CN117778355A - High specific activity alkaline xylanase mutant - Google Patents

Abstract

The invention relates to the technical field of genetic engineering and protein engineering, in particular to a high specific activity alkaline xylanase mutant and application thereof. Compared with the wild type, the specific activity of the mutant is obviously improved, the production cost can be obviously reduced, and the mutant is favorable for wide application in the industrial fields of papermaking and the like.

Description

High specific activity alkaline xylanase mutant

Technical Field

The invention relates to the technical field of genetic engineering and protein engineering, in particular to a high specific activity alkaline xylanase mutant and application thereof.

Background

Cellulose, hemicellulose and lignin are the main components of plant hemicellulose, which together form a supporting framework of plant cell walls, and among the three, hemicellulose occupies more than 35% of plant dry weight, and is also a generic term of various complex glycans, the main component of which is xylan, which is a complex poly-five-carbon sugar. The main chain of the xylan is formed by connecting a plurality of xylopyranosyl groups through beta-1-4-glycosidic bonds, and a plurality of different substituents are connected to the side chain, mainly acetyl, glucuronyl, L-arabinosyl and the like, so that the complete degradation of the xylan needs to be participated by a plurality of enzymes.

Xylanase (Xylanase, EC 3.2.1.8) acts endometrically on the backbone of xylan, the most critical enzyme in the xylanolytic enzyme system. Xylanase is of very broad origin and can be produced by different kinds of microorganisms. Xylanases can be classified as alkaline, neutral and acidic according to their tolerance to acid-base environments.

Because of the potential industrial application of xylanases, more attention has been paid in the last decade, with alkaline xylanases being used mainly in pulp and paper industry. The application of the alkaline xylanase in the papermaking industry mainly comprises pulping, assisting bleaching, changing fiber property, deinking waste paper and the like. In industrial production, the pulping process is to remove lignin by high temperature digestion under alkaline conditions. In order to achieve a pulp dissolving cellulose purity of 98%, this requires a large amount of sodium hydroxide to treat the pulp, causing serious environmental pollution, for which many scholars have in turn tried to treat the pulp biologically, whereas xylanases for pulp bleaching should be thermostable and alkali-resistant. Feng Jianliang and the like, the xylanase pretreatment of wheat straw and the conventional chemical pulping method are used for carrying out a comparison experiment, and the xylanase pretreatment improves the delignification degree of the raw material and can also reduce the kappa number of paper pulp. Khasin et al obtained a xylanase derived from alkaline strain Bacillus stearothermophilus T which had the best bleaching effect on pulp at pH 9.0 and 65 ℃.

The enzymatic properties of xylanase determine the potential and application field of xylanase, but at present, the application of xylanase has a plurality of problems to be solved, and the activity and yield of xylanase are also the restriction factors of industrial application of xylanase. The genetic engineering method is applied to strain improvement and xylanase modification to develop xylanase products meeting the requirements of different application fields. For example, cao Yufan et al, based on the GH11 family xylanase xyn11A-LC, established a random mutant gene library, screened three mutants with significantly improved wild-type alkalophilicity, subjected to site-directed mutagenesis on the analyzed key sites by protein molecular simulation, and finally obtained three mutants with significantly improved alkalophilicity compared with the wild-type. The method comprises the steps of using GH10 family high-temperature xylanase from Bispora sp.MEY-1 as a male parent, using GH10 family xylanase Xyle from Penicillium canescens as a female parent, replacing a section in the male parent with a section corresponding to the female parent by adopting a molecular biological technology, and then carrying out section combination for expression. Under the transformation condition, the specific activity and the thermal stability of the xylanase mutant are obviously improved compared with those of a wild type (before mutation).

At present, a great deal of research and modification on enzymatic properties of xylanase are performed to adapt to different application scenes, but specific activity is also a key index for limiting the application of xylanase. The higher the specific activity of xylanase per se, the lower the production cost, the lower the price of the enzyme, and the wider application of the xylanase.

Disclosure of Invention

The invention provides a high specific activity alkaline xylanase mutant and application thereof for solving the problems in the prior art. Compared with the wild type, the specific activity of the mutant is obviously improved, and the mutant is favorable for wide application in the industrial fields of papermaking and the like.

One aspect of the invention relates to a xylanase mutant comprising an amino acid sequence having at least 90% identity to SEQ ID No. 1 and comprising a substitution of an amino acid at least one position selected from the group consisting of SEQ ID No. 1: 31, 37, 39, 41, 42, 43, 54, 92, 102, 119, 122, 123, 132, 134, 141, 142, 144, 145, 150, 156, 167, 168, 169, 172, 175, 186.

In some embodiments of the invention, the amino acid sequence of the mutant has at least 91%,92%,93%,94%,95%,96%,97%,98%, or at least 99% identity as compared to SEQ ID NO. 1.

In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%,99.2%,99.3%,99.4%,99.5%,99.6%,99.7%,99.8%, or at least 99.9% identity compared to SEQ ID No. 1.

In some embodiments of the invention, the mutant comprises a substitution of at least one amino acid in the group consisting of: L31C/F/N/V, Y37F, T39V, W41F, R42D/H/S, N43S, A54H/N, E92D, T102Q, T119S/D, Y122V/F/T/S, N123K/Y, T132S, Q134N/D, Q141S/A/E/F/I/L/M/P/W, Q142H, R144H/K/Q, T145P, T150N, D156S, S167T, H168N/S/V, D169N, I172V, T175V, V186I.

The invention also relates to DNA molecules encoding the xylanase mutants.

The invention also relates to a recombinant expression vector comprising the DNA molecule.

The invention also relates to a host cell comprising the recombinant expression vector.

The plasmid is transferred into a host cell, and the specific activity of the recombinant xylanase mutant is obviously improved.

In some embodiments of the invention, the host cell is Pichia pastoris (Pichia pastoris).

In some embodiments of the invention, the host cell is trichoderma reesei (Trichoderma reesei).

The invention also provides application of the xylanase mutant in the papermaking field.

The invention provides mutants comprising at least one mutation site of L31C/F/N/V, Y37F, T39V, W41F, R42D/H/S, N43S, A54H/N, E92D, T102Q, T119S/D, Y122V/F/T/S, N123K/Y, T132S, Q134N/D, Q141S/A/E/F/I/L/M/P/W, Q142H, R144H/K/Q, T145P, T150N, D156S, S167T, H168N/S/V, D169N, I172V, T175V, V186I based on wild-type xylanase Xyn11. Compared with wild xylanase Xyn11, the specific activity of the alkaline xylanase mutant is generally improved by 10.0-56.6%; wherein, the specific activity of the alkaline xylanase mutant containing N123K single-point mutation is highest and reaches 379U/mg, thus obtaining unexpected technical effects.

In conclusion, the specific activity of the xylanase mutant provided by the invention is obviously improved, so that the production cost of xylanase is reduced, and the xylanase mutant is promoted to be widely applied in the industrial field.

Detailed Description

The present invention uses conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as MOLEC μm LAR CLONING: ALABORATORY MANUAL,3nd Ed (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLEC μm LAR bio-iy (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art may adopt other conventional methods, experimental schemes and reagents in the art based on the technical scheme described in the present invention, and are not limited to the specific embodiments of the present invention. For example, the invention may be used with the following experimental materials and reagents:

strains and vectors: coli DH 5. Alpha., pichia pastoris GS115, vector pPIC9k, amp, G418 were purchased from Invitrogen corporation.

Enzyme and kit: the PCR enzyme and the ligase were purchased from Takara, the restriction enzyme from Fermentas, the plasmid extraction kit and the gel purification recovery kit from Omega, and the GeneMorph II random mutagenesis kit from Beijing Bomeis Biotechnology Co.

The formula of the culture medium comprises:

coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH7.0;

yeast Medium (YPD Medium): 1% yeast extract, 2% peptone, 2% glucose;

yeast screening medium (MD medium): 2% peptone, 2% agarose;

BMGY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4X 10) ^-5 % biotin, 1% glycerol;

BMMY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4X 10) ^-5 % biotin, 0.5% methanol;

LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100. Mu.g/mL ampicillin, pH7.0;

LB-AMP plate: 0.5% yeast extract, 1% peptone, 1% NaCl,1.5% agar, 100. Mu.g/mL ampicillin, pH7.0;

upper medium: 0.1% MgSO ₄ ，1％KH ₂ PO ₄ ，0.6％(NH ₄ ) ₂ SO ₄ 1% glucose, 18.3% sorbitol, 0.35% agarose;

lower medium plates: 2% glucose, 0.5% (NH ₄ ) ₂ SO ₄ ，1.5％KH ₂ PO ₄ ，0.06％MgSO ₄ ，0.06％CaCl ₂ 1.5% agar.

The invention is further illustrated by the following examples:

EXAMPLE 1 construction of recombinant plasmid

The xylanase gene (GenBank PZN 45477.1) from actinobacillus (Actinobacteria bacterium) was codon optimized according to pichia pastoris codon preference and increased by 6 bases GAATTC (EcoR I cleavage site) before its start codon ATG and GCGGCCGC (Not I cleavage site) after its stop codon TAA. The optimized nucleotide sequence is synthesized by Shanghai JieRui bioengineering Co. The xylanase is named Xyn11, and the amino acid sequence of the xylanase is SEQ ID NO:1, the coding nucleotide sequence is SEQ ID NO:2.

the xylanase gene was digested with restriction enzymes EcoR I and Not I (Fermentas); at the same time, plasmid pPIC9K was digested with restriction enzymes EcoR I and Not I. The cleavage products were purified using a gel purification kit and the two cleavage products were ligated with T4 DNA ligase (Fermentas). The ligation product was transformed into DH 5. Alpha. E.coli (Invitrogen) and selected with ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen).

The plasmid was purified from E.coli clones with correct sequencing results using a plasmid miniprep kit (Omega) to obtain 1 recombinant plasmid, which was designated pPIC9K-Xyn11.

EXAMPLE 2 screening of high specific Activity xylanase mutants

In order to further increase the enzymatic activity of xylanase Xyn11, the applicant performed a protein structure analysis. The protein is a G11 family xylanase with a beta-jelly roll structure. Applicants have performed a number of mutated screens for this enzyme by directed evolution techniques.

1.1 designing PCR primers Xyn11-F1 and Xyn11-R1:

Xyn11-F1：GGCGAATTCGATACTTGTATCACTCAAAACCAAAC (restriction enzyme EcoRI recognition site underlined);

Xyn11-R1：ATAGCGGCCGCTTATCCAATGGTAACAGTTGATGATCC (restriction endonuclease NotI recognition site underlined).

The Xyn11 gene (SEQ ID NO: 2) is used as a template, the primers are used for carrying out PCR amplification by using a GeneMorph II random mutation PCR kit, PCR products are recovered by glue, ecoRI and NotI are subjected to enzyme digestion treatment and then are connected with pET21a carriers subjected to enzyme digestion, the products are converted into escherichia coli BL21 (DE 3), the escherichia coli BL21 are coated on LB+Amp plates, inverted culture is carried out at 37 ℃, after the transformants appear, the transformants are picked up to 96-well plates one by using toothpicks, 150 mu L of LB+Amp culture medium containing 0.1mM IPTG is added into each well, culture is carried out at about 6 hours at 37 ℃, supernatant is centrifugally discarded, and bacterial cells are resuspended by buffer solution and repeatedly frozen and broken to obtain the escherichia coli cell lysate containing xylanase.

Respectively taking out 30 mu L of lysate to two new 96-well plates; one 96-well plate was added with 30. Mu.L of substrate, reacted at 37℃for 30min, and then the resulting reducing sugar was measured by the DNS method, and the other plate was added with 150. Mu.L of Coomassie Brilliant blue solution, and left to stand for 10min, and the protein content was measured by the Coomassie Brilliant blue (Bradford) binding method, and the enzyme activity levels and protein contents of the different mutants were calculated, respectively. Finally, the applicant screens mutation sites which remarkably improve xylanase specific activity from twenty thousands of transformants: L31C/F/N/V, Y37F, T39V, W41F, R42D/H/S, N43S, A54H/N, E92D, T102Q, T119S/D, Y122V/F/T/S, N123K/Y, T132S, Q134N/D, Q141S/A/E/F/I/L/M/P/W, Q142H, R144H/K/Q, T145P, T150N, D156S, S167T, H168N/S/V, D169N, I172V, T175V, V186I.

On the basis of the above wild-type xylanase Xyn11, the present invention provides mutants comprising single mutation sites of L31C/F/N/V, Y37F, T39V, W41F, R42D/H/S, N43S, A54H/N, E92D, T102Q, T119S/D, Y122V/F/T/S, N123K/Y, T132S, Q134N/D, Q141S/A/E/F/I/L/M/P/W, Q142H, R144H/K/Q, T145P, T150N, D156S, S167T, H168N/S/V, D169N, I172V, T175V, V186I, respectively.

EXAMPLE 3 xylanase expression in Pichia pastoris

3.1 construction of expression vectors

The gene sequences of xylanase Xyn11 and mutants thereof are respectively optimized according to the password preference of pichia pastoris, the xylanase Xyn11 and mutants thereof are synthesized by Shanghai Jierui bioengineering Co., ltd, and two restriction sites EcoRI and NotI are respectively added at the 5 'and 3' ends of the synthesized sequences.

The gene sequences of the synthesized xylanase Xyn11 and its mutants were digested separately with EcoRI and NotI, and then ligated overnight at 16℃with the pPIC-9K vector digested in the same manner, and transformed into E.coli DH5a, which was spread on LB+Amp plates, cultured in an inverted manner at 37℃and, after the appearance of the transformants, colony PCR (reaction system: template-picked monoclonal, rTaqDNA polymerase 0.5. Mu.L, 10 XBuffer 2.0. Mu.L, dNTPs (2.5 mM) 2.0. Mu.L, 5'AOX primer (10 mM): 0.5. Mu.L, 3' AOX primer: 0.5. Mu.L, ddH) was performed as described in example 1 ₂ O14.5 μl, reaction procedure: pre-denaturation at 95 ℃ for 5min,30 cycles: 94℃30sec,55℃30sec,72℃2min,72℃10 min). And (3) verifying positive clones, and obtaining the correct recombinant expression plasmid after sequencing verification.

3.2 construction of Pichia pastoris engineering strains

3.2.1 Yeast competent preparation

Activating Pichia pastoris GS115 strain by YPD plate, culturing at 30deg.C for 48h, inoculating activated GS115 monoclonal in 6mLYPD liquid culture medium, culturing at 30deg.C for about 12h, transferring the bacterial liquid into a triangular flask containing 30mL YPD liquid culture medium, culturing at 30deg.C for about 5h at 220rpm, detecting the bacterial density by ultraviolet spectrophotometer, respectively collecting 4mL bacterial cells into sterilized EP tube after OD600 value is 1.1-1.3, centrifuging at 9000rpm for 2min at 4deg.C, slightly discarding supernatant, sucking residual supernatant with sterilized filter paper, re-suspending with pre-cooled 1mL sterilized water for 2min at 4deg.C, slightly discarding supernatant, re-multiplexing sterilized water for 1mL, centrifuging at 4deg.C and 9000rpm for 2min, slightly discarding supernatant, and re-suspending pre-cooled 1mL sorbitol (1 mol/L); centrifuge at 9000rpm for 2min at 4℃and gently discard supernatant, gently resuspend pre-chilled 100-150. Mu.L sorbitol (1 mol/L).

3.2.2 transformation and screening

Linearizing the recombinant expression plasmid obtained by constructing 3.1 by Sac I, purifying and recovering linearization fragments, respectively converting Pichia pastoris GS115 by electroporation, screening on an MD plate to obtain Pichia pastoris recombinant strain, and screening multiple copies of transformants on YPD plates (0.5 mg/mL-8 mg/mL) containing geneticin at different concentrations.

Transferring the obtained transformants into BMGY culture medium respectively, and culturing at 30 ℃ and 250rpm in a shaking way for 1d; then transferring the strain into a BMMY culture medium, and carrying out shaking culture at 30 ℃ and 250 rpm; adding 0.5% methanol every day, and inducing expression for 4d; and (3) centrifuging at 9000rpm for 10min to remove thalli, thus obtaining fermentation supernatant respectively containing xylanase Xyn11 and xylanase mutants.

1. Xylanase enzyme activity determination method

(1) Definition of xylanase enzyme activity units

The amount of enzyme required to degrade and release 1. Mu. Mol of reducing sugar per minute from a xylan solution at a concentration of 5mg/mL at 50℃and pH 8.0 is one enzyme activity unit, denoted U.

(2) Xylanase enzyme activity determination method

10.0mL of xylan solution was aspirated and equilibrated at 50deg.C for 20min.

10.0mL of the properly diluted enzyme solution was aspirated and equilibrated at 50℃for 5min.

Blank sample measurement: 2.00mL of the properly diluted enzyme solution (equilibrated at 50 ℃) was pipetted into a graduated tube and then 5mL of DNS reagent was added and the mixture was subjected to electromagnetic shaking for 3s. Then 2.0mL of xylan solution was added, equilibrated at 50℃for 30min and heated in a boiling water bath for 5min. Cooling to room temperature by tap water, adding water to a constant volume of 25mL, and carrying out electromagnetic oscillation for 3-5 s. Measuring absorbance A at 540nm using standard blank as blank control _B 。

Sample measurement: draw 2.00mL pastThe enzyme solution (equilibrated at 50 ℃) was diluted appropriately, added to a graduated tube, and 2.0mL of xylan solution (equilibrated at 50 ℃) was added, followed by electromagnetic shaking for 3s, and precise incubation at 50℃for 30min. 5.0mL of DNS reagent was added and the enzymatic hydrolysis was stopped by electromagnetic shaking for 3s. Heating in boiling water bath for 5min, cooling to room temperature with tap water, adding water to constant volume to 25mL, and electromagnetic oscillating for 3s. Measuring absorbance A at 540nm using standard blank as blank control _E 。

Wherein:

X _D -xylanase activity in the sample dilution, U/mL;

A _E -absorbance of the enzyme reaction solution;

A _B -absorbance of enzyme blank;

slope of K-standard curve;

C _O -intercept of standard curve;

molar mass M (C) of M-xylose ₅ H ₁₀ O ₅ )＝150.2g/mol；

t-enzymolysis reaction time, wherein the unit is minutes (min);

n-dilution of enzyme solution;

1000-conversion factor, 1 mmol=1000 μmol.

(3) Measurement results

The enzyme activity detection is carried out according to the method, and the result shows that: the enzyme activity of the recombinant strain fermentation supernatant of the recombinant expression xylanase Xyn11 and the mutant thereof is 265-379U/mL.

2. Protein content determination method

The determination of protein content by coomassie brilliant blue (Bradford) binding is a complex method of colorimetry combined with the pigment method. Coomassie brilliant blue G-250 appears brownish red in acidic solution, turns blue when bound to protein, and accords with beer's law in a certain concentration range of protein, and can be colorimetrically measured at 595 nm. A large amount of absorption is obtained in 3-5 minutes, and the absorption is stable for at least 1 hour. In the range of 10-1000. Mu.g/mL, absorbance is proportional to protein concentration.

According to the volume ratio of the enzyme solution to the coomassie brilliant blue solution of 1:5, and standing for 10mm, and determining protein content by Coomassie Brilliant blue (Bradford) binding method

The protein content was measured as described above. The results show that: the protein content of the recombinant strain fermentation supernatant of the recombinant expression xylanase Xyn11 and the mutant thereof is 0.32-0.41mg/mL.

3. Specific activity calculation

"specific activity (Specific Activity)" means: the number of units of enzyme activity per unit weight of protein is generally expressed as U/mg protein.

The specific activity calculation formula: specific activity (U/mg) =enzyme activity (U/mL)/protein content (mg/mL).

The specific results are shown in Table 1.

TABLE 1 comparison of alkaline xylanase mutants specific Activity

As can be seen from the results in Table 1, compared with the wild-type xylanase Xyn11, the specific activity of the alkaline xylanase mutant provided by the invention is generally improved by 10.0% -56.6%; wherein, the specific activity of the alkaline xylanase mutant containing N123K single-point mutation is highest and reaches 379U/mg, thus obtaining unexpected technical effects.

In conclusion, the specific activity of the alkaline xylanase mutant provided by the invention is obviously improved, so that the production cost of the enzyme is reduced, and the wide application of the alkaline xylanase in the industrial field, especially the papermaking field is promoted.

Claims (10)

1. A xylanase mutant comprising an amino acid sequence having at least 90% identity to SEQ ID No. 1 and comprising an amino acid substitution at least one position selected from the group consisting of SEQ ID No. 1: 31, 37, 39, 41, 42, 43, 54, 92, 102, 119, 122, 123, 132, 134, 141, 142, 144, 145, 150, 156, 167, 168, 169, 172, 175, 186.

2. The xylanase mutant according to claim 1, wherein the amino acid sequence of the mutant has at least 91%,92%,93%,94%,95%,96%,97%,98%, or at least 99% identity compared to SEQ ID No. 1.

3. The xylanase mutant according to claim 2, wherein the amino acid sequence of the mutant has at least 99.1%,99.2%,99.3%,99.4%,99.5%,99.6%,99.7%,99.8%, or at least 99.9% identity compared to SEQ ID No. 1.

4. The xylanase mutant according to claim 1, wherein said mutant comprises a substitution of at least one amino acid from the group consisting of: L31C/F/N/V, Y37F, T39V, W41F, R42D/H/S, N43S, A54H/N, E92D, T102Q, T119S/D, Y122V/F/T/S, N123K/Y, T132S, Q134N/D, Q141S/A/E/F/I/L/M/P/W, Q142H, R144H/K/Q, T145P, T150N, D156S, S167T, H168N/S/V, D169N, I172V, T175V, V186I.

5. A DNA molecule encoding the xylanase mutant of any one of claims 1-4.

6. A recombinant expression plasmid comprising the DNA molecule of claim 5.

7. A host cell comprising the recombinant expression plasmid of claim 6; the host cell is a non-plant cell.

8. The host cell of claim 7, wherein the host cell is Trichoderma reeseiTrichoderma reesei）。

9. The host cell of claim 7, wherein the host cell is Pichia pastorisPichia pastoris）。

10. Use of a xylanase mutant according to any one of claims 1-4 in papermaking.