CN117757959A - SNP molecular marker related to sow dystocia traits and application thereof - Google Patents
SNP molecular marker related to sow dystocia traits and application thereof Download PDFInfo
- Publication number
- CN117757959A CN117757959A CN202410195093.1A CN202410195093A CN117757959A CN 117757959 A CN117757959 A CN 117757959A CN 202410195093 A CN202410195093 A CN 202410195093A CN 117757959 A CN117757959 A CN 117757959A
- Authority
- CN
- China
- Prior art keywords
- sow
- pig
- dystocia
- snp
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 208000010515 dystocia Diseases 0.000 title claims abstract description 48
- 239000003147 molecular marker Substances 0.000 title claims abstract description 34
- 238000009395 breeding Methods 0.000 claims abstract description 23
- 230000001488 breeding effect Effects 0.000 claims abstract description 23
- 210000000349 chromosome Anatomy 0.000 claims abstract description 15
- 108700028369 Alleles Proteins 0.000 claims abstract description 10
- 230000035772 mutation Effects 0.000 claims abstract description 10
- 241000282887 Suidae Species 0.000 claims description 23
- 238000000034 method Methods 0.000 claims description 22
- 235000016299 Canarium odontophyllum Nutrition 0.000 claims description 14
- 244000001582 Canarium odontophyllum Species 0.000 claims description 14
- 238000011144 upstream manufacturing Methods 0.000 claims description 5
- 239000003795 chemical substances by application Substances 0.000 claims description 4
- 238000012239 gene modification Methods 0.000 claims description 4
- 230000005017 genetic modification Effects 0.000 claims description 4
- 235000013617 genetically modified food Nutrition 0.000 claims description 4
- 150000007523 nucleic acids Chemical group 0.000 claims description 4
- 239000002773 nucleotide Substances 0.000 claims description 3
- 125000003729 nucleotide group Chemical group 0.000 claims description 3
- 238000012214 genetic breeding Methods 0.000 claims description 2
- 238000004519 manufacturing process Methods 0.000 claims 1
- 241000282898 Sus scrofa Species 0.000 abstract description 50
- 230000008901 benefit Effects 0.000 abstract description 6
- 230000002068 genetic effect Effects 0.000 abstract description 6
- 230000006872 improvement Effects 0.000 abstract description 6
- 238000004458 analytical method Methods 0.000 description 11
- 108020004414 DNA Proteins 0.000 description 9
- 230000001850 reproductive effect Effects 0.000 description 7
- 230000000694 effects Effects 0.000 description 6
- 230000008569 process Effects 0.000 description 6
- 238000012163 sequencing technique Methods 0.000 description 6
- 238000012408 PCR amplification Methods 0.000 description 4
- 238000001514 detection method Methods 0.000 description 4
- 241000255969 Pieris brassicae Species 0.000 description 3
- 238000012098 association analyses Methods 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 210000003754 fetus Anatomy 0.000 description 3
- 239000003550 marker Substances 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 238000003908 quality control method Methods 0.000 description 3
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- 206010055690 Foetal death Diseases 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 238000006243 chemical reaction Methods 0.000 description 2
- 230000007547 defect Effects 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 102000054766 genetic haplotypes Human genes 0.000 description 2
- 238000005259 measurement Methods 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- 241001465754 Metazoa Species 0.000 description 1
- 238000010171 animal model Methods 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000001276 controlling effect Effects 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000010219 correlation analysis Methods 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 210000002257 embryonic structure Anatomy 0.000 description 1
- 238000000105 evaporative light scattering detection Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 244000144992 flock Species 0.000 description 1
- 230000006870 function Effects 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000002372 labelling Methods 0.000 description 1
- 210000001161 mammalian embryo Anatomy 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 238000002205 phenol-chloroform extraction Methods 0.000 description 1
- 235000015277 pork Nutrition 0.000 description 1
- 230000000644 propagated effect Effects 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 238000000611 regression analysis Methods 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 238000009394 selective breeding Methods 0.000 description 1
- 238000002791 soaking Methods 0.000 description 1
- 238000010561 standard procedure Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 230000004083 survival effect Effects 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
- 238000012070 whole genome sequencing analysis Methods 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical fields of molecular biotechnology and molecular markers, and particularly relates to an SNP molecular marker related to sow dystocia traits and application thereof. The SNP locus of the SNP molecular marker related to the sow dystocia trait corresponds to the A > G mutation at 26392865bp on the chromosome of the 11.1 version 6 of the international swine reference genome, and the polymorphism of the locus base influences the sow dystocia trait. The invention solves the difficult problem of genetic improvement of sow dystocia by utilizing a molecular breeding means, and can increase the dominant allele frequency generation by optimizing the dominant allele of the SNP, reduce the difficult yield of the sow, and accelerate the progress of genetic improvement of the sow so as to effectively improve the economic benefit of breeding of the sow.
Description
Technical Field
The invention belongs to the technical fields of molecular biotechnology and molecular markers, and particularly relates to an SNP molecular marker related to sow dystocia traits and application thereof.
Background
The reproductive performance of sows directly influences the economic benefit of pig breeding enterprises, and the dystocia of sows can cause a plurality of problems. Dystocia refers to the difficult process of sow delivery being hindered and fetus delivery. The sow is difficult to produce during delivery, the survival rate of piglets can be reduced, the number of dead fetuses can be increased, the service life of the sow which can be propagated can be even influenced, and huge economic loss can be brought to a pig farm. The sow dystocia process is regulated and controlled by multiple factors, and the sow dystocia is genetically improved by the traditional method, so that the defects of long time consumption, slow progress and the like exist. Therefore, if the molecular marker assisted selection (marker assisted selection, MAS) technology is utilized, the sow dystocia trait is genetically improved from the molecular level, the breeding process of the trait is further accelerated, and the economic benefit of pig breeding can be remarkably improved.
Genome-wide association analysis (Genome-wide association study, GWAS) refers to the search for SNPs that are significantly related to a trait of interest across the entire Genome. GWAS is an effective method for resolving quantitative traits, by which significant SNPs are detected to be useful for molecular marker-assisted selective breeding. However, the sample size and label density are important factors affecting GWAS results. In general, the greater the sample size, the higher the label density, and the greater the statistical power of GWAS. The size of the sample size is mainly affected by objective factors such as experiment cost and experiment period, and the label density can be increased by genotype filling technology.
at present, pork consumption of people in China mainly takes Duroc (Duroc X (long white pig X big white pig)) matched commercial pigs generated by lean-type breeding pigs as main raw materials, and Duroc, long white pig and big white pig are Duroc commercial pig parents, so that the difficult-to-produce characters of the Duroc, long white pig and big white pig in the core group are genetically improved, the reproductive performance of sows can be improved, the competitiveness of pig raising enterprises is improved, and economic and huge economic benefits are brought to the enterprises.
Disclosure of Invention
In order to overcome the defects and shortcomings of the prior art, the primary aim of the invention is to provide an SNP molecular marker related to sow dystocia traits.
It is another object of the present invention to provide the use of the above SNP molecular marker.
it is still another object of the present invention to provide a primer pair and a kit for identifying the above SNP molecular markers.
A fourth object of the present invention is to provide the use of the above primer pair and kit.
A fifth object of the present invention is to provide a method for genetic modification of pigs.
the aim of the invention is achieved by the following technical scheme:
A SNP molecular marker related to sow dystocia traits, wherein the SNP locus corresponds to an A > G mutation at 26392865bp on an international swine reference genome 11.1 version 6 chromosome, and the polymorphism of the base at the locus influences sow dystocia traits; the influence on the sow dystocia character is particularly influence on the sow dystocia rate.
the nucleotide sequence of the SNP molecular marker is preferably shown as SEQ ID NO.1, wherein M in the sequence is A or G, and the SNP molecular marker affects the difficult productivity difference of the sow during delivery.
The SNP locus of the SNP molecular marker is a single-base mutation of nucleic acid of A190-G190 with the labeling position of the SEQ ID NO:1 sequence being 190, and the single-base mutation is named as g.190A > G (corresponding to 26392865bp on chromosome No. 6 of 11.1 version 6 of the international swine reference genome).
the SNP molecular marker is applied to identifying the characteristics of the dystocia of the pigs, reducing the difficult yield of the sows or genetic breeding of the pigs.
The pig is Duroc pig, duroc pig synthetic line, changbai sow synthetic line, dabai sow or Dabai sow synthetic line.
The pigs are preferably American Duroc pigs, american Duroc synthetic lines, american long white sows synthetic lines, french white sows or French white sows synthetic lines.
A method for detecting dystocia traits in sows, comprising the steps of:
detecting the SNP molecular marker on the chromosome 6 of the pig, wherein the SNP locus mononucleotide of the SNP molecular marker is A or G.
The pig is Duroc pig, duroc pig synthetic line, changbai sow synthetic line, dabai sow or Dabai sow synthetic line.
The pigs are preferably American Duroc pigs, american Duroc synthetic lines, american long white sows synthetic lines, french white sows or French white sows synthetic lines.
A primer pair for identifying the SNP molecular marker, comprising a primer-F and a primer-R, wherein the nucleic acid sequence is as follows:
Upstream primer-F: 5'-TGGATTATTTGGGGTTTGGGT-3';
downstream primer-R: 5'-TCCTCTCGATGTGGCAATGA-3'.
A kit for identifying the above SNP molecular markers, comprising the above primer pair.
The primer pair or the kit is applied to identifying the dystocia trait of the sow.
the primer pair or the kit is applied to reducing the difficult yield of the sow.
the primer pair or the kit is applied to pig molecular marker assisted breeding.
a method for reducing the refractory yield of a sow comprising the steps of: detecting the genotype of the pig at 26392865bp on chromosome No. 6 of the international pig reference genome 11.1, and selecting an individual with the AA type locus as a breeding pig.
The detection method comprises the following steps:
(1) Extracting genome DNA of a pig to be detected;
(2) Using the primer pair or the primer pair in the kit as an amplification primer, and performing PCR amplification by using the genome DNA of the pig to be detected obtained in the step (1) as a template DNA to obtain a PCR amplification product;
(3) Sequencing the PCR amplification product to obtain a sequencing result;
(4) Based on the sequencing results, the genotype is determined.
The pig is Duroc pig, duroc pig synthetic line, changbai sow synthetic line, dabai sow or Dabai sow synthetic line.
The pigs are preferably American Duroc pigs, american Duroc synthetic lines, american long white sows synthetic lines, french white sows or French white sows synthetic lines.
A method of genetic modification of a pig comprising the steps of:
Determining the SNP molecular markers of the breeding pigs in the breeding pig core group, and making corresponding selection according to the SNP molecular markers: the breeding of the AA type individuals at 26392865bp on the chromosome of the 11.1 version 6 of the international pig reference genome eliminates GG type and AG type individuals at the locus, so as to increase the frequency of the allele A at the locus by generations, thereby reducing the difficult yield of the sow.
The pig is Duroc pig, duroc pig synthetic line, changbai sow synthetic line, dabai sow or Dabai sow synthetic line.
The pigs are preferably American Duroc pigs, american Duroc synthetic lines, american long white sows synthetic lines, french white sows or French white sows synthetic lines.
Compared with the prior art, the invention has the following advantages and effects:
(1) Based on whole genome association analysis and genotype filling strategies, the SNP molecular marker related to the sow dystocia trait is researched and determined to be A > G mutation at 26392865bp position on chromosome No. 6 of international swine reference genome 11.1, and the polymorphism of the SNP locus is obviously related to the sow dystocia trait.
(2) The invention provides a primer pair, a kit and a method for identifying the SNP molecular marker and genetic improvement of pigs based on the SNP molecular marker, and establishes a high-efficiency and accurate molecular marker assisted breeding technology which is applied to genetic improvement of sow dystocia traits, thereby reducing sow dystocia yield, improving enterprise profit and increasing core competitiveness.
(3) The invention solves the difficult problem of genetic improvement of sow dystocia by utilizing a molecular breeding means, and can increase the dominant allele frequency generation by optimizing the dominant allele of the SNP, reduce the difficult yield of the sow, and accelerate the progress of genetic improvement of the sow so as to effectively improve the economic benefit of breeding of the sow.
Drawings
FIG. 1 is a graph of a whole genome association (GWAS) analysis on chromosome 6 for a sow dystocia trait; wherein: the abscissa indicates chromosome number of pigs; ordinate represents-log10（P value）。
FIG. 2 is a graph showing the analysis of the yield of sow of different genotypes.
Detailed Description
the present invention will be described in further detail with reference to examples and drawings, but embodiments of the present invention are not limited thereto.
Example 1 specifically explaining the measurement procedure for influencing the dystocia trait in the present invention
(1) Experimental animal
Experimental swinery: the experiment used 64 American Duroc sows, 143 American long white sows and 1111 American big white sows together.
The experimental pig group used in the invention is the core pig group of the pig branch company of the stock market of the new large animal industry, henan province, and the group genealogy record is detailed. The pig flock can eat and drink water freely, and the whole feeding mode, feeding conditions and the like are kept consistent all the time, so that the method is a conventional method.
(2) Dystocia trait assay
The present study recorded the state of sow during delivery, wherein manual assistance was needed during the entire delivery process, which was difficult, whereas it was antenatal. All sows were simultaneously recorded for the first 4-child delivery status (antenatal, dystocia), total parity, live parity, dead parity, mummy, healthy parity (piglet birth weight >0.8 kg). Wherein, the birth rate is the number of the birth rate divided by the total number of the birth rate; the fitness rate is the fitness number divided by the total number of children produced.
(3) Sample collection
collecting ear-like tissues of the Mei-system Duroc sow, the Mei-system Changbai sow and the French Dabai sow, soaking in an ethanol solution with the volume fraction of 75%, and storing in a refrigerator at-20deg.C for use.
Example 2 specifically explaining the inventive procedure for obtaining the gene markers in the present invention
(1) Extraction of DNA of ear-like tissues of Duroc sows, changbai sows and French white sows: whole genomic DNA was extracted with reference to standard phenol-chloroform method. The DNA of the above population was subjected to mass detection and concentration measurement by using a Nanodrop-ND1000 spectrophotometer. The A260/280 ratio is 1.8-2.0, and the A260/230 ratio is 1.7-1.9, and the product is judged to be qualified. Finally, uniformly diluting the qualified DNA sample to 50 ng/. Mu.L.
(2) Pig whole genome 50K SNP genotype detection: the DNA sample was sent to Beijing Kang Pusen Biotechnology Co., ltd. Based on the core one 50K SNP typing platform, chip hybridization and result scanning (i.e., genotype determination) were performed using Illumina Infinium instructions and standard procedures. Genotype data were finally read by genome studio software. Quality control of the obtained genotype data with PLINK v1.90, reject detection rate <95%, allele frequency (mimor allel frequency, MAF) <1% or deviation from Hardy-Weinberg Equilibrium, HWEP≤10-6The detection rate of SNP markers of (2) is less than 95%.
(3) Pig deletion genotype filling: the SNPs chip data of Duroc sow, changbai sow and Dabai pig 50K described above were filled into whole genome sequencing data using Beagle v5.1 software based on a reference haplotype pool using public data 947 individuals (https:// doi. Org/10.1038/s 41467-023-40434-3) as a fill reference population. And then carrying out quality control on the genotype filling data, wherein the specific quality control method is consistent with the step (2).
(4) Whole genome association (GWAS) analysis: and (3) adopting Case-Control (Case-Control) whole genome association analysis based on SNP markers, and searching for a locus in linkage disequilibrium with a locus controlling a target trait by detecting the difference of allele and genotype frequency in Case individuals and Control individuals at each SNP marker locus within the whole genome. The study selected the GEMMA software co-developed by Xiang Zhou and Matthew Stephens from university of michigan, usa, for GWAS analysis of duroc sows, large white sows and long white sows. The sow is in the same direction as the first four childhood delivery, and is considered as a Control group; when the sow is delivered from the first four fetuses, one of the fetuses is difficult to produce, and the sow is a Case group. 465 refractory sows and 853 antenatal sows were used for subsequent analysis in this study. In order to eliminate the layering effect of the population, the invention adopts linear mixed model single-point regression analysis and combines R language GenABEL software package to carry out GWAS analysis, and the layering effect is corrected by utilizing the similarity of genome among individuals in an analysis model.
furthermore, given the assumption that the number of independent haplotype boxes for pig and human are substantially the same on the genome, human-related GWAS analysis sets a genome significance threshold of 5.00×10-8. The invention refers to a human genome significant threshold, the genome significant level threshold is 1.00 multiplied by 10-8The method comprises the steps of carrying out a first treatment on the surface of the Chromosome level significance threshold of 1.00×10-6。
The GWAS analysis results are shown in fig. 1. As can be seen from FIG. 1, in Duroc sows, long white sows and large white sows, there are sites in chromosome 6 that significantly affect the dystocia of the sows, and the most strongly associated SNP is g.190A > GP=2.57×10-7）。
(5) Correlation analysis of different genotypes and sow dystocia phenotype: as can be seen from Table 1, SNP locus g.190A > G of the molecular marker is extremely significantly related to the dystocia traitP=2.57×10-7) The molecular marker obviously affects the sow dystocia trait, and the yield of the population is reduced by auxiliary selection of the SNP locus of the sow, so that the breeding process of the sow dystocia trait is accelerated. Further, as is clear from Table 1 and FIG. 2, the GG form is more difficult to produce than the AA and AG forms, and it is revealed that homozygote GG is the most unfavorable for the sow dystocia trait. Therefore, it is necessary to phase out GG type and AG type breeding pigs during breeding, and to maintain AA type breeding pigs to increase the frequency of allele A at this site from generation to reduce the difficult yield of sows.
TABLE 1 correlation of SNP loci g.190A > G of molecular markers and sow dystocia traits
(6) Effect of antenatal and dystocia on sow reproductive performance: the statistical analysis software used in this study was the R language. Single factor inter-group variance analysis is performed on the front 4-embryo antenatal dystocia traits of 1318 sows by using an anov () function,P<0.05 indicates that the difference is significant,P>0.05 indicates that the difference was not significant. As can be seen from Table 2, the total litter size, litter size and litter size ratio of the antenatal group sow are significantly higher than those of the dystocia group sowP< 0.001), and the dead fetus number, the mummy number and the primary average weight are significantly lower than those of the sow of the difficult groupP< 0.01). The reproductive performance of the antenatal sow is obviously higher than that of the dystocia sow as a whole.
TABLE 2 Effect of dystocia on sow reproductive traits
example 3 specifically explaining the inventive procedure for detecting SNP markers
(1) The target fragment containing SNP sites remarkably related to the dystocia traits of Duroc sows, changbai sows and Dabai sows is a 241bp nucleotide sequence (SEQ ID NO: 1) in chromosome 6, and the upstream and downstream primers for sequence amplification are primer-F and primer-R, wherein the nucleic acid sequences are as follows:
Upstream primer-F:5'-TGGATTATTTGGGGTTTGGGT-3';
Downstream primer-R:5'-TCCTCTCGATGTGGCAATGA-3'.
(2) System and condition setting for PCR amplification
A10. Mu.L system was configured in which the DNA sample was 1.0. Mu.L, the upstream primer was 0.3. Mu.L, the downstream primer was 0.3. Mu.L, PCR mix was 5. Mu.L, ddH2O3.4. Mu.L, PCR reaction procedure: 95 ℃ for 3min;94 ℃,30 s,60 ℃,30 s,72 ℃, 20s,30 cycles; 72 ℃ for 10 min.
(3) Sequencing and identifying DNA sequences: sequence sequencing was performed in Shenzhen Hua big Gene technologies Co., ltd, and the gene fragment was tested for both the forward and reverse reactions. Comparing the detected sequence with NCBI genome sequence to obtain mutation of corresponding SNP locus, and sequencing the sequence as follows:
TGGATTATTTGGGGTTTGGGTATAAAGTTCTTTTGAGTTTAACTGTTTGTATATCAACTCCTTATCAGACATATTACATGCAAATAATTTCTCCTATTGTGTAGGTTGCCTTTTCATCTTGTTGATCATTTATTTTGCTGTACAGGAGTTTTTAGTTTGATATAACCCAACTTGTGTGTTTTTTATTTTM（A/G)TTGCTTGTGCTCTAGGAATTATATCCTAAAATCATTGCCACATCGAGAGGA。
Note that: m in the sequence is the mutation site, underlined (in brackets is the mutation base, is the allelic mutation), the sequence is shown in the beginning and end of the thick as the primer sequence binding position.
EXAMPLE 4 SNP site g.190A > G Effect analysis of molecular markers
the invention provides the SNP molecular marker capable of remarkably reducing the difficult yield of Duroc sows, long white sows and large white sows, and the SNP molecular marker is used for marker assisted selection, so that the breeding process of the difficult yield traits of the sows can be greatly accelerated. If all GG individuals with molecular markers affecting the dystocia traits of the sows are selected and bred into AA individuals, the difficult yield of the sows is reduced from 42.37% to 21.80%, and the reproductive performance of the sows is greatly improved. Assuming that 1 ten thousand sows are bred into an AA type from GG type, the number of antenatal sows is increased from 2180 to 4237, and 2057. According to the 2057 sows, 2.83 piglets are provided per embryo, and based on 2.2 embryos of the sows in one year, 12807 pigs are provided per year for the pig farm, 120kg of each pig is delivered, 2000 yuan people's coins are provided for each pig, and about 2560 ten thousand yuan income is brought for the pig farm. It follows that the potential for low dystocia to provide revenue to the pig industry is enormous. In the SNP molecular marker individual, the preferential allele (A) of the SNP of the Duroc sow, the Changbai sow and the Dabai sow group is optimized, so that the reproductive performance of the sow can be finally improved, and the income of enterprises can be increased.
The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.
Claims (10)
1. A SNP molecular marker related to sow dystocia traits is characterized in that the SNP locus corresponds to A > G mutation at 26392865bp on chromosome No. 6 of International pig reference genome 11.1, and polymorphism of the locus base influences sow dystocia traits;
The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1.
2. the use of the SNP molecular marker of claim 1 in identifying a trait of refractory pig production, reducing refractory sow yield or genetic breeding of pigs.
3. the method for detecting the dystocia character of the sow is characterized by comprising the following steps of:
detecting the SNP molecular marker according to claim 1 on the chromosome 6 of the pig, wherein the SNP locus mononucleotide of the SNP molecular marker is A or G.
4. a primer pair for identifying the SNP molecular marker as set forth in claim 1, characterized by comprising primers primer-F and primer-R, whose nucleic acid sequences are as follows:
Upstream primer-F: 5'-TGGATTATTTGGGGTTTGGGT-3';
downstream primer-R: 5'-TCCTCTCGATGTGGCAATGA-3'.
5. a kit for identifying the SNP molecular markers of claim 1, characterized by comprising the primer pair of claim 4.
6. use of the primer pair of claim 4 or the kit of claim 5 for identifying a sow dystocia trait.
7. use of the primer pair of claim 4 or the kit of claim 5 for reducing the refractory yield of sows.
8. use of the primer pair of claim 4 or the kit of claim 5 in pig molecular marker-assisted breeding.
9. A method for genetic modification of pigs comprising the steps of:
Determining the SNP molecular markers of claim 1 of breeding pigs in a breeding pig core group, and making corresponding selections according to the SNP molecular markers: the breeding of the AA type individuals at 26392865bp on the chromosome of the 11.1 version 6 of the international pig reference genome eliminates GG type and AG type individuals at the locus, so as to increase the frequency of the allele A at the locus by generations, thereby reducing the difficult yield of the sow.
10. The method of genetic modification of pigs according to claim 9, wherein:
The pig is Duroc pig, duroc pig synthetic line, changbai sow synthetic line, dabai sow or Dabai sow synthetic line.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410195093.1A CN117757959A (en) | 2024-02-22 | 2024-02-22 | SNP molecular marker related to sow dystocia traits and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410195093.1A CN117757959A (en) | 2024-02-22 | 2024-02-22 | SNP molecular marker related to sow dystocia traits and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117757959A true CN117757959A (en) | 2024-03-26 |
Family
ID=90326128
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410195093.1A Pending CN117757959A (en) | 2024-02-22 | 2024-02-22 | SNP molecular marker related to sow dystocia traits and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117757959A (en) |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101970688A (en) * | 2007-09-12 | 2011-02-09 | 美国辉瑞有限公司 | Methods of using genetic markers and related epistatic interactions |
| CN103757002A (en) * | 2013-12-26 | 2014-04-30 | 中国科学院昆明动物研究所 | Litter size related molecular marker of swine 6# chromosome |
| CN103757008A (en) * | 2013-12-26 | 2014-04-30 | 中国科学院昆明动物研究所 | Litter size related molecular marker of swine 6# chromosome and primers thereof |
| KR20190034124A (en) * | 2017-09-22 | 2019-04-01 | 고려대학교 산학협력단 | Novle Single Nucleotide Polymorphisms Markers for Predicting Lifetime Production Ability Trait of Sow and Uses Thereof |
| AU2020104202A4 (en) * | 2019-12-23 | 2021-03-11 | Institute Of Animal Science And Veterinary Medicine, Hubei Academy Of Agricultural Sciences | Application of a molecular marker assisted selection in number of piglets born alive |
| CN113564264A (en) * | 2021-08-20 | 2021-10-29 | 华南农业大学 | SNP molecular marker located on No. 14 chromosome of pig and related to number of stillbirths and litter size of sow and application thereof |
| CN114717329A (en) * | 2022-03-25 | 2022-07-08 | 华中农业大学 | SNP molecular marker related to sow stillbirth traits and application thereof |
| CN114736974A (en) * | 2022-05-24 | 2022-07-12 | 广西扬翔股份有限公司 | SNP molecular marker related to sow parturition traits and application thereof |
| CN115011704A (en) * | 2022-05-18 | 2022-09-06 | 温氏食品集团股份有限公司 | SNP molecular marker influencing litter interval traits and application thereof |
| CN116397033A (en) * | 2023-03-23 | 2023-07-07 | 湖北省农业科学院畜牧兽医研究所 | SNP molecular marker related to porcine reproductive trait gene NCK1, primer pair and application thereof |
-
2024
- 2024-02-22 CN CN202410195093.1A patent/CN117757959A/en active Pending
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101970688A (en) * | 2007-09-12 | 2011-02-09 | 美国辉瑞有限公司 | Methods of using genetic markers and related epistatic interactions |
| CN103757002A (en) * | 2013-12-26 | 2014-04-30 | 中国科学院昆明动物研究所 | Litter size related molecular marker of swine 6# chromosome |
| CN103757008A (en) * | 2013-12-26 | 2014-04-30 | 中国科学院昆明动物研究所 | Litter size related molecular marker of swine 6# chromosome and primers thereof |
| KR20190034124A (en) * | 2017-09-22 | 2019-04-01 | 고려대학교 산학협력단 | Novle Single Nucleotide Polymorphisms Markers for Predicting Lifetime Production Ability Trait of Sow and Uses Thereof |
| AU2020104202A4 (en) * | 2019-12-23 | 2021-03-11 | Institute Of Animal Science And Veterinary Medicine, Hubei Academy Of Agricultural Sciences | Application of a molecular marker assisted selection in number of piglets born alive |
| CN113564264A (en) * | 2021-08-20 | 2021-10-29 | 华南农业大学 | SNP molecular marker located on No. 14 chromosome of pig and related to number of stillbirths and litter size of sow and application thereof |
| CN114717329A (en) * | 2022-03-25 | 2022-07-08 | 华中农业大学 | SNP molecular marker related to sow stillbirth traits and application thereof |
| CN115011704A (en) * | 2022-05-18 | 2022-09-06 | 温氏食品集团股份有限公司 | SNP molecular marker influencing litter interval traits and application thereof |
| CN114736974A (en) * | 2022-05-24 | 2022-07-12 | 广西扬翔股份有限公司 | SNP molecular marker related to sow parturition traits and application thereof |
| CN116397033A (en) * | 2023-03-23 | 2023-07-07 | 湖北省农业科学院畜牧兽医研究所 | SNP molecular marker related to porcine reproductive trait gene NCK1, primer pair and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| "Pig(Sscrofa11.1) rs320495754", 《ENSEMBL DATABASE》, 31 July 2023 (2023-07-31) * |
| SCHNEIDER JF ET AL.: "Genomewide association analysis for average birth interval and stillbirth in swine", 《J ANIM SCI》, vol. 93, no. 2, 28 February 2015 (2015-02-28), pages 529 - 540 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110117665B (en) | SNP molecular marker located on pig No. 16 chromosome and related to pig lean meat percentage and eye muscle area and application | |
| CN108676897B (en) | SNP marker influencing daily gain traits of pigs and application thereof | |
| CN110106255B (en) | Molecular marker located on pig No. 7 chromosome and related to Duroc pig daily gain trait and application | |
| CN110541038A (en) | SNP molecular marker located on pig No.1 chromosome and related to daily gain of pig and application | |
| CN108913779B (en) | SNP marker influencing daily gain traits of pigs and application thereof | |
| CN110144408B (en) | SNP molecular marker located on pig chromosome 7 and related to total papilla number and application | |
| CN113564264B (en) | SNP molecular marker located on No. 14 chromosome of pig and related to number of stillbirth and litter size of sow and application thereof | |
| CN112941198B (en) | SNP marker for detecting pig eye muscle area and application thereof | |
| CN115011704A (en) | SNP molecular marker influencing litter interval traits and application thereof | |
| CN112280874B (en) | Copy number variation molecular marker influencing pig backfat thickness on pig chromosome 11 and application | |
| CN117757959A (en) | SNP molecular marker related to sow dystocia traits and application thereof | |
| CN112760387B (en) | SNP molecular marker related to total nipple number of pigs and application | |
| CN113355427B (en) | SNP (single nucleotide polymorphism) marker related to pig backfat thickness and utilization method thereof | |
| CN113584185A (en) | SNP molecular marker located on pig chromosome 12 and related to piglet malformation number and application thereof | |
| CN113736889A (en) | SNP molecular marker related to pig stillbirth number and survival rate on pig chromosome 7 and application thereof | |
| CN113736890A (en) | SNP molecular marker related to Jian' er number and survival rate and application thereof | |
| CN113699247A (en) | SNP molecular marker on pig No. 1 chromosome and related to pig remaining feed intake and application thereof | |
| CN113637768A (en) | SNP molecular marker on pig No. 13 chromosome related to number of malformed piglets born by sow and application thereof | |
| CN112011623A (en) | Molecular marker related to sow live litter size and effective live litter size traits | |
| CN117965749A (en) | SNP molecular marker related to lean meat percentage of pigs and application thereof | |
| CN114085914B (en) | SNP molecular marker located on chromosome 9 of pig and related to litter size and application thereof | |
| CN112458183B (en) | Copy number variation molecular marker on pig No. 3 chromosome and related to daily gain and weight and age on market of pig and application thereof | |
| CN113355428B (en) | SNP (Single nucleotide polymorphism) marker related to day age of up to 100kg body weight and application method thereof | |
| CN112266968B (en) | Copy number variation molecular marker influencing weight age in days and daily gain on pig chromosome 13 and application | |
| CN111808974B (en) | SNP molecular marker located on pig chromosome 9 and related to scrotal hernia and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |