cytPh-R (the primers are shown in Table 2), and carrying out PCR amplification by taking the plasmid pUC57-PhCCD1 constructed in the step (1) as a template to obtain a linear fragment-PhCCD 1-ePTS-, wherein both ends of the linear fragment contain enzyme cutting sites SacI and XhoI; the linear fragment is purified by a gel recovery and purification kit for standby. The remaining steps are the same as above, and the plasmid map is shown in FIG. 4.

TABLE 2 expression cassette vector primers

Primer(s)	Sequence (5 '-3')
		cytPh-F	CGCTCGAGATGGGTAGAAAGGAATCCG
cytPh-R	GCGAGCTCttaCAACTTAGCTTGTTCTTGGATTT

4. Principle of directed evolution of enzymes

The principle of directed evolution of the carotenoid cleavage dioxygenase PhCCD1 is shown in figure 2. Firstly, obtaining a mutation library through error-prone PCR, then linearizing the mutation library into chassis cells, and obtaining engineering strains with high yield through multiple rounds of strain screening.

Example 1: construction of PhCCD1 random mutation library for Candida tropicalis transformation

1. Randomly mutated PhCCD1 gene

(1) Determination of Mn in error-prone PCR System ²⁺ Concentration of

The PhCCD1 gene is obtained by using Tolin biotechnology limited company through codon optimization of candida tropicalis, the sequence is shown as SEQ ID NO.7 (the amino acid sequence is shown as SEQ ID NO. 8), and the gene PhCCD1 is integrated into a plasmid pUC57 to construct a plasmid pUC57-PhCCD1. Primers Ph-F, ph-R (containing ePTS) and cytPh-R (primers shown in Table 3) were designed using the plasmid as a template. Mn in PCR System ²⁺ The concentrations are respectively set to be 0, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 and 1.0mmol/L, error-prone PCR is carried out by using low-fidelity Taq enzyme, PCR products are obtained by amplification, and the PCR products under six concentrations are recovered into a tube; agarose gel electrophoresis is used for verifying whether the PCR product successfully amplifies the target fragment or not, and the target fragment is lightened by a stripJudging the degree, and finally selecting Mn ²⁺ The concentration of 0, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5 and 0.6mmol/L are error-prone PCR condition variables.

TABLE 3 primer sequences

(2) Acquisition of PhCCD1 random mutant fragments

Using the plasmid pUC57-PhCCD1 constructed in step (1) as a template, using primers Ph-F, ph-R (ePTS), cytPh-R (see Table 3), mn was added at a concentration of 0, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0mmol/L, respectively, using low-fidelity Taq enzyme ²⁺ Error-prone PCR was performed and the amplified products were mixed to obtain-PhCCD 1-ePTS-, -PhCCD 1-random mutant fragments.

2. Construction of PhCCD1 random mutation library

Taking the PhCCD1 random mutation fragment prepared in step 1, and obtaining fragment-PhCCD 1-ePTS-and fragment-PhCCD 1-after XhoI and SacI enzyme digestion; the pre-constructed gene expression cassette vector Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-ePTS-TENO1, and the Ts-GRE 3-gda-URRA 3-PGAPDH-PhCCD1-TENO1 are subjected to double enzyme digestion by XhoI and SacI respectively to obtain a vector segment-TENO 1-Ts-GRE 3-gda-324-URRA 3-PGAPDH- (for peroxisome) and a vector segment-TENO 1-Ts-GRE3-gda324-URRA3-PGAPDH- (for cytoplasm).

E.coli JM109 is transformed after the segment-PhCCD 1-ePTS-and the carrier-TENO 1-Ts-GRE 3-gda-324-URRA 3-PGAPDH- (for peroxisome) are connected by Solution I, transformants are scraped into the same tube respectively, plasmids are extracted after culturing, and PhCCD1 random mutation library Ts-GRE 3-gda-324-URRA 3-PGAPDH-PhCCD1 is obtained ^mutants -ePTS-TENO1。

E.coli JM109 is transformed after the segment-PhCCD 1-and the carrier-TENO 1-Ts-GRE 3-gda-324-URRA 3-PGAPDH- (for cytoplasm) are connected by Solution I, transformants are scraped into the same tube respectively, plasmids are extracted after culture, and PhCCD1 random mutation library Ts-GRE 3-gda-324-URRA 3-PGAPDH-PhCCD1 is obtained ^mutants -TENO1。

3. Construction of PhCCD1 random mutation library for Candida tropicalis transformation

Taking 2 to construct a PhCCD1 random mutation library Ts-GRE 3-gda-URRA 3-PGAPDH-PhCCD1 ^mutants -ePTS-TENO1，Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1 ^mutants MluI restriction linearization of TENO1 to obtain a random mutation library of PhCCD1 for Candida tropicalis transformation-GRE 3-gda-324-URRA 3-PGAPDH-PhCCD1 ^mutants -ePTS-TENO1-GRE3-、-GRE3-gda324-URRA3-PGAPDH-PhCCD1 ^mutants -TENO1-GRE3-。

Example 2: construction of candida tropicalis engineering bacteria for efficient synthesis of beta-ionone

1. Acquisition of GRE 3-targeting sgRNA transient expression cassettes

The method comprises the steps of obtaining sgRNA of a targeted candida tropicalis GRE3 locus through software sgRNAcas9 analysis design, taking a laboratory pre-constructed sgRNA targeted expression cassette plasmid pUC57-ptsgURA3 (disclosed in construction and application of a candida tropicalis CRISPR-dCAS9 system based on tRNA-gRNA strategy) as a template, designing a primer sgGRE3-F/R (the primer is shown in Table 4), taking the plasmid as the template, amplifying a sgRNA expression cassette containing the targeted GRE3 gene through whole plasmid PCR, transferring the expression cassette into competent cells of escherichia coli JM109 through a chemical transformation method after purification, coating ampicillin resistance LB plates, and culturing in a 37 ℃ incubator for 10-12h; randomly picking a plurality of single colonies for colony PCR to verify whether the sgRNA sequence is inserted correctly; the correct single colony is inoculated in LB liquid medium containing ampicillin resistance, cultured for 8-10h at 37 ℃ and 200rpm, plasmid is extracted by a plasmid extraction kit, sequencing is carried out to verify whether the sgRNA sequence is correct, and the sgRNA plasmid expression cassette Ts-sgRNA-GRE3 of the target GRE3 is obtained. The plasmid is used as a template, and a primer M13-F/R (the primer is shown in Table 4) is used for PCR amplification to obtain a sgRNA transient expression cassette-sgRNA-GRE 3-of the targeted GRE3.

TABLE 4 primer sequences

Primer name	Sequence (5 '-3')
		sgGRE3-F	CCCATTGTTGGACACCTGGAgttttagagctagaaatagc
sgGRE3-R	TCCAGGTGTCCAACAATGGGtgcaagaaccgggaatcgaa
		M13-F	TGTAAAACGACGGCCAGT
M13-R	CAGGAAACAGCTATGAC

The uracil-deficient strain ANT-07 is obtained by taking beta-carotene engineering bacteria ANT-06 established in the early stage of the laboratory as an initial strain (the specific construction method can refer to the literature of systemic metabolic engineering for producing terpenoid natural products by candida tropicalis), and popping up a marker gene URA3 by using a LiCl transformation method. The PhCCD1 random mutation library for Candida tropicalis transformation constructed in example 1-GRE 3-gda-324-URRA 3-PGAPDH-PhCCD1 ^mutants -ePTS-TENO1-GRE3-、-GRE3-gda324-URRA3-PGAPDH-PhCCD1 ^mutants TENO1-GRE 3-is respectively mixed with a sgRNA transient expression cassette-sgRNA-GRE 3-of the targeted GRE3 according to the proportion of 1:1, alcohol precipitation is carried out, a high-concentration DNA fragment to be converted is obtained, the DNA fragment is integrated on an engineering bacterium ANT-07 genome by a LiCl conversion method, a transformant is obtained, and a specific conversion method can refer to a literature of systemic metabolic engineering for producing terpenoid natural products by candida tropicalis.

The synthesis path of the beta-ionone is shown in figure 1, and the precursor substance beta-carotene is orange, the product beta-ionone is pale yellow, and PhCCD1 enzyme catalyzes the beta-carotene to generate the beta-ionone, so that the color of the candida tropicalis engineering bacteria for synthesizing the beta-ionone is lighter than that of the original strain. And (3) streaking yeast transformants with light colors on MM plates, comparing color differences after the lawn grows out, and obtaining potential forward mutant strains named C61, E13 and E43 respectively through multiple rounds of plate screening.

Example 3: phCCD enzyme mutant sequence determination

Taking candida tropicalis engineering bacteria strains C61, E13 and E43 obtained in the example 2, respectively carrying out plate streaking to obtain lawn, and extracting a yeast genome; the yeast genome is used as a template, and a primer Ph-F, te-R (the primer is shown in Table 5) is used for PCR amplification of high-fidelity enzyme and purification to obtain a fragment-PhCCD 1 ^mutants -ePTS-、-PhCCD1 ^mutants The obtained fragment was ligated with a commercial vector T-vector19 (Simple), E.coli JM109 was transformed, and plasmid Ts-PhCCD1 was constructed ^mutants -ePTS、Ts-PhCCD1 ^mutants The method comprises the steps of carrying out a first treatment on the surface of the And (3) carrying out sanger sequencing on the plasmid to obtain a nucleotide sequence of the PhCCD enzyme mutant, wherein the sequence is shown as SEQ ID NO. 1-3. Compared with PhCCD1, the enzyme mutant PhCCD1 ^C61 、PhCCD1 ^E13 、PhCCD1 ^E43 The amino acid sequence of the mutant is shown in SEQ ID NO. 9-11, and the amino acid sequence of the mutant is shown in Table 6.

TABLE 5 primer sequences

Primer name	Sequence (5 '-3')
		Ph-F	GCCTCGAGATGGGTAGAAAGGAATCCGATG
Te-R	gagaccccaagataacgaatatc

TABLE 6 amino acid mutations corresponding to enzyme mutants

Name of the name	Amino acid mutation points
		PhCCD1	Wild type
PhCCD1 ^C61	E11G，G82S，R112G
		PhCCD1 ^E13	G98S，Y422H
PhCCD1 ^E43	E297G

Example 4: efficient synthesis of beta-ionone by engineering bacteria

The construction method of the candida tropicalis engineering bacteria of the control group is as follows:

(1) Construction of strain Ph-S/D: the plasmid Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-ePTS-TENO1 constructed in the specific embodiment is subjected to MluI enzyme digestion to obtain a linearization fragment-GRE 3-gda-324-URRA 3-PGAPDH-PhCCD1-ePTS-TENO1-GRE3-; mixing (1:1) the linear fragment with a GRE 3-targeted sgRNA transient expression cassette-sgRNA-GRE 3- (example 2, step 1), and alcohol precipitating to obtain a high concentration DNA fragment; yeast ANT-07 is transformed by LiCl transformation, phCCD1-ePTS is integrated into the genome GRE3 locus, and PhCCD1-ePTS single copy strain Ph-S and PhCCD1-ePTS double copy strain Ph-D are obtained.

(2) Construction of the strain cytPh-D: the plasmid Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-TENO1 constructed in the specific embodiment is subjected to MluI digestion to obtain a linearization fragment-GRE 3-gda324-URRA3-PGAPDH-PhCCD1-TENO1-GRE3-; mixing (1:1) the linear fragment with a GRE 3-targeted sgRNA transient expression cassette-sgRNA-GRE 3- (example 2, step 1), and alcohol precipitating to obtain a high concentration DNA fragment; yeast ANT-07 was transformed by LiCl transformation, and PhCCD1 was integrated into the genomic GRE3 locus to obtain the PhCCD1 double-copy strain cytPh-D.

Marking the candida tropicalis engineering strains C61, E13 and E43 obtained in the example 2 and candida tropicalis engineering strains of a control group on a YPD flat plate to obtain single colonies; single colony was picked up and inoculated into 20mL (50 mL Erlenmeyer flask) YPD liquid medium, cultured at 30℃and 200rpm to OD ₆₀₀ 8-15, obtaining seed liquid; seed solution was inoculated into 15mL (250 mL Erlenmeyer flask) Y60 liquid medium to OD ₆₀₀ Reaching 0.1 (inoculum size is about 1% v/v), adding 10% v/v n-dodecane after culturing at 30 ℃ and 200rpm for 8 hours, extracting in situ, and fermenting in shake flask for 96 hours to produce the beta-ionone. And collecting an upper organic phase, and carrying out GC-MS detection and analysis to determine the content of the beta-ionone.

The GC-MS detection conditions are specifically as follows:

after the two-phase fermentation of the shake flask is finished, 12000rpm and 5min are carried out, and fermentation liquid is layered, wherein the steps are as follows: thallus, water phase and organic phase. Collecting an upper organic phase (dodecane phase), adding anhydrous sodium sulfate (0.5 g/mL) into the organic phase, oscillating for 10min by an oscillator, and standing for 2h to achieve the aim of removing water; centrifuging again at 12000rpm for 5min, removing anhydrous sodium sulfate, and collecting an organic phase; the organic phase was diluted with n-hexane and filtered through a 0.22 μm organic filter, and the yield of β -ionone was detected by GC-MS.

Detection of beta-ionone: high resolution gas chromatograph-mass spectrometer (extrazactive GC) (sammer, feishier technologies, germany) was used by gas chromatography-mass spectrometry (GC-MS). Sample injection amount, 1 μl; split ratio, 10:1. The detection condition is that the initial column temperature is controlled at 50 ℃ and kept for 1min; heating to 160 ℃ at a speed of 10 ℃/min, heating to 230 ℃ at a speed of 20 ℃/min, and keeping for 10min; the temperature of the sample inlet is 250 ℃; the temperature of the ion source is 260 ℃ and the scanning range of the mass spectrum is 35-350 m/z. The purity of the standard product used for the beta-ionone is 98 percent (Shanghai source leaf biotechnology Co., ltd.) and the concentration is 1 mg/L-50 mg/L.

As shown in FIG. 3, the engineering bacterium C61 expresses mutant PhCCD1 in cytoplasm ^C61 The copy number is 2, the yield of beta-ionone is 173.6 +/-7.0 mg/L (5.4+/-0.3 mg/g DCW; dry Cell Weight is the Dry Cell Weight), and compared with the engineering bacteria cytPh-D (83.1+/-2.9 mg/L) of a control group with the copy number of 2 and the cytoplasmic expression of unmutated PhCCD1, the yield is increased by 109%;

Although the present invention has been described with reference to the above embodiments, it is not limited thereto, and any changes and modifications may be made by those skilled in the art without departing from the spirit and scope of the present invention. The protection scope of the present invention shall be defined by the claims.

Claims

1. A carotenoid cleavage dioxygenase mutant, characterized in that the carotenoid cleavage dioxygenase mutant has one or more mutations at positions 11, 82, 98, 297, 422 of the amino acid sequence shown in SEQ ID No. 8.

2. The carotenoid cleavage dioxygenase mutant according to claim 1, wherein glutamic acid at position 297 is mutated to glycine; alternatively, glutamic acid at position 11 is mutated to glycine and glycine at position 82 is mutated to serine and arginine at position 112 is mutated to glycine; alternatively, glycine at position 98 is mutated to serine and tyrosine at position 422 is mutated to histidine.

3. A gene encoding the carotenoid cleavage dioxygenase mutant according to any one of claims 1 to 2.

4. A recombinant plasmid carrying the gene of claim 3.

5. A host cell harboring the gene of claim 3 or the recombinant plasmid of claim 4.

6. The host cell of claim 5, wherein the host cell is candida tropicalis.

7. The host cell of claim 5, wherein the carotenoid-cleaving dioxygenase mutant in candida tropicalis is expressed in the cytoplasm or in the peroxisome.

8. A catalyst comprising a carotenoid cleavage dioxygenase mutant according to any one of claims 1 to 2 or a host cell according to claims 5 to 6.

9. A method for synthesizing β -ionone, wherein the catalyst of claim 7 is used to catalyze β -carotene to synthesize β -ionone.

10. Use of a carotenoid cleavage dioxygenase mutant according to any one of claims 1 to 2 or a mutant gene according to claim 3 or a recombinant plasmid according to claim 4 or a host cell according to any one of claims 5 to 6 for the synthesis of β -ionone.