CN117757911A

CN117757911A - Probe composition, kit and sequencing method for nephrotic gene

Info

Publication number: CN117757911A
Application number: CN202211163134.6A
Authority: CN
Inventors: 潘世让; 王洋; 孟繁钊; 吴婷婷; 汪德鹏
Original assignee: Grandomics Biosciences Co ltd
Current assignee: Grandomics Biosciences Co ltd
Priority date: 2022-09-23
Filing date: 2022-09-23
Publication date: 2024-03-26

Abstract

The invention provides a probe composition, a kit and a sequencing method of a kidney disease gene, wherein the probe composition has the following characteristics: 1) The probe composition is used for detecting kidney disease genes, and the length of the detected kidney disease genes is not less than 1kb; 2) Comprises a plurality of probes, wherein the plurality of probes uniformly cover a kidney disease gene, and when each two adjacent probes are combined with the kidney disease gene, the cover sites have an overlapping area of not more than 10bp on average or have an average interval of 1 bp-4 kb; 3) The probe composition covers the whole length of the kidney disease gene; 4) The nucleic acid sequence of the probe in the probe composition is complementarily paired with the kidney disease gene. The probe composition, the kit and the sequencing method can cover all mutation types, and can sequence kidney disease genes economically and practically.

Description

Probe composition, kit and sequencing method for nephrotic gene

Technical Field

The invention relates to the technical field of biology, in particular to a probe composition, a kit and a sequencing method of a kidney disease gene.

Background

Hereditary kidney disease includes autosomal dominant polycystic kidney, autosomal recessive polycystic kidney, tubular interstitial kidney disease, and the like. Polycystic kidney is a genetic disease affecting the bilateral kidneys, with fluid filled cysts, known as cysts, that severely interfere with the kidneys' ability to filter waste products from the blood. The growth of cysts can lead to the continuous enlargement of the kidneys and even to renal failure, the most common congenital hereditary cystic kidney disease in the human body. The incidence of autosomal dominant genetic polycystic kidney disease (ADPKD) is about 1/500 to 1/1000 person. Autosomal recessive genetic polycystic kidney (ARPKD) disease has a incidence of about 1/20000 and is the most common hereditary childhood renal cystic disease (involving both kidneys and liver), often resulting in childhood renal failure. Renal cyst is sometimes formed at the cortical and medullary junction of the renal tubule, leading to chronic renal insufficiency and end-stage renal failure.

The kidney disease gene detection is carried out, so that a genetic variation carrier can be screened, and the disease prevention work is actively carried out; for patients with kidney disease, treatment strategies can also be adjusted according to specific variant genes and variant types. In addition, it is beneficial to the prenatal and postnatal care to block the transmission of pathogenic variation to the next generation.

Currently, various detection methods such as first generation sequencing, long Read-PCR (LR-PCR for short) combined with NGS sequencing, conventional second generation capturing sequencing, full exon sequencing (Whole Exome Sequencing, WES sequencing for short) and the like are used for detecting the mutation of the kidney disease gene, however, the existing methods have defects, and the detection sensitivity and the specificity are required to be improved. The first generation sequencing operation is time-consuming and labor-consuming, and the detection target area is too small; LR-PCR combines NGS sequencing, wherein a pair of forward and reverse amplification primers are designed at the upstream and downstream of a target segment, and after SV structural variation occurs in an amplification region, the amplification is often impossible. For example, when inversion occurs in the amplification region, the forward and reverse primers become the same-direction primers, and amplification is impossible. Therefore, the LR-PCR detection method cannot cover all variant types. The conventional second-generation capture sequencing cannot distinguish true and false gene interference due to short sequencing reads, some inversion and ectopic complex variation cannot be detected, and in addition, the demand on the probe is large, so that the detection cost is directly increased. Whole exon sequencing, although detecting many genes, has the problem of variation type undercrowhing, such as variation in intronic regions is often undercrown. The whole genome sequencing data is large in quantity and high in price, the subsequent analysis cost is high, and the large-scale clinical popularization is difficult temporarily.

Therefore, clinical kidney disease gene detection is urgently needed to overcome the defects of the existing detection technology, cover all variant types, and have an accessible detection scheme.

Disclosure of Invention

In view of the above, an object of the present invention is to provide a probe composition, a kit and a sequencing method for a kidney disease gene, which can cover all types of mutation and detect a kidney disease gene economically and practically.

In view of the above object, a first aspect of the present invention provides a probe composition, wherein,

1) The probe composition is used for detecting kidney disease genes, and the length of the detected kidney disease genes is not less than 1kb;

2) Comprises a plurality of probes, wherein the plurality of probes uniformly cover a kidney disease gene, and when each two adjacent probes are combined with the kidney disease gene, the cover sites have an overlapping area of not more than 10bp on average or have an average interval of 1 bp-4 kb; preferably, the average interval of the sites covered by every two adjacent probes is 500 bp-2 kb; more preferably, the average interval of the sites covered by every two adjacent probes is 900-1100 bp;

3) The probe composition covers the whole length of the kidney disease gene;

4) The nucleic acid sequence of the probe in the probe composition is complementarily paired with a kidney disease gene;

preferably, the kidney disease gene comprises a PKD1 gene, a PKD2 gene, a PKHD1 gene, a UMOD gene, a PMM2 gene, an LRP5 gene, a SEC63 gene, a HNF1B gene, and an ALG8 gene;

preferably, the species of the kidney disease gene is derived from an animal;

more preferably, the species of the kidney disease gene is derived from primate;

further preferably, the species of the kidney disease gene is of human origin.

In a preferred embodiment of the present invention, wherein the probe composition comprises group I: a probe capturing the full length of the kidney disease gene;

preferably, the probe composition further comprises a label bound to a solid phase;

more preferably, the label is selected from one of biotin, avidin, an antibody, and a chemical coupling agent;

further preferably, the label is biotin.

In a second aspect, the present invention provides a method for sequencing a kidney disease gene, comprising the steps of:

1) Breaking genomic DNA in a sample to be detected into a plurality of nucleic acid fragments and amplifying to construct a DNA library;

2) Capturing kidney disease genes in the DNA library that are capable of specifically binding to a plurality of probes in the probe composition using the probe composition described above;

3) Sequencing the kidney disease gene;

the sequencing methods are used for non-disease diagnostic or therapeutic purposes.

In a preferred embodiment of the present invention, the method of constructing a DNA library comprises:

connecting a connector sequence after repairing the tail end of the nucleic acid fragment, and designing a primer by taking the connector sequence as a template for PCR amplification;

preferably, the nucleic acid fragment has a length of 2 to 10kb;

more preferably, the nucleic acid fragment has a length of 4.5 to 5.5kb.

In a preferred embodiment of the invention, the capturing occurs on a solid support;

preferably, the solid phase carrier is an enrichment particle, and the enrichment particle is coated with biotin or avidin;

more preferably, the enrichment particles are magnetic beads.

In a preferred embodiment of the invention, the kidney disease gene is amplified prior to sequencing the kidney disease gene.

In a preferred embodiment of the invention, the sequencing is three-generation sequencing;

preferably, the third generation sequencing is performed using the PacBio sequence, promethION, minION, gridION platform.

In a third aspect the present invention provides a kit for kidney disease gene sequencing comprising the probe composition described above;

preferably, the kit further comprises one or more of the above solid phase carriers, linker sequences, primers for binding to the linker sequences and amplifying nucleic acid fragments, a DNA extraction system, a PCR reaction buffer, nuclease-free water, DNA polymerase, molecular weight markers, target sequence eluents, end repair enzymes, end repair buffers, DNA ligases.

In a fourth aspect, the invention provides the use of the above probe composition or the above kit for detecting a renal genetic variation;

preferably, the kidney disease genetic variation comprises an insertion, deletion, replication, inversion, translocation or SNP.

In a fifth aspect, the invention provides the use of a probe composition as described above or a kit as described above in the preparation of a diagnostic reagent for renal disease.

The beneficial effects of the invention are as follows:

(1) The average interval between the probes is reasonably regulated, so that the number of probes for detecting the nephrotic gene can be greatly reduced, but the detection effect is excellent;

(2) According to the method, the capture probe is designed to cover the full-length region of the nephrosis gene, so that the structural variation which is difficult to detect by the conventional method is successfully detected, the sensitivity of nephrosis gene detection is improved, and a molecular biological basis is provided for finding new pathogenic mutation;

(3) Further, by means of a third-generation long-reading long-sequencing technology, the rapid detection of the renal disease gene mutation is realized.

Drawings

FIG. 1 shows the results of a uniformity analysis of probe coverage for different intervals in one embodiment of the present invention.

FIG. 2 is a graph of Agilent2100 Bioanalyzer assay results in one embodiment of the invention.

Detailed Description

It is to be noted that unless otherwise defined, technical or scientific terms used herein should be given the ordinary meaning as understood by one of ordinary skill in the art.

The experimental methods in the following examples are conventional methods unless otherwise specified. The raw materials and reagent materials used in the following examples are all commercially available products unless otherwise specified.

As used herein, "read length" refers to the length of a sequence that can be measured by a sequencing reaction, and if the DNA sequence is longer than the read length, the DNA sequence must be split into short sequences that are within the read length in order to be sequenced. The first generation sequencing dideoxy chain termination method (Sanger method) has a read length of 1000bp, the second generation sequencing is lower than 50bp-300bp, the third generation sequencing can reach more than 5000bp, the longest read length can even reach 20kb, and the longer read length is the greatest advantage of the third generation sequencing.

As used herein, "coverage site" refers to the region where the probe binds to a kidney disease gene.

As used herein, "plurality" refers to two or more.

"complementary pairing" as used herein means that the probe is capable of hybridizing under stringent conditions to a sequence represented by the above-described site. "stringent conditions" as used in the present invention are well known and include, for example, hybridization in a hybridization solution containing 400mM NaCl, 40mM PIPES (pH 6.4) and 1mM EDTA at 65℃for 12 to 16 hours, followed by washing with a washing solution containing 0.1% SDS and 0.1% SSC at 65℃for 15 to 60 minutes. As will be familiar to those skilled in the art.

As used herein, a "solid support", particularly an "enrichment bead" can be made from any number of known materials. Examples of such materials include: inorganic substances, natural polymers and synthetic polymers. Specific examples of such materials include: cellulose, cellulose derivatives, acrylic resins, glass, silica gel, polystyrene, gelatin, polyvinylpyrrolidone, copolymers of vinyl and acrylamide, polystyrene, polyacrylamide, latex gel, dextran, rubber, silica gel, plastic, nitrocellulose, natural sponge, silica gel, control pore glass (control pore glass), metals, cross-linked dextran (e.g., sephadex (TM)), sepharose (TM), and other solid supports known to those skilled in the art.

As used herein, "enriched particles" refers to discrete small objects that may be of various shapes, such as spheres (e.g., beads), capsules, polyhedra, and the like. The particles may be macroscopic or microscopic, such as microparticles or nanoparticles. The particles may be non-magnetic or magnetic. The magnetic particles may contain a ferromagnetic substance, and the ferromagnetic substance may be Fe, ni, co, iron oxide, or the like.

As used herein, "chemical coupling agent" refers to a group that is capable of reacting with another chemical group to form a covalent bond, i.e., a group that is covalently reactive under suitable reaction conditions. Nucleophilic groups, electrophilic groups, and photoactivatable groups may generally be selected. Exemplary chemical coupling agents include, but are not limited to, olefins, acetylenes, alcohols, acids, ethers, oxides, halides, aldehydes, ketones, carboxylic acids, esters, amides, cyanates, isocyanates, thiocyanates, isothiocyanates, amines, hydrazines, hydrazones, hydrazides, diazonium, nitre (nitre), nitriles, thiols, sulfides, disulfides, sulfoxides, sulfones, sulfonic acids, sulfuric acids, acetals, ketals, anhydrides, sulfates, sulfenates, isonitriles, amidines, diimides, imidoesters, nitrones, hydroxylamines, oximes, hydroxamic acids, thiohydroxamic acids, allenes, orthoesters, sulfites, enamines, alkynamines, ureas, pseudoureas, semicarbazides, carbodiimides, carbamates, imines, azides, azo compounds, azo oxide compounds, and nitroso compounds. Reactive functional groups of the chemical coupling agent also include those used to prepare bioconjugates, such as N-hydroxysuccinimide esters, maleimides, and the like. Methods of preparing each of these functional groups are well known in the art and their use or modification for a particular purpose is within the ability of those skilled in the art (see, e.g., sandier and Karo, editions, organic Functional Group preparations. Academic Press, san Diego, 1989).

As used herein, "tissue lysate" refers to a sample and/or biological sample material comprising lysed tissue, i.e., wherein the structural integrity of the tissue has been compromised. To release the contents of a tissue sample, the material is typically treated with enzymes and/or chemical agents to lyse, degrade or destroy the cell walls and cell membranes of such tissue. The skilled artisan is well aware of suitable methods for obtaining tissue lysates.

The second generation sequencing technology has the defects of too short reading length, PCR amplification error introduction, GC preference and the like, and can not completely meet the demands of people on whole genome sequencing. As high throughput sequencing technologies continue to be studied, three generations of sequencing featuring single molecule sequencing have emerged, such as SMRT technology (PacBio) of Pacific Bioscience and nanopore single molecule sequencing technology of Oxford Nanopore Technologies company. Compared with the second generation sequencing, the third generation sequencing technology is characterized by single molecule sequencing, namely PCR amplification is not needed, so that the error introduced by the PCR amplification is avoided, and meanwhile, the third generation sequencing can realize longer reading length and provide sequencing efficiency.

Target region capture sequencing is to customize target region into specific probe to hybridize with genome DNA, enrich target region DNA fragment and then sequence. The problems in the prior art are as follows: the cost of probe synthesis is relatively high, especially for longer target regions. If the number of probes used in enrichment of the target area can be reduced without significantly reducing the detection effect, the cost will be greatly reduced.

Based on the above purpose, the invention combines three-generation sequencing with kidney disease gene capturing, thereby realizing the sequencing of kidney disease genes. The invention firstly designs the probes for hybridization capture of the kidney disease genes, optimizes the average interval among the probes, and finally comprehensively considers the coverage uniformity and the number of the probes to determine the average interval among a plurality of probes. Therefore, the number of probes used in enrichment of the target area can be reduced on the premise of not remarkably reducing the detection effect, and the cost is greatly reduced.

The present invention provides a probe composition, wherein,

2) Comprises a plurality of probes, wherein the plurality of probes uniformly cover a kidney disease gene, and when each two adjacent probes are combined with the kidney disease gene, the cover sites have an overlapping area of not more than 10bp on average or have an average interval of 1 bp-4 kb;

3) The probe composition covers the whole length of the kidney disease gene;

preferably, the species of the kidney disease gene is derived from an animal;

further preferably, the species of the kidney disease gene is of human origin.

In the invention, every two adjacent probes can have overlapping coverage sites when combined with a kidney disease gene, but the average overlapping area is required to be not more than 10bp, so that the detection effect can be ensured, and the number of probes used in enrichment of a target area can be reduced, thereby reducing the cost. Alternatively, each two adjacent probes have a certain average interval when binding to the kidney disease gene, for example, 1 bp-4 kb, preferably, the average interval of the covered sites of each two adjacent probes is 500 bp-2 kb; more preferably, the average interval between the sites covered by each two adjacent probes is 900-1100 bp. The average spacing of the plurality of probes is related to the average length of each probe and the average length of genome fragmentation, for example, the average spacing range of the plurality of probes is calculated using the following formula:

N＝(L+2)×P±3×P；

wherein:

n: average interval of probes, unit bp;

p: average length of each probe, unit bp;

l: genome fragmentation average length, unit kb, is an integer;

for example, each probe has an average length of 120bp, the average length of genomic fragmentation is 5kb, and the average probe spacing range is calculated according to the above formula: 580 bp-1200 bp. In practical applications, the numerical value in this range can be selected as the average interval of the probes, and the average interval of the probes can be further optimized, and in example 1, the invention further optimizes the average interval among the plurality of probes, and finally determines that the average interval of the plurality of probes has both relatively fewer probes and relatively better coverage uniformity at 1 kb.

In one embodiment, the probe composition of the invention has the following features: the probe composition comprises group I: a probe for capturing the whole length of the kidney disease gene.

Wherein the kidney disease gene is a human kidney disease gene, and the reference sequence is human reference genome version Hg19. In some embodiments, the probe hybridizes to each nucleotide sequence in the kidney disease gene sequence.

The probe sequences of group I are shown below:

chr1：155158432-155158552，chr1：155159433-155159553，chr1：155160433-155160553，chr1：155161492-155161612，chr1：155162433-155162553，chr11：62392928-62393048，chr11：62393928-62394048，chr11：62394817-62394937，chr11：62395850-62395970，chr11：62396928-62397048，chr11：62397928-62398048，chr11：62398832-62398952，chr11：62399928-62400048，chr11：62400943-62401063，chr11：62401931-62402051，chr11：62402928-62403048，chr11：62404416-62404536，chr11：62405461-62405581，chr11：62406428-62406548，chr11：62407323-62407443，chr11：62408897-62409017，chr11：62410428-62410548，chr11：62412428-62412548，chr11：62413428-62413548，chr11：62424223-62424343，chr11：68080693-68080813，chr11：68081581-68081701，chr11：68082581-68082701，chr11：68083581-68083701，chr11：68084611-68084731，chr11：68085454-68085574，chr11：68086448-68086568，chr11：68087614-68087734，chr11：68088581-68088701，chr11：68089640-68089760，chr11：68090408-68090528，chr11：68091473-68091593，chr11：68092581-68092701，chr11：68093581-68093701，chr11：68094581-68094701，chr11：68095581-68095701，chr11：68096563-68096683，chr11：68097562-68097682，chr11：68098581-68098701，chr11：68099581-68099701，chr11：68100581-68100701，chr11：68101673-68101793，chr11：68102454-68102574，chr11：68103581-68103701，chr11：68105081-68105201，chr11：68106081-68106201，chr11：68107694-68107814，chr11：68108581-68108701，chr11：68109641-68109761，chr11：68110587-68110707，chr11：68111581-68111701，chr11：68112597-68112717，chr11：68113600-68113720，chr11：68114581-68114701，chr11：68115570-68115690，chr11：68116762-68116882，chr11：68117455-68117575，chr11：68118581-68118701，chr11：68119581-68119701，chr11：68120581-68120701，chr11：68121581-68121701，chr11：68122605-68122725，chr11：68124081-68124201，chr11：68125081-68125201，chr11：68126081-68126201，chr11：68127018-68127138，chr11：68128081-68128201，chr11：68130164-68130284，chr11：68131094-68131214，chr11：68132081-68132201，chr11：68133000-68133120，chr11：68134081-68134201，chr11：68135092-68135212，chr11：68136081-68136201，chr11：68137112-68137232，chr11：68138081-68138201，chr11：68139081-68139201，chr11：68140081-68140201，chr11：68141084-68141204，chr11：68142081-68142201，chr11：68143081-68143201，chr11：68144088-68144208，chr11：68145059-68145179，chr11：68146109-68146229，chr11：68147175-68147295，chr11：68148010-68148130，chr11：68149094-68149214，chr11：68150081-68150201，chr11：68150987-68151107，chr11：68152081-68152201，chr11：68153081-68153201，chr11：68154082-68154202，chr11：68155075-68155195，chr11：68156082-68156202，chr11：68157079-68157199，chr11：68157995-68158115，chr11：68159081-68159201，chr11：68160758-68160878，chr11：68161581-68161701，chr11：68162733-68162853，chr11：68163581-68163701，chr11：68164656-68164776，chr11：68165581-68165701，chr11：68167081-68167201，chr11：68168581-68168701，chr11：68169581-68169701，chr11：68170690-68170810，chr11：68171581-68171701，chr11：68173073-68173193，chr11：68174081-68174201，chr11：68174925-68175045，chr11：68176109-68176229，chr11：68176939-68177059，chr11：68178106-68178226，chr11：68178963-68179083，chr11：68180088-68180208，chr11：68181095-68181215，chr11：68182081-68182201，chr11：68183581-68183701，chr11：68184581-68184701，chr11：68186081-68186201，chr11：68187581-68187701，chr11：68188649-68188769，chr11：68189652-68189772，chr11：68190608-68190728，chr11：68191581-68191701，chr11：68192399-68192519，chr11：68193464-68193584，chr11：68194581-68194701，chr11：68196135-68196255，chr11：68197081-68197201，chr11：68198081-68198201，chr11：68199081-68199201，chr11：68200081-68200201，chr11：68200935-68201055，chr11：68202104-68202224，chr11：68203087-68203207，chr11：68204150-68204270，chr11：68205091-68205211，chr11：68206081-68206201，chr11：68207081-68207201，chr11：68208072-68208192，chr11：68209581-68209701，chr11：68210511-68210631，chr11：68211581-68211701，chr11：68212454-68212574，chr11：68213584-68213704，chr11：68214581-68214701，chr11：68215755-68215875，chr11：68216638-68216758，chr11：77806866-77806986，chr11：77807639-77807759，chr11：77808898-77809018，chr11：77809941-77810061，chr11：77810928-77811048，chr11：77811875-77811995，chr11：77812742-77812862，chr11：77813977-77814097，chr11：77815390-77815510，chr11：77816457-77816577，chr11：77817507-77817627，chr11：77818529-77818649，chr11：77819967-77820087，chr11：77820928-77821048，chr11：77821928-77822048，chr11：77822935-77823055，chr11：77823908-77824028，chr11：77824928-77825048，chr11：77826344-77826464，chr11：77827376-77827496，chr11：77828319-77828439，chr11：77829308-77829428，chr11：77830312-77830432，chr11：77831469-77831589，chr11：77832411-77832531，chr11：77833253-77833373，chr11：77834564-77834684，chr11：77835490-77835610，chr11：77836421-77836541，chr11：77837981-77838101，chr11：77839008-77839128，chr11：77839928-77840048，chr11：77840910-77841030，chr11：77842115-77842235，chr11：77842954-77843074，chr11：77843760-77843880，chr11：77844961-77845081，chr11：77848987-77849107，chr11：77849918-77850038，chr12：6058169-6058289，chr12：6059167-6059287，chr12：6060122-6060242，chr12：6061169-6061289，chr12：6062017-6062137，chr12：6063166-6063286，chr12：6064002-6064122，chr12：6065088-6065208，chr12：6066281-6066401，chr12：6067169-6067289，chr12：6067998-6068118，chr12：6069209-6069329，chr12：6070669-6070789，chr12：6071626-6071746，chr12：6072669-6072789，chr12：6073669-6073789，chr12：6074669-6074789，chr12：6075669-6075789，chr12：6076664-6076784，chr12：6077535-6077655，chr12：6078669-6078789，chr12：6079669-6079789，chr12：6080622-6080742，chr12：6081669-6081789，chr12：6082669-6082789，chr12：6083669-6083789，chr12：6084656-6084776，chr12：6085669-6085789，chr12：6086528-6086648，chr12：6087669-6087789，chr12：6088535-6088655，chr12：6090220-6090340，chr12：6091169-6091289，chr12：6092169-6092289，chr12：6093169-6093289，chr12：6094182-6094302，chr12：6095169-6095289，chr12：6095986-6096106，chr12：6097169-6097289，chr12：6098169-6098289，chr12：6099169-6099289，chr12：6100234-6100354，chr12：6101169-6101289，chr12：6102169-6102289，chr12：6103169-6103289，chr12：6104059-6104179，chr12：6105169-6105289，chr12：6106169-6106289，chr12：6107267-6107387，chr12：6108157-6108277，chr12：6109170-6109290，chr12：6110169-6110289，chr12：6111169-6111289，chr12：6111992-6112112，chr12：6113250-6113370，chr12：6114183-6114303，chr12：6115132-6115252，chr12：6116169-6116289，chr12：6117148-6117268，chr12：6118070-6118190，chr12：6119239-6119359，chr12：6120169-6120289，chr12：6121169-6121289，chr12：6122187-6122307，chr12：6123169-6123289，chr12：6124013-6124133，chr12：6125169-6125289，chr12：6126169-6126289，chr12：6127125-6127245，chr12：6128169-6128289，chr12：6129094-6129214，chr12：6130169-6130289，chr12：6131169-6131289，chr12：6132131-6132251，chr12：6133169-6133289，chr12：6134130-6134250，chr12：6135169-6135289，chr12：6136169-6136289，chr12：6137169-6137289，chr12：6138656-6138776，chr12：6139669-6139789，chr12：6140669-6140789，chr12：6141713-6141833，chr12：6142669-6142789，chr12：6143669-6143789，chr12：6144669-6144789，chr12：6145666-6145786，chr12：6146669-6146789，chr12：6147669-6147789，chr12：6148665-6148785，chr12：6149669-6149789，chr12：6151169-6151289，chr12：6152169-6152289，chr12：6153169-6153289，chr12：6154169-6154289，chr12：6155010-6155130，chr12：6156170-6156290，chr12：6157169-6157289，chr12：6158169-6158289，chr12：6159169-6159289，chr12：6160287-6160407，chr12：6161169-6161289，chr12：6162201-6162321，chr12：6163169-6163289，chr12：6164169-6164289，chr12：6165169-6165289，chr12：6166243-6166363，chr12：6167169-6167289，chr12：6168169-6168289，chr12：6169169-6169289，chr12：6170340-6170460，chr12：6171299-6171419，chr12：6172177-6172297，chr12：6173169-6173289，chr12：6174157-6174277，chr12：6175202-6175322，chr12：6176169-6176289，chr12：6177140-6177260，chr12：6178271-6178391，chr12：6179236-6179356，chr12：6180169-6180289，chr12：6181169-6181289，chr12：6182292-6182412，chr12：6183169-6183289，chr12：6184151-6184271，chr12：6185169-6185289，chr12：6186120-6186240，chr12：6187169-6187289，chr12：6188169-6188289，chr12：6189169-6189289，chr12：6190169-6190289，chr12：6191043-6191163，chr12：6192087-6192207，chr12：6193169-6193289，chr12：6194169-6194289，chr12：6195169-6195289，chr12：6196169-6196289，chr12：6197167-6197287，chr12：6198169-6198289，chr12：6199206-6199326，chr12：6200169-6200289，chr12：6201169-6201289，chr12：6202232-6202352，chr12：6203177-6203297，chr12：6204385-6204505，chr12：6205161-6205281，chr12：6206110-6206230，chr12：6207135-6207255，chr12：6208103-6208223，chr12：6210263-6210383，chr12：6211143-6211263，chr12：6214168-6214288，chr12：6215276-6215396，chr12：6216693-6216813，chr12：6218050-6218170，chr12：6219169-6219289，chr12：6220045-6220165，chr12：6221169-6221289，chr12：6222169-6222289，chr12：6223169-6223289，chr12：6224140-6224260，chr12：6225169-6225289，chr12：6226169-6226289，chr12：6227190-6227310，chr12：6228169-6228289，chr12：6229169-6229289，chr12：6230169-6230289，chr12：6231169-6231289，chr12：6232169-6232289，chr12：6233169-6233289，chr13：110801442-110801562，chr13：110802337-110802457，chr13：110803330-110803450，chr13：110804235-110804355，chr13：110805450-110805570，chr13：110806279-110806399，chr13：110807356-110807476，chr13：110808363-110808483，chr13：110809337-110809457，chr13：110810372-110810492，chr13：110811363-110811483，chr13：110812278-110812398，chr13：110813450-110813570，chr13：110814337-110814457，chr13：110815337-110815457，chr13：110816170-110816290，chr13：110817337-110817457，chr13：110818330-110818450，chr13：110819337-110819457，chr13：110820268-110820388，chr13：110821337-110821457，chr13：110822247-110822367，chr13：110823337-110823457，chr13：110824340-110824460，chr13：110825337-110825457，chr13：110826337-110826457，chr13：110827337-110827457，chr13：110828337-110828457，chr13：110829337-110829457，chr13：110830337-110830457，chr13：110831337-110831457，chr13：110832337-110832457，chr13：110833277-110833397，chr13：110834337-110834457，chr13：110835350-110835470，chr13：110836337-110836457，chr13：110837337-110837457，chr13：110838337-110838457，chr13：110839374-110839494，chr13：110840337-110840457，chr13：110841244-110841364，chr13：110842446-110842566，chr13：110843320-110843440，chr13：110844337-110844457，chr13：110845337-110845457，chr13：110846337-110846457，chr13：110847337-110847457，chr13：110848337-110848457，chr13：110849402-110849522，chr13：110850327-110850447，chr13：110851337-110851457，chr13：110852304-110852424，chr13：110853337-110853457，chr13：110854337-110854457，chr13：110855179-110855299，chr13：110856179-110856299，chr13：110857295-110857415，chr13：110858444-110858564，chr13：110859337-110859457，chr13：110860337-110860457，chr13：110861326-110861446，chr13：110862337-110862457，chr13：110863337-110863457，chr13：110864313-110864433，chr13：110865837-110865957，chr13：110866986-110867106，chr13：110867948-110868068，chr13：110868797-110868917，chr13：110869814-110869934，chr13：110870887-110871007，chr13：110871837-110871957，chr13：110873332-110873452，chr13：110874337-110874457，chr13：110875337-110875457，chr13：110876352-110876472，chr13：110877359-110877479，chr13：110878357-110878477，chr13：110879337-110879457，chr13：110880329-110880449，chr13：110881337-110881457，chr13：110882337-110882457，chr13：110883337-110883457，chr13：110884349-110884469，chr13：110885337-110885457，chr13：110886325-110886445，chr13：110887178-110887298，chr13：110888351-110888471，chr13：110889337-110889457，chr13：110890337-110890457，chr13：110891337-110891457，chr13：110892274-110892394，chr13：110893479-110893599，chr13：110894337-110894457，chr13：110895345-110895465，chr13：110896508-110896628，chr13：110897337-110897457，chr13：110898241-110898361，chr13：110899337-110899457，chr13：110900336-110900456，chr13：110901337-110901457，chr13：110902381-110902501，chr13：110903337-110903457，chr13：110904211-110904331，chr13：110905281-110905401，chr13：110906809-110906929，chr13：110907790-110907910，chr13：110908837-110908957，chr13：110909837-110909957，chr13：110911007-110911127，chr13：110911832-110911952，chr13：110912837-110912957，chr13：110913837-110913957，chr13：110914853-110914973，chr13：110915720-110915840，chr13：110916804-110916924，chr13：110917837-110917957，chr13：110918837-110918957，chr13：110919837-110919957，chr13：110920837-110920957，chr13：110921846-110921966，chr13：110922837-110922957，chr13：110923837-110923957，chr13：110924837-110924957，chr13：110925837-110925957，chr13：110926837-110926957，chr13：110927712-110927832，chr13：110928798-110928918，chr13：110929837-110929957，chr13：110930684-110930804，chr13：110931829-110931949，chr13：110932841-110932961，chr13：110933802-110933922，chr13：110934837-110934957，chr13：110935864-110935984，chr13：110936715-110936835，chr13：110937919-110938039，chr13：110938837-110938957，chr13：110939837-110939957，chr13：110940940-110941060，chr13：110941837-110941957，chr13：110942837-110942957，chr13：110943837-110943957，chr13：110944700-110944820，chr13：110945837-110945957，chr13：110946827-110946947，chr13：110947676-110947796，chr13：110948811-110948931，chr13：110949892-110950012，chr13：110950810-110950930，chr13：110951837-110951957，chr13：110952894-110953014，chr13：110953812-110953932，chr13：110954837-110954957，chr13：110955837-110955957，chr13：110956837-110956957，chr13：110957767-110957887，chr13：110958757-110958877，chr15：38545302-38545422，chr15：38545986-38546106，chr15：38546983-38547103，chr15：38548069-38548189，chr15：38549261-38549381，chr15：38550093-38550213，chr15：38551171-38551291，chr15：38552173-38552293，chr15：38553173-38553293，chr15：38554173-38554293，chr15：38555173-38555293，chr15：38556173-38556293，chr15：38557336-38557456，chr15：38558173-38558293，chr15：38559173-38559293，chr15：38560293-38560413，chr15：38561011-38561131，chr15：38562022-38562142，chr15：38563109-38563229，chr15：38565451-38565690，chr15：38566497-38566617，chr15：38567490-38567610，chr15：38568673-38568793，chr15：38570249-38570369，chr15：38571295-38571415，chr15：38572175-38572295，chr15：38573175-38573295，chr15：38574231-38574351，chr15：38575115-38575235，chr15：38576318-38576438，chr15：38577173-38577293，chr15：38578073-38578193，chr15：38579173-38579293，chr15：38580137-38580257，chr15：38581173-38581293，chr15：38582175-38582295，chr15：38584942-38585062，chr15：38585577-38585697，chr15：38586863-38586983，chr15：38587673-38587793，chr15：38588673-38588793，chr15：38589657-38589777，chr15：38590688-38590808，chr15：38591649-38591769，chr15：38592673-38592793，chr15：38593675-38593795，chr15：38594720-38594840，chr15：38595593-38595713，chr15：38596776-38596896，chr15：38597719-38597839，chr15：38598771-38598891，chr15：38599783-38599903，chr15：38600679-38600799，chr15：38601616-38601736，chr15：38602711-38602831，chr15：38603644-38603764，chr15：38604673-38604793，chr15：38605673-38605793，chr15：38606670-38606790，chr15：38607673-38607793，chr15：38608714-38608834，chr15：38609649-38609769，chr15：38610683-38610803，chr15：38611825-38611945，chr15：38612705-38612825，chr15：38613645-38613765，chr15：38614496-38614616，chr15：38615602-38615722，chr15：38616646-38616766，chr15：38617673-38617793，chr15：38618545-38618665，chr15：38619679-38619799，chr15：38620672-38620792，chr15：38621673-38621793，chr15：38622673-38622793，chr15：38623638-38623758，chr15：38624721-38624841，chr15：38625719-38625839，chr15：38626495-38626615，chr15：38627659-38627779，chr15：38628671-38628791，chr15：38629626-38629746，chr15：38630673-38630793，chr15：38631850-38631970，chr15：38632669-38632789，chr15：38633673-38633793，chr15：38634678-38634798，chr15：38635794-38635914，chr15：38636672-38636792，chr15：38637644-38637764，chr15：38638673-38638793，chr15：38639673-38639793，chr15：38640688-38640808，chr15：38641627-38641747，chr15：38642775-38642895，chr15：38643673-38643793，chr15：38644735-38644855，chr15：38645675-38645795，chr15：38646673-38646793，chr15：38647635-38647755，chr15：38648630-38648750，chr16：2098156-2098276，chr16：2098958-2099078，chr16：2100210-2100330，chr16：2100959-2101079，chr16：2102113-2102233，chr16：2103113-2103233，chr16：2104203-2104323，chr16：2105113-2105233，chr16：2106088-2106208，chr16：2107057-2107177，chr16：2108173-2108293，chr16：2108971-2109091，chr16：2110613-2110733，chr16：2111472-2111592，chr16：2112511-2112631，chr16：2113613-2113733，chr16：2114654-2114774，chr16：2115686-2115806，chr16：2116538-2116658，chr16：2117738-2117858，chr16：2118440-2118560，chr16：2119883-2120003，chr16：2120486-2120606，chr16：2121657-2121777，chr16：2122605-2122725，chr16：2123611-2123731，chr16：2124739-2124859，chr16：2126113-2126233，chr16：2127073-2127193，chr16：2128087-2128207，chr16：2129101-2129221，chr16：2130087-2130207，chr16：2131093-2131213，chr16：2132113-2132233，chr16：2133113-2133233，chr16：2134121-2134241，chr16：2135184-2135304，chr16：2135969-2136089，chr16：2137027-2137147，chr16：2138180-2138300，chr16：2139122-2139242，chr16：2140113-2140233，chr16：2141113-2141233，chr16：2142204-2142324，chr16：2142974-2143094，chr16：2144153-2144273，chr16：2144884-2145004，chr16：2146135-2146255，chr16：2147130-2147250，chr16：2148113-2148233，chr16：2149200-2149320，chr16：2150113-2150233，chr16：2151245-2151365，chr16：2152113-2152233，chr16：2153114-2153234，chr16：2154077-2154197，chr16：2155064-2155184，chr16：2156113-2156233，chr16：2157092-2157212，chr16：2158113-2158233，chr16：2159113-2159233，chr16：2160242-2160362，chr16：2161113-2161233，chr16：2162116-2162236，chr16：2163113-2163233，chr16：2163929-2164049，chr16：2165113-2165233，chr16：2166214-2166334，chr16：2167113-2167233，chr16：2168073-2168193，chr16：2169113-2169233，chr16：2170229-2170349，chr16：2172113-2172233，chr16：2172932-2173052，chr16：2174105-2174225，chr16：2175113-2175233，chr16：2176231-2176351，chr16：2177128-2177248，chr16：2178300-2178420，chr16：2179802-2179922，chr16：2180719-2180839，chr16：2181795-2181915，chr16：2183080-2183200，chr16：2184069-2184189，chr16：2185065-2185185，chr16：8882611-8882731，chr16：8883611-8883731，chr16：8884436-8884556，chr16：8885721-8885841，chr16：8886611-8886731，chr16：8888020-8888140，chr16：8889111-8889231，chr16：8890111-8890231，chr16：8891111-8891231，chr16：8892111-8892231，chr16：8893114-8893234，chr16：8894181-8894301，chr16：8895111-8895231，chr16：8896111-8896231，chr16：8897111-8897231，chr16：8898159-8898279，chr16：8899697-8899817，chr16：8900611-8900731，chr16：8901617-8901737，chr16：8902617-8902737，chr16：8903548-8903668，chr16：8904793-8904913，chr16：8905612-8905732，chr16：8906545-8906665，chr16：8907611-8907731，chr16：8908468-8908588，chr16：8909449-8909569，chr16：8911111-8911231，chr16：8912111-8912231，chr16：8913093-8913213，chr16：8914111-8914231，chr16：8915122-8915242，chr16：8916473-8916593，chr16：8918159-8918279，chr16：8919448-8919568，chr16：8920619-8920739，chr16：8921782-8921902，chr16：8922611-8922731，chr16：8923509-8923629，chr16：8925123-8925243，chr16：8926111-8926231，chr16：8939276-8939396，chr16：8940045-8940165，chr16：8941111-8941231，chr16：8942111-8942231，chr16：8943122-8943242，chr16：20344928-20345048，chr16：20345928-20346048，chr16：20346928-20347048，chr16：20347928-20348048，chr16：20348975-20349095，chr16：20349707-20349827，chr16：20350917-20351037，chr16：20351928-20352048，chr16：20352928-20353048，chr16：20353928-20354048，chr16：20354981-20355101，chr16：20355946-20356066，chr16：20356928-20357048，chr16：20357856-20357976，chr16：20359022-20359142，chr16：20359887-20360007，chr16：20360908-20361028，chr16：20361928-20362048，chr16：20362926-20363046，chr16：20363928-20364048，chr16：20364923-20365043，chr16：20365928-20366048，chr16：20366984-20367104，chr17：29421969-29422089，chr17：29422969-29423089，chr17：29423938-29424058，chr17：29424983-29425103，chr17：29425985-29426105，chr17：29426897-29427017，chr17：29427969-29428089，chr17：29428940-29429060，chr17：29430104-29430224，chr17：29431392-29431512，chr17：29432420-29432540，chr17：29433472-29433592，chr17：29434329-29434449，chr17：29435551-29435671，chr17：29436322-29436442，chr17：29437441-29437561，chr17：29438469-29438589，chr17：29439332-29439452，chr17：29441153-29441273，chr17：29442496-29442616，chr17：29443469-29443589，chr17：29444969-29445089，chr17：29448002-29448122，chr17：29449028-29449148，chr17：29449969-29450089，chr17：29450969-29451089，chr17：29451969-29452089，chr17：29452866-29452986，chr17：29454026-29454146，chr17：29454902-29455022，chr17：29457530-29457650，chr17：29458561-29458681，chr17：29459536-29459656，chr17：29461140-29461260，chr17：29461924-29462044，chr17：29462969-29463089，chr17：29463969-29464089，chr17：29464969-29465089，chr17：29466586-29466706，chr17：29467285-29467405，chr17：29468415-29468535，chr17：29469485-29469605，chr17：29470541-29470661，chr17：29471468-29471588，chr17：29472474-29472594，chr17：29473469-29473589，chr17：29474574-29474694，chr17：29475433-29475553，chr17：29476608-29476728，chr17：29477325-29477445，chr17：29478469-29478589，chr17：29479469-29479589，chr17：29480471-29480591，chr17：29481353-29481473，chr17：29482402-29482522，chr17：29483469-29483589，chr17：29484281-29484401，chr17：29485430-29485550，chr17：29486490-29486610，chr17：29487590-29487710，chr17：29488469-29488589，chr17：29489469-29489589，chr17：29490307-29490427，chr17：29491527-29491647，chr17：29492310-29492430，chr17：29493469-29493589，chr17：29494393-29494513，chr17：29495533-29495653，chr17：29496281-29496401，chr17：29497472-29497592，chr17：29498469-29498589，chr17：29499469-29499589，chr17：29500610-29500730，chr17：29501383-29501503，chr17：29506543-29506663，chr17：29508469-29508589，chr17：29509508-29509628，chr17：29510469-29510589，chr17：29516071-29516191，chr17：29517272-29517392，chr17：29517861-29517981，chr17：29518969-29519089，chr17：29520467-29520587，chr17：29521843-29521963，chr17：29523083-29523203，chr17：29524626-29524746，chr17：29525546-29525666，chr17：29526522-29526642，chr17：29527469-29527589，chr17：29528439-29528559，chr17：29529477-29529597，chr17：29530469-29530589，chr17：29531453-29531573，chr17：29532469-29532589，chr17：29533343-29533463，chr17：29534434-29534554，chr17：29535469-29535589，chr17：29536469-29536589，chr17：29537572-29537692，chr17：29538396-29538516，chr17：29539346-29539466，chr17：29540469-29540589，chr17：29541469-29541589，chr17：29542469-29542589，chr17：29543544-29543664，chr17：29544577-29544697，chr17：29545349-29545469，chr17：29546632-29546752，chr17：29547469-29547589，chr17：29548419-29548539，chr17：29549469-29549589，chr17：29550652-29550772，chr17：29551521-29551641，chr17：29552498-29552618，chr17：29553469-29553589，chr17：29554320-29554440，chr17：29555534-29555654，chr17：29556558-29556678，chr17：29557469-29557589，chr17：29558425-29558545，chr17：29559484-29559604，chr17：29560469-29560589，chr17：29561306-29561426，chr17：29562603-29562723，chr17：29563313-29563433，chr17：29564558-29564678，chr17：29565370-29565490，chr17：29566465-29566585，chr17：29571599-29571719，chr17：29572379-29572499，chr17：29573510-29573630，chr17：29574404-29574524，chr17：29575342-29575462，chr17：29576464-29576584，chr17：29577434-29577554，chr17：29578469-29578589，chr17：29579481-29579601，chr17：29580396-29580516，chr17：29581469-29581589，chr17：29582486-29582606，chr17：29583471-29583591，chr17：29584644-29584764，chr17：29585399-29585519，chr17：29586601-29586721，chr17：29587457-29587577，chr17：29588469-29588589，chr17：29589466-29589586，chr17：29591014-29591134，chr17：29591969-29592089，chr17：29592859-29592979，chr17：29593827-29593947，chr17：29594969-29595089，chr17：29595988-29596108，chr17：29596969-29597089，chr17：29597912-29598032，chr17：29598830-29598950，chr17：29599969-29600089，chr17：29600964-29601084，chr17：29602083-29602203，chr17：29602872-29602992，chr17：29603796-29603916，chr17：29604912-29605032，chr17：29606413-29606533，chr17：29607532-29607652，chr17：29608470-29608590，chr17：29609969-29610089，chr17：29610969-29611089，chr17：29612313-29612433，chr17：29613473-29613593，chr17：29614469-29614589，chr17：29615452-29615572，chr17：29616469-29616589，chr17：29617508-29617628，chr17：29618469-29618589，chr17：29619463-29619583，chr17：29620449-29620569，chr17：29621469-29621589，chr17：29622469-29622589，chr17：29623467-29623587，chr17：29624332-29624452，chr17：29625501-29625621，chr17：29626469-29626589，chr17：29627466-29627586，chr17：29628583-29628703，chr17：29629469-29629589，chr17：29630469-29630589，chr17：29631469-29631589，chr17：29632438-29632558，chr17：29633486-29633606，chr17：29634469-29634589，chr17：29635469-29635589，chr17：29636469-29636589，chr17：29637469-29637589，chr17：29638529-29638649，chr17：29639508-29639628，chr17：29640336-29640456，chr17：29641364-29641484，chr17：29642582-29642702，chr17：29643542-29643662，chr17：29644462-29644582，chr17：29645467-29645587，chr17：29646421-29646541，chr17：29647393-29647513，chr17：29648656-29648776，chr17：29649651-29649771，chr17：29650469-29650589，chr17：29651485-29651605，chr17：29652469-29652589，chr17：29653603-29653723，chr17：29654469-29654589，chr17：29655551-29655671，chr17：29656360-29656480，chr17：29657393-29657513，chr17：29658644-29658764，chr17：29659477-29659597，chr17：29660469-29660589，chr17：29661381-29661501，chr17：29662566-29662686，chr17：29663397-29663517，chr17：29664469-29664589，chr17：29665539-29665659，chr17：29666469-29666589，chr17：29667469-29667589，chr17：29668599-29668719，chr17：29669576-29669696，chr17：29670575-29670695，chr17：29671458-29671578，chr17：29672306-29672426，chr17：29673469-29673589，chr17：29674502-29674622，chr17：29675489-29675609，chr17：29676469-29676589，chr17：29677505-29677625，chr17：29678969-29679089，chr17：29679841-29679961，chr17：29681127-29681247，chr17：29681890-29682010，chr17：29682969-29683089，chr17：29683969-29684089，chr17：29684947-29685067，chr17：29685969-29686089，chr17：29687048-29687168，chr17：29687969-29688089，chr17：29688961-29689081，chr17：29689984-29690104，chr17：29691018-29691138，chr17：29691935-29692055，chr17：29692925-29693045，chr17：29694147-29694267，chr17：29695059-29695179，chr17：29695969-29696089，chr17：29696994-29697114，chr17：29697822-29697942，chr17：29698941-29699061，chr17：29700047-29700167，chr17：29700969-29701089，chr17：29701993-29702113，chr17：29703030-29703150，chr17：29703969-29704089，chr17：29704969-29705089，chr17：29705965-29706085，chr17：29706969-29707089，chr17：29707969-29708089，chr17：29708946-29709066，chr17：36046939-36047059，chr17：36047945-36048065，chr17：36048775-36048895，chr17：36049944-36050064，chr17：36050945-36051065，chr17：36051945-36052065，chr17：36052816-36052936，chr17：36054086-36054206，chr17：36056445-36056565，chr17：36057455-36057575，chr17：36058445-36058565，chr17：36059408-36059528，chr17：36060433-36060553，chr17：36061445-36061565，chr17：36062445-36062565，chr17：36063274-36063394，chr17：36064392-36064512，chr17：36065405-36065525，chr17：36066443-36066563，chr17：36067446-36067566，chr17：36068445-36068565，chr17：36069523-36069643，chr17：36070445-36070565，chr17：36071445-36071565，chr17：36072445-36072565，chr17：36073491-36073611，chr17：36074445-36074565，chr17：36075458-36075578，chr17：36076465-36076585，chr17：36077460-36077580，chr17：36078445-36078565，chr17：36079445-36079565，chr17：36080578-36080698，chr17：36081445-36081565，chr17：36082445-36082565，chr17：36083445-36083565，chr17：36084402-36084522，chr17：36085445-36085565，chr17：36086445-36086565，chr17：36087445-36087565，chr17：36088565-36088685，chr17：36089445-36089565，chr17：36090445-36090565，chr17：36091445-36091565，chr17：36092466-36092586，chr17：36093445-36093565，chr17：36094445-36094565，chr17：36095445-36095565，chr17：36096445-36096565，chr17：36097431-36097551，chr17：36098438-36098558，chr17：36099448-36099568，chr17：36100545-36100665，chr17：36101420-36101540，chr17：36102445-36102565，chr17：36103436-36103556，chr17：36104475-36104595，chr19：11546124-11546244，chr19：11547124-11547244，chr19：11548624-11548744，chr19：11549624-11549744，chr19：11550813-11550933，chr19：11551532-11551652，chr19：11552624-11552744，chr19：11553780-11553900，chr19：11555110-11555230，chr19：11556164-11556284，chr19：11557124-11557244，chr19：11558124-11558244，chr19：11559251-11559371，chr19：11560240-11560360，chr19：11561638-11561758，chr22：29999996-30000116，chr22：30000830-30000950，chr22：30001851-30001971，chr22：30002996-30003116，chr22：30004173-30004293，chr22：30004954-30005074，chr22：30005966-30006086，chr22：30007485-30007605，chr22：30008587-30008707，chr22：30009590-30009710，chr22：30011185-30011305，chr22：30013172-30013292，chr22：30013996-30014116，chr22：30014902-30015022，chr22：30015828-30015948，chr22：30016996-30017116，chr22：30017980-30018100，chr22：30019185-30019305，chr22：30019996-30020116，chr22：30021174-30021294，chr22：30021996-30022116，chr22：30023139-30023259，chr22：30023996-30024116，chr22：30024996-30025116，chr22：30025995-30026115，chr22：30026996-30027116，chr22：30027937-30028057，chr22：30028996-30029116，chr22：30029996-30030116，chr22：30030996-30031116，chr22：30032013-30032133，chr22：30032996-30033116，chr22：30033996-30034116，chr22：30034996-30035116，chr22：30036164-30036284，chr22：30037082-30037202，chr22：30037996-30038116，chr22：30038996-30039116，chr22：30041496-30041616，chr22：30042348-30042468，chr22：30043496-30043616，chr22：30044496-30044616，chr22：30046167-30046287，chr22：30046847-30046967，chr22：30047994-30048114，chr22：30049033-30049153，chr22：30049996-30050116，chr22：30050996-30051116，chr22：30051846-30051966，chr22：30053036-30053156，chr22：30053996-30054116，chr22：30054872-30054992，chr22：30055996-30056116，chr22：30056996-30057116，chr22：30057971-30058091，chr22：30058992-30059112，chr22：30060008-30060128，chr22：30060884-30061004，chr22：30062046-30062166，chr22：30062996-30063116，chr22：30063996-30064116，chr22：30064996-30065116，chr22：30065905-30066025，chr22：30066996-30067116，chr22：30067976-30068096，chr22：30069510-30069630，chr22：30070496-30070616，chr22：30071496-30071616，chr22：30072440-30072560，chr22：30073482-30073602，chr22：30074510-30074630，chr22：30075363-30075483，chr22：30076496-30076616，chr22：30077496-30077616，chr22：30078496-30078616，chr22：30079496-30079616，chr22：30080433-30080553，chr22：30081658-30081778，chr22：30082603-30082723，chr22：30083496-30083616，chr22：30084515-30084635，chr22：30085496-30085616，chr22：30086496-30086616，chr22：30087512-30087632，chr22：30088496-30088616，chr22：30089496-30089616，chr22：30090496-30090616，chr22：30091550-30091670，chr22：30092496-30092616，chr22：30093469-30093589，chr22：30094519-30094639，chr3：10183929-10184049，chr3：10185586-10185706，chr3：10187001-10187121，chr3：10188116-10188236，chr3：10188967-10189087，chr3：10189935-10190055，chr3：10191086-10191206，chr3：10192086-10192206，chr3：10193093-10193213，chr3：10194042-10194162，chr3：10195096-10195216，chr3：127770848-127770968，chr3：127771935-127772055，chr3：127772935-127773055，chr3：127774014-127774134，chr3：127774935-127775055，chr3：127776034-127776154，chr3：127776929-127777049，chr3：127777930-127778050，chr3：127778935-127779055，chr3：127779935-127780055，chr3：127780935-127781055，chr3：127781921-127782041，chr3：127782935-127783055，chr3：127783935-127784055，chr3：127784951-127785071，chr3：127785935-127786055，chr3：127786944-127787064，chr3：127788009-127788129，chr3：127788935-127789055，chr3：127789935-127790055，chr3：137780926-137781046，chr3：137781926-137782046，chr3：137782926-137783046，chr3：137783926-137784046，chr3：137784926-137785046，chr3：137785926-137786046，chr3：137786859-137786979，chr3：137787799-137787919，chr3：137788926-137789046，chr3：137789926-137790046，chr3：137790926-137791046，chr3：137794917-137795037，chr3：137796426-137796546，chr3：137797426-137797546，chr3：137798426-137798546，chr3：137799426-137799546，chr3：137800426-137800546，chr3：137801426-137801546，chr3：137802426-137802546，chr3：137803460-137803580，chr3：137805426-137805546，chr3：137806564-137806684，chr3：137807426-137807546，chr3：137808248-137808368，chr3：137809426-137809546，chr3：137810519-137810639，chr3：137811426-137811546，chr3：137813116-137813236，chr3：137813926-137814046，chr3：137814931-137815051，chr3：137816112-137816232，chr3：137816840-137816960，chr3：137817951-137818071，chr3：137818849-137818969，chr3：137819836-137819956，chr3：137822572-137822692，chr3：137823426-137823546，chr3：137824502-137824622，chr3：137825288-137825408，chr3：137826463-137826583，chr3：137827426-137827546，chr3：137828244-137828364，chr3：137829926-137830046，chr3：137830926-137831046，chr3：137831926-137832046，chr3：137832926-137833046，chr3：137833811-137833931，chr3：186285320-186285440，chr3：186286309-186286429，chr3：186287367-186287487，chr3：186288321-186288441，chr3：186289297-186289417，chr3：186290423-186290543，chr3：186291433-186291553，chr3：186292472-186292592，chr3：186293276-186293396，chr3：186294353-186294473，chr3：186295362-186295482，chr3：186296339-186296459，chr3：186297320-186297440，chr3：186298373-186298493，chr3：186299316-186299436，chr3：186300313-186300433，chr3：186301302-186301422，chr3：186302300-186302420，chr3：186303320-186303440，chr4：88929158-88929278，chr4：88930256-88930376，chr4：88931163-88931283，chr4：88932210-88932330，chr4：88933288-88933408，chr4：88934292-88934412，chr4：88935288-88935408，chr4：88936373-88936493，chr4：88937330-88937450，chr4：88938430-88938550，chr4：88939276-88939396，chr4：88940288-88940408，chr4：88941163-88941283，chr4：88942308-88942428，chr4：88943288-88943408，chr4：88944788-88944908，chr4：88945890-88946010，chr4：88949401-88949521，chr4：88950288-88950408，chr4：88951173-88951293，chr4：88952232-88952352，chr4：88953438-88953558，chr4：88954197-88954317，chr4：88955280-88955400，chr4：88956288-88956408，chr4：88957288-88957408，chr4：88958365-88958485，chr4：88959288-88959408，chr4：88960288-88960408，chr4：88961288-88961408，chr4：88962288-88962408，chr4：88963176-88963296，chr4：88964240-88964360，chr4：88965241-88965361，chr4：88966288-88966408，chr4：88967405-88967525，chr4：88968277-88968397，chr4：88969280-88969400，chr4：88970415-88970535，chr4：88971471-88971591，chr4：88972288-88972408，chr4：88973129-88973249，chr4：88974403-88974523，chr4：88975172-88975292，chr4：88976288-88976408，chr4：88977785-88977905，chr4：88978845-88978965，chr4：88979720-88979840，chr4：88980669-88980789，chr4：88981788-88981908，chr4：88982859-88982979，chr4：88983653-88983773，chr4：88984788-88984908，chr4：88985664-88985784，chr4：88986788-88986908，chr4：88987941-88988061，chr4：88988841-88988961，chr4：88989916-88990036，chr4：88990836-88990956，chr4：88991630-88991750，chr4：88992788-88992908，chr4：88993788-88993908，chr4：88995194-88995314，chr4：88996421-88996541，chr4：88997288-88997408，chr4：88998288-88998408，chr6：32006284-32006404，chr6：32007192-32007312，chr6：32008192-32008312，chr6：32009192-32009312，chr6：51480684-51480804，chr6：51481659-51481779，chr6：51482684-51482804，chr6：51483710-51483830，chr6：51484617-51484737，chr6：51485704-51485824，chr6：51486668-51486788，chr6：51487724-51487844，chr6：51488651-51488771，chr6：51489660-51489780，chr6：51490684-51490804，chr6：51491684-51491804，chr6：51492684-51492804，chr6：51494686-51494806，chr6：51495718-51495838，chr6：51496644-51496764，chr6：51497837-51497957，chr6：51498513-51498633，chr6：51499572-51499692，chr6：51500684-51500804，chr6：51501498-51501618，chr6：51502678-51502798，chr6：51503644-51503764，chr6：51504619-51504739，chr6：51505682-51505802，chr6：51506867-51506987，chr6：51507684-51507804，chr6：51508679-51508799，chr6：51509732-51509852，chr6：51510639-51510759，chr6：51511684-51511804，chr6：51512750-51512870，chr6：51513684-51513804，chr6：51514701-51514821，chr6：51515706-51515826，chr6：51516684-51516804，chr6：51517645-51517765，chr6：51518495-51518615，chr6：51519686-51519806，chr6：51521213-51521333，chr6：51522041-51522161，chr6：51523184-51523304，chr6：51524184-51524304，chr6：51525152-51525272，chr6：51526164-51526284，chr6：51527361-51527481，chr6：51528262-51528382，chr6：51529184-51529304，chr6：51530037-51530157，chr6：51531195-51531315，chr6：51537218-51537338，chr6：51538191-51538311，chr6：51539106-51539226，chr6：51540103-51540223，chr6：51541366-51541486，chr6：51542184-51542304，chr6：51543184-51543304，chr6：51544184-51544304，chr6：51545184-51545304，chr6：51546146-51546266，chr6：51547268-51547388，chr6：51548184-51548304，chr6：51549226-51549346，chr6：51550331-51550451，chr6：51551184-51551304，chr6：51552211-51552331，chr6：51553046-51553166，chr6：51556684-51556804，chr6：51557823-51557943，chr6：51558660-51558780，chr6：51559623-51559743，chr6：51560683-51560803，chr6：51561607-51561727，chr6：51562546-51562666，chr6：51563712-51563832，chr6：51564681-51564801，chr6：51565683-51565803，chr6：51566548-51566668，chr6：51567762-51567882，chr6：51568684-51568804，chr6：51569684-51569804，chr6：51570606-51570726，chr6：51571622-51571742，chr6：51572684-51572804，chr6：51573792-51573912，chr6：51574617-51574737，chr6：51575684-51575804，chr6：51576691-51576811，chr6：51577684-51577804，chr6：51578697-51578817，chr6：51579793-51579913，chr6：51580684-51580804，chr6：51581684-51581804，chr6：51582684-51582804，chr6：51583690-51583810，chr6：51584743-51584863，chr6：51585731-51585851，chr6：51586684-51586804，chr6：51587647-51587767，chr6：51588683-51588803，chr6：51589683-51589803，chr6：51590684-51590804，chr6：51591694-51591814，chr6：51592692-51592812，chr6：51593636-51593756，chr6：51594684-51594804，chr6：51595639-51595759，chr6：51596523-51596643，chr6：51597497-51597617，chr6：51598684-51598804，chr6：51599716-51599836，chr6：51600780-51600900，chr6：51601684-51601804，chr6：51602813-51602933，chr6：51603684-51603804，chr6：51604684-51604804，chr6：51605588-51605708，chr6：51606518-51606638，chr6：51607679-51607799，chr6：51608684-51608804，chr6：51609690-51609810，chr6：51610684-51610804，chr6：51611565-51611685，chr6：51612684-51612804，chr6：51613684-51613804，chr6：51614800-51614920，chr6：51615842-51615962，chr6：51616684-51616804，chr6：51617683-51617803，chr6：51618650-51618770，chr6：51619684-51619804，chr6：51620537-51620657，chr6：51621537-51621657，chr6：51622781-51622901，chr6：51623711-51623831，chr6：51624625-51624745，chr6：51625645-51625765，chr6：51626680-51626800，chr6：51627618-51627738，chr6：51628568-51628688，chr6：51629684-51629804，chr6：51630675-51630795，chr6：51631627-51631747，chr6：51633070-51633190，chr6：51634184-51634304，chr6：51635184-51635304，chr6：51636030-51636150，chr6：51637258-51637378，chr6：51638178-51638298，chr6：51639162-51639282，chr6：51640136-51640256，chr6：51641147-51641267，chr6：51642184-51642304，chr6：51643205-51643325，chr6：51644184-51644304，chr6：51645184-51645304，chr6：51646239-51646359，chr6：51647184-51647304，chr6：51648302-51648422，chr6：51649184-51649304，chr6：51650156-51650276，chr6：51651233-51651353，chr6：51652296-51652416，chr6：51653184-51653304，chr6：51654243-51654363，chr6：51655184-51655304，chr6：51656184-51656304，chr6：51657184-51657304，chr6：51658012-51658132，chr6：51664184-51664304，chr6：51665182-51665302，chr6：51666245-51666365，chr6：51667184-51667304，chr6：51668184-51668304，chr6：51669203-51669323，chr6：51670312-51670432，chr6：51671184-51671304，chr6：51672183-51672303，chr6：51673068-51673188，chr6：51674184-51674304，chr6：51675261-51675381，chr6：51676349-51676469，chr6：51677039-51677159，chr6：51678184-51678304，chr6：51679228-51679348，chr6：51680184-51680304，chr6：51681184-51681304，chr6：51682184-51682304，chr6：51683184-51683304，chr6：51684364-51684484，chr6：51685135-51685255，chr6：51686112-51686232，chr6：51687184-51687304，chr6：51688212-51688332，chr6：51689184-51689304，chr6：51690224-51690344，chr6：51691184-51691304，chr6：51692189-51692309，chr6：51693345-51693465，chr6：51694184-51694304，chr6：51695184-51695304，chr6：51696367-51696487，chr6：51697184-51697304，chr6：51698274-51698394，chr6：51699086-51699206，chr6：51700223-51700343，chr6：51701184-51701304，chr6：51702121-51702241，chr6：51703164-51703284，chr6：51704201-51704321，chr6：51705285-51705405，chr6：51706192-51706312，chr6：51707184-51707304，chr6：51708225-51708345，chr6：51709184-51709304，chr6：51710184-51710304，chr6：51711193-51711313，chr6：51712231-51712351，chr6：51713184-51713304，chr6：51720184-51720304，chr6：51721280-51721400，chr6：51722184-51722304，chr6：51723088-51723208，chr6：51724296-51724416，chr6：51725220-51725340，chr6：51726135-51726255，chr6：51727283-51727403，chr6：51728270-51728390，chr6：51729184-51729304，chr6：51730184-51730304，chr6：51731184-51731304，chr6：51732044-51732164，chr6：51733159-51733279，chr6：51734156-51734276，chr6：51735098-51735218，chr6：51736254-51736374，chr6：51737031-51737151，chr6：51738139-51738259，chr6：51739335-51739455，chr6：51746332-51746452，chr6：51747305-51747425，chr6：51748130-51748250，chr6：51749198-51749318，chr6：51750184-51750304，chr6：51751002-51751122，chr6：51752000-51752120，chr6：51753282-51753402，chr6：51754151-51754271，chr6：51755184-51755304，chr6：51756338-51756458，chr6：51757184-51757304，chr6：51758184-51758304，chr6：51759184-51759304，chr6：51760022-51760142，chr6：51767184-51767304，chr6：51768293-51768413，chr6：51769184-51769304，chr6：51770184-51770304，chr6：51771090-51771210，chr6：51772184-51772304，chr6：51773184-51773304，chr6：51774184-51774304，chr6：51775184-51775304，chr6：51776184-51776304，chr6：51777184-51777304，chr6：51778176-51778296，chr6：51779184-51779304，chr6：51780134-51780254，chr6：51781184-51781304，chr6：51782184-51782304，chr6：51787842-51787962，chr6：51788684-51788804，chr6：51789746-51789866，chr6：51790873-51790993，chr6：51791684-51791804，chr6：51792684-51792804，chr6：51793714-51793834，chr6：51794682-51794802，chr6：51795651-51795771，chr6：51796753-51796873，chr6：51797684-51797804，chr6：51798684-51798804，chr6：51799684-51799804，chr6：51800684-51800804，chr6：51802240-51802360，chr6：51809228-51809348，chr6：51810184-51810304，chr6：51811284-51811404，chr6：51812280-51812400，chr6：51813184-51813304，chr6：51814184-51814304，chr6：51815184-51815304，chr6：51816144-51816264，chr6：51817184-51817304，chr6：51818184-51818304，chr6：51819165-51819285，chr6：51820270-51820390，chr6：51821184-51821304，chr6：51822145-51822265，chr6：51823196-51823316，chr6：51824185-51824305，chr6：51825266-51825386，chr6：51826191-51826311，chr6：51827184-51827304，chr6：51828264-51828384，chr6：51829168-51829288，chr6：51830078-51830198，chr6：51831367-51831487，chr6：51832330-51832450，chr6：51833184-51833304，chr6：51834041-51834161，chr6：51836756-51836876，chr6：51837677-51837797，chr6：51838803-51838923，chr6：51839796-51839916，chr6：51840625-51840745，chr6：51841784-51841904，chr6：51842684-51842804，chr6：51843626-51843746，chr6：51844684-51844804，chr6：51845843-51845963，chr6：51847684-51847804，chr6：51848684-51848804，chr6：51849683-51849803，chr6：51850767-51850887，chr6：51851684-51851804，chr6：51852582-51852702，chr6：51853684-51853804，chr6：51854738-51854858，chr6：51855640-51855760，chr6：51856684-51856804，chr6：51857684-51857804，chr6：51858636-51858756，chr6：51859684-51859804，chr6：51860684-51860804，chr6：51861684-51861804，chr6：51862684-51862804，chr6：51863684-51863804，chr6：51864684-51864804，chr6：51865684-51865804，chr6：51866684-51866804，chr6：51867684-51867804，chr6：51868709-51868829，chr6：51869684-51869804，chr6：51870708-51870828，chr6：51872184-51872304，chr6：51873092-51873212，chr6：51874182-51874302，chr6：51875178-51875298，chr6：51876184-51876304，chr6：51877184-51877304，chr6：51878044-51878164，chr6：51879184-51879304，chr6：51880184-51880304，chr6：51881050-51881170，chr6：51882184-51882304，chr6：51883184-51883304，chr6：51884098-51884218，chr6：51885156-51885276，chr6：51886253-51886373，chr6：51887184-51887304，chr6：51888054-51888174，chr6：51889184-51889304，chr6：51890184-51890304，chr6：51891033-51891153，chr6：51892345-51892465，chr6：51893137-51893257，chr6：51894184-51894304，chr6：51895184-51895304，chr6：51896314-51896434，chr6：51897175-51897295，chr6：51898137-51898257，chr6：51899233-51899353，chr6：51900303-51900423，chr6：51901184-51901304，chr6：51902372-51902492，chr6：51903163-51903283，chr6：51904854-51904974，chr6：51905600-51905720，chr6：51906684-51906804，chr6：51907684-51907804，chr6：51908681-51908801，chr6：51909684-51909804，chr6：51910717-51910837，chr6：51911684-51911804，chr6：51912745-51912865，chr6：51913685-51913805，chr6：51914714-51914834，chr6：51915614-51915734，chr6：51916683-51916803，chr6：51917684-51917804，chr6：51918684-51918804，chr6：51919684-51919804，chr6：51920684-51920804，chr6：51921684-51921804，chr6：51922721-51922841，chr6：51923639-51923759，chr6：51924684-51924804，chr6：51925708-51925828，chr6：51926741-51926861，chr6：51927684-51927804，chr6：51928668-51928788，chr6：51929684-51929804，chr6：51930672-51930792，chr6：51931702-51931822，chr6：51932684-51932804，chr6：51933678-51933798，chr6：51934684-51934804，chr6：51935702-51935822，chr6：51936635-51936755，chr6：51937656-51937776，chr6：51938684-51938804，chr6：51939684-51939804，chr6：51940606-51940726，chr6：51941684-51941804，chr6：51942681-51942801，chr6：51943755-51943875，chr6：51944684-51944804，chr6：51945684-51945804，chr6：51946684-51946804，chr6：51947684-51947804，chr6：51948770-51948890，chr6：51949853-51949973，chr6：51950658-51950778，chr6：51951650-51951770，chr6：108189104-108189224，chr6：108190116-108190236，chr6：108191116-108191236，chr6：108192116-108192236，chr6：108192976-108193096，chr6：108194081-108194201，chr6：108195116-108195236，chr6：108196001-108196121，chr6：108197116-108197236，chr6：108198301-108198421，chr6：108199145-108199265，chr6：108200112-108200232，chr6：108201134-108201254，chr6：108202206-108202326，chr6：108203116-108203236，chr6：108204221-108204341，chr6：108205084-108205204，chr6：108206131-108206251，chr6：108206971-108207091，chr6：108214011-108214131，chr6：108215054-108215174，chr6：108216068-108216188，chr6：108216837-108216957，chr6：108218224-108218344，chr6：108219082-108219202，chr6：108220116-108220236，chr6：108221121-108221241，chr6：108222036-108222156，chr6：108223127-108223247，chr6：108224116-108224236，chr6：108224952-108225072，chr6：108226086-108226206，chr6：108227093-108227213，chr6：108228116-108228236，chr6：108229085-108229205，chr6：108230116-108230236，chr6：108231280-108231400，chr6：108232175-108232295，chr6：108233004-108233124，chr6：108234103-108234223，chr6：108235116-108235236，chr6：108236078-108236198，chr6：108237080-108237200，chr6：108237930-108238050，chr6：108241752-108241872，chr6：108242600-108242720，chr6：108243724-108243844，chr6：108244586-108244706，chr6：108245728-108245848，chr6：108246655-108246775，chr6：108247542-108247662，chr6：108248545-108248665，chr6：108249740-108249860，chr6：108250616-108250736，chr6：108251793-108251913，chr6：108252608-108252728，chr6：108253616-108253736，chr6：108254615-108254735，chr6：108257805-108257925，chr6：108258519-108258639，chr6：108260037-108260157，chr6：108261187-108261307，chr6：108262040-108262160，chr6：108263021-108263141，chr6：108264174-108264294，chr6：108265116-108265236，chr6：108266021-108266141，chr6：108267017-108267137，chr6：108268170-108268290，chr6：108269039-108269159，chr6：108270121-108270241，chr6：108271288-108271408，chr6：108272227-108272347，chr6：108273179-108273299，chr6：108274088-108274208，chr6：108275674-108275794，chr6：108276616-108276736，chr6：108277616-108277736，chr6：108278616-108278736，chr9：101984301-101984421，chr9：101985295-101985415，chr9：101986300-101986420，chr9：101987301-101987421，chr9：101988224-101988344，chr9：101989165-101989285，chr9：101990301-101990421，chr9：101991431-101991551，chr9：101992305-101992425，chr9：135766674-135766794，chr9：135767678-135767798，chr9：135768615-135768735，chr9：135769678-135769798，chr9：135770678-135770798，chr9：135771678-135771798，chr9：135772678-135772798，chr9：135773650-135773770，chr9：135774678-135774798，chr9：135775665-135775785，chr9：135776619-135776739，chr9：135777709-135777829，chr9：135778678-135778798，chr9：135779678-135779798，chr9：135780710-135780830，chr9：135781555-135781675，chr9：135782647-135782767，chr9：135784184-135784304，chr9：135785189-135785309，chr9：135786215-135786335，chr9：135787348-135787468，chr9：135788178-135788298，chr9：135789179-135789299，chr9：135790180-135790300，chr9：135791178-135791298，chr9：135792178-135792298，chr9：135793290-135793410，chr9：135794144-135794264，chr9：135795178-135795298，chr9：135796178-135796298，chr9：135797187-135797307，chr9：135798178-135798298，chr9：135799158-135799278，chr9：135800178-135800298，chr9：135801211-135801331，chr9：135802303-135802423，chr9：135803269-135803389，chr9：135804183-135804303，chr9：135805178-135805298，chr9：135806178-135806298，chr9：135807179-135807299，chr9：135808178-135808298，chr9：135808999-135809119，chr9：135810178-135810298，chr9：135811178-135811298，chr9：135812122-135812242，chr9：135813008-135813128，chr9：135814050-135814170，chr9：135815185-135815305，chr9：135816240-135816360，chr9：135817266-135817386，chr9：135818178-135818298，chr9：135819178-135819298，chr9：135820166-135820286，chr9：135821178-135821298，chr9：135822178-135822298，chrX：13753350-13753470，chrX：13754344-13754464，chrX：13755402-13755522，chrX：13756350-13756470，chrX：13757457-13757577，chrX：13758330-13758450，chrX：13759579-13759699，chrX：13761007-13761127，chrX：13761834-13761954，chrX：13762850-13762970，chrX：13763850-13763970，chrX：13764896-13765016，chrX：13765921-13766041，chrX：13766850-13766970，chrX：13767885-13768005，chrX：13769032-13769152，chrX：13769906-13770026，chrX：13770820-13770940，chrX：13771848-13771968，chrX：13772939-13773059，chrX：13773686-13773806，chrX：13774821-13774941，chrX：13775850-13775970，chrX：13776916-13777036，chrX：13777716-13777836，chrX：13778855-13778975，chrX：13779850-13779970，chrX：13780784-13780904，chrX：13781847-13781967，chrX：13782884-13783004，chrX：13783865-13783985，chrX：13784850-13784970，chrX：13785740-13785860，chrX：13786803-13786923，chrX：138612921-138613041，chrX：138613939-138614059，chrX：138614937-138615057，chrX：138615938-138616058，chrX：138616938-138617058，chrX：138617789-138617909，chrX：138618782-138618902，chrX：138619938-138620058，chrX：138620938-138621058，chrX：138621938-138622058，chrX：138622938-138623058，chrX：138623997-138624117，chrX：138624938-138625058，chrX：138625938-138626058，chrX：138626938-138627058，chrX：138627938-138628058，chrX：138629022-138629142，chrX：138629982-138630102，chrX：138631077-138631197，chrX：138631951-138632071，chrX：138632938-138633058，chrX：138633959-138634079，chrX：138635053-138635173，chrX：138636079-138636199，chrX：138637048-138637168，chrX：138638008-138638128，chrX：138638934-138639054，chrX：138639938-138640058，chrX：138640938-138641058，chrX：138641938-138642058，chrX：138643089-138643209，chrX：138643938-138644058，chrX：138644872-138644992，chrX：154064065-154064185，chrX：154065069-154065189，chrX：154066069-154066189，chrX：154067069-154067189，chrX：154068027-154068147，chrX：154069034-154069154，chrX：154070069-154070189，chrX：154070975-154071095，chrX：154077534-154077654，chrX：154079048-154079168，chrX：154080239-154080359，chrX：154081752-154081872，chrX：154082625-154082745，chrX：154083556-154083676，chrX：154084710-154084830，chrX：154086677-154086797，chrX：154087388-154087508，chrX：154088631-154088751，chrX：154089534-154089654，chrX：154090567-154090687，chrX：154091570-154091690，chrX：154092569-154092689，chrX：154093735-154093855，chrX：154094615-154094735，chrX：154095538-154095658，chrX：154101449-154101569，chrX：154103217-154103337，chrX：154104040-154104160，chrX：154105069-154105189，chrX：154106069-154106189，chrX：154106929-154107049，chrX：154108570-154108690，chrX：154109569-154109689，chrX：154110609-154110729，chrX：154111501-154111621，chrX：154112604-154112724，chrX：154113569-154113689，chrX：154114674-154114794，chrX：154115569-154115689，chrX：154116539-154116659，chrX：154117569-154117689，chrX：154118529-154118649，chrX：154119700-154119820，chrX：154120569-154120689，chrX：154121601-154121721，chrX：154123069-154123189，chrX：154124021-154124141，chrX：154124947-154125067，chrX：154126069-154126189，chrX：154127069-154127189，chrX：154128079-154128199，chrX：154129207-154129327，chrX：154130201-154130321，chrX：154131069-154131189，chrX：154132073-154132193，chrX：154133069-154133189，chrX：154134096-154134216，chrX：154134953-154135073，chrX：154136069-154136189，chrX：154137002-154137122，chrX：154137909-154138029，chrX：154141237-154141357，chrX：154144009-154144129，chrX：154144975-154145095，chrX：154146120-154146240，chrX：154147079-154147199，chrX：154148069-154148189，chrX：154149026-154149146，chrX：154150521-154150641，chrX：154151569-154151689，chrX：154155148-154155268，chrX：154156069-154156189，chrX：154157069-154157189，chrX：154158069-154158189，chrX：154159162-154159282，chrX：154159920-154160040，chrX：154161069-154161189，chrX：154162155-154162275，chrX：154163059-154163179，chrX：154164061-154164181，chrX：154165077-154165197，chrX：154166208-154166328，chrX：154167041-154167161，chrX：154176069-154176189，chrX：154176965-154177085，chrX：154178522-154178642，chrX：154179569-154179689，chrX：154180674-154180794，chrX：154181451-154181571，chrX：154182522-154182642，chrX：154183667-154183787，chrX：154185608-154185728，chrX：154186569-154186689，chrX：154187630-154187750，chrX：154188566-154188686，chrX：154189514-154189634，chrX：154190569-154190689，chrX：154192028-154192148，chrX：154193023-154193143，chrX：154194222-154194342，chrX：154194911-154195031，chrX：154196069-154196189，chrX：154197069-154197189，chrX：154198069-154198189，chrX：154198983-154199103，chrX：154199927-154200047，chrX：154203643-154203763，chrX：154204583-154204703，chrX：154206510-154206630，chrX：154207601-154207721，chrX：154208463-154208583，chrX：154209569-154209689，chrX：154210690-154210810，chrX：154211684-154211804，chrX：154212680-154212800，chrX：154213710-154213830，chrX：154214404-154214524，chrX：154215569-154215689，chrX：154216675-154216795，chrX：154217577-154217697，chrX：154218616-154218736，chrX：154219533-154219653，chrX：154220408-154220528，chrX：154221446-154221566，chrX：154222664-154222784，chrX：154223569-154223689，chrX：154224573-154224693，chrX：154225507-154225627，chrX：154226569-154226689，chrX：154227569-154227689，chrX：154228569-154228689，chrX：154229443-154229563，chrX：154231213-154231333，chrX：154232635-154232755，chrX：154233569-154233689，chrX：154234565-154234685，chrX：154235569-154235689，chrX：154236531-154236651，chrX：154237569-154237689，chrX：154238608-154238728，chrX：154239404-154239524，chrX：154240494-154240614，chrX：154242051-154242171，chrX：154243121-154243241，chrX：154244065-154244185，chrX：154245151-154245271，chrX：154246020-154246140，chrX：154247069-154247189，chrX：154248053-154248173，chrX：154249069-154249189，chrX：154250254-154250374，chrX：154251069-154251189，chrX：154252072-154252192，chrX：154253069-154253189，chrX：154254027-154254147，chrX：154255069-154255189。

the probe sequence is represented by positional information on a chromosomal region, for example, chr1:155158432-155158552 it is understood that the sequence of the probe is between positions 155158432 and 155158552 on chromosome 1, the sequence of the probe comprises the sequence at start site 155158432 but no sequence at stop site 155158552, and the sequence of the probe obtained by querying NCBI is: AGCTTCCACACACTGAGAAGTGTCCGAGAAATTGGTGGGGCCTCTGAAGGAGGCTGTGAGCAGCCCACCTGAACTCCCAGCTCACCAGCCCAAACAGGGTGCAGGGGCTCTGGCCCTGAA, the size is 120bp. The rest probe sequences can be obtained by inquiring the position information given by the invention in NCBI.

In some embodiments, the probe is a DNA probe or an RNA probe, or a DNA-RNA hybrid probe, preferably a DNA probe.

In some embodiments, the probe composition further comprises a label bound to the solid phase.

In some embodiments, the label may be selected from biotin, avidin (also known as avidin, preferably streptavidin), antibodies, chemical coupling agents; and any biological, chemical, physical or enzymatic reagent known in the art for affinity purification, more preferably, the label is biotin.

The probe composition can be used with three-generation sequencing to achieve better technical effects. Accordingly, the present invention provides a method for sequencing a kidney disease gene, comprising the steps of:

3) Sequencing the kidney disease gene;

In some embodiments, the sample to be tested is a bodily fluid, such as blood (whole blood), serum, plasma, cell culture supernatant, saliva, semen, tissue, or tissue lysate.

In some embodiments, the sample to be tested is from a tissue or tissue lysate, and the tissue may be selected from amniotic fluid, villus, bone, muscle or hair, for example.

As previously mentioned, three generations of sequencing have longer read lengths, and therefore, short sequences of the disrupted nucleic acid fragment within the read length can be sequenced. Thus, in some embodiments, the nucleic acid fragment is 2-10 kb in length; it is also possible to select 3k, 4k, 5k, 6k, 7k, 8k or 9k, preferably 4.5 to 5.5kb.

Third generation sequencing uses a template called SMRTbell, a single stranded circular DNA molecule formed by ligating hairpin linker sequences to both ends of a target double stranded DNA molecule, the hairpin linker sequences at both ends providing sites for primer binding. Thus, the method of constructing a DNA library of the present invention comprises:

and (3) connecting a connector sequence after repairing the tail end of the nucleic acid fragment, and designing a primer by taking the connector sequence as a template for PCR amplification.

Target sequence capture refers to the selective isolation or enrichment of specific fragments of a genome by some means. One important method of target sequence capture has been developed based on the principle of complementary hybridization of nucleic acid molecules to bases. The method is to design probes completely complementary to the target genome sequence, fix the probes on certain supports (for separation), break the genome DNA, hybridize with the probes after adding a connector (for sequencing), elute the DNA not hybridized, recover the target DNA fragments, and directly build a library for DNA sequencing.

Target sequence capture can be classified into a solid phase hybridization method and a liquid phase hybridization method according to the hybridization conditions. Solid phase hybridization, i.e., immobilization of probes on a solid support, is typically represented by a gene chip. Eluting the DNA fragments which are not hybridized after hybridization, eluting the DNA hybridized with the probes, and amplifying to construct a high-throughput sequencing library. Thus, in one embodiment, the capturing occurs on a solid support.

Preferably, the solid phase carrier is an enrichment particle, and the enrichment particle is coated with biotin or avidin; preferably avidin, and the subject it captures is biotin, with a high affinity between avidin and biotin.

More preferably, the enrichment particles are magnetic beads.

Preferably, the kidney disease gene is amplified prior to sequencing the kidney disease gene. Preferably, the amplification is specifically a PCR amplification.

In some embodiments, the sequencing is three-generation sequencing.

In some embodiments, the third generation sequencing is performed using the PacBio sequence, promethION, minION, gridION platform.

The method not only can detect the conventional SNV/Indel, but also can detect various SV variation, and truly realizes the full-coverage detection of variation types. Overcomes the problems that the first generation Sanger sequencing or the second generation high-throughput gene sequencing can not distinguish true genes or false genes from mutation sources and the mutation type coverage is incomplete.

The invention also provides a kit for kidney disease gene sequencing, which comprises the probe composition;

The adaptor sequence, primer or DNA extraction system in the kit is not limited in the present invention, and specific examples can be referred to.

In some embodiments, the water is nuclease free water, such as double distilled water or deionized water.

In some embodiments, the DNA polymerase is selected from any one of Taq, bst, vent, phi, pfu, tru, tth, tl1, tac, tne, tma, tih, tf1, pwo, kod, sac, sso, poc, pab, mth, pho, ES 4DNA polymerase, klenow fragment.

The kit can be used with three-generation sequencing to achieve better technical effects.

The probe composition and the kit provided by the invention can be combined with a three-generation sequencing method to effectively sequence the nephrotic gene and analyze the mutation in the nephrotic gene. Therefore, the invention provides the application of the probe composition or the kit in detecting the renal disease gene variation;

In some embodiments, the kidney disease gene variation is located in an intron region and/or an exon region of a kidney disease gene.

The use may be for non-diagnostic purposes, such as genetic studies, ethnic distribution, human chemical approach, etc., as is typical for SNP applications, or for the identification of cells and animal models of diseases associated with renal genes (if homology to humans is high).

The invention also provides application of the probe composition or the kit in preparation of a kidney disease diagnosis reagent.

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

Example 1 test of uniformity of coverage of probe Density and Capture of renal disease genes

The percentage of sequences with 0.5X average coverage depth is a relatively common parameter for evaluating the uniformity of panel coverage for examining the limitations imposed by low coverage depths. 0.5X represents 50% of the average coverage depth, for example, capturing of a kidney disease gene, specifically to a certain sequence locus, 200X of loci (i.e., 200 times measured at a certain locus), 150X of loci, 100X of loci, and the calculated average 150X of the kidney disease gene as a whole (i.e., 150 times measured at each locus on average), and the average coverage depth of 0.5X is considered as the ratio of 0.5×150=75x and above; if more than 90% of the target area exhibits an average coverage depth exceeding 0.5X, the coverage uniformity of Panel is better. For this reason, the coverage uniformity of the target area by the probes designed at average intervals of 250bp, 500bp, 1K, 2K, 3K, and 4K was evaluated, and as shown in fig. 1, the more densely the probes, the higher the percentage of sequences at average coverage depth of 0.5X, the better the coverage uniformity of the probes designed at average interval of 1K was than that designed at average interval of more than 1K, and the probes designed at average interval of 1K were very close in coverage uniformity to those designed at average interval of less than 1K, i.e., the percentage of sequences at average coverage depth of 0.5X was nearly saturated; probes designed at 1K average spacing combine relatively fewer probe counts with relatively better coverage uniformity. Therefore, probes designed at 1K average spacing possess the best cost performance.

Example 2 preparation of a probe for hybridization Capture of a renal disease Gene

Aiming at the full-length sequence of the kidney disease gene, a probe is designed at intervals of 500 bp-2K, and preferably, a probe is designed at intervals of 1K. The third generation sequencer has long sequencing read length, for example, the sequence of Pacbio company or PromethION sequencing length of Oxford Nanopore company can reach tens of K, the genome DNA in the sample to be tested is broken into fragments with the size of about 5K, one probe is designed every 1K, and 5 probes can be combined on average for each DNA fragment, so that effective capturing can be carried out on the target fragment. The designed probe has the advantages of 50-130 bp of base number, moderate GC content value and no hairpin structure, and further performs Blast comparison with NCBI and other databases, and ensures that the probe avoids repetitive regions on genome, and the specificity of the probe is ensured through the parameters. Preferably, the number of bases of the designed probe is 120bp. The probe sequences thus designed are shown in the information "nephrotic gene probe I set".

EXAMPLE 3 construction of Capture library

3.1 preparation of working Joint

The working joint is formed by combining an A sequence and a B sequence, wherein the A sequence is as follows:

5 '-pGATCGGGAAGAGCACACGTCTGACTNNNNNNNNNNNACCACGTCCGCCATACTTG-3' shown in SEQ ID NO 1;

the sequence B is as follows:

5'-CTTGGAGAACACCCCAAAGGAGATNNNNNNNNNNNNNNNNAGTTCAGACGTGTGCTCTTCCGATCT/3 SpC/-3' as shown in SEQ ID NO. 2;

p in the above sequence represents a phosphorylation modification; n represents any one of four bases A/G/C/T; 3/SpC/represents phosphorothioate bond modification; the A sequence NNNNNNNNNNNN and the B sequence NNNNNNNNNNNNNNNN were used to identify libraries constructed from different samples.

Further, specific operations for preparing a working linker from the above linker A and B sequences are:

1) Dissolving the primer powder;

2) Mixing adaptor A and adaptor B in equal volume in PCR tube;

3) PCR procedure was used: 95 ℃ for 3 minutes; slowly cooling to 25 ℃ for 1 hour, and reducing the temperature by 0.05 ℃/s; and obtaining the working joint.

3.2 sample genomic DNA extraction and quality assessment

Taking 0.5-1 mL of peripheral blood of a sample to be detected, and extracting genome DNA by adopting Blood Genomic DNA Mini Kit (Beijing kang is a century biotechnology Co., ltd., peripheral blood). The integrity of the genome was checked by agarose gel electrophoresis and the genome was subjected to concentration measurement using Qubit (Life Technologies, usa). DNA samples with relatively complete genome and concentration of 25 ng/. Mu.l or more are selected for library construction.

3.3 construction of Capture library

3.3.1 disruption of genomic DNA

The genomic DNA was disrupted using a Covaris E220 non-contact sonicator with the following parameters set forth: duration 600sec, peak Incident Power watts, duty Factor 20%, cycles per Burst 1000.

The fragmented genomic DNA was prepared by purification using 0.6-fold volume of AMPure PB beads.

3.3.2 sample end repair, splice

3.3.2.1 repair of the end, add "A"

A NEB Next Ultra End Repair/dA-labeling Module kit was used.

The system is as follows:

TABLE 1

The reaction conditions are as follows:

TABLE 2

3.3.2.2 joint connection

A NEB Next Ultra II Ligation Module kit was used.

The system is as follows:

TABLE 3 Table 3

In a PCR apparatus, the reaction was carried out at 20℃for 15min. Subsequently, purification was performed using 0.6-fold volume of AMPure XP magnetic beads to obtain a library solution.

3.3.3 Pre-amplification of library

The reaction system is as follows:

TABLE 4 Table 4

The Primer is a Primer for library pre-amplification, and specifically comprises the following components:

primer F:5'-CAAGTATGGCGGACGTGGGT-3', as shown in SEQ ID NO. 3;

Primer-R:5'-CTTGGAGAACACCCCAAAGGA-3', as shown in SEQ ID NO. 4.

The reaction conditions are as follows:

TABLE 5

The PCR product was recovered using 0.6 volumes of AMPure XP magnetic beads.

3.4 hybridization Capture target sequences

3.4.1 Capture preparation

The samples to be captured were mixed in equal amounts, and the total amount of DNA was 1. Mu.g.

A4. Mu.LIndex blocking reagent (Index A Block, index B Block) was added to Block the linker A and B sequences used in library construction, respectively, to prevent hybridization of the two linker sequences and probes on the library.

The sequence is as follows:

the Index A Block sequence is:

5'-CAAGTATGGCGGACGTGGGTNNNNNNNNNNAGTTCAGACGTGTGCTCTTCCGATC-3' as shown in SEQ ID NO. 5;

the Index B Block sequence is:

5'-AGATCGGAAGAGCACACGTCTGAACTNNNNNNNNNNNNNNNNATCTCCTTTGGGGTGTTCTCCAAG-3' as shown in SEQ ID NO. 6;

n in the sequence represents any one of four bases A/G/C/T, wherein Index ABlock is reversely complementary with the sequence of the linker A; indexB Block is reverse complementary to the linker B sequence.

Shaking and mixing evenly, and then uncovering the cover and concentrating in vacuum at 60 ℃ until the cover is evaporated to dryness.

3.4.2 Capture

Hybridization buffer was prepared according to the instructions of kit xGen Lockdown Reagent Kit (IDT, cat# 1072281), with the following specific system:

TABLE 6

Adding the hybridization buffer into the evaporated sample, shaking and uniformly mixing, centrifuging briefly, and placing the mixture on a PCR instrument at 95 ℃ for 10min.

After the reaction, the whole 13. Mu.L of the sample was transferred to a PCR tube containing 4. Mu.L of the capture probe (prepared in example 2) by centrifugation, and the mixture was well-mixed by pipetting. The sample was subjected to PCR at 65℃for 16 hours.

3.5 hybridization elution

3.5.1 preparation of elution reagent

Elution reagents were prepared according to the instructions of kit xGen Lockdown Reagent Kit (IDT, cat# 1072281):

TABLE 7

3.5.2 capture bead treatment:

a) The 50 mu l M280 magnetic beads are sucked into a centrifuge tube, the centrifuge tube is placed on a magnetic rack, and the supernatant is discarded after the supernatant is completely clarified.

b) 200 μl of 1x Bead Wash Buffer (visual 7) was added, mixed well, centrifuged, placed on a magnetic rack until the supernatant was completely clear, and the supernatant was discarded.

c) Repeating step b once.

d) Add 100. Mu.l 1x Bead Wash Buffer (visual 7), mix well, transfer to PCR tube, place on magnetic rack until supernatant is completely clear, discard supernatant.

3.5.3 binding of magnetic beads to library of interest:

mu.l of the hybridization system (prepared in step 3.4.2) was added to a PCR tube with magnetic beads, and the mixture was gently sucked up and down and mixed, and incubated on a PCR instrument at 65℃for 45min.

3.5.4 elution:

a) 100 μl of 1 XWash Buffer I (visual 1) at 65deg.C was added and mixed well. Placing on a magnetic rack, discarding supernatant when the supernatant is completely clear.

b) 200 μl of 65℃1x Stringent Wash Buffer (visual 4) was added, mixed well and transferred to a preheated large centrifuge tube. Placing on Wen Yoyi at 65deg.C for 5min. Placing on a magnetic rack, discarding supernatant when the supernatant is completely clear.

c) 200 μl of 1 XWash Buffer I (visual 1) at room temperature was added and mixed well. Placing on a magnetic rack, discarding supernatant when the supernatant is completely clear.

d) 200 μl of 1 XWash Buffer II (visual 2) at room temperature was added and mixed well 1. Placing on a magnetic rack, discarding supernatant when the supernatant is completely clear.

e) 200. Mu.l of normal temperature 1x Wash Buffer III (visual 3) was added thereto and mixed well. Placing on a magnetic rack, discarding supernatant when the supernatant is completely clear.

f) The mixture was centrifuged briefly and a small amount of the remaining liquid was removed using a 10. Mu.l tip.

g) The beads were kept at-20℃using 25. Mu.l of Nuclear-free Water suspension.

3.6 hybridization library amplification

The M280 magnetic bead probe suspension obtained in the last step is prepared by taking 25 mu L/library and carrying out a PCR amplification system in a 200ml PCR tube according to the following table:

TABLE 8

/>

Primers described in the above table are identical to the primers pre-amplified in the library above:

primer F:5'-CAAGTATGGCGGACGTGGGT-3', as shown in SEQ ID NO. 3,

Primer-R:5'-CTTGGAGAACACCCCAAAGGA-3', as shown in SEQ ID NO. 4.

PCR reaction procedure:

TABLE 9

After the reaction is finished, the AMPure XP magnetic beads with the volume of 0.6 times are used for purification, and finally TE solution is used for eluting the magnetic beads, and the magnetic beads are transferred into a new centrifuge tube to enter the next operation or are placed in the temperature of minus 80 ℃ for standby.

3.7 library quality inspection

Those skilled in the art generally recognize that: the Qubit detection concentration is calculated to be more than 1ug, the Agilent2100 detection size is calculated, and the main peak is between 1K and 8K, so that the library can be regarded as qualified. The library prepared in the step 3.6 is subjected to Qkit detection and Agilent2100 Bioanalyzer detection, the main peak is about 3698bp, the size of amplified product fragments accords with expectations (shown in FIG. 2), and the qualified library is subjected to the next three-generation sequencing library construction.

Example 4 third generation sequencing library construction and sequencing

4.1 sequencing Using Pacbio sequence series platform

4.1.1 use of the library construction kit for library construction

4.1.1.1 repair of the pooled library

Preparing a repairing solution:

table 10

/>

Mixing, centrifuging, and placing into a PCR thermal cycler for repair reaction under the following specific conditions:

TABLE 11

4.1.1.2 purification

Purification was performed using 0.45 sample volumes of PB beads, and finally the beads were eluted with double distilled water and stored in a-20℃refrigerator.

4.1.1.3 joint connection

The connection solution system is as follows:

table 12

/>

Mixing, centrifuging, and performing connection reaction in a PCR thermal cycler under the following specific conditions:

TABLE 13

4.1.1.4 purification

4.1.2 primer annealing and Binding reactions

According to the standard operating mode given by Pacbio official webpage (https:// www.pacb.com/products-and-services/binding-and-clearup-ks /).

4.1.3 third Generation sequencing

Sequencing was performed according to the Pacbio sequal instrument standard operating Specification (https:// www.pacb.com/products-and-services/consistency-cells-sequencing-reagent-kits-and-sources /).

4.2 sequencing using Oxford Nanopore PromethION

4.2.1 sample end repair

The DNA is taken and placed on ice, NEB end repair/A tail connection reagent is added, and the mixture is evenly mixed. Incubate at 20℃for 40 min and 65℃for 20min.

4.2.2DNA purification

1 XAMPure beads were added to DNA, incubated at room temperature for 15min, magnetically held at room temperature for 5min, and the supernatant was aspirated.

Adding 80% ethanol, adsorbing with a magnetic rack, discarding supernatant, and repeating for one time. And (5) airing at room temperature.

Ultra Pure Water was added and the eluate was blown at 37 ℃.

Standing on a magnetic rack for 5min, and sucking the supernatant to obtain purified DNA.

4.2.3 Joint connection

Adding NEB T4 DNA quick-connection buffer, NEB T4 DNA quick-connection enzyme and a joint, mixing uniformly, and incubating for 20min at 20 ℃.

4.2.4DNA purification

0.8 XAMPure beads were added to the PCR product, incubated at room temperature for 5min, magnetically held at room temperature for 2min, and the supernatant was aspirated off. 200ul SFB is added, blown and evenly mixed, the mixture is adsorbed by a magnetic rack, the supernatant is discarded, and the process is repeated once. EB 15ul was added and the elution was blown off. Standing on a magnetic rack for 5min, and sucking the supernatant to obtain purified DNA.

4.2.5 printing and Loading operations

According to the standard operation mode given by Oxford Nanopore PromethION official webpage (https:// store. Nanoporetech. Com/sample-prep. Html).

4.2.6 third generation sequencing

Sequencing was performed according to the Oxford Nanopore PromethION instrument standard operating specification (https:// store. Nanoporetech. Com/precursor-advanced-translation. Html).

Example 5 bioinformatics analysis

5.1 splitting the data of each sample

If the off-machine data are multiple sample mixed measurement, the data of each sample are split according to the label sequence of each sample.

5.2 data Filtering

And generating high-quality data according to the characteristics of the data of each platform.

The ONT platform filters out data with lower quality values. The Pacbio platform uses official software to generate high quality consensus sequences.

5.3 data evaluation

High quality data is aligned to a human whole genome reference sequence, and unique alignment is performed (i.e., a single sequence can only be aligned to one position of the genome).

And counting the sequence number of the target area, and evaluating the capturing efficiency, the coverage depth of the target area and the coverage integrity.

If the data are not qualified (the qualification standard is that the sequencing coverage of the target area is not less than 95% and 30 times coverage is required), the data are subjected to complement testing according to the situation.

5.4 mutation detection

Detecting single nucleotide site variation, small fragment insertion and deletion, chromosome structure variation (SNV/InDel, SV) and the like of a target region; and annotating the mutation in each database to screen the mutation with high pathogenicity.

5.5 verification of variation.

And (5) carrying out a generation sanger sequencing verification on the screened high pathogenicity variation.

In this example, 60 samples were accumulated for 20 families diagnosed as hereditary nephropathy by clinical phenotypic observation; the nephrotic gene detection is carried out, the detection result is compared with the second generation sequencing result, and the inconsistent result is subjected to first generation verification. The results are shown in Table 14, and the second generation sequencing was inconsistent with the results obtained by the detection method of the present invention for 5 samples. For the 5 inconsistent clinical samples, further carrying out the first-generation Sanger sequencing verification according to the sequence information of the mutation sites, and the result shows that the first-generation Sanger sequencing result is consistent with the third-generation sequencing method. The verification result shows that the third generation sequencing method is superior to the control second generation sequencing method. In the detection process, the experimenter and the data analyst do not know the genotype and the phenotype of the sample, so that the credibility of the result is ensured. The test results are shown in Table 14:

table 14 results of validation of the variation

/>

Remarks: N/A represents healthy family members for which no site of pathogenic variation was detected.

Claims

1. A probe composition, wherein,

3) The probe composition covers the whole length of the kidney disease gene;

4) The nucleic acid sequence of the probe in the probe composition is complementarily paired with the kidney disease gene.

2. The probe composition of claim 1, wherein the probe composition comprises group I: a probe capturing the full length of the kidney disease gene;

further preferably, the label is biotin.

3. A method of sequencing a kidney disease gene comprising the steps of:

2) Capturing in the DNA library a kidney disease gene capable of specifically binding to a plurality of probes in the probe composition using the probe composition of claim 1 or 2;

3) Sequencing the kidney disease gene;

4. A sequencing method according to claim 3, wherein the method of constructing a DNA library comprises:

preferably, the nucleic acid fragment has a length of 2 to 10kb;

more preferably, the nucleic acid fragment has a length of 4.5 to 5.5kb.

5. The sequencing method of claim 3, wherein the capturing occurs on a solid support;

more preferably, the enrichment particles are magnetic beads.

6. The sequencing method of claim 3, wherein the kidney disease gene is amplified prior to sequencing the kidney disease gene.

7. The sequencing method of claim 3, wherein the sequencing is three-generation sequencing;

8. A kit for kidney disease gene sequencing comprising the probe composition of claim 1 or 2.

9. Use of the probe composition of claim 1 or 2 or the kit of claim 8 for detecting renal genetic variation.

10. Use of the probe composition of claim 1 or 2 or the kit of claim 8 for the preparation of a diagnostic reagent for renal disease.