CN117752795A - Application of T5224 in inhibiting invasion and metastasis of liver cancer - Google Patents

Abstract

The invention belongs to the field of biological medicine, and particularly relates to an application of T5224 in inhibiting invasion and metastasis of liver cancer. Specifically, the invention provides application of a small molecular compound T5224 of targeted MAP1S in treating MAP1S related diseases, and specifically, MAP1S related diseases comprise liver cancer, liver cancer metastasis, diseases caused by hepatitis B virus and the like.

Description

Application of T5224 in inhibiting invasion and metastasis of liver cancer

Technical Field

The invention belongs to the field of biological medicine, and particularly relates to an application of T5224 in inhibiting invasion and metastasis of liver cancer.

Background

Primary liver cancer is the sixth most common cancer worldwide and the fourth leading cause of cancer death. From 2007 to 2016, the incidence rate of liver cancer increases at a rate of 2% -3% per year, the death rate also increases rapidly, and the liver cancer gradually becomes stable in recent years, but the liver cancer is still one of malignant tumors with the lowest survival rate (18%) in 5 years, the number of new cases of primary liver cancer in 2020 is over 900000, and the death number is about 830000. It is estimated that by 2025 years, the global annual number of liver cancer patients will exceed 100 tens of thousands.

Hepatocellular carcinoma (hepatocellular carcinoma, HCC) is the most common pathological type in primary liver cancer, one of the most common malignant tumors worldwide, and the third leading cause of cancer-related death worldwide. HCC mainly occurs on the basis of chronic hepatitis cirrhosis, and Hepatitis B Virus (HBV) infection is a major risk factor, and China is a large country of Hepatitis B Virus (HBV) infection, and the social burden caused by liver cancer due to HBV infection is particularly serious, and the number of patients with cirrhosis and liver cancer caused by HBV infection is up to 30 ten thousand per year. In recent years, despite great advances in HCC detection and curative treatments such as liver resection, liver transplantation, etc., the survival of early stage primary HCC patients has been greatly prolonged, but frequent recurrence of HCC has greatly reduced patient survival. Recurrence rate was 35% in 1 year and 70% in 5 years after HCC hepatectomy. The more external tumor microenvironment factors play a more important role in the invasive metastasis of HCC cells. Successful metastasis of tumors depends on invasion and migration of tumor cells. Invasion occurs at the tumor-host interface, where the tumor interacts with stromal cells, thereby modulating the local extracellular membrane (ECM) to promote tumor cell migration, the core event of which is the dynamic changes in the cytoskeletal components of the tumor, promoting signal transduction and cell migration.

The currently available therapies are insufficient to address the need for effective therapies that can be used to treat most individuals affected by liver cancer. Therefore, there is a need to develop markers and targeted inhibitors for predicting early recurrence of liver cancer, so as to diagnose early treatment in the future, improve the survival quality of patients, and prolong the survival period of patients. Due to the stage of the disease of the patient and/or lack of availability.

Disclosure of Invention

The invention screens the small molecular compound T5224 targeting MAP1S, and provides a new target and a new treatment scheme for targeting treatment of MAP1S related diseases.

In a first aspect, the invention provides application of a reagent for detecting MAP1S in preparing a product for diagnosing liver cancer, evaluating invasiveness of liver cancer cells and predicting prognosis of a liver cancer patient.

Preferably, the reagent is a reagent for detecting the positive rate and/or the expression level of MAP1S cells.

The assays of the invention include assessing the presence or absence of expression of a marker in a subject derived sample and measuring its content (which may be an effective amount), including deriving a qualitative result or a quantitative concentration level. Markers of interest for the present invention include MAP1S.

Preferably, the reagent for detecting the expression level includes a reagent for detecting the protein expression level and/or the mRNA expression level.

Preferably, the reagent for detecting the protein expression amount includes a reagent used in the following method: hematoxylin-eosin staining (HE staining), safranin O-fast green staining, western Blot (Western Blot), enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), sandwich assay, immunohistochemical (immunochemistry) staining, mass spectrometry, immunoprecipitation analysis, complement fixation analysis, flow cytometry fluorescent resolution techniques, and protein chip method.

Preferably, the reagent for detecting the expression amount of mRNA includes a reagent used in the following method: PCR-based detection methods, southern hybridization methods, northern hybridization methods, dot hybridization methods, fluorescent in situ hybridization methods, DNA microarray methods, ASO methods, high throughput sequencing platform methods.

Preferably, the reagent for protein level of MAP1S comprises reagents required for immunological detection.

Preferably, the immunological assay comprises an ELISA assay, an Elispot assay, a Western blot or a surface plasmon resonance method. Reagents required for immunological detection are well known in the art and include, but are not limited to, antibodies, targeting polypeptides capable of specifically binding to MAP1S.

The "sample" of the present invention is preferably a biological sample isolated from a subject and may include, but is not limited to, whole blood, serum, plasma, tissue biopsies, cytological specimens, platelets, reticulocytes, white blood cells, epithelial cells, whole blood cells, and the like.

In a specific embodiment, the sample is a sample that may be fresh or frozen, including a treated sample, such as a tissue section.

Preferably, the prognostic indicator includes objective remission rate (Objective Response Rate, ORR), overall survival rate (Overall survival rate, overall survival, OS), progression-free survival (PFS), time To Progression (TTP), disease-free survival (DFS), time to failure of treatment (time to treatment failure, TTF), response Rate (RR), complete Response (CR), partial Response (PR), and the like.

Preferably, the cancer cells that underexpress MAP1S are less invasive, have reduced probability of recurrence, metastasis, and patients that underexpress MAP1S in the cancer cells will have a better prognosis, e.g., longer overall survival, etc.

In another aspect, the invention provides application of MAP1S inhibitor in preparing medicines for treating liver cancer and inhibiting liver cancer metastasis.

The term "inhibitor" as used herein refers to a substance that targets, reduces or inhibits at least one activity of a particular gene or protein of interest. In particular, the present invention is directed to active agents that target, reduce or inhibit MAP1S. The inhibitors include nucleic acid inhibitors, protein inhibitors, proteolytic enzymes, protein binding molecules.

Preferably, the inhibitor comprises synthetic or naturally occurring.

Preferably, the inhibitor comprises an agent that reduces expression of a gene or protein of interest by: RNA interference technology (RNAi), antisense oligonucleotide (ASO) technology, CRISPR technology, TALEN technology, ZFN technology, cre-loxP gene recombination technology.

Preferably, the inhibitors further include compounds (including small molecule compounds), antibodies, which specifically target the gene or protein of interest.

The "antibody" of the present invention includes human antibodies, humanized antibodies, chimeric antibodies, multispecific antibodies, monoclonal antibodies, polyclonal antibodies, and their oligomers or antigen-binding fragments. Also included are proteins having antigen binding fragments or regions, such as Fab, fab ', F (ab') 2, fv, diabodies, fd, dAb, minibodies, single chain antibody molecules, complementarity Determining Region (CDR) fragments, scFv, diabodies, triabodies, tetrabodies, and polypeptides, which contain at least a portion of an immunoglobulin sufficient to confer binding to a specific antigen of a target polypeptide.

Antibodies according to the invention may be derived from any animal source, including avian and mammalian. Preferably, the antibody is of human, murine, donkey, monkey, rabbit, goat, guinea pig, camel, horse or chicken origin.

Preferably, the MAP1S inhibitor is T5224.

Preferably, the medicament further comprises a chemotherapeutic agent or a biological agent (such as an antibody) specifically targeting liver cancer. The term "chemotherapeutic agent" includes alkylating agents, antimetabolites, antitumor antibiotics, antitumor botanicals and miscellaneous. Chemotherapeutic agents that are believed to be suitable include, for example, doxorubicin, 5-fluorouracil (5 FU), etoposide (VP-16), camptothecins, actinomycin D, mitomycin C, cisplatin (CDDP), and hydrogen peroxide.

In another aspect, the invention provides the use of a MAP1S inhibitor in the manufacture of a medicament for the treatment of a MAP 1S-related disorder.

Preferably, the MAP1S inhibitor is T5224, having a CAS number of 530141-72-1.

Preferably, the MAP 1S-related disease includes cancer, hepatitis b virus-induced disease.

The type of cancer described in the present specification is not particularly limited, and specific examples thereof include thyroid cancer, esophageal cancer, breast cancer, gastric cancer, pancreatic cancer, lung cancer, liver cancer, gall bladder cancer, rectal cancer, malignant melanoma, malignant lymphoma, osteosarcoma, pheochromocytoma, head and neck cancer, uterine cancer, ovarian cancer, chronic myelogenous leukemia, acute myelogenous leukemia, renal cancer, prostate cancer, testicular cancer, bladder cancer, sarcoma, and the like.

More preferably, the cancer is a cancer that highly expresses MAP1S.

Preferably, the cancer is liver cancer.

More preferably, the cancer is a liver cancer that highly expresses MAP1S, in particular, it may be more invasive.

Preferably, the hepatitis b virus-induced disease includes acute hepatitis, chronic hepatitis, cirrhosis, liver failure, liver cancer, and the like.

In another aspect, the invention provides methods for diagnosing liver cancer, screening for strongly invasive liver cancer cells, and predicting prognosis in a patient with liver cancer, comprising detecting MAP1S.

More specifically, the expression level of MAP1S is detected.

Preferably, the expression level includes an mRNA expression level or a protein expression level.

In another aspect, the invention provides a method of treating liver cancer, inhibiting metastasis of liver cancer, comprising administering a MAP1S inhibitor to a patient.

In another aspect, the invention provides methods of treating MAP 1S-related diseases using MAP1S inhibitors, the methods comprising administering a MAP1S inhibitor to a patient.

Preferably, the MAP1S inhibitor is T5224.

Preferably, the MAP 1S-related disease includes cancer, hepatitis b virus-induced disease.

Preferably, the cancer is liver cancer.

Preferably, the hepatitis b virus-induced disease includes acute hepatitis, chronic hepatitis, cirrhosis, liver failure, liver cancer, and the like.

The liver cancer of the present invention includes hepatocellular carcinoma (HCC), cholangiocarcinoma and hepatoblastoma. The liver cancer metastasis includes metastasis to any location, including but not limited to metastasis to lung, bone, lymph, adrenal gland, brain.

The Hepatitis B Virus (HBV) -induced disease refers to a disease or a disease of aggravated or caused by HBV infection, or refers to a disease or a disease of which HBV infection is a risk factor; specifically, for example, acute hepatitis (including acute hepatitis B), chronic hepatitis (including chronic hepatitis B), cirrhosis, liver scarring (cirrhosis), liver cancer (including hepatocellular carcinoma), and the like.

The treatment regimen provided by the present invention may be administered in combination with any one or more of the following: liver transplantation, surgical resection, percutaneous ablation, chemotherapy (including chemoembolization), radiation therapy, antibody therapy, and the like. The MAP1S inhibitor of the invention and pharmaceutically acceptable excipients can be prepared into tablets, capsules, granules, oral liquid, suspension, injection, microspheres or liposome according to the conventional method, and the MAP1S inhibitor can be administrated by local, enteral or parenteral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, inhaled, epidural and oral routes, and the diluents comprise PBS, physiological saline, DMSO and the like. Administration may be systemic or local.

The term "treating" as used herein refers to the complete or partial alleviation of or reduction of the disease or condition or disorder, or of the symptoms, adverse effects, or consequences, or phenotypes associated therewith. Desirable therapeutic effects include, but are not limited to, preventing occurrence or recurrence of disease, alleviating symptoms, reducing any direct or indirect pathological consequences of disease, preventing metastasis, slowing the rate of disease progression, improving or alleviating the disease state, and alleviating or improving prognosis. The term does not mean complete cure of the disease or complete elimination of any or all symptoms or consequences.

The term "subject" as used herein refers to any animal (e.g., mammal), including but not limited to humans, non-human primates, rodents, etc., that will become the recipient of a particular treatment. In general, the terms "subject" and "patient" are used interchangeably herein when referring to a human subject.

Drawings

FIG. 1 shows that high levels of MAP1S in hepatoma cells are associated with HCC metastasis and poor prognosis.

FIG. 2 shows that MAP1S high expression is inversely related to recurrence-free survival of HCC patients.

FIG. 3 shows the results of evaluation of the grade of the risk of HCC invasiveness and metastasis based on the results of the MAP1S histological evaluation.

Fig. 4 shows that inhibition of MAP1S can inhibit HCC cell invasion and migration.

Figure 5 shows that inhibition of MAP1S can reduce tumor volume.

FIG. 6 shows that T5224 has an inhibitory effect on the expression of MAP1S protein and mRNA in LM3 cells.

Figure 7 shows the ability of different concentrations of T5224 to invade LM3 cells.

Detailed Description

The present invention will be further described with reference to specific embodiments, but the scope of the present invention is not limited thereto, and any person skilled in the art, who is within the scope of the present invention, should make equivalent substitutions or modifications according to the technical scheme of the present invention and the inventive concept thereof, and should be covered by the scope of the present invention.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

EXAMPLE 1 expression of MAP1S elevated in HCC, metastatic HCC

1. Chip detection

The inventors used a tissue chip (HLivH 060CD03, shanghai core biotechnology limited, china, containing 2 normal liver tissues, 6 liver cirrhosis liver tissues, 13 matched distant livers, liver cancer 30 side and primary HCC and 19 distant metastatic HCC tissues) and anti-MAP1S antibodies (Biorbyt, # orb251641, uk) for expression detection of MAP1S by immunohistochemistry.

FIG. 1A is a representative image of liver sample microarray immune 6 histochemical detection of MAP1S expression and FIG. 1B is an expression intensity score. The expression intensity score is calculated as the product of staining intensity and positive rate.

Wherein, the dyeing intensity is divided into:

0: cells are not specifically stained; 1+: weak staining of cells; 2+: medium positive staining; 3+: cells were strongly and uniformly positively stained.

The positive rate is divided into:

0 point: 0% staining of liver cancer cells; 1, the method comprises the following steps: 1-25% of liver cancer cells are colored; 2, the method comprises the following steps: 25-50% of liver cancer cells are colored; 3, the method comprises the following steps: staining 51-75% of liver cancer cells; 4, the following steps: 76-100% of liver cancer cells are stained.

The final expression intensity score was used to evaluate the expression intensity of MAP 1S: 0-4 is classified as low expression intensity, 5-8 is expression intensity, and 12 is classified as high expression intensity.

2. HCC biopsy

Using anti-MAP1S antibodies (Biorbyt, # orb251641, UK), the inventors also assessed HCC biopsies from 26 HCC lesions, including matched HCC Tumor Bodies (TB) and Invasive Fronts (IF).

The upper panel of FIG. 1C shows 26 cases of primary HCC Invasive Fronts (IF), the lower panel shows Tumor Bodies (TB), which are representative images of the immunohistochemical detection of MAP1S, FIG. 1D shows the area of MAP1S positive cells labeled with anti-MAP1S antibody, and FIG. 1E shows the Integrated Optical Density (IOD) of MAP1S positive cells labeled with anti-MAP1S antibody.

The results indicate that expression of MAP1S in tumor Invasive Front (IF) is significantly stronger than in tumor mass (TB), indicating that regional up-regulation of MAP1S in tumor IF is similar to higher levels of MAP1S in metastatic HCC.

EXAMPLE 2 correlation of MAP1S with HCC prognosis

Survival analysis was performed using the UALCAN database (http:// UALCAN. Path. Uab. Edu).

Fig. 1F is a graph of Kaplan-Meier survival analysis total survival (OS) for MAP1S high expression (n=91) and low/medium expression (n=274) HCC patients. The results indicate that in the 365 HCC patient cohort, highly expressed MAP1S mRNA correlated significantly negatively with survival 30 (p=0.029), with higher MAP1S mRNA levels correlated closely with shorter overall survival.

EXAMPLE 3 correlation of MAP1S high expression with recurrence-free survival in HCC patients

The proteomic data used in this study were from the HCC dataset published by Gao et al, which data were stored at https:// doi.org/10.1016/j.cell.2019.08.052.

For analysis of differentially expressed proteins we used the Python language and the scipy package (v 1.7.3) and performed a Wilcoxon rank sum test with a significance threshold of P <0.05. Survival analysis was performed using the life package (v0.27.1) and visualization was performed using the matplotlib package (v3.5.1) and the seaborn package (v0.11.2). Statistical analysis was performed using Graphpad Prism 9.4.1 version (Graphpad Software inc., san Diego, CA, USA). The significance of the different expression assays was determined using the Welch double sample t-test. The data provided are expressed as mean ± standard deviation of at least three independent experiments. P <0.05 is statistically significant.

The results are shown in FIG. 2. The results indicate that patients with HCC with higher levels of MAP1S have shorter Relapse Free Survival (RFS) (p=0.019, hr=1.86 (1.10-3.15)), i.e. HCC cells highly express MAP1S to promote HCC invasive metastasis.

EXAMPLE 4 risk determination of HCC invasiveness and metastasis based on MAP1S histological evaluation results

The research result shows that the expression of MAP1S is positively correlated with the invasiveness and metastasis of HCC, and is negatively correlated with the survival time of HCC patients, so that the detection of the expression of MAP1S in liver tissues can provide a diagnosis basis for the judgment of the differentiation degree of HCC and a prediction index for diagnosis and prognosis of HCC patients.

The specific judging process is as follows: immunohistochemical (IHC) staining: the expression level of MAP1S protein was detected by immunostaining liver cancer tissue samples using specific antibodies. And (5) observing the dyeing result: according to the staining result, the expression intensity of MAP1S in liver cancer tissues was evaluated. Typically observed using a light microscope and scored according to the intensity of the stain.

And (3) dyeing intensity grading judgment:

level 0: no obvious MAP1S protein expression. There was no observable expression of MAP1S protein in cancer cells.

1+ stage: MAP1S protein expression is very weak. There is little MAP1S protein expression in the cancer cytoplasm.

2+ stage: MAP1S protein expression is moderate. There is moderate levels of MAP1S protein expression in the cancer cytoplasm.

3+ stage: MAP1S protein expression is very strong. There is significant expression of MAP1S protein in cancer cytoplasm and nucleus.

HCC aggressiveness and metastasis risk determination based on MAP1S histological evaluation results can be classified as: negative (0 grade, i.e., low grade), positive (1+ grade, 2+ grade, i.e., medium grade), strong positive 10 (3+ grade, i.e., high grade). The results are shown in FIG. 3.

Example 5 targeting MAP1S for treatment of disease

1. Knock-down of MAP1S effects on liver cancer cell growth and invasion

In order to gain insight into the effect of MAP1S expression on tumor cell growth and invasion, the inventors performed in vitro experiments using the low invasive liver cancer cell line HepG2, mhc 97L and the high invasive HCC cell line HCCLM 3.

FIG. 4A is a representative graph and statistical results of Western Blotting (WB) detection of MAP1S expression in HepG2, MHCC97L, HCCLM3 cells. The invasiveness of liver cancer cell lines HepG2 and MHCC97L, HCCLM is low to high. It was found that as aggressiveness increased, MAP1S expression gradually increased, and MAP1S was highly expressed in HCCLM3 cells. Immunoblotting detection found that higher levels of MAP1S were expressed in HCCLM3 compared to HepG2 and mhc c 97L.

To verify the effect of MAP1S expression on HCC cell migration, the inventors constructed a lentiviral vector pLV-hU6-MAP1S shRNA01 (human) -hef1 a-mNanngreen-P2A-Puro, abbreviated as ShMAP1S, for knocking down MAP1S, wherein the shRNA sequence of the MAP1S gene is: 5'-GCAACCTTGATGAACAGCTCACGAATGAGCTGTTCATCAAGGTTGC-3'.

ShVector, shMAP1S was transfected into HCCLM3 cells (labeled ShVector HCCLM3 and ShMAP1S HCCLM3, respectively) using empty vector without shRNA sequence (ShVector for short) as a control, and the effect of knockdown of MAP1S expression was confirmed by immunoblotting analysis.

The inventors then performed a cell invasiveness test. The matrigel-coated invasion cells (transwell) (354480 #, corning company, usa) were removed from the-80 ℃ refrigerator and left at 4 ℃ overnight for use. Mu.l of serum-free medium/chamber was taken and placed in an incubator at 37℃for 2 hours. The cells of interest were digested and suspensions of ShVector HCCLM3 and ShMAP1S HCCLM cells were prepared for the invasive conditions to be examined. Washing the cells 3 times with serum-free medium, and counting; add 100 μl of cell suspension per well; the small chamber is clamped by forceps, 500 μl/hole of DMEM culture medium containing 10% -20% of fetal bovine serum is added, a serum gradient is formed in the small chamber, and cells are induced to pass through the small chamber to reach the lower layer; culturing in a 37 ℃ incubator for 24 hours to wait for target cells to pass through the cell; taking out the Transwell chamber, and after PBS is washed twice, fixing cells by 5% glutaraldehyde; crystal violet (0.1%) was added for staining for 10min, rinsed with PBS at room temperature until the color was no longer 8, for three more times, then failed cells were scraped off with cotton balls over the chamber and the cell count was recorded under a microscope.

The results are shown in FIG. 4, B, C; fig. 4B is a representative graph and statistics of MAP1S expression of WB detection of two transfected cells, and fig. 4C is a graph and statistics of invasiveness (n=3) of WB detection of two transfected cells using transwell. Experiments showed that the invasion and migration capacity of MAP1S knockdown HCCLM3 cells was significantly reduced compared to control cells.

2. Animal experiment

In order to analyze the influence of MAP1S expression on the growth and invasion of liver cancer cells in vivo, the inventor performs experimental detection of mouse tumor-bearing. All nude mice were randomly grouped, 6 per group, male 4 week old Balb/c nude mice.

Building a nude mouse tumor-bearing model:

experimental group: shMAP1S HCCLM3 cells,

control group: shVector HCCLM3 cells,

the cells were resuspended in pre-chilled serum-free DMEM and the concentration was adjusted to 5X 10 ⁷ 15/ml, 200. Mu.L was injected subcutaneously and slowly into each nude mouse, and mice were anesthetized on day 5, day 15, day 25 and day 35, respectively, and tumor implantation and metastasis were examined, and then nude mice were sacrificed and part of nude mouse tumor tissue was frozen with liquid nitrogen.

The results are shown in FIG. 5. FIG. 5 is a quantitative plot of tumor volume (upper left panel), average tumor diameter (lower left panel), and tumor size (right panel) over time (4 weeks) following injection of ShMAP1S-HCCLM3 and control cells in mice. The results indicate that MAP1S knockdown HCCLM3 cells resulted in significantly smaller tumor volumes than control cells, even without tumor formation (P < 0.05).

In summary, inhibition of MAP1S inhibits HCC cell growth and invasion, both in vitro and in vivo.

Example 6 influence of T5224 on MAP1S and liver cancer cells

Subsequent experiments were performed screening for MAP 1S-targeted T5224.

mRNA and protein expression levels of MAP1S were measured in LM3 cells treated with different concentrations of T5224 (MCE, HY-12270) and the results are shown in FIG. 6.

2.5. Mu.M T5224 was added to LM3 cells to add DMSO as a negative control, incubation was continued for 24 hours at 37℃with a 5% CO2 incubator, after which the cells were lysed, the protein was collected, immunoblotted with anti-MAP1S antibody (1:1,000; geneTex, USA) and staining intensity was quantitatively measured with ImageQuant-TL-7.0 software version 2010 (Amersham Biosciences, piscataway, NJ, USA) and T5224 was found to significantly reduce MAP1S protein expression (P < 0.05) in HCCLM3 cells (see FIG. 7).

The results prove that the T5224 can reduce the expression quantity of MAP1S in liver cancer cells and obviously inhibit the invasion capacity of the liver cancer cells.

The foregoing is a further detailed description of the invention in connection with the preferred embodiments, and it is not intended that the invention be limited to the specific embodiments described. It will be apparent to those skilled in the art that several simple deductions or substitutions may be made without departing from the spirit of the invention, and these should be considered to be within the scope of the invention.

Claims (10)

1. Application of MAP1S inhibitor in preparing medicine for treating liver cancer and inhibiting liver cancer metastasis;

   preferably, the inhibitor comprises synthetic or naturally occurring;

   preferably, the inhibitor comprises an agent that reduces expression of the MAP1S gene or protein by: RNA interference technology, antisense oligonucleotide technology, CRISPR technology, TALEN technology, ZFN technology, cre-loxP gene recombination technology;

   preferably, the agent used by the RNA interference technique is shRNA that specifically targets MAP 1S;

   preferably, the sequence of the shRNA that specifically targets MAP1S is GCAACCTTGATGAACAGCTCACGAATGAGCTGTTCATCAAGGTTGC;

   preferably, the inhibitor further comprises a compound, an antibody, which specifically targets MAP 1S;

   preferably, the antibody is of human, murine, donkey, monkey, rabbit, goat, guinea pig, camel, horse or chicken origin.
2. 2. The use of claim 1, wherein the MAP1S inhibitor is T5224;

   preferably, the medicament also contains a chemotherapeutic agent or a biological agent specifically targeting liver cancer.
3. 3. The use of claim 1, wherein the liver cancer comprises hepatocellular carcinoma, cholangiocarcinoma, and hepatoblastoma;

   preferably, the liver cancer metastasis comprises metastasis to lung, bone, lymph, adrenal gland, brain.
4. Application of MAP1S inhibitor in preparing medicine for treating MAP1S related diseases;

   preferably, the inhibitor comprises synthetic or naturally occurring;

   preferably, the inhibitor comprises an agent that reduces expression of the MAP1S gene or protein by: RNA interference technology, antisense oligonucleotide technology, CRISPR technology, TALEN technology, ZFN technology, cre-loxP gene recombination technology;

   preferably, the inhibitor further comprises a compound, an antibody, which specifically targets MAP 1S;

   preferably, the antibody is of human, murine, donkey, monkey, rabbit, goat, guinea pig, camel, horse or chicken origin;

   preferably, the MAP1S inhibitor is T5224.
5. 5. The use according to claim 4, wherein the MAP 1S-related disease comprises cancer, hepatitis b virus-induced disease.
6. 6. The use of claim 4, wherein the cancer comprises thyroid cancer, esophageal cancer, breast cancer, gastric cancer, pancreatic cancer, lung cancer, liver cancer, gall bladder cancer, rectal cancer, malignant melanoma, malignant lymphoma, osteosarcoma, pheochromocytoma, head and neck cancer, uterine cancer, ovarian cancer, chronic myelogenous leukemia, acute myelogenous leukemia, renal cancer, prostate cancer, testicular cancer, bladder cancer, or sarcoma;

   more preferably, the cancer is a disease in which MAP1S is highly expressed.
7. 7. The use of claim 4, wherein the cancer is liver cancer;

   preferably, the hepatitis B virus-induced disease includes acute hepatitis, chronic hepatitis, cirrhosis, liver failure, liver cancer.
8. 8. Application of MAP1S detection reagent in preparing liver cancer diagnosis product;

   preferably, the reagent is a reagent for detecting the positive rate and/or the expression level of MAP1S cells.
9. 9. The use according to claim 8, wherein the reagent for detecting the expression level comprises a reagent for detecting the expression level of a protein and/or the expression level of an mRNA;

   preferably, the reagent for detecting the protein expression amount includes a reagent used in the following method: hematoxylin-eosin staining, safranin O-fast green staining, western blotting, enzyme-linked immunosorbent assay, radioimmunoassay, sandwich assay, immunohistochemical staining method, mass spectrometry, immunoprecipitation assay, complement fixation assay, flow cytometry fluorescence resolution technique, and protein chip method;

   preferably, the reagent for detecting the expression amount of mRNA includes a reagent used in the following method: PCR-based detection methods, southern hybridization methods, northern hybridization methods, dot hybridization methods, fluorescent in situ hybridization methods, DNA microarray methods, ASO methods, high throughput sequencing platform methods.
10. 10. The use of claim 8, wherein the detection is performed on a sample from a subject, the sample being tissue;

    preferably, the liver cancer includes hepatocellular carcinoma, cholangiocarcinoma, and hepatoblastoma.