CN117750972A

CN117750972A - Influenza-coronavirus combination vaccine

Info

Publication number: CN117750972A
Application number: CN202280041534.1A
Authority: CN
Inventors: 拉斐尔·纳克巴戈耶; 卡罗勒·亨利; 纪尧姆·斯图尔特-琼斯; 伊丽莎白·纳拉亚南; 哈米尔顿·班尼特; 安德烈亚·卡尔菲
Original assignee: ModernaTx Inc
Current assignee: ModernaTx Inc
Priority date: 2021-04-14
Filing date: 2022-04-13
Publication date: 2024-03-22

Abstract

The present disclosure provides combination mRNA vaccines against respiratory viruses such as influenza and coronaviruses (e.g., SARS-CoV-2), and methods of using the vaccines.

Description

Influenza-coronavirus combination vaccine

RELATED APPLICATIONS

The present application claims priority from U.S. c. ≡119 (e) to U.S. provisional patent application No. 63/175,007 filed on day 2021, month 4, and U.S. provisional patent application No. 63/242,346 filed on day 2021, month 9, which are hereby incorporated by reference in their entirety. Reference to sequence Listing submitted as text File through EFS-WEB

The present application contains a sequence listing submitted in ASCII format via EFS-Web and hereby incorporated by reference in its entirety. The ASCII copy was created at 2022, month 4, 13, under the name M137870180WO00-JXV-SEQ and of size 202,400 bytes.

Background

Respiratory diseases are medical terms that encompass pathological conditions affecting organs and tissues that enable gas exchange by higher organisms, and include conditions of the upper respiratory tract, trachea, bronchi, bronchioles, alveoli, pleural and pleural spaces, and respiratory nerves and muscles. Respiratory diseases range from mild self-limiting entities (such as the common cold) to life threatening entities (such as bacterial pneumonia, pulmonary embolism, acute asthma and lung cancer). Respiratory diseases are common and important causes of illness and death worldwide. In the united states, about 10 hundred million cases of "common cold" occur annually. Respiratory disease is one of the most common causes of hospitalization of children.

Seasonal influenza is an acute respiratory infection caused by influenza viruses (influenza a and b viruses, members of the Orthomyxoviridae family) and is prevalent worldwide. Seasonal influenza is characterized by sudden fever, cough (usually dry), headache, muscle and joint pain, severe discomfort (sensory discomfort), sore throat, and runny nose. In industrialized countries, most deaths associated with influenza occur in the 65 year old or older population. Epidemics can lead to high worker/school absences and productivity losses. During peak disease times, clinics and hospitals may be overwhelmed. The effect of seasonal influenza epidemics on developing countries is not completely understood, but studies have estimated that 99% of deaths in children under 5 years of age caused by influenza-related lower respiratory tract infections occur in developing countries.

Human coronaviruses are enveloped positive-sense single-stranded RNA viruses of the family Coronaviridae (Coronaviridae) that are highly infectious. Two subfamilies of the coronaviridae are known to cause human disease. The most affecting is the coronavirus b (beta-coronaviruses). Coronaviruses b are common pathogens for mild to moderate upper respiratory tract infections. However, outbreaks of new coronavirus infections have been associated with high mortality deaths. This recently discovered coronavirus, known as Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (formerly known as "2019 novel coronavirus" or "2019-nCoV"), has rapidly infected millions of people. Pandemic diseases caused by SARS-CoV-2 virus have been named COVID-19 (2019 coronavirus disease) by the World Health Organization (WHO). Researchers at the center of Chinese disease prevention control published the first genomic sequence of the SARS-CoV-2 isolate (Wuhan-Hu-1; USA-WA1/2020 isolate) on the British Forum virologic on day 1 and 10 of 2020 for analysis and interpretation of viral molecular evolution and epidemiology. This sequence was then deposited in GenBank under accession number MN908947.1 at 1 month 12 of 2020. Subsequently, a number of variants of SARS-CoV-2 strain were identified, some of which were more infectious than the SARS-CoV-2 isolate.

Persistent health problems associated with respiratory viruses such as influenza and coronaviruses are of international social interest, enhancing the importance of developing effective and safe vaccine candidates against these viruses.

Disclosure of Invention

In some aspects, the present disclosure provides a combination vaccine comprising: a first messenger ribonucleic acid (mRNA) polynucleotide comprising an Open Reading Frame (ORF) encoding a first respiratory viral antigenic polypeptide, wherein the first respiratory viral antigenic polypeptide is an influenza viral antigen; and a second mRNA polynucleotide comprising an ORF encoding a second respiratory viral antigenic polypeptide from a coronavirus; lipid nanoparticles.

In another aspect, the present disclosure provides a combination vaccine comprising: a first messenger ribonucleic acid (mRNA) polynucleotide comprising an Open Reading Frame (ORF) encoding a first respiratory viral antigenic polypeptide, wherein the first respiratory viral antigenic polypeptide is an influenza viral antigen; a second mRNA polynucleotide comprising an ORF encoding a second respiratory viral antigenic polypeptide from a second influenza virus; a third mRNA polynucleotide comprising an ORF encoding a third respiratory viral antigenic polypeptide from a third influenza virus; a fourth mRNA polynucleotide comprising an ORF encoding a fourth respiratory virus antigenic polypeptide from a fourth influenza virus; a fifth mRNA polynucleotide comprising an ORF encoding a fifth respiratory viral antigenic polypeptide from the first coronavirus; a sixth mRNA polynucleotide comprising an ORF encoding a sixth respiratory virus antigenic polypeptide from a second coronavirus; lipid nanoparticles.

In some embodiments, the first virus, the second virus, the third virus, and the fourth virus are selected from influenza a virus and influenza b virus. In some embodiments, the second virus is a coronavirus b. In some embodiments, the coronavirus (e.g., first coronavirus, second coronavirus, or both the first coronavirus and the second coronavirus) is selected from the group consisting of MERS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH, and HCoV-HKU 1.

In some embodiments, the first respiratory virus antigenic polypeptide is from influenza b virus. In some embodiments, the first respiratory virus antigenic polypeptide is from influenza a virus. In some embodiments, the first respiratory virus antigenic polypeptide is a Hemagglutinin Antigen (HA) or a Neuraminidase Antigen (NA).

In some embodiments, the second respiratory viral antigenic polypeptide is from SARS-CoV. In some embodiments, the second respiratory viral antigenic polypeptide is from SARS-CoV-2. In some embodiments, the second respiratory virus antigenic polypeptide is from a non-SARS human coronavirus (HCoV).

In some embodiments, the vaccine comprises at least 2 mRNA polynucleotides comprising ORFs encoding influenza virus antigens. In some embodiments, the vaccine comprises 2-4 mRNA polynucleotides comprising ORFs encoding influenza virus antigens. In some embodiments, the vaccine comprises at least 2 mRNA polynucleotides comprising ORFs encoding respiratory viral antigenic polypeptides from coronaviruses.

In some embodiments, the vaccine comprises less than 15 mRNA polynucleotides. In some embodiments, the vaccine comprises 3-10 mRNA polynucleotides. In some embodiments, the vaccine comprises 4-10 mRNA polynucleotides. In some embodiments, the vaccine comprises 5-10 mRNA polynucleotides. In some embodiments, the vaccine comprises 8-9 mRNA polynucleotides.

In some embodiments, the vaccine comprises at least three mRNA polynucleotides encoding influenza virus antigenic polypeptides. In some embodiments, the vaccine comprises at least eight mRNA polynucleotides encoding influenza virus antigenic polypeptides. In some embodiments, the vaccine comprises at least two mRNA polynucleotides encoding coronavirus antigenic polypeptides.

In some embodiments, the first mRNA polynucleotide and the second mRNA polynucleotide are present in the combination vaccine in a 1:1 ratio. In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the influenza virus, the coronavirus in a ratio of 4:1. In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the influenza virus, the coronavirus in a ratio of 3:1. In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the influenza virus, the coronavirus in a ratio of 2:1. In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the influenza virus, the coronavirus in a ratio of 5:1. In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the influenza virus, the coronavirus in a ratio of 4:2. In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the influenza virus, the coronavirus in a ratio of 1:2. In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first virus to the second virus in a ratio of 8:2. In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first virus to the second virus in a ratio of 8:1. In some embodiments, the respiratory viral antigenic polypeptide of the first virus comprises HA and NA in a ratio of 4:4.

In some embodiments, each of the mRNA polynucleotides in the combination vaccine is complementary to and does not interfere with each other mRNA polynucleotide in the combination vaccine.

In some embodiments, at least one of the respiratory virus antigenic polypeptides is derived from a naturally occurring antigen. In some embodiments, at least one of the respiratory virus antigenic polypeptides is a stable version of a naturally occurring antigen. In some embodiments, at least one of the respiratory virus antigenic polypeptides is a non-naturally occurring antigen.

In some embodiments, the vaccine further comprises an mRNA polynucleotide encoding a structurally altered variant respiratory viral antigenic polypeptide, wherein the structurally altered variant is a structurally altered variant of either the first respiratory viral antigenic polypeptide or the second respiratory viral antigenic polypeptide.

In some embodiments, at least one of the first mRNA polynucleotide and the second mRNA polynucleotide is polycistronic. In some embodiments, each of the first mRNA polynucleotide and the second mRNA polynucleotide is polycistronic.

Another aspect of the present disclosure provides a multivalent RNA composition comprising a first messenger ribonucleic acid (mRNA) polynucleotide comprising an Open Reading Frame (ORF) encoding a first respiratory viral antigenic polypeptide from a first virus; and a second mRNA polynucleotide comprising an ORF encoding a second respiratory viral antigenic polypeptide from a coronavirus; wherein the multivalent RNA composition comprises greater than 40% poly-a-tailed RNA, and/or the first mRNA polynucleotide and/or the second mRNA polynucleotide differ from each other by at least 100 nucleotides in length.

In some embodiments, the method comprises: (a) Combining a linearized first DNA molecule encoding the first mRNA polynucleotide and a linearized second DNA molecule encoding the second mRNA polynucleotide into a single reaction vessel, wherein the first DNA molecule and the second DNA molecule are obtained from different sources; and (b) simultaneously transcribing the linearized first DNA molecule and the linearized second DNA molecule in vitro to obtain a multivalent RNA composition.

In some embodiments, the different sources are first and second bacterial cell cultures, and wherein the first and second bacterial cell cultures are not co-cultured. In some embodiments, the amounts of the first DNA molecule and the second DNA molecule present in the reaction mixture prior to the start of the IVT have been normalized.

In some embodiments, wherein the coronavirus is selected from the group consisting of MERS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH and HCoV-HKU 1.

Another aspect of the present disclosure provides a multivalent RNA composition comprising 2-15 mRNA polynucleotides, each comprising a different Open Reading Frame (ORF) encoding a respiratory viral antigenic polypeptide, wherein at least one respiratory viral antigenic polypeptide is an influenza virus and at least one respiratory viral antigenic polypeptide is a coronavirus, and wherein each mRNA polynucleotide comprises one or more non-coding sequences in an untranslated region (UTR), optionally a 5'UTR or a 3' UTR.

In some embodiments, the non-coding sequence is located in the 3' utr of the mRNA, upstream of the poly a tail of the mRNA.

In some embodiments, the non-coding sequence is located in the 3' utr of the mRNA, downstream of the poly a tail of the mRNA.

In some embodiments, the non-coding sequence is located in the 3' utr of the mRNA, between the last codon of the ORF of the mRNA and the first "a" of the poly a tail of the mRNA. In some embodiments, the non-coding sequence comprises 1 to 10 nucleotides. In some embodiments, the non-coding sequence comprises one or more rnase cleavage sites. In some embodiments, the rnase cleavage site is an rnase H cleavage site.

In some embodiments, the coronavirus antigen is selected from the group consisting of MERS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH and HCoV-HKU 1.

In some aspects, the present disclosure provides a multivalent RNA composition comprising: a first messenger ribonucleic acid (mRNA) polynucleotide comprising an Open Reading Frame (ORF) encoding a first respiratory viral antigenic polypeptide from an influenza virus; a second mRNA polynucleotide comprising an ORF encoding a second respiratory viral antigenic polypeptide from a coronavirus; and wherein at least one of the respiratory viral antigenic polypeptides is derived from a naturally occurring antigen or a stable version of a naturally occurring antigen, and the multivalent RNA composition further comprises an mRNA polynucleotide encoding a structurally altered variant respiratory viral antigenic polypeptide, wherein the structurally altered variant is a structurally altered variant of either the first respiratory viral antigenic polypeptide or the second respiratory viral antigenic polypeptide.

In some embodiments, the coronavirus is selected from the group consisting of MERS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH and HCoV-HKU 1.

In some embodiments, the structurally altered variant is a structurally altered variant of the first respiratory viral antigenic polypeptide.

In some embodiments, the structurally altered variant is a structurally altered variant of the second respiratory viral antigenic polypeptide.

Another aspect of the present disclosure provides a multivalent RNA composition comprising 5 to 15 messenger ribonucleic acid (mRNA) polynucleotides, each comprising an Open Reading Frame (ORF) encoding a different respiratory viral antigenic polypeptide, wherein the respiratory viral antigenic polypeptides are derived from two different viral families, wherein the two viral families comprise influenza virus and coronavirus; lipid nanoparticles.

In some embodiments, the composition has 3-6 mRNA polynucleotides comprising ORFs encoding influenza antigens. In some embodiments, the composition has 1-5 mRNA polynucleotides comprising ORFs encoding coronavirus antigens.

In some aspects, the present disclosure provides a multivalent RNA composition comprising a set of at least 6 messenger ribonucleic acid (mRNA) polynucleotides, each comprising an Open Reading Frame (ORF) encoding a respiratory viral antigenic polypeptide from a first virus or a second virus; wherein the first virus is an influenza virus, wherein the second virus is a coronavirus, and wherein the composition comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first virus to the second virus in a ratio of 4:1, 4:2, or 4:3.

In some embodiments, the first mRNA polynucleotide and the second mRNA polynucleotide are present in the combination vaccine in a 1:1 ratio. In some embodiments, the multivalent RNA composition comprises a 4:1 ratio of mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first virus to the second virus. In some embodiments, the multivalent RNA composition comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first virus to the second virus in a ratio of 3:1. In some embodiments, the multivalent RNA composition comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first virus to the second virus in a ratio of 2:1. In some embodiments, the multivalent RNA composition comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first virus to the second virus in a ratio of 5:1. In some embodiments, the multivalent RNA composition comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first virus to the second virus in a ratio of 4:2. In some embodiments, the multivalent RNA composition comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first virus to the second virus in a 1:2 ratio. In some embodiments, the multivalent RNA composition comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first virus to the second virus in a ratio of 8:1 or 8:2.

In some embodiments, the antigenic polypeptides include fusion (F) proteins, spike (S) proteins, and Hemagglutinin Antigens (HA). In some embodiments, the multivalent RNA compositions described herein further comprise a Neuraminidase (NA) antigen.

In some embodiments, the multivalent RNA compositions described herein further comprise at least one Lipid Nanoparticle (LNP). In some embodiments, the LNP comprises a molar ratio of 20% -60% ionizable amino lipid, 5% -25% non-cationic lipid, 25% -55% sterol, and 0.5% -15% PEG-modified lipid. In some embodiments, the ionizable amino lipid comprises the structure of compound 1:

in some embodiments, the respiratory virus antigenic polypeptide comprises a cell surface glycoprotein.

In some aspects, the present disclosure provides a method for vaccinating a subject, the method comprising administering to the subject a combination vaccine, wherein the combination vaccine comprises a first messenger ribonucleic acid (mRNA) polynucleotide comprising an Open Reading Frame (ORF) encoding a first respiratory viral antigenic polypeptide from influenza virus; and a second mRNA polynucleotide comprising an ORF encoding a second respiratory viral antigenic polypeptide from a coronavirus.

In some embodiments, the subject is 65 years old or older. In some embodiments, the subject is less than 18 years old.

In some embodiments, the method prevents respiratory tract infection in the subject. In some embodiments, the method reduces the severity of respiratory tract infection in the subject.

In some embodiments, the subject is seronegative for at least one of the antigenic polypeptides. In some embodiments, the subject is seronegative for all of the antigenic polypeptides. In some embodiments, the subject is seropositive for at least one of the antigenic polypeptides. In some embodiments, the subject is seropositive for all of the antigenic polypeptides.

In some embodiments, any of the methods disclosed herein further comprise administering a booster vaccine. In some embodiments, the booster vaccine is administered between 3 weeks and 1 year after the combination vaccine.

In some embodiments, the booster vaccine comprises at least one mRNA polynucleotide comprising an ORF encoding the first respiratory viral antigenic polypeptide or the second respiratory viral antigenic polypeptide. In some embodiments, the booster vaccine comprises at least one mRNA polynucleotide comprising ORFs encoding the first respiratory viral antigenic polypeptide and the second respiratory viral antigenic polypeptide. In some embodiments, the booster vaccine comprises at least one mRNA polynucleotide comprising an ORF encoding a structurally altered variant of the first respiratory viral antigenic polypeptide or the second respiratory viral antigenic polypeptide.

In some embodiments, the combination vaccine is a seasonal booster vaccine.

In some embodiments, the combination vaccine is any vaccine disclosed herein.

In some embodiments, the present disclosure provides a method of preventing or reducing the severity of a respiratory tract infection by administering to a subject an effective amount of a combination/multivalent vaccine described herein to prevent or reduce the severity of a respiratory tract infection in the subject based on a single dose or a single dose plus a booster.

In some embodiments, the combination vaccine is administered to the subject at a dose of 50 μg. In some embodiments, the combination vaccine is administered to the subject at a dose of 25 μg. In some embodiments, the combination vaccine is administered to the subject at a dose of 100 μg.

In some embodiments, each RNA polynucleotide of the vaccine is formulated in a separate LNP. In some embodiments, the RNA polynucleotides of the vaccine are co-formulated in LNP.

In some embodiments, any of the compositions or vaccines described herein (e.g., for use in any of the methods described herein) comprise mRNA polynucleotides encoding four HA antigens. In some embodiments, the four HA antigens are present in a ratio of 1:1:1:1.

In some embodiments, any of the compositions or vaccines described herein further comprise mRNA polynucleotides encoding the four NA antigens. In some embodiments, the four NA antigens are present in a ratio of 1:1:1:1.

In some embodiments, the ratio of HA antigen to NA antigen is 1:1. In some embodiments, the ratio of HA antigen to NA antigen is 3:1.

In some embodiments, any of the compositions described herein (e.g., for use in any of the methods described herein), the coronavirus is a b-coronavirus.

Drawings

Fig. 1 is a series of charts showing Hemagglutinin (HA) reactive IgG antibody titers against each of the four HA antigens 21 days after one dose of the indicated formulation.

Fig. 2 is a series of charts showing NA reactive IgG antibody titers against each of the four NA antigens 21 days after one dose of the indicated formulation.

FIG. 3 is a graph showing SARS-CoV-2S 2P-specific IgG antibody titers 21 days after a single dose of the indicated formulation.

Fig. 4 is a series of charts showing normalized Hemagglutinin (HA) reactive IgG antibody titers for each of the four HA antigens 21 days after one dose of the indicated formulation.

FIG. 5 is a graph showing normalized SARS-CoV-2S 2P-specific IgG antibody titers 21 days after a single dose of the indicated formulation.

FIG. 6 is a graph showing SARS-CoV-2S 2P-specific IgG antibody titers 21 days after a single dose of the indicated formulation.

FIG. 7 is a graph showing SARS-CoV-2B.1.351 variant specific IgG antibody titers 21 days after a single dose of the indicated formulation.

FIG. 8 is a graph showing Hemagglutinin (HA) -reactive IgG antibody titers against the H1 HA Wisconsin antigen (SEQ ID NO: 22) 21 days after one dose of the indicated formulation.

FIG. 9 is a graph showing Hemagglutinin (HA) -reactive IgG antibody titers against H3 HA Hong Kong antigen (SEQ ID NO: 19) 21 days after one dose/36 days after two doses of the indicated formulation.

FIG. 10 is a graph showing Hemagglutinin (HA) -reactive IgG antibody titers against the B HA Phyket antigen (SEQ ID NO: 21) 21 days/36 days after two doses of the indicated formulation.

FIG. 11 is a graph showing Hemagglutinin (HA) -reactive IgG antibody titers against the B HA Washington antigen (SEQ ID NO: 20) 21 days after one dose of the indicated formulation.

Detailed Description

Respiratory viruses are the most common disease pathogens in humans and have a significant impact on morbidity and mortality worldwide. Certain respiratory pathogens from several viral families are well suited for efficient human transmission, resulting in global epidemics. Community-based studies confirm that these viruses are the most common causative agent of acute respiratory infections. For most of these viruses, there are currently no effective vaccines and antiviral drugs.

Thus, in some embodiments, the present disclosure provides a combination vaccine comprising RNA (e.g., mRNA) polynucleotides encoding at least two respiratory antigenic polypeptides from at least two different respiratory viruses. In some embodiments, the two different viruses are from the orthomyxoviridae and coronaviridae families (optionally, the orthocoronaviridae subfamilies). In some embodiments, the respiratory antigenic polypeptide is from the genus influenza a, influenza b or coronavirus.

The manufacture of combination RNA vaccines has been challenging due to synthesis, formulation, and delivery limitations. Disclosed herein are combinations of two or more RNA polynucleotides encoding respiratory antigens in a lipid nanoparticle carrier. Disclosed herein are methods for successfully producing functional combinations of RNA polynucleotides encoding antigens to produce highly effective combination vaccines. One limitation of combination vaccines involves interference between antigens such that a complete and powerful immune response cannot be generated against all antigens in the vaccine. It has been demonstrated that combination vaccines encoding a variety of antigens (i.e., 8-10 antigens) can be produced and still produce an intact immune response. In some embodiments, each of the mRNA polynucleotides in the combination vaccine is complementary to and does not interfere with each other mRNA polynucleotide in the combination vaccine. Thus, the antigens produced by administration of the combination vaccine do not interfere with each other's immune response. As shown by the data described in the examples, surprisingly, administration of a combination vaccine comprising mRNA polynucleotides encoding antigens from the orthomyxoviridae (e.g., influenza antigens) and coronaviridae (e.g., SARS-CoV-2) did not inhibit or reduce the neutralizing antibody titer of each corresponding antigen compared to administration of mRNA encoding each single antigen alone.

Also provided herein are methods of administering the vaccines, methods of producing the vaccines, compositions comprising the vaccines, and nucleic acids encoding the vaccines. As described herein, the vaccines described herein can be used to induce balanced immune responses, including cellular and humoral immunity, without many of the risks associated with DNA vaccination. Such a vaccine, optionally referred to herein as a multivalent vaccine or combination vaccine, may be administered to a seropositive or seronegative subject. For example, the subject may be naive and not have antibodies reactive with at least one respiratory viral antigenic polypeptide of the vaccine, or may have pre-existing antibodies to at least one respiratory viral antigen of the vaccine because the respiratory virus was previously infected or a dose of vaccine (e.g., an mRNA vaccine) that induces antibodies to the respiratory virus may have been previously administered. In some embodiments, the subject may have pre-existing antibodies to all respiratory viral antigens of the vaccine.

Antigen and combination vaccine

As used herein, an antigen is a protein capable of inducing an immune response (e.g., resulting in the immune system producing antibodies to the antigen). The vaccines of the present disclosure provide unique advantages over traditional protein-based vaccination methods in which protein antigens are purified or produced in vitro, such as recombinant protein production techniques. The vaccine of the present disclosure is characterized by an mRNA encoding a desired antigen, which when introduced into the body, i.e., when administered to a mammalian subject (e.g., a human) in vivo, results in cells of the body expressing the desired antigen. The vaccine of the present disclosure is characterized by an mRNA encoding a desired viral surface antigen (e.g., glycoprotein antigen), which when introduced into the body, i.e., when administered in vivo to a mammalian subject (e.g., a human), causes cells of the body to express the desired peptide in a native folded manner, optionally in a human glycosylation pattern. Thus, combination vaccines encoding viral surface antigens from a range of pathogenic viruses all present correctly folded and optionally glycosylated viral antigens in the same manner as produced during actual infection. Thus, mRNA vaccines thus provide an optimal vehicle for the manufacture of respiratory viral vaccines, which can be produced without the use of attenuated viruses, but without the associated risks. To facilitate delivery of the mRNA of the present disclosure to body cells, the mRNA is encapsulated in Lipid Nanoparticles (LNPs). After delivery and uptake by body cells, the mRNA is translated in the cytosol and the protein or glycoprotein antigen is folded and processed by the host cell machinery. Protein and/or glycoprotein antigens are presented and elicit adaptive humoral and cellular immune responses. Neutralizing antibodies are directed against expressed viral receptor binding proteins and glycoprotein antigens, and thus these viral protein antigens are considered the most relevant target antigens in vaccine development. Jian Erlai the neutralizing antibodies are generally directed against viral surface proteins, such as glycoproteins, which are responsible for binding to cells and when blocked by specific antibodies, the virus is neutralized. In this context, unless otherwise indicated, the use of the term "antigen" encompasses immunogenic viral surface proteins (e.g., glycoproteins) and immunogenic fragments (immunogenic fragments that induce (or are capable of inducing) an immune response against (at least one) respiratory virus). In some embodiments, the antigen is a naturally occurring antigen (e.g., the respiratory virus antigenic polypeptide encodes a naturally occurring antigen). In some embodiments, the at least one respiratory virus antigenic polypeptide is an engineered version of a protein or glycoprotein antigen for use in a combination vaccine or a non-naturally occurring antigen. In some embodiments, at least one respiratory viral antigenic polypeptide is a stabilized version of a naturally occurring antigen (e.g., a coronavirus spike protein stabilized by one or more amino acid substitutions, additions or deletions, such as two proline substitutions). In another embodiment, other modifications are engineered into the viral surface proteins, e.g., glycoproteins, such as mutations or cytoplasmic tail deletions to promote protein processing or conformational stability.

It is understood that the term "protein" encompasses glycoproteins, proteins, peptides, and fragments thereof, and that the term "antigen" encompasses the antigenic portion of such molecules that elicits an immune response. For the viral vaccines included herein, the term "antigen" includes viral surface proteins (e.g., glycoproteins), viral protein (e.g., glycoprotein) fragments, and design and/or mutant versions of viral proteins (e.g., glycoproteins) derived from respiratory viruses.

Orthomyxoviridae family

The orthomyxoviridae family is a negative sense RNA viridae family, including influenza a, b, t, c (salmon anemia), togaovirus (thogaovirus), and qualanjie Gu Bingdu (Quaranjavirus). The vaccines described herein can comprise a viral antigenic polypeptide from an influenza a virus or an influenza b virus. Both of which are related to the sense of human flow.

All influenza viruses are negative strand RNA viruses with a segmented genome. Influenza a and b viruses have 8 genes that encode 10 proteins, including the surface proteins Hemagglutinin (HA) and Neuraminidase (NA). In the case of influenza a virus, the two surface proteins can be further subdivided into different subtypes based on their difference. To date, 16 HA subtypes and 9 NA subtypes have been identified. However, in the 20 th century, influenza a subtype widely prevalent in humans had only a (H1N 1); a (H1N 2); a (H2N 2) and a (H3N 2). All known influenza a virus subtypes have been isolated from birds and can affect a range of mammalian species. As with humans, the number of influenza a subtypes isolated from other mammalian species is limited. Almost all influenza a pandemics were caused by offspring of 1918 virus, including the "drifting" H1N1 virus and the reassortant H2N2 and H3N2 viruses. Influenza a viruses contain HA and NA proteins on their viral envelope surface. HA allows the virus to recognize and bind to target cells and infect cells with viral RNA. NA is critical for the release of subviral particles that are subsequently produced within the infected cells so that they can be transmitted to other cells.

Influenza b virus almost exclusively infects humans. Influenza b viruses are not classified into subtypes, but can be subdivided into lineages. The currently prevalent influenza B viruses belong to the B/Yamagata (B/Yamagata/16/88-like) or B/Victoria (B/Victoria/2/87-like) lineages. The mutation rate of influenza b virus is 2 to 3 times slower than that of influenza a virus; however, it has a significant effect on children and young adults every year. The influenza B virus capsid has an envelope, and its virion consists of an envelope, a matrix protein, a nucleoprotein complex, a nucleocapsid, and a polymerase complex. It may be spherical or filiform. About 500 of its surface projections consist of HA and NA. The influenza b virus genome is 14,548 nucleotides long and consists of eight segments of linear negative single stranded RNA. The multipart genome is encapsulated, each segment in a separate nucleocapsid surrounded by an envelope.

The mRNA vaccines of the present invention comprise mRNA encoding HA and optionally NA antigens of influenza viruses that are prevalent when the vaccine is designed. An exemplary vaccine of the invention comprises mRNA encoding HA antigens and optionally NA antigens of the H1N1 virus and H3N2 virus that are prevalent. The vaccine of the invention may comprise a combination of mRNA encoding HA antigen of each influenza a subtype of epidemic or each major influenza a subtype and mRNA encoding HA antigen of each influenza b lineage of epidemic (or each major influenza lineage). In exemplary embodiments, the vaccine further comprises mRNA encoding an NA antigen corresponding to the selected HA antigen. The major viruses, or the viruses that predominate in circulation, are viruses that are detected in the population at a frequency of endemic or above a certain threshold as understood by those skilled in the art, which is necessary to demonstrate the prevalence of these strains in the population (e.g., in a population representing the northern hemisphere or the southern hemisphere).

The mRNA vaccine of the present invention is suitable for inclusion of a variety of mrnas, and thus may comprise mrnas encoding HA antigens, e.g., the most prevalent a/H1N1 strain, a/H3N2 strain, B/Victoria lineage and B/Yamagata lineage, and optionally the corresponding NA antigens, but may also include mrnas encoding HA antigens, e.g., the second most prevalent a/H1N1 strain, a/H3N2 strain, B/Victoria lineage and/or B/Yamagata lineage, and optionally the corresponding NA antigens. In exemplary embodiments, the mRNA vaccines of the present invention comprise mRNA encoding HA antigen of influenza a strain of subtype a (H1N 1), mRNA encoding HA antigen of influenza a strain of subtype a (H3N 2), mRNA encoding HA antigen of influenza B strain of B/Victoria lineage, and mRNA encoding HA antigen of influenza B strain of B/Yamagata lineage.

In some embodiments, the antigen is an influenza antigen. The influenza antigen is Hemagglutinin (HA) or Neuraminidase (NA). In some embodiments, the influenza antigen is a fragment, derivative or modification of HA or NA. For example, in some embodiments, the NA is a wild-type NA (e.g., has enzymatic activity). In some embodiments, the NA is a modified NA, such as an enzymatically inactive NA. As used herein, "enzymatically inactive NA" refers to NA that has been mutated such that it has no or minimal catalytic activity (see, e.g., richard et al, J Clin Virol. 2008,41 (1): 20-24; yen et al, J Virol. 2006,80 (17): 8787-8795). For example, in some embodiments, the non-enzymatically active NA has an activity of less than 30%, 25%, 20%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or 0% of the catalytic activity of the wild-type NA (e.g., in an enzymatic activity assay, as known in the art). In some embodiments, at least one of Arg118, asp151, arg152, arg224, glu276, arg292, arg371, and Tyr406 is mutated. In some embodiments, 1, 2, 3, 4, 5, 6, 7, or all 8 amino acids are mutated. In some embodiments, the mutation is R118K, D151G, E227D.

In some embodiments, the mRNA vaccines of the present disclosure can comprise a combination of mrnas encoding HA, optionally with mrnas encoding NA antigens or fragments, derivatives, or modified versions thereof. In some embodiments, the mRNA vaccine may comprise a combination of mRNA encoding HA and mRNA encoding NA antigen or a fragment, derivative, or modified version thereof. In some embodiments, the vaccine comprises mRNA encoding 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 HA antigens and/or mRNA encoding 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 NA antigens or any combination thereof (e.g., 4 HA antigens, or 4 HA antigens and 4 NA antigens). In some embodiments, the vaccine comprises mRNA encoding one HA antigen. In some embodiments, the vaccine comprises mRNA encoding two HA antigens. In some embodiments, the vaccine comprises mRNA encoding three HA antigens. In some embodiments, the vaccine comprises mRNA encoding the four HA antigens. In some embodiments, the vaccine comprises mRNA encoding five HA antigens. In some embodiments, the vaccine comprises mRNA encoding six HA antigens. In some embodiments, the vaccine comprises mRNA encoding one HA antigen and mRNA encoding one NA antigen. In some embodiments, the vaccine comprises mRNA encoding two HA antigens and mRNA encoding two NA antigens. In some embodiments, the vaccine comprises mRNA encoding the three HA antigens and mRNA encoding the three NA antigens. In some embodiments, the vaccine comprises mRNA encoding the four HA antigens and mRNA encoding the four NA antigens. In some embodiments, the vaccine comprises mRNA encoding five HA antigens and mRNA encoding five NA antigens. In some embodiments, the vaccine comprises mRNA encoding six HA antigens and mRNA encoding six NA antigens.

By virtue of the multiple mRNA versions, the vaccine of the invention can encode HA antigens representing epidemic strains/lineages of multiple different influenza clades and sub-clades, and optionally corresponding NA antigens, resulting in a vaccine that is more effective against the upcoming or upcoming influenza season.

Coronaviridae family

Coronaviridae include enveloped positive-strand RNA viruses that infect mammals, amphibians, and birds. The subfamily of coronaviridae, including RNA viruses that cause diseases in mammals and birds, can cause respiratory tract infections ranging from common cold to more fatal diseases (e.g., SARS, MERS, COVID-19). In some embodiments, the respiratory virus antigenic polypeptide is from the genus coronavirus, e.g.: MERS-CoV, SARS-CoV (S ARS-CoV-1), SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL 63, HCoV-NL, HCoV-NH or HCoV-HKU1.

The genome of Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is single-stranded sense RNA (+ssRNA) of 29.8-30kb in size encoding about 9860 amino acids (Chan et al 2000, supra; kim et al 2020cell, 14 days 5 months; 181 (4): 914-921.e10.). SARS-CoV-2 is a polycistronic mRNA with a 5 'cap and a 3' poly A tail. The SARS-CoV-2 genome is organized into specific genes encoding structural and non-structural proteins (NSps). The sequence of structural proteins in the genome is 5 '-replicase (open reading frame (ORF) 1/ab) -structural protein [ spike (S) -envelope (E) -membrane (M) -nucleocapsid (N) ] -3'. The genome of coronaviruses includes a variable number of open reading frames that encode helper proteins, non-structural proteins and structural proteins (Song et al 2019viruses;11 (1): p.59). Most antigenic peptides are located in structural proteins (Cui et al 2019Nat. Rev. Microbiol.;17 (3): 181-192). Spike surface glycoprotein (S), small envelope protein (E), matrix protein (M) and nucleocapsid protein (N) are four major structural proteins. Since the S protein contributes to cell tropism and viral entry, and is also capable of inducing neutralizing antibodies (NAb) and protective immunity, it can be considered one of the most important targets in all other structural proteins in coronavirus vaccine development.

As used herein, the term "spike protein" refers to a glycoprotein that forms homotrimers protruding from the envelope (viral surface) of viruses, including coronaviruses. Trimerized spike proteins facilitate the entry of virions into host cells by binding to receptors on the surface of the host cell, followed by fusion of the virus with the host cell membrane. The S protein is a highly glycosylated large type I transmembrane fusion protein consisting of 1,160 to 1,400 amino acids, depending on the virus type. The coronavirus spike protein comprises about 1100 to 1500 amino acids.

The mRNA of the invention is designed to produce SARS-CoV-2 spike protein (i.e., encodes spike protein such that the spike protein is expressed when the mRNA is delivered to a cell or tissue (e.g., a cell or tissue in a subject), as well as antigenic variants thereof that have altered structure. The skilled artisan will appreciate that while a substantially full length or complete spike protein is necessary for a virus (e.g., coronavirus) to perform its intended function of facilitating entry of the virus into a host cell, a certain number of variations in spike protein structure and/or sequence are tolerable when primarily seeking to elicit an immune response against the spike protein. For example, minor truncations, e.g., one to several, possibly up to 5 or up to 10 amino acids, from the N-or C-terminus of the encoded spike protein (e.g., encoded spike protein antigen) may be tolerated without altering the antigenic properties of the protein. Also, variations (e.g., conservative substitutions) of one to several, possibly up to 5 or up to 10 amino acids (or more), of the encoded spike protein (e.g., encoded spike protein antigen) can be tolerated without altering the antigenic properties of the protein. In some embodiments, the spike protein is not a stable spike protein, e.g., the spike protein is stabilized by two proline substitutions (2P mutations).

In some embodiments, the spike protein is from a different strain of virus. A strain is a genetic variant of a microorganism (e.g., a virus). When two or more viruses infect the same cell in nature, e.g., by antigenic drift or transformation, new strains can be produced due to mutation or exchange of genetic components.

Antigenic drift is a genetic variation of a virus caused by the accumulation of mutations in the viral genes encoding viral surface proteins recognized by host antibodies. This results in the generation of a new strain of viral particles that is not effectively inhibited by antibodies that prevent infection by the previous strain. This makes it easier for the altered virus to spread in partially immunized populations.

Antigenic shift is the process by which two or more different strains of a virus, or strains of two or more different viruses, combine to form a new subtype with a mixture of surface antigens of the two or more original strains. This term is often specific to influenza, as this is the most well known example, but this process is known to occur on other viruses as well. Antigenic shift is a special case of reassortment or viral shift that results in a phenotypic change. Antigenic shift is in contrast to antigenic drift, which is a natural mutation of a known viral strain over time that may lead to loss of immunity or vaccine mismatch. Antigenic shift is often associated with a significant reorganization of viral surface antigens, resulting in a reconfiguration that greatly alters the phenotype of the virus.

A strain as used herein is a genetic variant of a virus characterized by mutations in one or more surface proteins or other proteins of the virus. For example, in the case of SARS-CoV-2, the amino acid sequences in the SARS-CoV-2 spike protein differ, wherein the immune response of an individual to a new strain is less effective than the immune response of a strain used to immunize or first infect an individual. Due to the persistent immune response in immunized or previously infected individuals, new strains of virus may be generated due to natural mutations or a combination of natural mutations and immune selection. The novel strains differ in that there is one, two, three or more amino acid mutations in the region of the spike protein responsible for viral function, such as receptor binding or fusion of the virus with the target cell. Spike proteins from new strains may differ from the parent strain by up to 80%, 85%, 90%, 95%, 98%, 99% at the amino acid level.

A natural viral strain is a variant of a given virus that can be recognized by having some "unique phenotypic characteristics" (e.g., stable and heritable biological, serological, and/or molecular characteristics) that remain stable under natural conditions. Such "unique phenotypic characteristics" refer to biological characteristics that differ from the reference virus compared, such as unique antigenic characteristics, host range (e.g., infection of different types of hosts), disease symptoms caused by the strain, different types of disease caused by the strain (e.g., spread by different means), and the like. The "unique phenotypic characteristic" may be detected clinically (e.g., in a clinical manifestation detected in a host infected with the strain), or in a comparative animal experiment in which a person skilled in virology may distinguish between animals infected with a reference control virus and animals infected with a so-called new strain without knowing which animal is infected with which virus, nor any information about the differences between the two viruses. Importantly, if there is no unique virus phenotype that is identifiable, a virus variant with simple genomic sequence differences is not a single strain. The degree of genomic sequence variation is irrelevant to the classification of variants as bacterial strains, as sometimes a few mutations produce different phenotypes.

For example, in some embodiments, the mRNA encodes an antigen from at least one strain variant or comprises a mutation from at least one non-wild-type SARS-CoV-2 strain. In some embodiments, the vaccine comprises an mRNA encoding a spike protein associated with a b.1.1.7 lineage (UK) variant (20B/501Y.V1 VOC 202012/01). B.1.1.7 lineage variants have a mutation in the Receptor Binding Domain (RBD) of spike protein at position 501 wherein the amino acid asparagine (N) has been replaced with tyrosine (Y); i.e., the N501Y mutation. Furthermore, the variant has a 69/70 deletion, which occurs spontaneously multiple times, resulting in conformational changes in the spike protein; P681H mutation near S1/S2 furin cleavage site; and mutations in ORF8, producing the ORF8 stop codon (Q27 stop). The v2 (South Africa, SA) variant comprises multiple mutations in the spike protein, including N501Y and E484K, but no deletion at 69/70. The E484K mutation is considered to be an "escape" mutation relative to at least one form of anti-SARS-CoV-2 monoclonal antibody, and thus it may alter the antigenicity of the virus. Other mutations that have been found include the D614G mutation (believed to increase viral transmission rate) and the N543Y mutation (found in mink farms in the netherlands and denmark). In some embodiments, the spike protein comprises mutations from more than one variant (e.g., a combination of mutations found in the b.1.1.7 and 502y.v2 variants) and is a structurally altered variant with multiple mutations.

The S protein of coronaviruses can be divided into two important functional subunits, including the N-terminal S1 subunit, which forms the globular head of the S protein; and the C-terminal S2 region, which forms the stem of the protein, is directly embedded in the viral envelope. Upon interaction with a potential host cell, the S1 subunit will recognize and bind to receptors on the host cell, in particular the angiotensin converting enzyme 2 (ACE 2) receptor, whereas the S2 subunit is the most conserved component of the S protein and will be responsible for fusing the envelope of the virus with the host cell membrane. (see, e.g., shang et al, PLoS Pathog.2020Mar;16 (3): e 1008392.). Each monomer of the trimeric S protein trimer contains two subunits S1 and S2, which mediate attachment and membrane fusion, respectively. As part of the in vivo infection process, the two subunits are separated from each other by an enzymatic cleavage process. The S protein is first cleaved by furin-mediated cleavage at the S1/S2 site of the infected cell, and in vivo, the subsequent serine protease-mediated cleavage event occurs at the S2' site within S1. In SARS-CoV2, the S1/S2 cleavage site is located at amino acids 676-TQTNSPRRAR/SVA-688 (see SEQ ID NO: 49). The S2' cleavage site is located at amino acids 811-KPSKR/SFI-818 (cf. SEQ ID NO: 50).

As used herein, for example, in the context of designing a SARS-CoV-2S protein antigen encoded by a nucleic acid (e.g., mRNA) of the present invention, the term "S1 subunit" (e.g., S1 subunit antigen) refers to the N-terminal subunit of the spike protein starting at the N-terminus of the S protein and ending at the S1/S2 cleavage site, while the term "S2 subunit" (e.g., S2 subunit antigen) refers to the C-terminal subunit of the spike protein starting at the S1/S2 cleavage site of the spike protein and ending at the C-terminus. As described above, the skilled artisan will appreciate that while substantially full length or intact spike protein S1 or S2 subunits, respectively, may be necessary for receptor binding or membrane fusion, a number of variations in the S1 or S2 structure and/or sequence are tolerable when primarily seeking to elicit an immune response against spike protein subunits. For example, minor truncations, e.g., one to several, possibly up to 4, 5, 6, 7, 8, 9 or 10 amino acids, from the N-terminus or C-terminus of the encoded subunit (e.g., encoded S1 or S2 protein antigen) may be tolerated without altering the antigenic properties of the protein. Also, variations (e.g., conservative substitutions) of one to several, possibly up to 4, 5, 6, 7, 8, 9, or 10 amino acids (or more) of the encoded spike protein subunit (e.g., encoded S1 or S2 protein antigen) can be tolerated without altering the antigenic properties of the protein.

The S1 and S2 subunits of SARS-CoV-2 spike protein also include domains that are readily distinguishable by structure and function, which in turn can be used to design antigens encoded by nucleic acid vaccines, particularly mRNA vaccines of the present invention. Within the S1 subunit, the domain includes an N-terminal domain (NTD) and a Receptor Binding Domain (RBD), which also includes a Receptor Binding Motif (RBM). Within the S2 subunit, the domains include Fusion Peptide (FP), heptad repeat 1 (HR 1), heptad repeat 2 (HR 2), transmembrane domain (TM) and cytoplasmic domain (also known as Cytoplasmic Tail (CT)) (Lu R. Et al, supra; wan et al J.Virol.2020, 3 months, 94 (7) e 00127-20). The HR1 and HR2 domains may be referred to as the "fusion core region" of SARS-CoV-2 (Xia et al 2020Cell Mol Immunol. January; 17 (1): 1-12.). The S1 subunit includes an N-terminal domain (NTD), a linker region, a Receptor Binding Domain (RBD), a first subdomain (SD 1), and a second subdomain (SD 2). The S2 subunit includes, among other things, a first heptad repeat (HR 1), a second heptad repeat (HR 2), a transmembrane domain (TM), and a cytoplasmic tail. NTD and RBD of S1 are good antigens for the vaccine design method of the invention, as these domains have been demonstrated to be targets for neutralizing antibodies in individuals infected with coronavirus b.

The compositions provided herein comprise mRNA that may encode any one or more full-length or partial (truncated or other sequence deleted) S protein subunits (e.g., S1 or S2 subunits), one or more domains or combinations of domains of S protein subunits (e.g., NTD, RBD, or NTD-RBD fusions, with or without SD1 and/or SD 2), or chimeras of full-length or partial and S2 protein subunits. Other S protein subunit and/or domain configurations are contemplated herein. Exemplary SARS-CoV-2mRNA vaccines are provided in PCT/US2021/015145 and PCT/US2021/016979, each of which is incorporated herein by reference in its entirety.

The genome of SARS-CoV (e.g., SARS-CoV-1) also includes a single positive-stranded RNA of about 29,700 nucleotides in length. The whole genome organization of SARS-CoV is similar to that of other coronaviruses. The reference genome comprises 13 genes, which encode at least 14 proteins. Two large Overlapping Reading Frames (ORFs) covered 71% of the genome. The remainder has 12 potential ORFs, including genes for structural proteins S (spike), E (small envelope), M (membrane) and N (nucleocapsid). Other potential ORFs encode unique putative SARS-CoV specific polypeptides that lack significant sequence similarity to known proteins. Detailed analysis of the SARS-CoV genome is described in J Mol Biol 2003; 331:991-1004.

In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding a SARS-CoV S protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding the S1 subunit of the SARS-CoV S protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding the S2 subunit of the SARS-CoV S protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding a SARS-CoV E protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding a SARS-CoV N protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding a SARS-CoV M protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding at least one of the following SARS-CoV proteins: s protein (S, S and/or S2), E protein, N protein and M protein.

MERS-CoV is a plus-sense single stranded RNA virus of the genus coronavirus. The genome is phylogenetically divided into two clades, clade a and clade B. The genome of MERS-CoV encodes at least four unique accessory proteins, such as 3, 4a, 4b, and 5; two replicase proteins (open reading frames 1a and 1 b); and four major structural proteins, including spike (S), envelope (E), nucleocapsid (N) and membrane (M) proteins (Almazan F et al MBio2013;4 (5): E00650-13). The S protein is particularly important in mediating viral binding to cells expressing the receptor dipeptidyl peptidase 4 (DPP 4) via the Receptor Binding Domain (RBD) in the S1 subunit, whereas the S2 subunit subsequently mediates viral entry via fusion of the virus to the target cell membrane (Li F.J Virol 2015;89 (4): 1954-64; raj VS et al Nature 2013;495 (7440): 251-4).

In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding MERS-CoV S protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding the S1 subunit of MERS-CoV S protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding the S2 subunit of MERS-CoV S protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding MERS-CoV E protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding MERS-CoV N protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding MERS-CoV M protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding at least one of the following MERS-CoV proteins: s protein (S, S and/or S2), E protein, N protein and M protein.

Human coronavirus OC43 is an enveloped plus-sense single stranded RNA virus belonging to the species coronavirus 1 (genus B, subfamily coronaviridae, family coronaviridae, order Nelumoviridae). Four HCoV-OC43 genotypes (A through D) have been identified, with genotype D most likely produced recombinantly. Along with HCoV-229E (a species in the genus coronavirus A), HCoV-OC43 is also a known virus that causes the common cold. Both viruses can cause severe lower respiratory tract infections, including pneumonia in infants, the elderly, and immunocompromised individuals (such as those undergoing chemotherapy and those with HIV-AIDS). In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HCoV-OC43 protein.

Human coronavirus HKU1 (HCoV-HKU 1) is a positive-sense single-stranded RNA virus having HE gene, which is classified into group 2 or B coronaviruses. The genomic organization is identical to that of other group II coronaviruses, and the characteristic gene sequences are 1a, 1b, HE, S, E, M and N. Furthermore, there is an auxiliary protein gene (ORF 4) between S and E and an auxiliary protein gene (ORF 8) at the position of the N gene. The TRS may be located within the AAUCUAAAC sequence, which precedes each ORF except for E. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HKU1 HE protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HKU 1S protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HKU 1E protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HKU 1M protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HKU 1N protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding at least one of the following HKU1 proteins: HE protein, S protein, E protein, N protein and M protein.

In some embodiments, the coronavirus B is human coronavirus NL63 (HCoV-NL 63 or HCoV-NL). Human Neuroblack coronavirus (Human New Haven coronavirus, HCoV-NH) is a strain of human coronavirus NL 63. Genes predictably encoding S, E, M and N proteins are found in the 3' part of the HCoV-NL63 genome. In some embodiments, the vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an NL 63S protein. In some embodiments, the vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an NL 63S protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an H NL63 KU 1E protein. In some embodiments, the vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an NL 63M protein. In some embodiments, the vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an NL 63N protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding at least one of the following NL63 proteins: s protein, E protein, N protein and M protein.

Human coronavirus 229E (HCoV-229E) is a single stranded positive sense RNA virus species of the genus coronavirus of the subfamily A of the family Coronaviridae of the order nidae. Together with human coronavirus OC43, it causes the common cold to occur. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HCoV-229E antigenic protein.

It will be appreciated by those skilled in the art that the virus classification evolves as additional viruses are identified and sequenced. Although specific examples of respiratory viruses involved in human diseases are described and illustrated herein, the mRNA vaccines of the present invention may include other human respiratory viruses, such as viruses in these families or related human respiratory viruses not specifically described. To the extent that viruses are explicitly identified herein as belonging to a particular family or subfamily, such viruses are explicitly indicated as belonging to such family/subfamily even if they are later reclassified or otherwise or non-consistently identified in other publications or sources. It will be understood that viruses are considered to be within the scope of the viridae, subfamily or genus of these terms as defined and used herein if they were classified in the past, present or future under one of the families, subfamilies or genera described or claimed herein.

Embodiments of the present disclosure provide combination vaccines (e.g., combination mRNA vaccines). The "combination vaccine" of the present disclosure refers to a vaccine comprising at least 2 polynucleotides, each polynucleotide comprising an open reading frame encoding at least one respiratory viral antigenic polypeptide, wherein at least one polynucleotide encoding an influenza antigen and at least one polynucleotide encoding a coronavirus antigen are present. In another embodiment, the antigenic polypeptide is derived from a viral surface receptor binding glycoprotein or protein of the contained virus, as these result in induction of an optimally neutralizing antibody response. In some embodiments, the combination vaccine comprises 2-15 mRNA polynucleotides, for example 2-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 3-11, 3-12, 3-13, 3-14, 3-15, 4-5, 4-6, 4-7, 4-8, 4-9, 4-10, 4-11, 4-12, 4-13, 4-14, 4-15, 5-6, 5-7, 5-8, 5-9, 5-10, 5-11, 5-12, 5-13, 5-14, 5-15, 6-7, 6-8, 4-10, 5-13, 5-7 6-9, 6-10, 6-11, 6-12, 6-13, 6-14, 6-15, 7-8, 7-9, 7-10, 7-11, 7-12, 7-13, 7-14, 7-15, 8-9, 8-10, 8-11, 8-12, 8-13, 8-14, 8-15, 9-10, 9-11, 9-12, 9-13, 9-14, 9-15, 10-11, 10-12, 10-13, 10-14, 10-15, 11-12, 10-13, 8-12, 11-13, 11-14, 11-15, 12-13, 12-14, 12-15, 13-14, 13-15, or 14-15 mRNA polynucleotides. In some embodiments, the combination vaccine comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mRNA polynucleotides. In particular embodiments, all RNAs encode viral surface proteins, such as glycoproteins, that are involved in receptor binding to facilitate viral entry into a host cell.

In some embodiments, the vaccine comprises at least two mRNA polynucleotides encoding influenza virus antigenic polypeptides. In some embodiments, the vaccine comprises at least three mRNA polynucleotides encoding influenza virus antigenic polypeptides. In some embodiments, the vaccine comprises at least four mRNA polynucleotides encoding influenza virus antigenic polypeptides. In some embodiments, the vaccine comprises at least 5, 6, 7, 8, 9, 10, 11, or 12 mRNA polynucleotides encoding influenza virus antigenic polypeptides.

In some embodiments, the vaccine comprises at least two mRNA polynucleotides encoding coronavirus antigenic polypeptides. In some embodiments, the vaccine comprises at least 2, 3, 4, 5, or 6 mRNA polynucleotides encoding coronavirus antigenic polypeptides.

In some embodiments, the mRNA encoding the influenza antigen is present in the formulation in an equivalent amount (e.g., 1:1 ratio), e.g., the mRNA encoding the different HA antigens is present in a 1:1 ratio, or the mRNA encoding the different HA and NA antigens is present in a 1:1 ratio. In an exemplary vaccine comprising mRNA encoding four different HA antigens, a "1:1 ratio" of mRNA would include 1:1:1:1 ratios of mRNA of the first, second, third, and fourth mrnas. In an exemplary vaccine comprising mRNA encoding four different HA antigens and four different NA antigens, a "1:1 ratio" of mRNA would include mRNA encoding the different HA antigens for the first, second, third, and fourth mRNA at a 1:1:1:1 ratio, and mRNA encoding the different NA antigens for the first, second, third, and fourth mRNA at a 1:1:1 ratio.

In some embodiments, the ratios of the mrnas encoding different HA antigens are identical to each other (e.g., 1:1:1:1), and the ratios of the mrnas encoding different NA antigens are identical to each other (e.g., 1:1:1:1); however, the ratio of mRNA encoding the HA antigen to mRNA encoding the NA antigen is not 1:1. In an exemplary vaccine comprising mRNA encoding four different HA antigens and four different NA antigens, a "3:1 ratio" of mRNA would include mRNA encoding the different HA antigens for the first, second, third, and fourth mRNA in a 3:3:3:3 ratio, and mRNA encoding the different NA antigens for the first, second, third, and fourth mRNA in a 1:1:1 ratio. In some embodiments, the HA to NA ratio is 1:1, 1:2, 1:3, 1:4, 2:1, 3:1, or 4:1.

In some embodiments, the first and second mRNA polynucleotides are present in the combination vaccine in a ratio of 1:1 (e.g., influenza mRNA polynucleotide: coronavirus mRNA polynucleotide). In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from a first virus (e.g., influenza) to a second virus in a ratio of 4:1. In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from a first virus (e.g., influenza) to a second virus (e.g., coronavirus) in a ratio of 3:1. In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from a first virus (e.g., influenza) to a second virus (e.g., coronavirus) in a ratio of 2:1. In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from a first virus (e.g., influenza) to a second virus (e.g., coronavirus) in a ratio of 5:1. In some embodiments, the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from a first virus (e.g., influenza) to a second virus (e.g., coronavirus) in a ratio of 1:2. In some embodiments, the combination vaccine (e.g., multivalent RNA composition) comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from a first virus to a second virus (e.g., coronavirus) in a ratio of 4:1, 4:2, 4:3, 1:4, 2:4, or 3:4.

In some embodiments, each of the mRNA polynucleotides in the combination vaccine is complementary to, i.e., does not interfere with, each other mRNA polynucleotide in the combination vaccine. That is, the administration of the antigen produced by the combination vaccine does not significantly interfere with the immune response to any other antigen produced by the vaccine, thereby impairing the ability of the antigen to elicit a protective immune response in the subject. In some embodiments, the combination vaccine is additional to the neutralizing antibodies to each individual antigen in the vaccine. As shown in fig. 1-11, administration of a combination vaccine comprising mRNA polynucleotides encoding influenza antigen and SARS-CoV-2 antigen did not inhibit or reduce the neutralizing antibody titer of each corresponding antigen compared to administration of mRNA encoding each single antigen alone, relative to administration of mRNA encoding each single antigen separately.

In each embodiment or aspect of the invention, it is understood that the feature vaccine comprises mRNA encapsulated within the LNP. While each unique mRNA can be packaged in its own LNP, mRNA vaccine technology has the significant technical advantage of being able to package multiple mrnas in a single LNP product.

Nucleic acid

The compositions of the present disclosure comprise (at least one) messenger RNA (mRNA) having an Open Reading Frame (ORF) encoding an influenza virus antigen and a coronavirus antigen. In some embodiments, the mRNA further comprises a 5' utr, a 3' utr, a poly (a) tail, and/or a 5' cap analog.

In some embodiments, the first, second, and/or third mRNA polynucleotides in the composition differ from each other by at least 100 nucleotides in length (e.g., 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or more nucleotides).

It should also be understood that the respiratory viral vaccines of the present disclosure may comprise any 5 'untranslated region (UTR) and/or any 3' UTR. Exemplary UTR sequences include SEQ ID NOS 29-32; however, other UTR sequences may be used or any UTR sequence described herein may be replaced with other UTR sequences. In some embodiments, the 5' UTR of the present disclosure comprises a sequence selected from the group consisting of SEQ ID NO:29 (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUA UAAGAGCCACC) and SEQ ID NO:30 (GGGAAAUAAGAGAGAAAA GAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC). In some embodiments, the 3' UTR of the present disclosure comprises a sequence selected from the group consisting of SEQ ID NO:31 (UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCC UUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUAC CCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) and SEQ ID NO:32 (UGAUAAUAGGCUGGAGCCUCGGUGGCCUAGCUUCUU GCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACC CGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC). UTR may also be omitted from the RNA polynucleotides provided herein.

Nucleic acids comprise polymers of nucleotides (nucleotide monomers). Thus, a nucleic acid is also referred to as a polynucleotide. The nucleic acid may be or may include, for example, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), threose Nucleic Acid (TNA), glycol Nucleic Acid (GNA), peptide Nucleic Acid (PNA), locked nucleic acid (LNA, including LNA having a β -D-ribose configuration, a-LNA having an a-L-ribose configuration (diastereomer of LNA), 2 '-amino-LNA having 2' -amino functionalization, and 2 '-amino-a-LNA having 2' -amino functionalization), ethylene Nucleic Acid (ENA), cyclohexenyl nucleic acid (CeNA), and/or chimeras and/or combinations thereof.

Messenger RNA (mRNA) is any RNA that encodes a (at least one) protein (naturally occurring, non-naturally occurring or modified amino acid polymer) and can be translated to produce the encoded protein in vitro, in vivo, in situ, or ex vivo. The skilled artisan will appreciate that unless otherwise indicated, the nucleic acid sequences set forth in this application may refer to "T" in a representative DNA sequence, but when the sequence represents mRNA, "T" will be replaced with "U". Thus, any DNA disclosed and identified herein by a particular sequence identifier also discloses a corresponding mRNA sequence complementary to that DNA, wherein each "T" of the DNA sequence is substituted with a "U".

An Open Reading Frame (ORF) is a continuous DNA or RNA segment that begins with an initiation codon (e.g., methionine (ATG or AUG)) and ends with a termination codon (e.g., TAA, TAG or TGA, or UAA, UAG or UGA). The ORF generally encodes a protein. It is to be understood that the sequences disclosed herein may also comprise additional elements, such as 5'utr and 3' utr, but those elements, unlike ORFs, are not necessarily present in the RNA polynucleotides of the present disclosure.

Variants

In some embodiments, the compositions of the present disclosure comprise RNA encoding respiratory viral antigens and variants representing structural alterations of multiple viral antigens. An antigenic variant or structurally altered variant refers to a molecule whose amino acid sequence differs from the wild-type (naturally occurring), native or reference protein sequence. Variants with altered antigen/structure may have substitutions, deletions and/or insertions at certain positions within the amino acid sequence compared to the native or reference sequence. Typically, the variant has at least 50% identity to a wild-type, natural or reference sequence. In some embodiments, the variant has at least 80% or at least 90% identity to a wild-type, native or reference sequence.

Variant antigens/polypeptides encoded by the nucleic acids of the present disclosure may contain amino acid changes that confer any of a number of desirable properties, e.g., enhance their immunogenicity, alter their breadth of immunogenicity (i.e., relative to the breadth of immune responses produced), enhance their expression, and/or improve their stability or PK/PD properties in a subject. Variant antigens/polypeptides may be prepared using conventional mutagenesis techniques and assayed as appropriate to determine if they have the desired properties. Assays for determining expression levels and immunogenicity are well known in the art, and exemplary such assays are set forth in the examples section. Similarly, PK/PD characteristics of protein variants may be measured using art-recognized techniques, for example, by determining expression of antigen over time in a vaccinated subject and/or by observing the persistence of an induced immune response. The stability of the protein encoded by the variant nucleic acid may be measured by determining the thermostability or stability upon urea denaturation, or may be measured using computer prediction. Methods for such experiments and computer assays are known in the art.

In some embodiments, the composition comprises an RNA or RNA ORF comprising a nucleotide sequence of any one of the sequences provided herein, or comprising a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to a nucleotide sequence of a wild-type (naturally occurring) or variant antigen.

The term "identity" refers to a relationship between sequences of two or more polypeptides (e.g., antigens) or polynucleotides (nucleic acids), as determined by comparing the sequences. Identity also refers to the degree of sequence relatedness between sequences, as determined by the number of matches between strings of two or more amino acid residues or nucleic acid residues. The identity measures the percentage of identity matches between smaller sequences in two or more sequences with gap alignments (if any) that are processed by a particular mathematical model or computer program (e.g., an "algorithm"). Identity of the relevant antigen or nucleic acid can be readily calculated by known methods. When applied to a polypeptide or polynucleotide sequence, "percent (%) identity" is defined as the percentage of residues (amino acid residues or nucleic acid residues) in a candidate amino acid or nucleic acid sequence that are identical to residues in the amino acid sequence or nucleic acid sequence of the second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Methods and computer programs for alignment are well known in the art. It will be appreciated that identity depends on the calculation of percent identity, but the values may be different due to gaps and penalties introduced in the calculation. Typically, variants of a particular polynucleotide or polypeptide (e.g., antigen) have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to the particular reference polynucleotide or polypeptide as determined by sequence alignment procedures and parameters described herein and known to those of skill in the art. Such tools for alignment include those of the BLAST suite (Stephen F. Altschul et al (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", nucleic Acids Res.25: 3389-3402). Another popular local alignment technique is based on the Smith-Waterman algorithm (Smith, T.F. and Waterman, M.S. (1981) "-Identification of common molecular subsequences." J.mol. Biol. 147:195-197). A common global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, S.B. & Wunsch, C.D. (1970) "A general method applicable to the search for similarities in the amino acid sequences of two proteins." J.mol. Biol. 48:443-453). Recently, a Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed that purportedly produces global alignments of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm.

Thus, polynucleotides encoding proteins or glycoproteins containing substitutions, insertions and/or additions, deletions and covalent modifications relative to a reference sequence (particularly a polypeptide (e.g., antigen) sequence disclosed herein) are included within the scope of the present disclosure. For example, a sequence tag or amino acid, such as one or more lysines, may be added to the peptide sequence (e.g., at the N-terminus or C-terminus). Sequence tags may be used for peptide detection, purification or localization. Lysine can be used to increase peptide solubility or allow biotinylation. Alternatively, amino acid residues located in the carboxy and amino terminal regions of the amino acid sequence of the peptide or protein may optionally be deleted to provide a truncated sequence. Depending on the use of the sequence, for example, certain amino acids (e.g., C-terminal or N-terminal residues) may alternatively be deleted when the sequence is expressed as part of a larger sequence that is soluble or attached to a solid support. In some embodiments, sequences for (or encoding) signal sequences, termination sequences, transmembrane domains, linkers, multimerization domains (e.g., like folding regions), etc., can be substituted with alternative sequences that perform the same or similar functions. In some embodiments, cavities in the protein core may be filled to improve stability, for example by introducing larger amino acids. In other embodiments, the buried hydrogen bond network may be replaced with hydrophobic residues to improve stability. In yet other embodiments, the glycosylation site can be removed and replaced with an appropriate residue. Such sequences are readily identifiable to those skilled in the art. It is also to be understood that some of the sequences provided herein contain sequence tags or terminal peptide sequences (e.g., at the N-terminus or C-terminus) that may be deleted, for example, prior to use in preparing an mRNA vaccine.

As will be appreciated by those skilled in the art, protein fragments, functional protein domains and homologous proteins are also considered to be within the scope of the respiratory viral antigen of interest. For example, provided herein are any protein fragments of a reference protein (meaning polypeptide sequences that are at least one amino acid residue shorter than the reference antigen sequence but otherwise identical), provided that the fragments are immunogenic and confer a protective immune response against respiratory viruses.

In addition to variants that are identical to the reference protein but truncated, in some embodiments, the variants that are structurally altered include antigens that have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations relative to the reference antigen. Some examples of structurally altered variants are shown in the sequences provided or referenced herein. The length of the antigen/antigenic polypeptide can range from about 4, 6 or 8 amino acids to a full-length protein.

Stabilization element

Naturally occurring eukaryotic mRNA molecules may contain stabilizing elements including, but not limited to, untranslated regions (UTRs) at their 5 'ends (5' UTRs) and/or at their 3 'ends (3' UTRs), as well as other structural features such as 5 'cap structures or 3' poly (a) tails. Both the 5'UTR and the 3' UTR are usually transcribed from genomic DNA and are elements of mature mRNA. Characteristic structural features of mature mRNA, such as the 5 'cap and 3' poly (a) tail, are typically added to transcribed (immature) mRNA during mRNA processing.

In some embodiments, the composition comprises an RNA polynucleotide having an open reading frame encoding at least one antigenic polypeptide having at least one modification, at least one 5' end cap, and the composition is formulated within a lipid nanoparticle. The 5' capping of polynucleotides can be accomplished simultaneously during an in vitro transcription reaction, according to the manufacturer's protocol, using the following chemical RNA cap analogs to generate a 5' -guanosine cap structure: 3' -O-Me-m7G (5 ') ppp (5 ') G [ ARCA cap ]; g (5 ') ppp (5') A; g (5 ') ppp (5') G; m7G (5 ') ppp (5') A; m7G (5 ') ppp (5') G (New England BioLabs, ipswick, mass.). The 5' capping of modified RNAs can be accomplished post-transcriptionally using vaccinia virus capping enzymes to create a "cap 0" structure: m7G (5 ') ppp (5') G (New England BioLabs, ipswick, mass.). Cap 1 structures can be generated using vaccinia virus capping enzymes and 2' -O methyltransferases to generate the following structures: m7G (5 ') ppp (5 ') G-2' -O-methyl. The cap 2 structure may be generated from the cap 1 structure, followed by 2' -O-methylation of the 5' -penultimate nucleotide using a 2' -O methyltransferase. The cap 3 structure may be generated from the cap 2 structure, followed by 2' -O-methylation of the 5' -penultimate nucleotide using 2' -O methyltransferase. The enzyme may be derived from recombinant sources.

The 3 'poly (A) tail is typically an adenine nucleotide segment added to the 3' end of the transcribed mRNA. In some cases, it may contain up to about 400 adenine nucleotides. In some embodiments, the length of the 3' poly (a) tail may be an essential element for stability of a single mRNA. In some embodiments, the combination vaccine (e.g., multivalent RNA composition) comprises greater than 20%, 30%, 40%, 50%, or 60% poly-a-tailed RNA.

In some embodiments, the composition comprises a stabilizing element. The stabilizing element may comprise, for example, a histone stem loop. A stem-loop binding protein (SLBP), a 32kDa protein, has been identified. It associates with the histone stem loop at the 3' end of the histone information in the nucleus and cytoplasm. Its expression level is regulated by the cell cycle; it peaks in S phase, where histone mRNA levels also rise. The proteins have been shown to be critical for efficient 3' end processing of histone pre-mRNA by U7 snRNP. SLBP continues to associate with the stem loop after processing, and then stimulates translation of mature histone mRNA into group proteins in the cytoplasm. The RNA binding domain of SLBP is conserved in both metazoans and protozoans; its binding to the histone stem loop depends on the structure of the loop. The minimal binding site comprises at least three nucleotides 5 'and two nucleotides 3' relative to the stem loop.

In some embodiments, the mRNA comprises a coding region, at least one histone stem loop, and optionally a poly (a) sequence or polyadenylation signal. The poly (A) sequence or polyadenylation signal should generally enhance the expression level of the encoded protein. In some embodiments, the encoded protein is not a histone, a reporter protein (e.g., luciferase, GFP, EGFP, β -galactosidase, EGFP) or a marker or a selectin (e.g., α -globin, galactokinase, and xanthine: guanine Phosphoribosyl Transferase (GPT)).

In some embodiments, the mRNA comprises a poly (a) sequence or a combination of a polyadenylation signal and at least one histone stem loop, although both represent alternative mechanisms in nature, acting synergistically to increase protein expression beyond that observed with either element alone. The synergistic effect of the combination of poly (a) and at least one histone stem loop is independent of the order of the elements or the length of the poly (a) sequence.

In some embodiments, the mRNA does not comprise a Histone Downstream Element (HDE). "histone downstream elements" (HDEs) include a purine-rich polynucleotide segment of about 15 to 20 nucleotides 3' to the naturally occurring stem loop, representing the binding site of U7 snRNA, which is involved in the processing of histone pre-mRNA into mature histone mRNA. In some embodiments, the nucleic acid does not comprise an intron.

The mRNA may or may not contain enhancer and/or promoter sequences, which may be modified or unmodified or may be activated or inactivated. In some embodiments, the histone stem loop is generally derived from a histone gene and includes intramolecular base pairing of two adjacent partially or fully reverse complementary sequences separated by a spacer consisting of a short sequence forming a loop of the structure. Unpaired loop regions are generally unable to base pair with any of the stem-loop elements. It is more common in RNA, a key component of many RNA secondary structures, but may also be present in single stranded DNA. The stability of the stem-loop structure generally depends on the length of the mating region, the number of mismatches or bulges, and the base composition. In some embodiments, wobble base pairing (non Watson-Crick base pairing) may result. In some embodiments, at least one histone stem loop sequence comprises 15 to 45 nucleotides in length.

In some embodiments, the mRNA has one or more AU-rich sequences removed. These sequences (sometimes referred to as AURES) are unstable sequences found in the 3' UTR. AURES can be removed from RNA vaccine. Alternatively, the AURES may remain in the RNA vaccine.

Signal peptides

In some embodiments, the composition comprises an mRNA having an ORF encoding a signal peptide fused to a respiratory viral antigen. The signal peptide comprises 15-60 amino acids from the N-terminus of the protein, which is typically required for transmembrane translocation across the secretory pathway, thus generally controlling the entry of most proteins into the secretory pathway in eukaryotes and prokaryotes. In eukaryotes, the signal peptide of a new precursor protein (preprotein) directs the ribosome to the rough Endoplasmic Reticulum (ER) membrane and initiates processing of the growing peptide chain across the membrane. ER processing produces mature proteins in which the signal peptide is typically cleaved from the precursor protein by the ER resident signal peptidase of the host cell, or they remain uncleaved and act as membrane anchors. The signal peptide may also facilitate targeting of the protein to the cell membrane.

The signal peptide may have a length of 15-60 amino acids. For example, the signal peptide may have a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 amino acids. In some embodiments, the signal peptide has a length of 20-60, 25-60, 30-60, 35-60, 40-60, 45-60, 50-60, 55-60, 15-55, 20-55, 25-55, 30-55, 35-55, 40-55, 45-55, 50-55, 15-50, 20-50, 25-50, 30-50, 35-50, 40-50, 45-50, 15-45, 20-45, 25-45, 30-45, 35-45, 40-45, 15-40, 20-40, 25-40, 30-40, 35-40, 15-35, 20-35, 25-35, 30-35, 15-30, 20-30, 25-30, 15-25, 20-25, or 15-20 amino acids.

Signal peptides from heterologous genes, which modulate expression of genes other than respiratory viral antigens in nature, are known in the art and can be tested for desired properties and then incorporated into the nucleic acids of the present disclosure.

Fusion proteins

In some embodiments, the compositions of the present disclosure comprise mRNA encoding an antigenic fusion protein. Thus, one or more encoded antigens may comprise two or more proteins (e.g., proteins and/or protein fragments) linked together. Alternatively, a protein fused to a protein antigen does not promote a strong immune response to itself, but rather to a respiratory viral antigen. In some embodiments, the antigenic fusion proteins retain the functional properties of each of the original proteins.

Bracket part

In some embodiments, an mRNA vaccine as provided herein encodes a fusion protein comprising an respiratory viral antigen linked to a scaffold moiety. In some embodiments, such scaffold moieties confer desirable properties to an antigen encoded by a nucleic acid of the disclosure. For example, scaffold proteins may improve the immunogenicity of an antigen, e.g., by altering the structure of the antigen, altering the uptake and processing of the antigen, and/or binding the antigen to a binding partner.

In some embodiments, the scaffold moiety is a protein that can self-assemble into highly symmetric, stable and structurally ordered protein nanoparticles, 10-150nm in diameter, which is a very suitable size range for optimal interaction with various cells of the immune system. In some embodiments, viral proteins or virus-like particles may be used to form stable nanoparticle structures. Examples of such viral proteins are known in the art. For example, in some embodiments, the scaffold moiety is hepatitis b surface antigen (HBsAg). HBsAg forms spherical particles with an average diameter of about 22nm, which lack nucleic acid and are therefore not infectious (Lopez-Sagaseta, J. Et al Computational and Structural Biotechnology Journal (2016) 58-68). In some embodiments, the scaffold moiety is hepatitis b core antigen (HBcAg) that self-assembles into 24-31nm diameter particles, similar to viral cores obtained from HBV infected human liver. HBcAg self-assembles into two types of nano-particles with different sizes and diameters ofAnd->Corresponding to 180 or 240 protomers. In some embodiments, the respiratory viral antigen is fused to HBsAG or HBcAG to facilitate self-assembly of nanoparticles displaying the respiratory viral antigen.

In some embodiments, a bacterial protein platform may be used. Non-limiting examples of such self-assembling proteins include ferritin, 2, 4-dihydroxypteridine (lumazine) and encapsulation proteins (encapulins).

Ferritin is a protein whose primary function is intracellular iron storage. Ferritin consists of 24 subunits, each consisting of one four alpha helix bundle, self-assembled in an octahedral symmetrical quaternary structure (Cho k.j. Et al J Mol biol 2009; 390:83-98). Several high resolution structures of ferritin have been established, confirming that H.pylori (Helicobacter pylori) ferritin consists of 24 identical protomers, whereas in animals ferritin light and heavy chains can be assembled individually or in different proportions into 24 subunit particles (Granier T. Et al J Biol Inorg chem.2003;8:105-111; lawson D. M. Et al Nature.1991; 349:541-544). Ferritin self-assembles into nanoparticles with strong thermal and chemical stability. Thus, ferritin nanoparticles are well suited for carrying and exposing antigens.

2, 4-dihydroxypteridine synthase (LS) is also well suited as a nanoparticle platform for antigen display. LS is responsible for the penultimate catalytic step of riboflavin biosynthesis and is an enzyme that is present in a variety of organisms including archaea, bacteria, fungi, plants and eubacteria (Weber S.E. Flavins and Flavopins. Methods and Protocols, series: methods in Molecular biology.2014). LS monomers are 150 amino acids long and consist of a beta sheet and tandem alpha helices flanking both sides. Many different quaternary structures of LS have been reported, illustrating their morphological diversity: from homopentamer to forming a diameter of Is of the shell of (a)Symmetrical assembly of 12 pentamers. LS cages of even more than 100 subunits have been described (Zhang X. Et al J Mol biol.2006; 362:753-770).

The encapsulated protein is a novel protein cage nanoparticle isolated from Thermotoga maritima (Thermotoga maritima) and can also be used as a platform for antigen presentation on the surface of self-assembled nanoparticles. The encapsulated protein was assembled from 60 copies of the same 31kDa monomer with a thin icosahedral t=1 symmetrical cage structure with inner and outer diameters of 20nm and 24nm, respectively (Sutter m. Et al, nat Struct Mol biol.2008, 15:939-947). Although the exact function of the encapsulated proteins in Thermotoga maritima has not been clearly understood at present, their crystal structures have recently been resolved and their functions are assumed to encapsulate the cell compartments of proteins involved in oxidative stress responses such as DyP (dye-decolorized peroxidase) and Flp (ferritin-like protein) (Rahmanpour R. Et al FEBS J.2013, 280:2097-2104).

In some embodiments, the RNA of the present disclosure encodes a respiratory viral antigen fused to a folding domain. The folding domain may be obtained, for example, from phage T4 fibrin (see, e.g., tao Y et al Structure 1997Jun 15;5 (6): 789-98).

Linker and cleavable peptide

In some embodiments, the mRNA of the present disclosure encodes more than one polypeptide, referred to herein as a fusion protein. In some embodiments, the mRNA also encodes a linker located between at least one domain or each domain of the fusion protein. The linker may be, for example, a cleavable linker or a protease sensitive linker. In some embodiments, the linker is selected from the group consisting of an F2A linker, a P2A linker, a T2A linker, an E2A linker, and combinations thereof. This family of self-cleaving peptide linkers, known as 2A peptides, has been described in the art (see, e.g., kim, J.H. et al (2011) PLoS ONE 6:e18556). In some embodiments, the linker is an F2A linker. In some embodiments, the linker is a GGGS linker. In some embodiments, the fusion protein contains three domains with intervening linkers, having the following structure: domain-linker-domain.

Cleavable linkers known in the art may be used in conjunction with the present disclosure. Exemplary such joints include: F2A linker, T2A linker, P2A linker, E2A linker (see, e.g., WO 2017127750). The skilled artisan will appreciate that other art-recognized linkers may be suitable for use with the constructs of the disclosure (e.g., encoded by the nucleic acids of the disclosure). The skilled artisan will also appreciate that other polycistronic constructs (mRNA encoding more than one antigen/polypeptide, respectively, within the same molecule) may be suitable for use as provided herein.

Sequence optimization

In some embodiments, the ORF encoding the antigens of the present disclosure are codon optimized. Codon optimization methods are known in the art. For example, ORFs of any one or more of the sequences provided herein may be codon optimized. In some embodiments, codon optimization can be used to match codon frequencies in the target organism and host organism to ensure proper folding; biasing GC content to increase mRNA stability or decrease secondary structure; minimizing tandem repeat codon or base runs that may impair gene construction or expression; customizing transcription and translation control regions; inserting or removing protein transport sequences; removal/addition of post-translational modification sites (e.g., glycosylation sites) in the encoded protein; adding, removing or shuffling protein domains; inserting or deleting restriction sites; modifying the ribosome binding site and the mRNA degradation site; adjusting the rate of translation to allow correct folding of the individual domains of the protein; or to reduce or eliminate problematic secondary structures within polynucleotides. Codon optimization tools, algorithms and services are known in the art, non-limiting examples include those from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and/or proprietary methods. In some embodiments, an optimization algorithm is used to optimize the Open Reading Frame (ORF) sequence.

In some embodiments, the codon optimized sequence shares less than 95% sequence identity with a naturally occurring sequence ORF or a wild-type sequence ORF (e.g., a naturally occurring mRNA sequence encoding an respiratory viral antigen or a wild-type mRNA sequence). In some embodiments, the codon-optimized sequence shares less than 90% sequence identity with a naturally occurring sequence or a wild-type sequence (e.g., a naturally occurring mRNA sequence encoding an respiratory viral antigen or a wild-type mRNA sequence). In some embodiments, the codon-optimized sequence shares less than 85% sequence identity with a naturally occurring sequence or a wild-type sequence (e.g., a naturally occurring mRNA sequence encoding an respiratory viral antigen or a wild-type mRNA sequence). In some embodiments, the codon-optimized sequence shares less than 80% sequence identity with a naturally occurring sequence or a wild-type sequence (e.g., a naturally occurring mRNA sequence encoding an respiratory viral antigen or a wild-type mRNA sequence). In some embodiments, the codon-optimized sequence shares less than 75% sequence identity with a naturally occurring sequence or a wild-type sequence (e.g., a naturally occurring mRNA sequence encoding an respiratory viral antigen or a wild-type mRNA sequence).

In some embodiments, the codon optimized sequence shares between 65% and 85% (e.g., between about 67% and about 85% or between about 67% and about 80%) sequence identity with a naturally occurring sequence or wild-type sequence (e.g., a naturally occurring mRNA sequence encoding an respiratory viral antigen or a wild-type mRNA sequence). In some embodiments, the codon-optimized sequence shares between 65% and 75% or about 80% sequence identity with a naturally occurring sequence or wild-type sequence (e.g., a naturally occurring mRNA sequence encoding an respiratory viral antigen or a wild-type mRNA sequence).

In some embodiments, the immunogenicity of the antigen encoded by the codon-optimized sequence is the same as or greater than (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% greater than) the respiratory viral antigen encoded by the non-codon-optimized sequence.

When transfected into a mammalian host cell, the modified mRNA has stability between 12-18 hours or greater than 18 hours, e.g., 24, 36, 48, 60, 72, or greater than 72 hours and is capable of being expressed by the mammalian host cell.

In some embodiments, the codon optimized RNA can be RNA in which G/C levels are enhanced. The G/C content of a nucleic acid molecule (e.g., mRNA) can affect the stability of RNA. RNA with increased amounts of guanine (G) and/or cytosine (C) residues is functionally more stable than RNA containing large amounts of adenine (A) and thymine (T) or uracil (U) nucleotides. By way of example, WO02/098443 discloses pharmaceutical compositions containing mRNA stabilized by sequence modification in the translation region. Due to the degeneracy of the genetic code, modifications work by replacing those codons that promote greater RNA stability with existing codons without altering the resulting amino acid. The method is limited to the coding region of RNA.

Nucleotides not chemically modified

In some embodiments, the mRNA is chemically unmodified and comprises standard ribonucleotides consisting of adenosine, guanosine, cytosine, and uridine. In some embodiments, the nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues, such as those present in transcribed RNA (e.g., A, G, C or U). In some embodiments, the nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides, such as those present in DNA (e.g., dA, dG, dC, or dT).

Chemical modification

In some embodiments, the compositions of the present disclosure comprise RNA having an open reading frame encoding an antigen of a respiratory virus, wherein the nucleic acid comprises nucleotides and/or nucleosides that may be standard (unmodified) or modified as known in the art. In some embodiments, the nucleotides and nucleosides of the present disclosure include modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally occurring modified nucleotides and nucleosides or non-naturally occurring modified nucleotides and nucleosides. Such modifications may include those at the sugar, backbone or nucleobase portion of the nucleotide and/or nucleoside as recognized in the art.

In some embodiments, the naturally occurring modified nucleotide or nucleoside of the present disclosure is a nucleotide or nucleoside as generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleosides are found in particular in the widely recognized MODOMOS database.

In some embodiments, the non-naturally occurring modified nucleotide or nucleoside of the present disclosure is a nucleotide or nucleoside generally known or recognized in the art. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides can be found in, inter alia, published U.S. application nos. PCT/US2012/058519, PCT/US2013/075177, PCT/US2014/058897, PCT/US2014/058891, PCT/US2014/070413, PCT/US2015/036773, PCT/US2015/036759, PCT/US2015/036771, or PCT/IB2017/051367, which applications are all incorporated herein by reference.

Thus, the nucleic acids of the present disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids) can comprise standard nucleotides and nucleosides, naturally occurring nucleotides and nucleosides, non-naturally occurring nucleotides and nucleosides, or any combination thereof.

In some embodiments, the nucleic acids of the present disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids) comprise various (more than one) different types of standard and/or modified nucleotides and nucleosides. In some embodiments, a particular region of a nucleic acid contains one, two, or more (optionally different) types of standard and/or modified nucleotides and nucleosides.

In some embodiments, a modified RNA nucleic acid (e.g., modified mRNA nucleic acid) introduced into a cell or organism exhibits reduced degradation in the cell or organism relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides, respectively.

In some embodiments, a modified RNA nucleic acid (e.g., modified mRNA nucleic acid) introduced into a cell or organism exhibits reduced immunogenicity (e.g., reduced innate response) in the cell or organism relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides, respectively.

In some embodiments, a nucleic acid (e.g., an RNA nucleic acid, such as an mRNA nucleic acid) comprises non-natural modified nucleotides that are introduced during or after synthesis of the nucleic acid to achieve a desired function or characteristic. Modifications may be present on internucleotide linkages, purine or pyrimidine bases or sugars. The modification may be introduced at the end of the chain or at any other position in the chain by chemical synthesis or with a polymerase. Any region of the nucleic acid may be chemically modified.

The present disclosure provides modified nucleosides and nucleotides of nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids). "nucleoside" refers to a compound containing a sugar molecule (e.g., pentose or ribose) or derivative thereof in combination with an organic base (e.g., purine or pyrimidine) or derivative thereof (also referred to herein as "nucleobase"). "nucleotide" refers to a nucleoside, including phosphate groups. Modified nucleotides may be synthesized by any useful method, such as, for example, chemical, enzymatic or recombinant, to include one or more modified or unnatural nucleosides. The nucleic acid may comprise one or more regions of linked nucleosides. Such regions may have variable backbone linkages. The linkage may be a standard phosphodiester linkage, in which case the nucleic acid will comprise a nucleotide region.

Modified nucleotide base pairing encompasses not only standard adenosine-thymine, adenosine-uracil or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of the hydrogen bond donor and hydrogen bond acceptor allows hydrogen bonding between the non-standard base and standard base or between two complementary non-standard base structures, e.g., in those nucleic acids having at least one chemical modification. An example of such non-standard base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of bases/sugars or linkers may be incorporated into the nucleic acids of the disclosure.

In some embodiments, modified nucleobases in a nucleic acid (e.g., an RNA nucleic acid, such as an mRNA nucleic acid) include 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e 1 ψ), 5-methoxy-uridine (mo 5U), 5-methyl-cytidine (m 5C), and/or pseudouridine (ψ). In some embodiments, the modified nucleobases in a nucleic acid (e.g., an RNA nucleic acid, such as an mRNA nucleic acid) include 5-methoxymethyl uridine, 5-methylthiouridine, 1-methoxymethyl pseudouridine, 5-methylcytidine, and/or 5-methoxycytidine. In some embodiments, a polyribonucleotide includes a combination of at least two (e.g., 2, 3, 4, or more) nucleobases of any of the above modifications, including but not limited to chemical modifications.

In some embodiments, the mRNA of the present disclosure comprises 1-methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions of the nucleic acid.

In some embodiments, the mRNA of the present disclosure comprises a 1-methyl-pseudouridine (m1ψ) substitution at one or more or all uridine positions of the nucleic acid and a 5-methylcytidine substitution at one or more or all cytidine positions of the nucleic acid.

In some embodiments, the mRNA of the present disclosure comprises pseudo-uridine (ψ) substitutions at one or more or all uridine positions of the nucleic acid.

In some embodiments, the mRNA of the present disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more or all cytidine positions of the nucleic acid.

In some embodiments, the mRNA of the present disclosure comprises uridine at one or more or all uridine positions of the nucleic acid.

In some embodiments, the mRNA is consistently modified (e.g., fully modified, modified throughout the sequence) for a particular modification. For example, the nucleic acid may be consistently modified with 1-methyl-pseudouridine, which means that all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, nucleic acids can be uniformly modified for any type of nucleoside residue present in a sequence by substitution with modified residues, such as those set forth above.

The nucleic acids of the present disclosure may be partially or fully modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., any one or more or all of purine or pyrimidine, or A, G, U, C) may be consistently modified in a nucleic acid of the disclosure or a predetermined sequence region thereof (e.g., in an mRNA that includes or does not include a poly (a) tail). In some embodiments, all nucleotides X in a nucleic acid (or sequence region thereof) of the present disclosure are modified nucleotides, wherein X can be any of nucleotides A, G, U, C, or any of the combinations a+ G, A + U, A + C, G + U, G + C, U + C, A +g+ U, A +g+ C, G +u+c or a+g+c.

The nucleic acid may contain about 1% to about 100% modified nucleotides (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any one or more of A, G, U or C) or any intermediate percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 80% to 80%, 80% to 90%, 80% to 95%, and 80% to 95% to 100%). It should be understood that any remaining percentages are by the presence of unmodified A, G, U or C.

The mRNA may contain a minimum of 1% and a maximum of 100% modified nucleotides, or any intermediate percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, a nucleic acid may contain a modified pyrimidine, such as a modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in the nucleic acid are replaced with modified uracils (e.g., 5-substituted uracils). The modified uracil can be replaced with a compound having a single unique structure, or can be replaced with multiple compounds having different structures (e.g., 2, 3, 4, or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in the nucleic acid are replaced with modified cytosines (e.g., 5-substituted cytosines). The modified cytosine may be replaced with a compound having a single unique structure, or may be replaced with a plurality of compounds having different structures (e.g., 2, 3, 4, or more unique structures).

Untranslated region (UTR)

The mRNA of the present disclosure may comprise one or more regions or portions that serve or act as untranslated regions. When the mRNA is designed to encode at least one antigen of interest, the nucleic acid may comprise one or more of these untranslated regions (UTRs). The wild-type untranslated region of a nucleic acid is transcribed but not translated. In mRNA, the 5' utr extends from the transcription start site to the start codon, but does not contain the start codon; whereas the 3' UTR starts immediately after the stop codon, and continues until a transcription termination signal occurs. There is increasing evidence that UTR plays a regulatory role in the stability of nucleic acid molecules and translation. Regulatory features of UTRs may be incorporated into polynucleotides of the present disclosure to, inter alia, enhance stability of molecules, etc. Specific features may also be incorporated to ensure controlled down-regulation of the transcript in the event that the transcript is misdirected to an undesired organ site. A variety of 5'utr and 3' utr sequences are known and available in the art.

The 5'UTR is the region of the mRNA immediately upstream (5') of the start codon (first codon of the ribosome-translated mRNA transcript). The 5' UTR does not encode a protein (is non-coding). The native 5' UTR has features that play a role in translation initiation. They have the same characteristics as Kozak sequences, which are generally known to be involved in the process of ribosome initiation of many gene translations. The Kozak sequence has a consensus CCR (A/G) CCAUGG (SEQ ID NO: 68), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), followed by another "G". The 5' UTR is also known to form secondary structures involved in elongation factor binding.

In some embodiments of the disclosure, the 5' UTR is a heterologous UTR, i.e., a UTR associated with a different ORF found in nature. In another embodiment, the 5' UTR is a synthetic UTR, i.e., does not exist in nature. Synthetic UTRs include UTRs that have been mutated to improve their properties, such as UTRs that increase gene expression, as well as fully synthetic UTRs. Exemplary 5' UTRs include Xenopus (Xenopus) or human-derived a-or b-globin (8278063; 9012219), human cytochrome b-245a polypeptides and hydroxysteroid (17 b) dehydrogenases, and tobacco etch virus (US 8278063, 9012219). CMV immediate early 1 (IE 1) gene (US 20140206753, WO 2013/185069), sequence GGGAUCCUACC (SEQ ID NO: 48) (WO 2014144196) can also be used. In another embodiment, the 5' UTR of the TOP gene is the 5' UTR of the TOP gene lacking the 5' TOP motif (oligopyrimidine tract) (e.g., WO/2015101414, WO2015101415, WO/2015/062738, WO2015024667, WO 2015024667); the 5' UTR element (WO/2015101414, WO2015101415, WO/2015/062738) derived from the ribosomal protein large 32 (L32) gene, the 5' UTR element (WO 2015024667) derived from the 5' UTR of the hydroxysteroid (17-. Beta.) dehydrogenase 4 gene (HSD 17B 4) or the 5' UTR element (WO 2015024667) derived from the 5' UTR of ATP5A1 may be used. In some embodiments, an Internal Ribosome Entry Site (IRES) is used in place of the 5' utr.

In some embodiments, the 5' UTR of the present disclosure comprises a sequence selected from the group consisting of SEQ ID NO:29 and SEQ ID NO: 30.

The 3'UTR is the region of the mRNA immediately downstream (3') of the stop codon (the codon of the mRNA transcript which transmits the translation termination signal). The 3' UTR does not encode proteins (is non-coding). It is known that natural or wild-type 3' UTRs have adenosine and uridine segments embedded therein. These AU-rich features are particularly prevalent in high turnover genes. AU-rich elements (AREs) can be divided into three classes, based on their sequence characteristics and functional properties (Chen et al, 1995): class I ARE contain multiple copies of the discrete AUUUA motif within the U-rich region. C-Myc and MyoD contain class I AREs. Class II ARE have two or more overlapping UUAUUUA (U/a) nonamers. Molecules containing this type of ARE include GM-CSF and TNF-a. The definition of class III ARES is less well defined. These U-rich regions do not contain the AUUUA motif. c-Jun and myogenin are examples of two of these that have been well studied. Most proteins that bind ARE known to disrupt messenger stability, whereas members of the ELAV family, most notably HuR, have been shown to increase mRNA stability. HuR binds to ARE of all three categories. Engineering a HuR specific binding site into the 3' utr of a nucleic acid molecule will result in HuR binding and thus in stabilization of in vivo information.

The introduction, removal, or modification of 3' utr AU enrichment elements (ARE) can be used to modulate the stability of nucleic acids (e.g., RNAs) of the present disclosure. When engineering a particular nucleic acid, one or more copies of an ARE can be introduced to make the nucleic acids of the disclosure less stable, and thereby reduce translation and reduce production of the resulting protein. Also, ARE may be identified, removed, or mutated to increase intracellular stability, thereby increasing translation and production of the resulting protein. Transfection experiments can be performed in related cell lines using the nucleic acids of the present disclosure, and protein production can be determined at different time points after transfection. For example, cells can be transfected with different ARE engineering molecules and related proteins detected by using ELISA kits and the proteins produced 6 hours, 12 hours, 24 hours, 48 hours, and 7 days post-transfection ARE determined.

One of ordinary skill in the art will appreciate that heterologous or synthetic 5 'UTRs can be used with any desired 3' UTR sequence. For example, a heterologous 5'UTR may be used with a synthetic 3' UTR having a heterologous 3 "UTR.

non-UTR sequences may also be used as regions or sub-regions within a nucleic acid. For example, introns or portions of intronic sequences may be incorporated into regions of nucleic acids of the disclosure. The incorporation of intron sequences can increase protein production and nucleic acid levels.

Combinations of features may be included in the flanking regions and may be included within other features. For example, the ORF may be flanked by 5 'utrs, which may contain a strong Kozak translation initiation signal, and/or 3' utrs, which may include an oligo (dT) sequence for template addition of a poly a tail. The 5'utr may comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and/or different genes, such as the 5' utr described in U.S. patent application publication No. 20100293625 and PCT/US2014/069155, which are incorporated herein by reference in their entirety.

It will be appreciated that any UTR from any gene may incorporate a region of nucleic acid. In addition, multiple wild-type UTRs of any known gene may be utilized. Artificial UTRs that are not variants of the wild-type region are also provided within the scope of the present disclosure. These UTRs or portions thereof may be placed in the same orientation as their transcripts are selected from, or may be changed in orientation or position. Thus, a 5'utr or 3' utr may be inverted, shortened, lengthened, made with one or more other 5 'utrs or 3' utrs. As used herein, the term "altering" when referring to a UTR sequence means that the UTR has been altered in some way relative to a reference sequence. For example, the 3'UTR or 5' UTR may be altered relative to the wild-type or natural UTR by altering the orientation or position as taught above, or may be altered by including additional nucleotides, deleted nucleotides, exchanged or transposed nucleotides. Any of these changes that result in an "altered" UTR (whether 3 'or 5') comprise a variant UTR.

In some embodiments, dual, triple, or quadruple UTRs, such as 5'UTR or 3' UTR, may be used. As used herein, a "dual" UTR is a UTR in which two copies of the same UTR are encoded in tandem or substantially in tandem. For example, dual βglobin 3' utrs may be used as described in U.S. patent publication 20100129877, the contents of which are incorporated herein by reference in their entirety.

Patterned UTRs are also within the scope of the present disclosure. As used herein, "patterned UTRs" are those UTRs reflecting a repeating or alternating pattern, such as ABABAB or AABBAABBAABB or abccabc, or variants thereof that repeat once, twice, or more than 3 times. In these modes, each letter A, B or C represents a different UTR at the nucleotide level.

In some embodiments, the flanking regions are selected from a family of transcripts whose proteins share a common function, structure, feature or characteristic. For example, the polypeptide of interest may belong to a family of proteins expressed in a particular cell, tissue, or at some time during development. UTRs from any of these genes may be swapped for any other UTRs of the same or different protein families to produce new polynucleotides. As used herein, "protein family" is used in its broadest sense to refer to a group of two or more polypeptides of interest that share at least one function, structure, feature, localization, origin, or expression pattern.

The untranslated region may also comprise a Translation Enhancer Element (TEE). As non-limiting examples, TEEs may include those described in U.S. application No. 20090226470 (which is incorporated herein by reference in its entirety) as well as those known in the art.

In vitro transcription of RNA

Aspects of the present disclosure provide methods of producing (e.g., synthesizing) an RNA transcript (e.g., an mRNA transcript), the methods comprising contacting a DNA template (e.g., a first input DNA and a second input DNA) with an RNA polymerase (e.g., a T7 RNA polymerase variant, etc.) under conditions that result in the production of the RNA transcript. This process is known as "in vitro transcription" or "IVT". IVT conditions typically require a purified linear DNA template containing a promoter, nucleoside triphosphates, a buffer system comprising Dithiothreitol (DTT) and magnesium ions, and RNA polymerase. The exact conditions used in the transcription reaction depend on the amount of RNA required for the particular application. Typical IVT reactions are performed by incubating a DNA template with an RNA polymerase and nucleoside triphosphates, including GTP, ATP, CTP and UTP (or nucleotide analogs), in a transcription buffer. From this reaction, RNA transcripts with guanosine triphosphates at the 5' -end are produced.

In some embodiments, a wild-type T7 polymerase is used in an IVT reaction. In some embodiments, a modified or mutated T7 polymerase is used in the IVT reaction. In some embodiments, the T7 RNA polymerase variant comprises an amino acid sequence having at least 50%, 60%, 70%, 80%, 90%, 95% or 99% identity to a wild-type T7 (WT T7) polymerase. In some embodiments, the T7 polymerase variant is a T7 polymerase variant described in international application publication No. WO2019/036682 or WO2020/172239, the entire contents of each of which are incorporated herein by reference. In some embodiments, the RNA polymerase (e.g., T7 RNA polymerase or T7 RNA polymerase variant) is present in the reaction (e.g., IVT reaction) at a concentration of 0.01mg/ml to 1 mg/ml. For example, RNA polymerase may be present in the reaction at a concentration of 0.01mg/mL, 0.05mg/mL, 0.1mg/mL, 0.5mg/mL, or 1.0 mg/mL.

The imported deoxyribonucleic acid (DNA) serves as a nucleic acid template for the RNA polymerase. The DNA template may include a polynucleotide encoding a polypeptide of interest (e.g., an antigenic polypeptide). In some embodiments, the DNA template comprises an RNA polymerase promoter (e.g., a T7 RNA polymerase promoter) 5' to and operably linked to a polynucleotide encoding a polypeptide of interest. The DNA template may also include a nucleotide sequence encoding a polyadenylation (poly a) tail located at the 3' end of the target gene. In some embodiments, the DNA input comprises plasmid DNA (pDNA). As used herein, "plasmid DNA" or "pDNA" refers to an extrachromosomal DNA molecule that is physically separated from chromosomal DNA in a cell and that can replicate independently. In some embodiments, plasmid DNA is isolated from cells (e.g., as a plasmid DNA preparation). In some embodiments, plasmid DNA comprises an origin of replication, which may contain one or more heterologous nucleic acids, e.g., nucleic acids encoding therapeutic proteins that can be used as templates for RNA polymerase. Plasmid DNA may be circularized or linear (e.g., plasmid DNA that has been linearized by restriction enzyme digestion).

Multivalent mRNA constructs are typically produced by: one mRNA product is transcribed at a time, each mRNA product is purified, and the purified mRNA products are mixed together and then formulated. This type of process requires a significant amount of time and money investment, especially at the Good Manufacturing Practice (GMP) scale.

Aspects of the disclosure relate to methods for producing compositions comprising multivalent different RNAs (e.g., 2 or more different RNAs). In some aspects, the multivalent transcription methods disclosed herein involve selecting the amount of input DNA for an IVT reaction, thereby producing a multivalent RNA composition having a higher purity than RNA compositions produced using previous methods. It is observed that certain features or characteristics of co-transcribed (e.g., in vitro simultaneous transcription) DNA molecules, such as differences in length between DNA molecules, poly-a tailing efficiency of DNA molecules, etc., and/or other agents (e.g., RNA polymerase, nucleotide Triphosphates (NTPs), etc.) present in a common IVT reaction mixture may introduce compositional deviations into the resulting multivalent RNA composition. Surprisingly, a method of reducing such compositional deviation was found. In some embodiments, modifying the amount of input DNA results in the production of a multivalent RNA composition having increased purity (e.g., as measured by the percentage of RNA that comprises poly-a tails) relative to RNA compositions produced by previous methods. It has also surprisingly been found that the collective IVT methods described herein produce multivalent RNA compositions of high purity even when there is a large difference in the length of the input DNA used in the IVT reaction (e.g., >100 nucleotides).

Thus, in some aspects, the present disclosure provides a method for producing a multivalent RNA composition, the method comprising simultaneously transcribing at least two DNA molecules in vitro in a reaction mixture, the reaction mixture comprising: a first population of DNA molecules encoding a first RNA; a second population of DNA molecules encoding a second RNA that is different from the first RNA; and obtaining a multivalent RNA composition having a predetermined ratio of the first RNA to the second RNA produced by the IVT.

As used herein, the term "multivalent RNA composition" refers to a composition comprising more than two different mrnas. The multivalent RNA composition can comprise 2 or more different RNAs, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different RNAs. In some embodiments, the multivalent RNA composition comprises more than 10 different RNAs. The term "different RNA" refers to any RNA that is different from another RNA in the multivalent RNA composition. For example, two RNAs are different if they have i) different lengths (whether the RNAs are the same over the entire length of the shorter of the two lengths), ii) different nucleotide sequences, iii) different chemical modification patterns, or iv) any combination of the foregoing.

In some embodiments, each input DNA (e.g., population of input DNA molecules) in a common IVT reaction is obtained from a different source (e.g., synthesized separately, e.g., in different cells or cell populations). In some embodiments, each input DNA (e.g., input DNA population) is obtained from a different bacterial cell or bacterial cell population. For example, in a common IVT reaction with three populations of input DNA, a first input DNA is produced in bacterial cell population a, a second input DNA is produced in bacterial cell population B, and a third input DNA is produced in bacterial population C, wherein A, B and C are each not the same bacterial culture (e.g., co-cultured in the same vessel or plate). Methods for obtaining an input DNA population (e.g., plasmid DNA) are known, for example, as described in Sambrook, joseph. Molecular Cloning: a Laboratory Manual, cold Spring Harbor, N.Y., cold Spring Harbor Laboratory Press, 2001.

Some aspects include normalizing the amount of DNA used in the multivalent common IVT reaction. In some embodiments, normalization is based on the molar mass of the input DNA. In some embodiments, the normalization is based on the degradation rate of the input DNA. In some embodiments, normalization is based on the degradation rate of the resulting mRNA (e.g., measured based on poly-a variants present in the reaction mixture, or T7 polymerase null transcripts or truncated transcripts). In some embodiments, normalization is based on the nucleotide content of the input DNA (e.g., the amount of A, G, C, U or any combination thereof). In some embodiments, normalization is based on the purity of the input DNA. In some embodiments, normalization is based on the poly-a tailing efficiency of the input DNA. In some embodiments, normalization is based on the length of the input DNA.

In some embodiments, the mRNA has a predefined mRNA ratio, which may include a ratio between 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different RNAs (e.g., depending on the number of different RNAs in the composition). In some embodiments, the predefined ratio comprises a ratio between more than 10 RNAs. As used herein, "predefined mRNA ratio" refers to the desired final ratio of RNA molecules in the multivalent RNA composition. The desired final ratio of RNA composition will depend on the final peptide or polypeptide product encoded by the RNA. For example, the multivalent RNA mixture can comprise two RNAs (e.g., an RNA encoding a first antigen and an RNA encoding a second antigen); in this case, the desired final ratio of RNA molecules may be 1 first antigenic RNA to 1 second antigenic RNA. In another example, a multivalent RNA composition can comprise several (e.g., 3, 4, 5, 6, 7, 8, or more) RNAs encoding different antigenic peptides (e.g., for use as a vaccine); in this case, the desired ratio may include 3 to 10 RNAs (e.g., a: b: c, d, a: c: d, e, a: b: c: d: e, f: g, a: b: c: d: f: g: h, a: b: c: e: f: g: h: i, a: b: c: d: e: f: g: h: i: j, etc., where a-j are each a number between 1 and 10).

In some embodiments, normalization is based on the minimum level present in the input DNA (e.g., the minimum molar mass, degradation rate (e.g., degradation rate of the input DNA and/or output RNA), nucleotide content, purity, and/or poly-a tailing efficiency). In some embodiments, normalization is based on the highest level present in the input DNA (e.g., highest molar mass, degradation rate (e.g., degradation rate of the input DNA and/or output RNA), nucleotide content, purity, and/or poly a tailing efficiency). In some embodiments, normalization is based on the RNA production rate of the input DNA (e.g., the highest RNA production rate of the input DNA or the lowest RNA production rate of the input DNA in the reaction mixture).

In some aspects, the disclosure relates to IVT methods in which the amount of input DNA (e.g., first DNA or second DNA) is adjusted or normalized in order to improve the production of multivalent RNA compositions having predefined mRNA component ratios.

As described herein, certain factors that affect the purity of multivalent RNA compositions, such as large differences in size (e.g., length differences exceeding 100, 200, 500, 1000 or more nucleotides) between input DNA during an IVT and/or poly a tailing efficiency of a given DNA, can be addressed by normalizing the amount of input DNA prior to the IVT based on one or more of these factors.

The amount of input DNA (e.g., population of input DNA molecules) used in the IVT reaction can vary, depending on the number of different RNA molecules that are desired to be included in the multivalent RNA composition. In some embodiments, the IVT reaction mixture comprises 2 or more different input DNAs, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more different input DNAs. In some embodiments, the IVT reaction comprises more than 15 different input DNAs. The term "different input DNA" encompasses input DNA encoding, for example, different RNAs with: i) Different lengths (whether or not the RNA is identical over the entire length of the shorter of the two lengths), ii) different nucleotide sequences, iii) different chemical modification patterns, or iv) any combination of the foregoing.

In some embodiments, two or more input DNA molecules used in an IVT reaction encode mRNA molecules of different lengths (e.g., comprising different numbers of nucleotides). In some embodiments, the difference in length between two or more mRNA molecules encoded by different input DNA molecules in an IVT reaction mixture is greater than 70 nucleotides, 80 nucleotides, 90 nucleotides, or 100 nucleotides (e.g., two input DNA in a composition encode mRNA molecules that are not within 70, 80, 90, or 100 nucleotides of each other in length). In some embodiments, the difference in length between two or more mRNA molecules encoded by different input DNA molecules is more than 100 nucleotides, e.g., 500 nucleotides, 1000 nucleotides, 1500 nucleotides, 2000 nucleotides, 3000 nucleotides, 4000 nucleotides, or more.

In particular embodiments, a combination vaccine (e.g., a multivalent RNA composition) is produced by combining a linearized first DNA molecule encoding a first mRNA polynucleotide, a linearized second DNA molecule encoding a second mRNA polynucleotide, and a linearized third DNA molecule encoding a third mRNA polynucleotide into a single reaction vessel, wherein the first DNA molecule, the second DNA molecule, and the third DNA molecule are obtained from different sources. In some embodiments, the different sources are first, second, and third bacterial cell cultures, and wherein the first, second, and third bacterial cell cultures are not co-cultured. In some embodiments, the different sources are first, second, and third bacterial cell cultures, and wherein the first, second, and third bacterial cell cultures are co-cultured. In some embodiments, the amounts of the first, second, and third DNA molecules present in the reaction mixture prior to initiation of in vitro transcription have been normalized.

In some embodiments, the linearizing the first DNA molecule, linearizing the second DNA molecule, and linearizing the third DNA molecule are performed simultaneously in vitro to obtain the multivalent RNA composition.

In some embodiments, the in vitro transcription template encodes a 5 'Untranslated (UTR) region, contains an open reading frame, and encodes a 3' UTR and a poly (a) tail. The specific nucleic acid sequence composition and length of an in vitro transcribed template will depend on the mRNA encoded by the template.

"5 'untranslated region" (UTR) refers to the region of mRNA that is immediately upstream (i.e., 5') of the start codon (i.e., the first codon of a ribosome-translated mRNA transcript) that does not encode a polypeptide. When producing RNA transcripts, the 5' UTR may comprise the promoter sequence. Such promoter sequences are known in the art. It will be appreciated that such promoter sequences will not be present in the vaccine of the present disclosure.

"3 'untranslated region (UTR)" refers to the region of mRNA that is immediately downstream (i.e., 3') of the stop codon (i.e., the codon of the mRNA transcript that signals translation termination) that does not encode a polypeptide.

An "open reading frame" is a continuous DNA segment beginning with a start codon (e.g., methionine (ATG)) and ending with a stop codon (e.g., TAA, TAG, or TGA), and encodes a polypeptide.

"poly (A) tail" is a region of mRNA downstream, e.g., immediately downstream (i.e., 3 '), of the 3' UTR that contains multiple consecutive adenosine monophosphates. The poly (a) tail may contain 10 to 300 adenosine monophosphates. For example, the poly (a) tail can contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenosine monophosphates. In some embodiments, the poly (a) tail contains 50 to 250 adenosine monophosphates. In a related biological environment (e.g., in a cell, in vivo), the poly (a) tail serves to protect mRNA from enzymatic degradation, e.g., in the cytoplasm, and to facilitate transcription termination and/or export of mRNA from the nucleus, as well as translation.

In some embodiments, the nucleic acid comprises 200 to 3,000 nucleotides. For example, a nucleic acid may comprise 200 to 500, 200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500, 500 to 2000, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 3000, 1500 to 3000, or 2000 to 3000 nucleotides.

In vitro transcription systems typically comprise a transcription buffer, nucleotide Triphosphates (NTPs), an rnase inhibitor, and a polymerase.

NTP may be manufactured internally, may be selected from suppliers, or may be synthesized as described herein. NTPs may be selected from, but are not limited to, those described herein, including natural and non-natural (modified) NTPs.

Any number of RNA polymerases or variants can be used in the methods of the present disclosure. The polymerase may be selected from, but is not limited to, phage RNA polymerases, such as T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, and/or mutant polymerases, such as, but not limited to, polymerases capable of incorporating modified nucleic acids and/or modified nucleotides (including chemically modified nucleic acids and/or nucleotides). Some embodiments exclude the use of dnase.

In some embodiments, the RNA transcript is capped via enzymatic capping. In some embodiments, the RNA comprises a 5' end cap, e.g., 7mG (5 ') ppp (5 ') NlmpNp.

Non-coding sequences

Aspects of the disclosure relate to multivalent RNA compositions comprising mRNA (e.g., 2-15 mRNA polynucleotides), each mRNA polynucleotide comprising a different Open Reading Frame (ORF) encoding an antigenic polypeptide of a respiratory virus, wherein each mRNA polynucleotide comprises one or more non-coding sequences in an untranslated region (UTR) having a unique identifier sequence or non-coding sequence. As used herein, "non-coding sequence" refers to a sequence in a biomolecule (e.g., nucleic acid, protein, etc.) that when combined with a sequence of another biomolecule is used to recognize the other biomolecule.

Typically, the non-coding sequence is a heterologous sequence that is incorporated into or appended to the target biomolecule sequence and serves as a reference to recognize the target molecule of interest. In some embodiments, the non-coding sequence is a sequence of a nucleic acid (e.g., a heterologous or synthetic nucleic acid) that is incorporated into or attached to the target nucleic acid and used as a reference to identify the target nucleic acid. In some embodiments, the non-coding sequence is of formula (N) N. In some embodiments, n is an integer in the range of 5 to 20, 5 to 10, 10 to 20, 7 to 20, or 7 to 30. In some embodiments, n is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or greater. In some embodiments, N is a nucleotide each independently selected from A, G, T, U and C or an analog thereof. Thus, some embodiments comprise a nucleic acid (e.g., mRNA) that (i) has a target sequence of interest (e.g., a coding sequence (e.g., a sequence encoding a therapeutic peptide or therapeutic protein)); and (ii) comprises a unique non-coding sequence.

In some embodiments, one or more in vitro transcribed mRNA comprises one or more non-coding sequences in an untranslated region (UTR) such as a 5'UTR or a 3' UTR. The inclusion of non-coding sequences in the UTR of mR NA prevents the non-coding sequences from being translated into peptides. In some embodiments, the non-coding sequence is located in the 3' utr of the mRNA. In some embodiments, the non-coding sequence is located upstream of the poly-a tail of the mRNA. In some embodiments, the non-coding sequence is located downstream (e.g., after) the poly-a tail of the mRNA. In some embodiments, the non-coding sequence is located between the last codon of the ORF of the mRNA and the first "a" of the poly a tail of the mRNA. In some embodiments, the polynucleotide non-coding sequence located in U TR comprises 1 to 10 nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides). In some embodiments, a UTR comprising a polynucleotide non-coding sequence further comprises one or more (e.g., 1, 2, 3, or more) rnase cleavage sites, such as an rnase H cleavage site. In some embodiments, each different RNA of the multivalent RNA composition comprises a different (e.g., unique) non-coding sequence. In some embodiments, the RNA of the multivalent RNA composition is detected and/or purified based on the polynucleotide non-coding sequence of the RNA. In some embodiments, the mRNA non-coding sequence is used to identify the presence of mRNA in a sample (e.g., a reaction product or a pharmaceutical product) or to determine the relative proportions of different mrnas. In some embodiments, mRNA non-coding sequences are detected using one or more of depth sequencing, PCR, and Sanger sequencing. Exemplary non-coding sequences include: AACGUGAU, AA ACAUCG, ATGCCUAA, AGUGGUCA, ACCACUGU, ACAUUG GC, CAGAUCUG, CAUCAAGU, CGCUGAUC, ACAAGCUA, C UGUAGCC, AGUACAAG, AACAACCA, AACCGAGA, AACGC UUA, AAGACGGA, AAGGUACA, ACACAGAA, ACAGCAGA, ACCUCCAA, ACGCUCGA, ACGUAUCA, ACUAUGCA, AGAG UCAA, AGAUCGCA, AGCAGGAA, AGUCACUA, AUCCUGUA, AUUGAGGA, CAACCACA, GACUAGUA, CAAUGGAA, CACU UCGA, CAGCGUUA, CAUACCAA, CCAGUUCA, CCGAAGUA, ACAGUG, CGAUGU, UUAGGC, AUCACG, and UGACCA.

In some embodiments, the multivalent RNA composition is produced by a method comprising:

(a) Combining a linearized first DNA molecule encoding a first mRNA polynucleotide, a linearized second DNA molecule encoding a second mRNA polynucleotide, and a linearized third, fourth, seventh, eighth, ninth, or tenth DNA molecule encoding a third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth mRNA polynucleotide into a single reaction vessel, wherein the first DNA molecule, the second DNA molecule, and the third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecules are obtained from different sources; and

(b) Simultaneously in vitro transcribing the linearized first DNA molecule, linearizing the second DNA molecule, and linearizing the third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecule to obtain the multivalent RNA composition. The different sources may be bacterial cell cultures that may not be co-cultivated. In some embodiments, the amounts of the first, second, and third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecules present in the reaction mixture prior to the start of the IVT have been normalized.

Chemical synthesis

Nucleic acids of the present disclosure may be manufactured in whole or in part using solid phase techniques. Solid-phase chemical synthesis of nucleic acids is an automated process in which molecules are immobilized on a solid support and synthesized stepwise in a reactant solution. Solid phase synthesis can be used to introduce chemical modifications in the nucleic acid sequence at site-specific locations.

Synthesis of nucleic acids of the present disclosure by continuous addition of monomeric building blocks may be performed in the liquid phase.

The synthetic methods discussed above each have their advantages and limitations. Attempts have been made to combine these approaches to overcome these limitations. Combinations of such methods are within the scope of the present disclosure. The use of a combination of solid or liquid phase chemical synthesis with enzymatic ligation provides an efficient way to generate long-chain nucleic acids that cannot be obtained by chemical synthesis alone.

Ligation of nucleic acid regions or sub-regions

Nucleic acid assembly by ligase may also be used. DNA or RNA ligases facilitate intermolecular ligation of the 5 'and 3' ends of polynucleotide strands by forming phosphodiester bonds. Nucleic acids such as chimeric polynucleotides and/or circular nucleic acids may be prepared by ligating one or more regions or sub-regions. The DNA fragments may be joined by a ligase-catalyzed reaction to produce recombinant DNA having different functions. Two oligodeoxynucleotides, one with a 5 'phosphoryl group and the other with a free 3' hydroxyl group, were used as substrates for DNA ligases.

Purification

Purification of nucleic acids described herein may include, but is not limited to, nucleic acid purification, quality assurance, and quality control. Purification can be performed by methods known in the art, such as, but not limited toBeads (Beckman Coulter Genomics, danvers, mass.), poly-T beads, LNATM oligo-T capture probes (++>Inc, vedbaek, denmark) or HPLC-based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC) and hydrophobic interaction HPLC (HIC-HPLC). The term "purified" when used in connection with a nucleic acid, such as "purified nucleic acid", refers to a nucleic acid that is separated from at least one contaminant. "contaminant" means another substance that is rejected, impure, or inferiorAny substance. Thus, purified nucleic acids (e.g., DNA and RNA) exist in a form or context that is different from that which it found in nature, or from that which it existed prior to the treatment or purification process.

Quality assurance and/or quality control checks may be performed using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC.

In some embodiments, the nucleic acid may be sequenced by methods including, but not limited to, reverse transcriptase-PCR.

Quantification of

In some embodiments, the nucleic acids of the present disclosure may be quantified in exosomes or when derived from one or more bodily fluids. Body fluids include peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, bronchoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or periejaculatory fluid, sweat, stool, hair, tears, cyst fluid, pleural and peritoneal fluids, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretions, fecal water, pancreatic juice, sinus cavity lavage fluid, bronchopulmonary aspirates, blastocyst fluid, and umbilical cord blood. Alternatively, exosomes may be recovered from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver and placenta.

The determination can be made using construct-specific probes, cytometry, qRT-PCR, real-time PCR, flow cytometry, electrophoresis, mass spectrometry, or a combination thereof, while the exosomes can be isolated using immunohistochemical methods such as enzyme-linked immunosorbent assay (ELISA) methods. Exosomes may also be isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoadsorption capture, affinity purification, microfluidic separation or combinations thereof.

These methods provide researchers with the ability to monitor the level of nucleic acid remaining or delivered in real time. This is possible because, in some embodiments, the nucleic acids of the present disclosure differ from endogenous forms due to structural or chemical modifications.

In some embodiments, nucleic acids may be quantified using methods such as, but not limited to, ultraviolet visible spectroscopy (UV/Vis). Non-limiting examples of UV/Vis spectrometers areSpectrometer (thermo Fisher, waltham, mass.). The quantified nucleic acid may be analyzed to determine if the nucleic acid is of an appropriate size, and to check if the nucleic acid has not degraded. Degradation of nucleic acids can be checked by methods such as, but not limited to, the following: agarose gel electrophoresis; HPLC-based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), hydrophobic interaction high performance liquid chromatography (HIC-HPLC); liquid chromatography-mass spectrometry (LCMS); capillary Electrophoresis (CE); and Capillary Gel Electrophoresis (CGE).

Lipid Nanoparticles (LNP)

In some embodiments, the mRNA of the present disclosure is formulated in Lipid Nanoparticles (LNPs). Lipid nanoparticles typically comprise ionizable amino lipids, non-cationic lipids, sterols, and PEG lipid components, and target nucleic acid cargo. Lipid nanoparticles of the present disclosure may be produced using components, compositions, and methods generally known in the art, see, e.g., PCT/US2016/052352, PCT/US2016/068300, PCT/US2017/037551, PCT/US2015/027400, PCT/US2016/047406, PCT/US2016/000129, PCT/US2016/014280, PCT/US2017/038426, PCT/US2014/027077, PCT/US2014/055394, PCT/US2016/052117, PCT/US2012/069610, PCT/US2017/027492, PCT/US2016/059575, and PCT/US2016/069491, all of which are incorporated herein by reference in their entirety.

The vaccine of the present disclosure is typically formulated in lipid nanoparticles. For example, a mixing process such as T-junction mixing of a microfluidic and two fluid streams, one of which contains mRNA and the other of which contains a lipid component, may be used to prepare a vaccine. In some embodiments, the vaccine is prepared by combining an ionizable amino lipid, a phospholipid (such as DOPE or DSPC), a PEG lipid (such as 1, 2-dimyristoyl-OT-glycerogxypolyethylene glycol, also known as PEG-DMG), and a structural lipid (such as cholesterol) in an alcohol (e.g., ethanol). For example, the lipids can be combined to produce the desired molar ratio and diluted with water and alcohol (e.g., ethanol) to a final lipid concentration of between about 5.5mM and about 25 mM.

Vaccines comprising mRNA and a lipid component can be prepared, for example, by combining a lipid solution with an mRNA solution in a weight to weight ratio of lipid component to mRNA of about 5:1 to about 50:1. A microfluidic-based system (e.g., nanoAssembler) may be used to rapidly inject a lipid solution into, for example, an mRNA solution at a flow rate of between about 10ml/min and about 18ml/min to produce a suspension (e.g., a ratio of water to alcohol of between about 1:1 and about 4:1).

The vaccine may be processed by dialysis to remove alcohol (e.g., ethanol) and effect buffer exchange. The formulation may be dialyzed against Phosphate Buffered Saline (PBS) (pH 7.4), e.g., a volume greater than the volume of the primary product (e.g., using Slide-a-Lyzer cassette (Thermo Fisher Scientific inc., rockford, IL)), e.g., a molecular weight cut-off of 10kD. The foregoing exemplary methods induce nano-precipitation and particle formation. Alternative methods, including but not limited to T-junctions and direct injection, can be used to achieve the same nano-precipitation.

The vaccine of the present disclosure is typically formulated in lipid nanoparticles. In some embodiments, the lipid nanoparticle comprises at least one ionizable amino lipid, at least one non-cationic lipid, at least one sterol, and/or at least one polyethylene glycol (PEG) modified lipid.

In some embodiments, the lipid nanoparticle comprises 20-60mol% ionizable amino lipids. For example, the lipid nanoparticle may comprise 20-50mol%, 20-40mol%, 20-30mol%, 30-60mol%, 30-50mol%, 30-40mol%, 40-60mol%, 40-50mol%, or 50-60mol% of the ionizable amino lipid. In some embodiments, the lipid nanoparticle comprises 20mol%, 30mol%, 40mol%, 50mol%, or 60mol% of the ionizable amino lipid.

In some embodiments, the lipid nanoparticle comprises 5-25mol% non-cationic lipid. For example, the lipid nanoparticle may comprise 5-20mol%, 5-15mol%, 5-10mol%, 10-25mol%, 10-20mol%, 10-25mol%, 15-20mol%, or 20-25mol% of the non-cationic lipid. In some embodiments, the lipid nanoparticle comprises 5mol%, 10mol%, 15mol%, 20mol%, or 25mol% of a non-cationic lipid.

In some embodiments, the lipid nanoparticle comprises 25-55 mole% sterols. For example, the lipid nanoparticle may comprise 25-50mol%, 25-45mol%, 25-40mol%, 25-35mol%, 25-30mol%, 30-55mol%, 30-50mol%, 30-45mol%, 30-40mol%, 30-35mol%, 35-55mol%, 35-50mol%, 35-45mol%, 35-40mol%, 40-55mol%, 40-50mol%, 40-45mol%, 45-55mol%, 45-50mol%, or 50-55mol% sterols. In some embodiments, the lipid nanoparticle comprises 25mol%, 30mol%, 35mol%, 40mol%, 45mol%, 50mol%, or 55mol% sterols.

In some embodiments, the lipid nanoparticle comprises 0.5 to 15mol% peg-modified lipid. For example, the lipid nanoparticle may comprise 0.5-10mol%, 0.5-5mol%, 1-15mol%, 1-10mol%, 1-5mol%, 2-15mol%, 2-10mol%, 2-5mol%, 5-15mol%, 5-10mol%, or 10-15mol%. In some embodiments, the lipid nanoparticle comprises 0.5mol%, 1mol%, 2mol%, 3mol%, 4mol%, 5mol%, 6mol%, 7mol%, 8mol%, 9mol%, 10mol%, 11mol%, 12mol%, 13mol%, 14mol%, or 15mol% peg-modified lipid.

In some embodiments, the lipid nanoparticle comprises 20-60mol% ionizable amino lipids, 5-25mol% non-cationic lipids, 25-55mol% sterols, and 0.5-15mol% peg-modified lipids. In some embodiments, the lipid nanoparticle comprises 40-50mol% ionizable amino lipids, 5-15mol% neutral lipids, 20-40mol% cholesterol, and 0.5-3mol% peg-modified lipids. In some embodiments, the lipid nanoparticle comprises 45-50mol% ionizable amino lipids, 9-13mol% neutral lipids, 35-45mol% cholesterol, and 2-3mol% peg-modified lipids. In some embodiments, the lipid nanoparticle comprises 48mol% ionizable amino lipids, 11mol% neutral lipids, 68.5mol% cholesterol, and 2.5mol% peg-modified lipids.

In some embodiments, the ionizable amino lipids of the present disclosure comprise a compound of formula (I):

or a salt or isomer thereof, wherein:

R ₁ selected from C _5-30 Alkyl, C _5-20 Alkenyl, -R x YR ", -YR" and-R "M 'R';

R ₂ and R is ₃ Independently selected from H, C _1-14 Alkyl, C _2-14 Alkenyl, -R-YR ', -YR ' and-R-OR ', OR R ₂ And R is ₃ Together with the atoms to which they are attached, form a heterocyclic or carbocyclic ring;

R ₄ selected from C _3-6 Carbocycles, - (CH) ₂ ) _n Q、-(CH ₂ ) _n CHQR、-CHQR、-CQ(R) ₂ And unsubstituted C _1-6 Alkyl, wherein Q is selected from the group consisting of carbocycles, heterocycles, -OR, -O (C H) ₂ ) _n N(R) ₂ 、-C(O)OR、-OC(O)R、-CX ₃ 、-CX ₂ H、-CXH ₂ 、-CN、-N(R) ₂ 、-C(O)N(R) ₂ 、-N(R)C(O)R、-N(R)S(O) ₂ R、-N(R)C(O)N(R) ₂ 、-N(R)C(S)N(R) ₂ 、-N(R)R ₈ 、-O(CH ₂ ) _n OR、-N(R)C(＝NR ₉ )N(R) ₂ 、-N(R)C(＝C HR ₉ )N(R) ₂ 、-OC(O)N(R) ₂ 、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O) ₂ R、-N(OR)C(O)OR、-N(OR)C(O)N(R) ₂ 、-N(OR)C(S)N(R) ₂ 、-N(OR)C(＝NR ₉ )N(R) ₂ 、-N(OR)C(＝CHR ₉ )N(R) ₂ 、-C(＝NR ₉ )N(R) ₂ 、-C(＝NR ₉ ) R, -C (O) N (R) OR and-C (R) N (R) ₂ C (O) OR, and each n is independently selected from 1, 2, 3, 4, and 5;

each R ₅ Independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R ₆ Independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

m and M 'are independently selected from the group consisting of-C (O) O-, -OC (O) -, -C (O) N (R'), -N (R ') C (O) -, -C (O) -, -C (S) -, -C (S) S-, -SC (S) -, -CH (OH) -, -P (O) (OR') O-, -S (O) ₂ -, -S-, aryl and heteroaryl;

R ₇ selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

R ₈ selected from C _3-6 Carbocycles and heterocycles;

R ₉ selected from H, CN, NO ₂ 、C _1-6 Alkyl, -OR, -S (O) ₂ R、-S(O) ₂ N(R) ₂ 、C _2-6 Alkenyl, C _3-6 Carbocycles and heterocycles;

each R is independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R' is independently selected from C _1-18 Alkyl, C _2-18 Alkenyl, -R x YR ", -YR", and H;

each R' is independently selected from C _3-14 Alkyl and C _3-14 Alkenyl groups;

each R is independently selected from C _1-12 Alkyl and C _2-12 Alkenyl groups;

each Y is independently C _3-6 A carbocycle;

each X is independently selected from the group consisting of F, cl, br and I; and is also provided with

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13.

In some embodiments, a subset of compounds of formula (I) include those wherein when R ₄ Is- (CH) ₂ ) _n Q、-(CH ₂ ) _n CHQR, -CHQR or-CQ (R) ₂ When N is 1, 2, 3, 4 or 5, then Q is not-N (R) ₂ Or (ii) whenWhen n is 1 or 2, Q is not a 5-, 6-or 7-membered heterocycloalkyl.

In some embodiments, another subset of compounds of formula (I) includes those wherein

R ₄ selected from C _3-6 Carbocycles, - (CH) ₂ ) _n Q、-(CH ₂ ) _n CHQR、-CHQR、-CQ(R) ₂ And unsubstituted C _1-6 Alkyl, wherein Q is selected from the group consisting of C _3-6 Carbocycles, 5-to 14-membered heteroaryl groups, -OR, -O (CH) having one OR more heteroatoms selected from N, O and S ₂ ) _n N(R) ₂ 、-C(O)OR、-OC(O)R、-CX ₃ 、-CX ₂ H、-CXH ₂ 、-CN、-C(O)N(R) ₂ 、-N(R)C(O)R、-N(R)S(O) ₂ R、-N(R)C(O)N(R) ₂ 、-N(R)C(S)N(R) ₂ 、-CRN(R) ₂ C(O)OR、-N(R)R ₈ 、-O(CH ₂ ) _n OR、-N(R)C(＝NR ₉ )N(R) ₂ 、-N(R)C(＝CHR ₉ )N(R) ₂ 、-OC(O)N(R) ₂ 、-N(R)C(O)OR、-N(OR)C(O)R、-N(O R)S(O) ₂ R、-N(OR)C(O)OR、-N(OR)C(O)N(R) ₂ 、-N(OR)C(S)N(R) ₂ 、-N(OR)C(＝NR ₉ )N(R) ₂ 、-N(OR)C(＝CHR ₉ )N(R) ₂ 、-C(＝NR ₉ )N(R) ₂ 、-C(＝NR ₉ ) R, -C (O) N (R) OR and a 5-to 14-membered heterocycloalkyl having one OR more heteroatoms selected from N, O and S, which is substituted with one OR more groups selected from oxo (=O), OH, amino, mono-OR dialkylamino and C _1-3 Substituents of the alkyl group are substituted, and each n is independently selected from 1, 2, 3, 4, and 5;

Each R ₅ Independently selected from C _1-3 Alkyl group,C _2-3 Alkenyl and H;

each R ₆ Independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

R ₇ selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

R ₈ selected from C _3-6 Carbocycles and heterocycles;

each R is independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R is independently selected from C _1-12 Alkyl and C _2-12 Alkenyl groups;

each Y is independently C _3-6 A carbocycle;

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or a salt or isomer thereof.

R ₄ selected from C _3-6 Carbocycles, - (CH) ₂ ) _n Q、-(CH ₂ ) _n CHQR、-CHQR、-CQ(R) ₂ And unsubstituted C _1-6 Alkyl, wherein Q is selected from the group consisting of C _3-6 Carbocycles, 5-to 14-membered heterocycles, -OR, -O (CH) with one OR more heteroatoms selected from N, O and S ₂ ) _n N(R) ₂ 、-C(O)OR、-OC(O)R、-CX ₃ 、-CX ₂ H、-CXH ₂ 、-CN、-C(O)N(R) ₂ 、-N(R)C(O)R、-N(R)S(O) ₂ R、-N(R)C(O)N(R) ₂ 、-N(R)C(S)N(R) ₂ 、-CRN(R) ₂ C(O)OR、-N(R)R ₈ 、-O(CH ₂ ) _n OR、-N(R)C(＝NR ₉ )N(R) ₂ 、-N(R)C(＝CHR ₉ )N(R) ₂ 、-OC(O)N(R) ₂ 、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O) ₂ R、-N(OR)C(O)OR、-N(OR)C(O)N(R) ₂ 、-N(OR)C(S)N(R) ₂ 、-N(OR)C(＝NR ₉ )N(R) ₂ ,-N(OR)C(＝CHR ₉ )N(R) ₂ 、-C(＝NR ₉ ) R, -C (O) N (R) OR and-C (=NR) ₉ )N(R) ₂ And each n is independently selected from 1, 2, 3, 4, and 5; and when Q is a 5-to 14-membered heterocycle and (i) R ₄ Is- (CH) ₂ ) _n Q, wherein n is 1 or 2, or (ii) R ₄ Is- (CH) ₂ ) _n CHQR wherein n is 1, or (iii) R ₄ is-CHQR and-CQ (R) ₂ When Q is a 5-to 14-membered heteroaryl or an 8-to 14-membered heterocycloalkyl;

each R ₅ Independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R ₆ Independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

m and M ' are independently selected from the group consisting of-C (O) O-, -OC (O) -, -C (O) N (R ') -, -N (R ') C (O) -, -C (S) S-, -SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O) ₂ -, -S-, aryl and heteroaryl;

R ₇ selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

R ₈ selected from C _3-6 Carbocycles and heterocycles;

each R is independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R is independently selected from C _1-12 Alkyl and C _2-12 Alkenyl groups;

each Y is independently C _3-6 A carbocycle;

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or a salt or isomer thereof.

R ₄ selected from C _3-6 Carbocycles, - (CH) ₂ ) _n Q、-(CH ₂ ) _n CHQR、-CHQR、-CQ(R) ₂ And unsubstituted C _1-6 Alkyl, wherein Q is selected from the group consisting of C _3-6 Carbocycles, 5-to 14-membered heteroaryl groups, -OR, -O (CH) having one OR more heteroatoms selected from N, O and S ₂ ) _n N(R) ₂ 、-C(O)OR、-OC(O)R、-CX ₃ 、-CX ₂ H、-CXH ₂ 、-CN、-C(O)N(R) ₂ 、-N(R)C(O)R、-N(R)S(O) ₂ R、-N(R)C(O)N(R) ₂ 、-N(R)C(S)N(R) ₂ 、-CRN(R) ₂ C(O)OR、-N(R)R ₈ 、-O(CH ₂ ) _n OR、-N(R)C(＝NR ₉ )N(R) ₂ 、-N(R)C(＝CHR ₉ )N(R) ₂ 、-OC(O)N(R) ₂ 、-N(R)C(O)OR、-N(OR)C(O)R、-N(O R)S(O) ₂ R、-N(OR)C(O)OR、-N(OR)C(O)N(R) ₂ 、-N(OR)C(S)N(R) ₂ 、-N(OR)C(＝NR ₉ )N(R) ₂ 、-N(OR)C(＝CHR ₉ )N(R) ₂ 、-C(＝NR ₉ ) R, -C (O) N (R) OR and-C (=NR) ₉ )N(R) ₂ And each n is independently selected from 1, 2, 3, 4, and 5;

each R ₅ Independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R ₆ Independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

R ₇ selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

R ₈ selected from C _3-6 Carbocycles and heterocycles;

each R is independentlyIs selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R is independently selected from C _1-12 Alkyl and C _2-12 Alkenyl groups;

each Y is independently C _3-6 A carbocycle;

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or a salt or isomer thereof.

R ₂ and R is ₃ Independently selected from H, C _2-14 Alkyl, C _2-14 Alkenyl, -R-YR ', -YR ' and-R-OR ', OR R ₂ And R is ₃ Together with the atoms to which they are attached, form a heterocyclic or carbocyclic ring;

R ₄ is- (CH) ₂ ) _n Q or- (CH) ₂ ) _n CHQR wherein Q is-N (R) ₂ And n is selected from 3, 4 and 5;

each R ₅ Independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R ₆ Independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

R ₇ selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R is independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R is independently selected from C _1-12 Alkyl and C _1-12 Alkenyl groups;

each Y is independently C _3-6 A carbocycle;

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or a salt or isomer thereof.

R ₂ and R is ₃ Independently selected from C _1-14 Alkyl, C _2-14 Alkenyl, -R-YR ', -YR ' and-R-OR ', OR R ₂ And R is ₃ Forms, together with the atoms to which they are attached, a heterocyclic or carbocyclic ring;

R ₄ selected from the group consisting of- (CH) ₂ ) _n Q、-(CH ₂ ) _n CHQR, -CHQR and-CQ (R) ₂ A group consisting of wherein Q is-N (R) ₂ And n is selected from 1, 2, 3, 4 and 5;

each R ₅ Independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R ₆ Independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

m and M' are independently selected from the group consisting of-C (O) O-、-OC(O)-、-C(O)N(R’)-、-N(R’)C(O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O) ₂ -, -S-, aryl and heteroaryl;

R ₇ selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R is independently selected from C _1-3 Alkyl, C _2-3 Alkenyl and H;

each R is independently selected from C _1-12 Alkyl and C _1-12 Alkenyl groups;

each Y is independently C _3-6 A carbocycle;

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or a salt or isomer thereof.

In some embodiments, a subset of compounds of formula (I) include those of formula (IA):

or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4 and 5; m is selected from 5, 6, 7, 8 and 9; m is M ₁ Is a bond or M'; r is R ₄ Is unsubstituted C _1-3 Alkyl or- (CH) ₂ ) _n Q, wherein Q is OH, -NHC (S) N (R) ₂ 、-NHC(O)N(R) ₂ 、-N(R)C(O)R、-N(R)S(O) ₂ R、-N(R)R ₈ 、-NHC(＝NR ₉ )N(R) ₂ 、-NHC(＝CHR ₉ )N(R) ₂ 、-OC(O)N(R) ₂ -N (R) C (O) OR, heteroaryl OR heterocycloalkyl; m and M ' are independently selected from the group consisting of-C (O) O-, -OC (O) -, -C (O) N (R ') -, -P (O) (OR ') O-, -S-S-, aryl and heteroarylThe method comprises the steps of carrying out a first treatment on the surface of the And R is ₂ And R is ₃ Independently selected from H, C _1-14 Alkyl and C _2-14 Alkenyl groups.

In some embodiments, a subset of compounds of formula (I) include those of formula (II):

or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4 and 5; m is M ₁ Is a bond or M'; r is R ₄ Is unsubstituted C _1-3 Alkyl or- (CH) ₂ ) _n Q, wherein N is 2, 3 or 4, and Q is OH, -NHC (S) N (R) ₂ 、-NHC(O)N(R) ₂ 、-N(R)C(O)R、-N(R)S(O) ₂ R、-N(R)R ₈ 、-NHC(＝NR ₉ )N(R) ₂ 、-NHC(＝CH R ₉ )N(R) ₂ 、-OC(O)N(R) ₂ -N (R) C (O) OR, heteroaryl OR heterocycloalkyl; m and M ' are independently selected from the group consisting of-C (O) O-, -OC (O) -, -C (O) N (R ') -, -P (O) (OR ') O-, -S-S-, aryl, heteroaryl; and R is ₂ And R is ₃ Independently selected from H, C _1-14 Alkyl and C _2-14 Alkenyl groups.

In some embodiments, a subset of compounds of formula (I) include those of formula (IIa), (IIb), (IIc), or (IIe):

or a salt or isomer thereof, wherein R ₄ As described herein.

In some embodiments, a subset of compounds of formula (I) include those of formula (IId):

or a salt or isomer thereof, wherein n is 2, 3 or 4; and m, R' and R ₂ To R ₆ As described herein. For example, R ₂ And R is ₃ Each independently selected from the group consisting of C _5-14 Alkyl and C _5-14 Alkenyl groups.

In some embodiments, the ionizable amino lipids of the present disclosure comprise a compound having the structure:

in some embodiments, the non-cationic lipids of the present disclosure comprise 1, 2-distearoyl-sn-glycero-3-phosphorylcholine (DSPC), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (POPC), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (DLPC), 1, 2-dimyristoyl-sn-glycero-phosphorylcholine (DMPC), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (DOPC), l, 2-dipalmitoyl-sn-glycero-3-phosphorylcholine (DPPC), 1, 2-dioleoyl-sn-glycero-phosphorylcholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphorylcholine (POPC), 1, 2-dioleoyl-2-cholesterol hemisuccinyl-sn-glycero-3-phosphorylcholine (18:0 diether PC), 1-oleoyl-2-cholesterol hemisuccinyl-sn-3-phosphorylcholine (ocpc), l, 2-dipalmitoyl-sn-glycero-3-phosphorylcholine (dpp), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (dpp choline, 16-C), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (lyc), and 16-phosphorylcholine (C) 1, 2-didodecylhexaenoyl-sn-glycero-3-phosphorylcholine, 1, 2-didodecyloyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1, 2-distearoyl-sn-glycero-3-phosphoethanolamine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, 1, 2-didodecyloyl-sn-glycero-3-phosphoethanolamine, 1, 2-dioleoyl-sn-glycero-3-phospho-rac- (1-glycero) sodium salt (DOPG), sphingomyelin, and mixtures thereof.

In some embodiments, the PEG-modified lipids of the present disclosure include PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG-modified lipid is DMG-PEG, PEG-c-DOMG (also known as PEG-DOMG), PEG-DSG, and/or PEG-DPG.

In some embodiments, sterols of the present disclosure include cholesterol, stigmasterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, lycorine, ursolic acid, alpha-tocopherol, and mixtures thereof.

In some embodiments, the LNP of the present disclosure comprises an ionizable amino lipid of compound 1, wherein the non-cationic lipid is DSPC, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG (e.g., PEG 2000-DMG).

In some embodiments, the lipid nanoparticle comprises 45-55 mole% (mol%) of the ionizable amino lipid (e.g., compound 1). For example, the lipid nanoparticle may comprise 45-47, 45-48, 45-49, 45-50, 45-52, 46-48, 46-49, 46-50, 46-52, 46-55, 47-48, 47-49, 47-50, 47-52, 47-55, 48-50, 48-52, 48-55, 49-50, 49-52, 49-55, or 50-55 mole% of the ionizable amino lipid (e.g., compound 1). For example, the lipid nanoparticle may comprise 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 mole% of the ionizable amino lipid.

In some embodiments, the lipid nanoparticle comprises 5-15mol% non-cationic (neutral) lipids (e.g., DSPC). For example, the lipid nanoparticle may comprise 5-6, 5-7, 5-8, 5-9, 5-10, 5-11, 5-12, 5-13, 5-14, 5-15, 6-7, 6-8, 6-9, 6-10, 6-11, 6-12, 6-13, 6-14, 6-15, 7-8, 7-9, 7-10, 7-11, 7-12, 7-13, 7-14, 7-15, 8-9, 8-10, 8-11, 8-12, 8-13, 8-14, 8-15, 9-10, 9-11, 9-12, 9-13, 9-14, 9-15, 10-11, 10-12, 10-13, 10-14, 10-15, 11-12, 11-13, 11-14, 12-13, 13-15, or 14-15mol% non-cationic (e.g., DSPC). For example, the lipid nanoparticle may comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15mol% dspc.

In some embodiments, the lipid nanoparticle comprises 35-40mol% sterols (e.g., cholesterol). For example, the lipid nanoparticle may comprise 35-36, 35-37, 35-38, 35-39, 35-40, 36-37, 36-38, 36-39, 36-40, 37-38, 37-39, 37-40, 38-39, 38-40, or 39-40 mole% cholesterol. For example, the lipid nanoparticle may comprise 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, or 40mol% cholesterol.

In some embodiments, the lipid nanoparticle comprises 1-3mol% dmg-PEG. For example, the lipid nanoparticle may comprise 1-1.5, 1-2, 1-2.5, 1-3, 1.5-2, 1.5-2.5, 1.5-3, 2-2.5, 2-3, or 2.5-3 mole% DMG-PEG. For example, the lipid nanoparticle may comprise 1, 1.5, 2, 2.5, or 3mol% dmg-PEG.

In some embodiments, the lipid nanoparticle comprises 50mol% ionizable amino lipid, 10mol% dspc, 38.5mol% cholesterol, and 1.5mol% dmg-PEG. In some embodiments, the lipid nanoparticle comprises 48mol% ionizable amino lipid, 11mol% dspc, 38.5mol% cholesterol, and 2.5mol% peg2000-DMG.

In some embodiments, the LNP of the disclosure comprises an N to P ratio of about 2:1 to about 30:1.

In some embodiments, the LNP of the disclosure comprises an N to P ratio of about 6:1.

In some embodiments, the LNP of the disclosure comprises an N to P ratio of about 3:1.

In some embodiments, the LNP of the present disclosure comprises a wt/wt ratio of ionizable amino lipid composition to RNA of about 10:1 to about 100:1.

In some embodiments, the LNP of the present disclosure comprises a wt/wt ratio of ionizable amino lipid composition to RNA of about 20:1.

In some embodiments, the LNP of the present disclosure comprises a wt/wt ratio of ionizable amino lipid composition to RNA of about 10:1.

In some embodiments, the LNP of the present disclosure has an average diameter of about 50nm to about 150 nm.

In some embodiments, the LNP of the present disclosure has an average diameter of about 70nm to about 120 nm.

Multivalent vaccine

A composition as provided herein may comprise one RNA or multiple RNAs encoding two or more antigens of the same or different species; that is, the composition may be a multivalent composition (e.g., vaccine). In some embodiments, the composition comprises one RNA or more RNAs encoding two or more respiratory viral antigens. In some embodiments, the RNA can encode 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more respiratory tract viral antigens.

In some embodiments, two or more different mrnas encoding antigens may be formulated in the same lipid nanoparticle (e.g., four NA antigens and four HA antigens are formulated in a single lipid nanoparticle, or an influenza antigen and a coronavirus antigen are formulated in a single lipid nanoparticle). In other embodiments, two or more different antigen-encoding RNAs may be formulated in separate lipid nanoparticles (each mRNA formulated in a single lipid nanoparticle). The lipid nanoparticles can then be combined and administered as a single vaccine composition (e.g., comprising multiple RNAs encoding multiple antigens), or can be administered separately.

Pharmaceutical preparation

Provided herein are compositions (e.g., pharmaceutical compositions), methods, kits, and reagents for preventing or treating respiratory viruses, such as humans and other mammals. The compositions provided herein are useful as therapeutic or prophylactic agents. They are useful in medicine for the prevention and/or treatment of respiratory viral infections.

In some embodiments, an RNA-containing respiratory viral vaccine as described herein can be administered to a subject (e.g., a mammalian subject, such as a human subject), and the RNA polynucleotide is translated in vivo to produce an antigenic polypeptide (antigen).

The effective amount of the composition (e.g., comprising RNA) is based at least in part on the target tissue, the target cell type, the mode of administration, the physical characteristics of the RNA (e.g., length, nucleotide composition, and/or extent of nucleoside modification), other components of the vaccine, and other determinants such as the age, weight, height, sex, and general health of the subject. Generally, an effective amount of the composition provides an induced or enhanced immune response as a function of antigen production in the cells of the subject. In some embodiments, the effective amount is an amount necessary to prevent an infection or reduce the severity of a respiratory tract infection in a subject based on a single dose of the combination vaccine or a single dose of the combination vaccine plus a booster dose. In some embodiments, an effective amount of a composition comprising an RNA polynucleotide having at least one chemical modification is more effective than a composition comprising a corresponding unmodified polynucleotide encoding the same antigen or peptide antigen. Increased antigen production may be demonstrated by increased cell transfection (percentage of cells transfected with RNA vaccine), increased protein translation and/or expression of the polynucleotide, decreased nucleic acid degradation (as demonstrated, for example, by increased duration of protein translation by the modified polynucleotide), or altered antigen-specific immune response of the host cell.

The term "pharmaceutical composition" refers to a combination of an active agent and an inert or active carrier, thereby making the composition particularly suitable for diagnostic or therapeutic use in vivo or ex vivo. The "pharmaceutically acceptable carrier" does not cause an undesirable physiological effect upon administration to or on a subject. The carrier in the pharmaceutical composition must also be "acceptable", i.e. it is compatible with the active ingredient and capable of stabilizing the active ingredient. One or more solubilizing agents can be used as a pharmaceutical carrier for delivering the active agent. Examples of pharmaceutically acceptable carriers include, but are not limited to, biocompatible vehicles, adjuvants, additives, and diluents, to obtain compositions useful as dosage forms. Examples of other carriers include colloidal silica, magnesium stearate, cellulose and sodium lauryl sulfate. Other suitable pharmaceutical carriers and diluents and the pharmaceutical necessities for their use are described in Remington's Pharmaceutical Sciences.

In some embodiments, compositions according to the present disclosure (including polynucleotides and polypeptides encoded thereby) are useful for treating or preventing respiratory viral infections. The composition may be administered prophylactically or therapeutically to a healthy individual as part of an active immunization regimen, or during active infection at a latent stage or after symptoms appear at an early stage of infection. In some embodiments, the amount of RNA provided to a cell, tissue, or subject may be an amount effective for immunoprophylaxis.

The vaccines disclosed herein can be administered to a subject as a combination vaccine (i.e., wherein the two mrnas encoding the antigen are contained in the same formulation) or as separate vaccines (i.e., the mRNA encoding the influenza antigen and the mRNA encoding the coronavirus antigen are administered separately) to induce an antigen-specific immune response. When the vaccine is administered as a separate vaccine, the two mrnas may be administered to the subject simultaneously (i.e., within one hour of each other) or at different times (i.e., more than one hour apart, 12 hours apart, 24 hours apart, 2 days apart, 7 days apart, 2 weeks apart). When the vaccine is administered as a separate vaccine, the two mrnas may be administered to the same site or to different sites of the subject (i.e., as injections in separate arms). In some embodiments, the combination vaccine may be the only vaccine that the subject receives that comprises a nucleic acid encoding an influenza or coronavirus antigen. Alternatively, the vaccine may be administered as a priming dose and/or boosting dose in various combinations.

The vaccine may be administered to a seropositive or seronegative subject. For example, the subject may be naive and not have antibodies reactive with a virus having an antigen, wherein the antigen is a viral antigen encoded by the mRNA of the vaccine or a fragment thereof. Such subjects are considered seronegative for the vaccine. Alternatively, the subject may have pre-existing antibodies to the viral antigen encoded by the mRNA of the vaccine, as they have previously been infected with the virus carrying the antigen, or may have previously been administered a dose of vaccine (e.g., an mRNA vaccine) that induces antibodies to the antigen. Such subjects are considered to be seropositive for the vaccine. In some cases, the subject may have been previously exposed to the virus but not to a particular variant or strain of the virus or a particular vaccine associated with the variant or strain. Such subjects are considered seronegative for a particular variant or strain.

Thus, the present disclosure provides compositions (e.g., mRNA vaccines) that elicit potent neutralizing antibodies against influenza and coronavirus antigens in a subject. In some embodiments, such compositions may be administered to a seropositive or seronegative subject. Seronegative subjects may be naive and do not have antibodies that react with the particular virus to which the subject is immunized. Seropositive subjects may have pre-existing antibodies to that particular virus because they have previously been infected with that virus, variant or strain, or may have previously been administered a dose of vaccine (e.g., an mRNA vaccine) that induces antibodies to that virus, variant or strain.

In some embodiments, the composition comprises mRNA encoding at least one (e.g., one, two, or more) coronavirus antigen, such as SARS-CoV-2 antigen from a different SARS-CoV-2 mutant (also referred to herein as a variant). In some embodiments, the mRNA vaccine comprises multiple mrnas encoding SARS-CoV-2 antigens from different variants in a single lipid nanoparticle.

The compositions may be administered with other prophylactic or therapeutic compounds. As non-limiting examples, the prophylactic or therapeutic compound may be an adjuvant or a booster. As used herein, when referring to a prophylactic composition such as a vaccine, the term "booster" or "booster vaccine" refers to the additional administration of a prophylactic combination (vaccine) composition. In some embodiments, the booster vaccine comprises at least one mRNA polynucleotide having an ORF encoding the first, second, or third respiratory virus antigenic polypeptide. In some embodiments, the booster vaccine comprises at least one mRNA polynucleotide having an ORF encoding each of the first, second, and third respiratory virus antigenic polypeptides. In some embodiments, the booster vaccine comprises at least one mRNA polynucleotide having an ORF encoding a variant of the first, second, or third respiratory virus antigenic polypeptide.

The booster (or booster vaccine) may be administered after an earlier administration of the prophylactic composition. In some embodiments, the combination vaccine is a seasonal booster vaccine (e.g., the combination vaccine is administered once a year, such as in autumn or winter each year). The time between initial administration of the prophylactic composition and the booster may be, but is not limited to, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months. In exemplary embodiments, the time of administration between the initial administration of the prophylactic composition and the booster may be, but is not limited to, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, or 6 months. In one embodiment, the booster vaccine is administered between three weeks and one year after the combination vaccine.

In some embodiments, the composition may be administered intramuscularly, intranasally, or intradermally, similar to administration of inactivated vaccines known in the art.

The composition may be used in a variety of environments depending on the prevalence of the infection or the degree or level of unmet medical need. As a non-limiting example, RNA vaccines can be used to treat and/or prevent a variety of infectious diseases. RNA vaccines have superior properties in that they produce greater antibody titers, better neutralizing immunity, produce a longer lasting immune response, and/or a more premature response than commercially available vaccines.

Provided herein are pharmaceutical compositions comprising RNA and/or complexes optionally in combination with one or more pharmaceutically acceptable excipients.

The RNA may be formulated or administered alone or in combination with one or more other components. For example, the immune composition may include other components, including but not limited to adjuvants.

In some embodiments, the immune compositions do not contain an adjuvant (they do not contain an adjuvant).

The RNA can be formulated or administered in combination with one or more pharmaceutically acceptable excipients. In some embodiments, the vaccine composition comprises at least one additional active substance, such as, for example, a therapeutically active substance, a prophylactically active substance, or a combination of both. The vaccine composition may be sterile, pyrogen-free or both sterile and pyrogen-free. General considerations in formulating and/or manufacturing pharmaceutical agents such as vaccine compositions can be found, for example, in Remington, the Science and Practice of Pharmacy, 21 st edition, lippincott Williams & Wilkins,2005 (incorporated herein by reference in its entirety).

In some embodiments, the immune composition is administered to a human, human patient, or subject. For the purposes of this disclosure, the phrase "active ingredient" generally refers to an RNA vaccine or a polynucleotide contained therein, such as an RNA polynucleotide (e.g., an mRNA polynucleotide) encoding an antigen.

The formulation of the vaccine compositions described herein may be prepared by any method known in the pharmacological arts or later developed. Generally, such preparation methods comprise the following steps: the active ingredient (e.g., mRNA polynucleotide) is associated with an excipient and/or one or more other adjunct ingredients, and then, if necessary and/or desired, the product is divided, shaped, and/or packaged into the desired single or multiple dose units.

The relative amounts of the active ingredient, pharmaceutically acceptable excipients, and/or any additional ingredients in the pharmaceutical compositions according to the present disclosure will vary depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route of administration of the composition. For example, the composition may comprise between 0.1% and 100%, such as between 0.5% and 50%, between 1% -30%, between 5% -80%, at least 80% (w/w) of the active ingredient.

In some embodiments, the RNA is formulated using one or more excipients to: (1) increased stability; (2) increasing cell transfection; (3) Allowing sustained or delayed release (e.g., from a depot formulation); (4) Altering the biodistribution (e.g., for a particular tissue or cell type); (5) increasing in vivo translation of the encoded protein; and/or (6) altering the in vivo release profile of the encoded protein (antigen). In addition to conventional excipients such as any and all solvents, dispersion media, diluents or other liquid vehicles, dispersing or suspending aids, surfactants, isotonic agents, thickening or emulsifying agents, preservatives, excipients may include, but are not limited to, lipids, liposomes, lipid nanoparticles, polymers, lipid complexes, core-shell nanoparticles, peptides, proteins, cells transfected with RNA (e.g., for implantation into a subject), hyaluronidase, nanoparticle mimics, and combinations thereof.

Administration/administration

Provided herein are immune compositions (e.g., RNA vaccines), methods, kits, and reagents for preventing and/or treating at least one respiratory viral infection in humans and other mammals. The immune composition can be used as a therapeutic or prophylactic agent. In some embodiments, the immune composition is used to provide prophylactic protection against respiratory viral infection. In some embodiments, the immune composition is used to treat a respiratory viral infection. In some embodiments, the immune composition is used to reduce the severity of a respiratory viral infection in a subject. In some embodiments, the immune composition is used to elicit immune effector cells, e.g., to activate Peripheral Blood Mononuclear Cells (PBMCs) ex vivo, which are then infused (re-infused) into a subject.

The subject can be any mammal, including non-human primate and human subjects. Typically, the subject is a human subject. In some embodiments, the subject is aged 60 years or older (e.g., 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 years or older). In some embodiments, the subject is less than 18 years old (e.g., less than 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 year old).

In some embodiments, the immune composition (e.g., RNA vaccine) is administered to a subject (e.g., a mammalian subject, such as a human subject) in an amount effective to induce an antigen-specific immune response. RNA encoding respiratory viral antigens is expressed and translated in vivo to produce the antigen, which then stimulates the immune response of the subject.

Upon administration of the immune compositions (e.g., RNA vaccines) of the present disclosure, prophylactic protection against respiratory viruses can be achieved. The immunization vaccine may be administered once, twice, three times, four times or more, but it may be sufficient to administer the vaccine once (optionally followed by a single booster). Although less desirable, the immune composition may be administered to an infected individual to achieve a therapeutic response. The dose may need to be adjusted accordingly.

In aspects of the disclosure, a method of eliciting an immune response against a respiratory viral antigen (or antigens) in a subject is provided. In some embodiments, the method comprises administering to the subject an immune composition comprising an mRNA having an open reading frame encoding a respiratory viral antigen, thereby inducing a specific immune response against the respiratory viral antigen in the subject, wherein the anti-antigen antibody titer in the subject is increased after vaccination relative to the anti-antigen antibody titer in a subject vaccinated with a prophylactically effective dose of a traditional vaccine against the antigen. An "anti-antigen antibody" is a serum antibody that specifically binds to an antigen.

A prophylactically effective dose is one that prevents viral infection at a clinically acceptable level. In some embodiments, the effective dose is a dose listed in the vaccine package instructions. As used herein, a traditional vaccine refers to a vaccine other than the mRNA vaccine of the present disclosure. For example, traditional vaccines include, but are not limited to, live microbial vaccines, inactivated microbial vaccines, subunit vaccines, protein antigen vaccines, DNA vaccines, virus-like particle (VLP) vaccines, and the like. In exemplary embodiments, a traditional vaccine is a vaccine that has been approved by a regulatory authority and/or registered by a national drug administration (e.g., the U.S. Food and Drug Administration (FDA) or european drug administration (EMA)).

In some embodiments, the anti-antigen antibody titer in the subject after vaccination is increased from 1log to 10log relative to the anti-antigen antibody titer in a subject vaccinated with a prophylactically effective dose of a traditional vaccine against respiratory viruses or in a non-vaccinated subject. In some embodiments, the anti-antigen antibody titer in the subject after vaccination is increased by 1log, 2log, 3log, 4log, 5log, or 10log relative to the anti-antigen antibody titer in a subject vaccinated with a prophylactically effective dose of a traditional vaccine against respiratory viruses or in a non-vaccinated subject.

In other aspects of the disclosure, a method of eliciting an immune response against a respiratory virus in a subject is provided. The methods involve administering to a subject an immune composition (e.g., an RNA vaccine) comprising an RNA polynucleotide comprising an open reading frame encoding a respiratory viral antigen, thereby inducing an immune response specific for a respiratory virus in the subject; wherein the immune response in the subject is equivalent to the immune response in a subject vaccinated with a traditional vaccine against respiratory viruses at a dose level of 2-fold to 100-fold relative to the immune composition.

In some embodiments, the immune response in a subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at twice the dosage level relative to the immune composition of the present disclosure. In some embodiments, the immune response in a subject is equivalent to the immune response in a subject vaccinated with a traditional vaccine at three times the dosage level relative to the immune composition of the present disclosure. In some embodiments, the immune response in a subject is equivalent to the immune response in a subject vaccinated with a 4-fold, 5-fold, 10-fold, 50-fold, or 100-fold dose level of a traditional vaccine relative to an immune composition of the present disclosure. In some embodiments, the immune response in a subject is equivalent to the immune response in a subject vaccinated with a 10-fold to 1000-fold dosage level of a traditional vaccine relative to an immune composition of the present disclosure. In some embodiments, the immune response in a subject is equivalent to the immune response in a subject vaccinated with a 100-fold to 1000-fold dosage level of a traditional vaccine relative to an immune composition of the present disclosure.

In other embodiments, the immune response is assessed by measuring [ protein ] antibody titers in the subject. In other embodiments, the ability to promote a robust T cell response is measured using art-recognized techniques.

Other aspects of the disclosure provide methods of eliciting an immune response against a respiratory virus in a subject by: administering to the subject an immune composition (e.g., an RNA vaccine) comprising RNA having an open reading frame encoding an respiratory viral antigen, thereby inducing an immune response specific for the respiratory viral antigen in the subject, wherein the immune response in the subject is induced 2 days to 10 weeks earlier relative to the immune response induced in a subject vaccinated with a prophylactically effective dose of a traditional vaccine against a respiratory virus. In some embodiments, the immune response in the subject is induced in a subject vaccinated with a prophylactically effective dose of a traditional vaccine at a dose level of 2-fold to 100-fold relative to the immune composition of the present disclosure.

In some embodiments, the immune response in the subject is induced 2 days, 3 days, 1 week, 2 weeks, 3 weeks, 5 weeks, or 10 weeks earlier relative to the immune response induced in a subject vaccinated with a prophylactically effective dose of a traditional vaccine.

Also provided herein are methods of eliciting an immune response against a respiratory virus in a subject by administering to the subject an RNA having an open reading frame encoding a first antigen, wherein the RNA does not include a stabilizing element, and wherein the adjuvant is not co-formulated or co-administered with the vaccine.

The immune composition (e.g., RNA vaccine) can be administered by any route that produces a therapeutically effective result. These routes include, but are not limited to, intradermal, intramuscular, intranasal, and/or subcutaneous administration. The present disclosure provides methods comprising administering an RNA vaccine to a subject in need thereof. The exact amount required will vary from subject to subject depending on the species, age and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. RNA is typically formulated in dosage unit form to facilitate administration and uniformity of dosage. However, it should be understood that the total daily amount of RNA may be determined by the attending physician within the scope of sound medical judgment. The particular therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular patient will depend on a variety of factors including the disorder being treated and the severity of the disorder; the activity of the particular compound used; the specific composition employed; age, weight, general health, sex and diet of the patient; the time of administration, route of administration and rate of excretion of the particular compound being used; duration of treatment; a medicament for use in combination or simultaneously with the particular compound used; and similar factors well known in the medical arts.

An effective amount of RNA as provided herein may be as low as 25 μg (total mRNA), for example administered as a single dose or as two 12.5 μg doses. As used herein, "dose" represents the sum of the RNAs in the composition (e.g., including all NA antigens and/or HA antigens in the formulation). In some embodiments, the effective amount is a total dose of 25 μg to 300 μg, 50 μg to 300 μg, 100 μg to 300 μg, 150 μg to 300 μg, 200 μg to 300 μg, 250 μg to 300 μg, 150 μg to 200 μg, 150 μg to 250 μg, 150 μg to 300 μg, 200 μg to 250 μg, or 250 μg to 300 μg. For example, the effective amount may be a total dose of 25 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, 200 μg, 210 μg, 220 μg, 230 μg, 240 μg, 250 μg, 260 μg, 270 μg, 280 μg, 290 μg or 300 μg. In some embodiments, the effective amount is a total dose of 25 μg. In some embodiments, the effective amount is a total dose of 30 μg. In some embodiments, the effective amount is a total dose of 50 μg. In some embodiments, the effective amount is a total dose of 66 μg. In some embodiments, the effective amount is a total dose of 67 μg. In some embodiments, the effective amount is a total dose of 68 μg. In some embodiments, the effective amount is a total dose of 132 μg. In some embodiments, the effective amount is a total dose of 133 μg. In some embodiments, the effective amount is a total dose of 134 μg. In some embodiments, the effective amount is a total dose of 266 μg. In some embodiments, the effective amount is a total dose of 267 μg. In some embodiments, the effective amount is a total dose of 268 μg. In some embodiments, the effective amount is a total dose of 100 μg. In some embodiments, the effective amount is a total dose of 200 μg. In some embodiments, the effective amount is a total dose of 300 μg.

The RNAs described herein can be formulated into dosage forms described herein, such as intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous).

Vaccine efficacy

Some aspects of the disclosure provide for the preparation of an immune composition (e.g., an RNA vaccine) in which the RNA is formulated in an effective amount to generate an antigen-specific immune response (e.g., to generate respiratory virus antigen-specific antibodies) in a subject. An "effective amount" is an amount of RNA effective to produce an antigen-specific immune response. Also provided herein are methods of inducing an antigen-specific immune response in a subject.

As used herein, an immune response to a vaccine or LNP of the present disclosure is the generation of a humoral and/or cellular immune response in a subject against respiratory viral protein(s) present in the vaccine. For purposes of this disclosure, "humoral" immune response refers to an immune response mediated by antibody molecules, including, for example, secretory (IgA) or IgG molecules, while "cellular" immune response refers to an immune response mediated by T lymphocytes (e.g., CD4+ helper cells and/or CD8+ T cells (e.g., CTLs) and/or other leukocytes).

In some embodiments, the antigen-specific immune response is characterized by measuring the anti-respiratory virus antigen antibody titer produced in a subject administered an immune composition as provided herein. Antibody titer is a measure of the amount of antibody in a subject, e.g., antibody specific for a particular antigen or epitope of an antigen. Antibody titer is typically expressed as the reciprocal of the maximum dilution that provided a positive result. For example, enzyme-linked immunosorbent assay (ELISA) is a common assay for determining antibody titer.

In some embodiments, antibody titers are used to assess whether a subject has had an infection or to determine whether immunization is required. In some embodiments, antibody titers are used to determine the strength of the autoimmune response, determine whether booster immunization is required, determine whether a previous vaccine is effective, and identify any recent or previous infection. According to the present disclosure, antibody titers can be used to determine the intensity of an immune response induced in a subject by an immune composition (e.g., an RNA vaccine).

In some embodiments, the titer of anti-respiratory viral antigen antibodies produced in the subject is increased by at least 1log relative to a control. For example, the titer of anti-respiratory viral antigen antibodies produced in a subject can be increased by at least 1.5log, at least 2log, at least 2.5log, or at least 3log relative to a control. In some embodiments, the titer of anti-respiratory viral antigen antibodies produced in the subject is increased by 1log, 1.5log, 2log, 2.5log, or 3log relative to a control. In some embodiments, the titer of anti-respiratory viral antigen antibodies produced in the subject is increased 1-3log relative to a control. For example, the titer of anti-respiratory viral antigen antibodies produced in a subject can be increased by 1-1.5log, 1-2log, 1-2.5log, 1-3log, 1.5-2log, 1.5-2.5log, 1.5-3log, 2-2.5log, 2-3log, or 2.5-3log relative to a control.

In some embodiments, the anti-respiratory viral antigen antibody titer produced in the subject is increased at least 2-fold relative to a control. For example, the titer of anti-respiratory viral antigen antibodies produced in a subject can be increased at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold relative to a control. In some embodiments, the titer of anti-respiratory viral antigen antibodies produced in the subject is increased 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold relative to a control. In some embodiments, the anti-respiratory viral antigen antibody titer produced in the subject is increased between 2-10 fold relative to a control. For example, the titer of anti-respiratory viral antigen antibodies produced in a subject can be increased by a factor of 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8-10, 8-9, or 9-10 relative to a control.

In some embodiments, the antigen-specific immune response is measured as the ratio of Geometric Mean Titer (GMT), referred to as Geometric Mean Ratio (GMR), of serum neutralizing antibody titers against respiratory viruses. Geometric Mean Titer (GMT) is the mean antibody titer of a group of subjects calculated by multiplying all values and taking the n th power of the number, where n is the number of subjects with available data.

In some embodiments, the control is anti-respiratory viral antigen antibody titer produced in a subject who has not been administered an immune composition (e.g., an RNA vaccine). In some embodiments, the control is anti-respiratory viral antigen antibody titer generated in a subject administered a recombinant or purified protein vaccine. Recombinant protein vaccines typically include protein antigens produced in heterologous expression systems (e.g., bacteria or yeast) or purified from a large number of pathogenic organisms.

In some embodiments, the ability of an immune composition (e.g., an RNA vaccine) to be effective is measured in a murine model. For example, the immune composition can be administered to a murine model and the induction of neutralizing antibody titers in the murine model can be determined. Virus challenge studies can also be used to assess the efficacy of the vaccines of the present disclosure. For example, the immune composition can be administered to a murine model, the murine model is challenged with a virus, and survival and/or immune responses (e.g., neutralizing antibody responses, T cell responses (e.g., cytokine responses)) of the murine model are determined.

The "standard of care" as provided herein refers to medical or psychological treatment guidelines and may be general or specific. "standards of care" specify appropriate treatments based on scientific evidence and cooperation between medical professionals who are involved in treating a given condition. This is the diagnostic and therapeutic procedure that a doctor/clinician should follow for a certain type of patient, disease or clinical situation. A "standard of care dose" as provided herein refers to a dose of a recombinant or purified protein vaccine, or an attenuated live or inactivated vaccine, or VLP vaccine, that a doctor/clinician or other medical professional will administer to a subject to treat or prevent a respiratory viral infection or related condition while following standard of care guidelines for treating or preventing a respiratory viral infection or related condition.

In some embodiments, the anti-respiratory viral antigen antibody titer produced in a subject administered an effective amount of the immune composition is equivalent to the anti-respiratory viral antigen antibody titer produced in a control subject administered a standard-of-care dose of a recombinant or purified protein vaccine, or an attenuated live or inactivated vaccine, or a VLP vaccine.

Vaccine efficacy can be assessed using standard assays (see, e.g., weinberg et al, J effect Dis.2010, 1 month 6; 201 (11): 1607-10). For example, vaccine efficacy can be measured by double-blind, randomized, clinical control trials. Vaccine efficacy can be expressed as a proportional decrease in disease onset rate (AR) between unvaccinated (ARU) and vaccinated (ARV) study groups, and can be calculated from the relative risk of disease (RR) in vaccinated groups using the following formula:

efficacy= (ARU-ARV)/ARU x 100; and is also provided with

Efficacy= (1-RR) x 100.

Likewise, standard assays can be used to assess vaccine effectiveness (see, e.g., weinberg et al, J effect Dis.2010, 1/6; 201 (11): 1607-10). Vaccine effectiveness is an assessment of how vaccines (which may have been demonstrated to have high vaccine efficacy) reduce disease in humans. This measure can assess the net balance of benefits and adverse effects of vaccination programs (not just the vaccine itself) under natural field conditions, but not in controlled clinical trials. Vaccine effectiveness is proportional to vaccine efficacy (potency), but is also affected by the degree of immunization of the target group in the population and other non-vaccine related factors that affect the "real world" outcome of hospitalization, out-patient visits, or costs. For example, a retrospective case control analysis may be used, in which the vaccination rates between a set of infection cases and the appropriate control are compared. Vaccine effectiveness can be expressed as the ratio difference, the Odds Ratio (OR) that uses the use of the vaccine to seed but still cause infection:

Validity= (1-OR) x 100.

In some embodiments, the efficacy of the immune composition (e.g., RNA vaccine) is at least 60% relative to a control subject that is not vaccinated. For example, the efficacy of the immune composition can be at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 95%, at least 98%, or 100% relative to a control subject that is not vaccinated.

Eliminating sexual immunity. By eliminant immunity is meant a unique immune state that prevents an effective pathogen from infecting the host. In some embodiments, an effective amount of an immune composition of the present disclosure is sufficient to provide at least 1 year of eliminant immunity in a subject. For example, an effective amount of an immune composition of the present disclosure is sufficient to provide at least 2 years, at least 3 years, at least 4 years, or at least 5 years of an ablative immunity in a subject. In some embodiments, an effective amount of an immune composition of the present disclosure is sufficient to provide an eliminant immunity in a subject at a dose that is at least 5-fold lower relative to a control. For example, an effective amount may be sufficient to provide an eliminant immunity in the subject at a dose that is at least 10-fold, 15-fold, or 20-fold lower relative to the control.

Antigens may be detected. In some embodiments, an effective amount of an immune composition of the present disclosure is sufficient to produce detectable levels of respiratory viral antigen as measured in the subject's serum 1-72 hours after administration.

Titer. Antibody titer is a measure of the amount of an antibody in a subject, e.g., an antibody that is specific for a particular antigen (e.g., an anti-respiratory virus antigen). Antibody titer is typically expressed as the reciprocal of the maximum dilution that provided a positive result. For example, enzyme-linked immunosorbent assay (ELISA) is a common assay for determining antibody titer.

In some embodiments, an effective amount of an immune composition of the present disclosure is sufficient to produce a neutralizing antibody titer of 1,000-10,000 produced by neutralizing antibodies against respiratory viral antigens measured in the subject's serum 1-72 hours after administration. In some embodiments, the effective amount is sufficient to produce a neutralizing antibody titer of 1,000-5,000 produced by neutralizing antibodies against respiratory viral antigens measured in the subject's serum 1-72 hours after administration. In some embodiments, the effective amount is sufficient to produce a neutralizing antibody titer of 5,000-10,000 produced by neutralizing antibodies against respiratory viral antigens measured in the subject's serum 1-72 hours after administration.

In some embodiments, the neutralizing antibody titer is at least 100NT ₅₀ . For example, the neutralizing antibody titer can be at least 200, 300, 400, 500, 600, 700, 800, 900, or 1000NT ₅₀ . In some embodiments, the neutralizing antibody titer is at least 10,000NT ₅₀ 。

In some embodiments, the neutralizing antibody titer is at least 100 neutralizing units per milliliter (NU/mL). For example, the neutralizing antibody titer can be at least 200, 300, 400, 500, 600, 700, 800, 900, or 1000NU/mL. In some embodiments, the neutralizing antibody titer is at least 10,000NU/mL.

In some embodiments, the titer of anti-respiratory viral antigen antibodies produced in the subject is increased by at least 1log relative to a control. For example, the titer of anti-respiratory viral antigen antibodies produced in a subject can be increased by at least 2, 3, 4, 5, 6, 7, 8, 9, or 10log relative to a control.

In some embodiments, the anti-respiratory viral antigen antibody titer produced in the subject is increased at least 2-fold relative to a control. For example, the titer of anti-respiratory viral antigen antibodies produced in the subject is increased at least 3, 4, 5, 6, 7, 8, 9, or 10 fold relative to a control.

In some embodiments, the geometric mean, the nth root of the product of n numbers, is generally used to describe a proportional increase. In some embodiments, the geometric mean is used to characterize the antibody titer produced in the subject.

The control may be, for example, an unvaccinated subject or a subject administered an attenuated live virus vaccine, an inactivated virus vaccine, or a protein subunit vaccine.

Blood coagulation inhibition assay

Hemagglutination inhibition (HAI) assay is a classical laboratory procedure for classifying or subtype of hemagglutinating viruses and further determining the antigenic characteristics of influenza virus isolates, provided that the reference antisera used contains antibodies against the currently prevailing virus (see, e.g., pedersen JC Methods Mol biol.2014;1161: 11-25). The antisera used are based on antigen preparations derived from wild-type strains or high growth re-ligands made using wild-type strains or antigenically equivalent strains.

For assays, serial dilutions of virus were prepared in each row of U-or V-bottom 96-well microtiter plates. For example, the most concentrated sample in the first well may be diluted 1/5 times the stock solution, and subsequent wells may be diluted two times (1/10, 1/20, 1/40, etc.). The last well was used as a negative control without virus. Each row of the plate typically has a different virus and the same dilution pattern. After serial dilution, standardized concentrations of Red Blood Cells (RBCs) were added to each well and gently mixed. Plates were incubated at room temperature. After the incubation period, the assay can be analyzed to distinguish agglutinated from non-agglutinated wells. The relative concentration or titer of the virus sample is based on the last well to have agglutinated before precipitation is observed.

Serological methods such as HAI detection are critical for many epidemiological and immunological studies and for the assessment of antibody responses after vaccination. Serological methods are also useful in cases where virus cannot be identified (e.g., after viral discharge ceases). HAI detection is used to identify epidemic influenza viruses that are antigenically similar to influenza viruses in previous-season vaccines. As used herein, "antigenically similar" refers to viruses having HAI titers that differ by two times or less.

In some embodiments, HAI assays are used to measure the effectiveness of candidate vaccines (such as those provided herein). In some embodiments, the mRNA vaccine has a specific profile relative to a control (e.g., administration of a traditional seasonal influenza vaccine such asHAI titer of the subject) by a factor of 2, 3, 4, 5, 6, 7, 8, 9, or 10.

In some embodiments, an HA ELISA assay is performed to examine HA antibody titers (e.g., igG antibody titers) generated by administration of the candidate vaccine (see, e.g., examples 1, 2, 4, 7, and 8). In some embodiments, the mRNA vaccine HAs an HA IgG antibody titer that is increased 1-log, 2-log, 3-log, 4-log, 5-log, 6-log, 7-log, 8-log, 9-log, or 10-log relative to a control (e.g., PBS). In some embodiments, the control comprises HA-reactive IgG antibody titer in the subject prior to administration of the composition (e.g., vaccine). In some embodiments, the candidate vaccine HAs an HA IgG antibody titer that is increased 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold relative to a control.

Neuraminidase inhibition assay

Neuraminidase inhibition (NAI) assay is a laboratory procedure for identifying Neuraminidase (NA) glycoprotein subtypes in influenza viruses or NA subtype specificity of influenza virus antibodies (see, e.g., pedersen JC Methods Mol biol.2014;1161: 27-36). Serological procedures for NA glycoprotein subtype typing are critical to the identification and classification of Avian Influenza (AI) viruses.

Influenza NA assays based on the use of different substrate molecules have two basic formats, one based on long-term assays using large substrates such as fetuin (e.g., enzyme Linked Lectin Assay (ELLA)), and the other on newer assays using small substrate molecules. Fetuin-based methods for determining the efficacy of viral NA and thus for NA inhibitionStandardized NA dose measured by the system (NAI). Once determined, standardized doses were added to serial dilutions of test antisera, negative control serum, and reference anti-NA serum. Any inhibition of NA activity by serum can then be determined and NAI titers calculated. The small substrate-based method may be a fluorometric assay using the substrate 2- (4-methyl umbrella-type keto) - α -D-N-acetylneuraminic acid (munna). The substrate is added to serial dilutions of the test antisera and NA cleaves the substrate of munna, allowing release of the fluorescent product methylumbelliferone. The inhibition of influenza NA by serum was determined by the concentration of serum required to reduce NA activity by 50% in IC ₅₀ The values are given. Alternatively, the small substrate-based method can be a Chemiluminescent (CL) -based assay using sialic acid 1, 2-dioxetane derivative (NA-Star) substrates or modified NA-XTD substrates. CL assays provide chemiluminescent light signals for extended luminescence and achieve neuraminidase inhibitor IC50 values over a range of viral dilutions.

In some embodiments, the mRNA vaccine has a NAI titer that is increased 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold relative to a control. In some embodiments, the control is a traditional seasonal influenza vaccine that only comprises HA antigen (e.g., no NA antigen). In some embodiments, the control is a NAI titer value for wild-type NA. In some embodiments, the mRNA vaccine has a NAI titer at least 2-fold higher than the control value. In some embodiments, the NAI value of the vaccine is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or at least 99% of the control (e.g., the NAI value of wild-type NA).

In some embodiments, an NA ELISA assay is performed to examine NA antibody titers (e.g., igG antibody titers) generated by administration of a candidate vaccine (see, e.g., examples 1,2, 4, 7, and 8). In some embodiments, the mRNA vaccine has an increase in NA IgG antibody titer of 1-log, 2-log, 3-log, 4-log, 5-log, 6-log, 7-log, 8-log, 9-log, or 10-log relative to a control (e.g., PBS). In some embodiments, the control comprises NA reactive IgG antibody titer in the subject prior to administration of the composition (e.g., vaccine). In some embodiments, the candidate vaccine has an NA IgG antibody titer that is increased 1,2, 3, 4, 5, 6, 7, 8, 9, or 10 fold relative to a control.

Examples

Example 1 immunogenicity of combination vaccine (influenza, SARS-CoV-2)

In this example, different combinations of vaccines comprising mRNA encoding influenza and SARS-CoV-2 antigen were tested at High Dose (HD) and Low Dose (LD). In this study, antigens were formulated separately into different LNPs and mixed prior to administration. The experiments were performed as shown in table 1 below. The vaccine includes mRNA-1273 (mRNA encoding spike protein with two proline substitutions; SEQ ID NO: 15), four Hemagglutinin (HA) antigens combined mRNA-1010 (at a ratio of 1:1:1:1 (e.g., mass ratio) for evaluation of interference between HAs; SEQ ID NO:19, 20, 21 and 22) and mRNA-1020 (8 antigen mixture of four HAs combined with four Neuraminidase (NA) antigens (i.e., 1:1:1:1:1:1:1:1:1) for evaluation of any interference between HAs in the presence of NA; SEQ ID NO:19, 20, 21, 22, 23, 24, 25 and 26, respectively). All vaccines were tested individually (groups 2-7) and in combination with a mixture of SARS-CoV-2 and influenza vaccine (groups 8-11).

The dose was administered intramuscularly to mice on day 0 and serum samples were collected on day 21. IgG antibody titers were measured by ELISA against individual HA antigen, NA antigen and SARS-CoV-2Sp2 recombinant protein. As shown in fig. 1-3, the presence of other antigens in the combination vaccine did not reduce the neutralization titer against each individual antigen in the vaccine (e.g., similar neutralization titers were observed between the combination vaccine and the individual antigen vaccine). Figures 4-5 show the results of normalized geometric mean titers using IgG antibodies and demonstrate that high doses (group 8) of SARS-CoV-2/influenza (4 xHA) induced a strong antibody response against all components in the vaccine compared to single antigen administration (high dose level).

TABLE 1 study design

EXAMPLE 2 immunogenicity of combination vaccine (influenza, SARS-CoV-2) in different proportions

Different combinations of vaccines comprising mRNAs encoding influenza and SARS-CoV-2 antigen were tested in a ratio of 1:1 and 2:1, respectively. The experiments were performed as shown in table 2 below. The SARS-CoV-2 vaccine comprises mRNA-1273 (mRNA encoding spike protein with two proline substitutions; SEQ ID NO: 15), mRNA-1283 (mRNA encoding N-terminal domain of SARS-CoV-2 spike protein, receptor binding domain and influenza hemagglutinin transmembrane domain linked by a linker; SEQ ID NO: 17), or 1:1 ratio mixture of mRNA-1273 or mRNA-1283 and mRNA encoding spike protein of SARS-CoV-2B.1.351 (RSA) variant (mRNA-1273.351 and mRNA-1283.351; SEQ ID NO:16 and 18, respectively). Influenza vaccines comprise mRNA-1010 (1:1:1:1 ratio of mRNA encoding the four HA antigens; SEQ ID NOs: 19, 20, 21 and 22). All vaccines were tested by combination of influenza and SARS-CoV-2 vaccine mixtures tested individually (groups 2-7) and in 1:1 (groups 9, 11, 13 and 15) and 2:1 (groups 8, 10, 12 and 14) ratios.

The dose was administered to BALB/c mice on day 0 and serum samples were collected on days 21 and 36. IgG antibody titers were measured by ELISA against a single HA antigen and SARS-CoV-2SP2 recombinant protein. The results on day 21 shown in fig. 6-11 demonstrate that the presence of other antigens in the combination vaccine did not reduce the neutralization titer against each individual antigen in the vaccine (e.g., similar neutralization titers were observed between the combination vaccine and the individual antigen vaccine). In addition, similar neutralization titers were observed between the influenza: SARS-CoV-2 combination vaccine at 1:1 (groups 9, 11, 13 and 15) and 2:1 (groups 8, 10, 12 and 14) ratios for each individual antigen in the vaccine.

TABLE 2 study design

Example 3 immunogenicity of neuraminidase antigen mutations and HA/NA antigen ratios in mRNA vaccines against influenza

In this example, the immunogenicity of combinations of Neuraminidase (NA) antigen mutations E227D and D151G with different mass ratios of Hemagglutinin (HA) to NA antigen was measured in BALB/c mice as antibody titers. As summarized in table 3, the immunogenicity of the different vaccines was evaluated, the antibody titer and dose response between HA/NA antigens administered in a 1:1 to 3:1 ratio in mRNA vaccine was evaluated and compared to individual antigens. These vaccines include 8 different influenza glycoprotein antigens (groups 2-9 or SEQ ID NOS: 62, 63, 27, 28, 64, 65, 66, 67, respectively) containing separate test E227D or D151G neuraminidase antigen mutations; mRNA-1020 (four HA antigens (SEQ ID NO:19, 20, 21, 22) and four NA antigens in a ratio of 1:1:1:1:1:1:1) in combination with 2021/22 northern hemisphere (Northern Hemisphere) composition containing D151G (SEQ ID NO:27, 62, 64, 66) or E227D (SEQ ID NO:28, 63, 65, 67) neuraminidase antigen mutations (groups 10 and 11, respectively); or mRNA-1030 (four HA antigens (SEQ ID NO 19, 20, 21, 22) and four NA antigens in a ratio of 3:3:3:1:1:1:1) in combination with 2021/22 northern hemisphere compositions, containing mutations in the D151G (SEQ ID NO:27, 62, 64, 66) or E227D (SEQ ID NO:28, 63, 65, 67) neuraminidase antigens (groups 12 and 13, respectively).

BALB/c mice were administered mRNA vaccine or PBS (as a control), and blood samples were taken from the mice on day 21. IgG antibody titers against each of the different influenza glycoprotein antigens were determined using ELISA assays.

TABLE 3 study design

* NH-northern hemisphere

Example 4 immunogenicity of HA/NA antigen ratio in mRNA vaccine against influenza Virus prevalent in northern and southern hemispheres

In this example, immunogenicity of different mass ratios of HA to NA antigens was measured in BALB/c mice as antibody titers. The immunogenicity of various influenza HA and NA antigens as mRNA vaccines was evaluated, and antibody titers and dose responses between 1:1 and 3:1 ratios of HA/NA antigens administered in mRNA vaccines were evaluated and compared to individual antigens.

The antigens tested included a 1:1:1:1 ratio of a mixture of four HA antigens from either the northern hemisphere or southern hemisphere strains (groups 2 and 3), or a 1:1:1:1:1:1:1:1 ratio of 8 antigen mixtures from 4 HA from the southern hemisphere strains combined with 4 NA (group 5), or a 3:3:3:1:1:1:1:1 ratio of 8 antigen mixtures from 4 HA from either the northern hemisphere or southern hemisphere strains combined with 4 NA (groups 6 and 7), or a 1:1:1 ratio of 5HA antigen mixtures (group 8).

mRNA vaccine or PBS (as control) was administered to BALB/c mice on days 1 and 22 as summarized in table 4. Blood samples were collected from mice on day 21 and day 36 and analyzed by ELISA to determine IgG antibody titers against each of the different influenza glycoprotein antigens.

TABLE 4 study design

* NH-northern hemisphere, SH-southern hemisphere

Example 5.I/phase II clinical trial

This is a phase 1/2, randomized, stratified, observer blind study aimed at evaluating the reactivity and immunogenicity in 18 to 75 year old healthy adults compared to each vaccine alone, of a combination vaccine (mRNA-1073) comprising mRNA encoding four different HA antigens and mRNA encoding SARS-CoV-2 spike protein with a stable biproline mutation (SEQ ID NO: 33) together with co-administered mRNA encoding four different HA antigens (mRNA-1010) and mRNA encoding SARS-CoV-2 spike protein with a stable biproline mutation (mRNA-1273;SEQ ID NO:33).

On day 1, each participant will receive 2 injections for intramuscular administration, one for each arm in the deltoid. The vaccine to be tested comprises: 1) mRNA-1273, mRNA encoding SARS-CoV-2 full-length S protein (SEQ ID NO: 33) (50 μg) modified to introduce S2P in a pre-fusion conformation; 2) mRNA-1010 (50 μg) encoding HA surface glycoproteins of 4 strains of WHO 2022NH influenza seasonal cells or recombinant vaccine; and 3) mRNA-1073, mRNA encoding each of the antigens of (1) and (2). This product (mRNA-1073) will also be used to prepare lower dose vaccines for group 5 and group 6. The placebo and diluent for the vaccine was 0.9% sodium chloride (normal saline) injection, meeting U.S. pharmacopoeia (USP) standards.

The study will recruit about 1050 generally healthy adults aged 18 to 75 years who have been previously fully vaccinated with a covd-19 prime series of vaccine using a locally authorized and approved SARS-CoV-2 vaccine, and their last time the covd-19 vaccine (primary series or booster) must be more than or equal to 120 days (or less, according to local guidelines) prior to the randomization visit. Participants had not received licensed influenza vaccine within 180 days or less after randomization, and had no known history of confirmed influenza infection within 180 days or less after screening or had no history of SARS-CoV-2 infection within 90 days or less after screening. The number and group of participants are shown in the table below.

In the phase 1 part, randomization will be stratified by age (balance between the two age groups within each vaccinated group between 18 and 49 years and 50 and 75 years), while in the phase 2 part, both age groups (balance between 18 to 49 years and 50 to 75 years, 2 age groups within each vaccinated group) and persons receiving the covd-19 booster (yes or no) will stratified at randomization.

Vaccine (mRNA-1073, mRNA-1010 or mRNA-1273) and placebo will be administered by Intramuscular (IM) injection, once per arm in deltoid. Safety and/or immunogenicity and/or biomarker study visits will be made on days 4, 8, 29 and 181 (end of study).

TABLE 5 research arm

Research material

mRNA-1073 was administered in a single dose, aimed at eliciting protection against influenza and SARS-CoV-2. mRNA-1073 contains mRNA encoding 4 HA antigens of the influenza virus strain recommended by WHO for 2022 NH seasonal vaccine and mRNA of S protein of SARS-CoV-2 virus, and is prepared by common 4 lipid mixture of the sponsored mRNA vaccine platform: compound 1, cholesterol, 1, 2-distearoyl-sn-glycerol-3-phosphorylcholine (DSPC) and 1-monomethoxy polyethylene glycol-2, 3-dimyristoylglycerol (PEG-2000-DMG) having a polyethylene glycol with an average molecular weight of 2000. mRNA-1073 is an antigen based on mRNA-1010 and mRNA-1273 codes, intended as a once-a-year dose for preventing seasonal influenza and SARS-CoV-2. Commercially available 0.9% sodium chloride (USP) will be used for dose preparation as appropriate.

mRNA-1010 is administered in a single dose, intended to elicit protection against influenza A and B viruses. mRNA-1010 is a tetravalent vaccine containing mRNA encoding 4 strains of HA recommended by the WHO for 2022 NH cells or recombinant vaccines, formulated with 4 lipid mixtures common to sponsored mRNA vaccine platforms: compound 1, cholesterol, DSPC and PEG-2000-DMG. The HA component uses equal amounts of mRNA encoding each of the 4 different strains. mRNA-1010 is administered in a single dose, intended to elicit protection against all seasonal influenza viruses covered by the vaccine.

mRNA-1273 was administered in a single dose, aimed at eliciting protection against SARS-CoV-2. mRNA-1273 contains mRNA CX-024414 encoding S-2P of Wuhan-Hu-1. mRNA-1273 consisted of mRNA formulated in 4 lipid mixtures common to sponsored mRNA vaccine platforms: compound 1, cholesterol, DSPC and PEG-2000-DMG.

Main objective

The main objective is to evaluate the safety and reactogenicity of the study vaccine. This will be determined by: the frequency and severity of each local and systemic reactogenic adverse reaction that was interrogated during the 7 day follow-up period after vaccination, the frequency and severity of any non-interrogated AEs during the 28 day follow-up period after vaccination, and the frequency of any SAE, AESI, MAAE and resulting aborted AEs from day 1 to day 181/EoS were measured.

Secondary target

A secondary objective included evaluating the humoral immunogenicity of each study vaccine arm against influenza and SARS CoV2 vaccine matched strains on day 29. This will be done by measuring GMT and GMFR on day 29 compared to day 1 (baseline) using HAI assay for influenza and pseudovirus neutralization assay (PsVNA) for SARS-CoV-2 (or binding antibody assay). For influenza, the percentage of participants with seroconversion (defined as anti-HA antibodies with a titer of ≡1:40 on day 29 if baseline <1:10, or 4 fold or higher if baseline ≡1:10) will be measured by HAI assay. For SARS-CoV-2, the percentage of participants with serum responses (defined as ∈4 times the 29 th day titer if the nAb titer baseline was ∈LLOQ, or ∈4×LLOQ if the baseline titer < LLOQ) was measured by PsVNA (or binding antibody assay).

Another secondary objective was to evaluate the humoral immunogenicity against influenza and SARS-CoV-2 vaccine matched strains at all evaluable time points for humoral immunogenicity. This will be measured by measuring GMT and GMFR compared to day 1 (baseline) using HAI for influenza and PsVNA for SARS-CoV-2 (or binding antibody assay), as well as the percentage of participants with seroconversion (influenza) and seroresponse (SARS-CoV-2) as defined above.

Exploratory targets

Exploratory targets include the following: evaluating humoral immunogenicity against the vaccine-mismatched strain (GMT and GMFR against the vaccine-mismatched strain (compared to day 1)); the humoral immunogenicity against the vaccine matched and unmatched strains (GMT and GMFR against the vaccine matched and unmatched strains as determined by alternative methods (e.g., a trace neutralization assay for influenza or a ligand binding assay for SARS CoV 2)) was evaluated using alternative methods; evaluating cellular immunogenicity of a portion of the participants (measuring frequency, magnitude and phenotype of virus-specific T-cell and B-cell responses by flow cytometry or other methods, and performing targeted library analysis on post-vaccination B-cells and T-cells); further characterizing the immune response of the study vaccine (to further characterize the frequency, specificity, or other endpoint to be determined for the immune response); and assessing the occurrence of clinical influenza and covd-19 in study participants and characterizing their immune response to infection and virus isolates (laboratory confirmed frequency of clinical influenza and covd-19, and assessment of immune response to infection and virus isolates).

Immunogenicity assessment

Blood samples were collected according to the activity schedule for immunogenicity assessment. The following analytes will be measured: serum antibody levels as measured by the hemagglutination inhibition assay HAI assay (influenza), serum neutralizing antibody levels as measured by the microactuation assay (influenza), serum neutralizing antibody titers as measured by the pseudovirus neutralization assay and/or serum binding antibody titers as measured using ELISA or multiplex assay (SARS-CoV-2), cellular immunogenicity (in a fraction of the participants).

Respiratory viral infection assessment

During the course of the study, participants may develop symptoms consistent with influenza or SARS-CoV-2 infection. All participants will provide Nasopharyngeal (NP) swab samples prior to day 1 injection for assessment of respiratory pathogen infection, including influenza virus and SARS-CoV 2, as influenza or covd-19 symptoms may confound the reactogenicity assessment. In addition, clinical information will be carefully collected to assess the severity of clinical cases.

Efficacy evaluation:

although this study will not be used for efficacy assessment, symptoms of respiratory pathogen infection will be tracked as an exploratory goal of this study.

Sample size:

the sample size of the study is not determined by the statistical assumptions of the formal hypothesis test. The number of participants suggested was considered sufficient to provide a descriptive summary of safety and immunogenicity for the different study groups. The study will recruit about 1050 generally healthy adults aged 18 to 75 years who have been previously fully vaccinated with a primary series of covd-19 vaccines using locally authorized and approved SARS-CoV-2 vaccines, and their last time the covd-19 vaccine must be greater than or equal to 120 days (or less, according to local guidelines) prior to the randomized visit. Participants had not received licensed influenza vaccine within 180 days or less after randomization, and had no known history of confirmed influenza infection within 180 days or less after screening or had no history of SARS-CoV-2 infection within 90 days or less after screening.

About 550 participants will participate in stage 1 in a ratio of 1:2:2:2:2:2. Another 500 participants will enter groups 1 and 2 of stage 2 in a 1:1 ratio.

Immunogenicity analysis

The immunogenicity analysis will be based on a set of compliance protocols (PP). If the number of participants in the complete analysis set (FAS) and PP set differ by more than 10% (defined as the difference divided by the total number of participants in the PP set), then a supportive analysis of immunogenicity can be performed using the FAS.

For the immunogenic endpoint, the treatment arm will provide a geometric mean of specific antibody titers at each time point with a corresponding 95% Confidence Interval (CI), and a geometric mean fold increase (GMFR) of specific antibody titers at each post-baseline time point relative to the pre-day injection baseline with a corresponding 95% CI, and adjust baseline antibody titers and other potential covariates, including age group and primary vaccine type. Descriptive summary statistics will also be provided, including median, minimum and maximum values.

For a summary of geometric mean titers, antibody titers reported below the lower limit of quantitation (LLOQ) would be replaced with 0.5×lloq. Values greater than the upper limit of quantitation (ULOQ) will be converted to ULOQ.

For mRNA-1010, serum conversion versus baseline was provided with 2-sided 95% CI using the Clopper-Pearson method at each post-baseline time point. Serum conversion is defined as the proportion of participants with a pre-inoculation HAI titer <1:10 and a post-inoculation HAI titer ≡1:40 or a pre-inoculation HAI titer ≡1:10 and a post-inoculation HAI antibody titer increase of at least 4 fold.

For mRNA-1273, the serum response is defined as if the participant baseline titer was greater than or equal to LLOQ, the neutralizing antibody (nAb) titer binding antibody (bAb) titer GMFR was greater than or equal to 4 times on day 29 compared to day 1, or if the baseline titer was < LLOQ, the day 29 titer was greater than or equal to 4 XLOQ.

The immunogenicity of mRNA-1073 will follow the same rules as mRNA-1010 and mRNA-1273.

Metaphase analysis

Two metaphase analyses (IA) and final analyses will be performed in this study.

After the phase 1 participants (550 participants) completed the visit on day 29, their data will be IA (IA 1) and will include safety and immunogenicity data collected by day 29. The nAb or bAb assay will be used to assess the immunogenicity of all participants. The full safety and immunogenicity data for the mRNA-1073 group in IA1 can support the dose selection of mRNA-1073. After the phase 2 participants (500 participants) completed the visit on day 29, their data will be subjected to a second IA (IA 2) and will include safety data and potential immunogenicity data collected by day 29. The IA will be performed by an independent team consisting of non-blind programmers and a statistician. The analysis will be presented in terms of vaccinated groups. The final analysis of all endpoints will be performed after all participants in stage 1 and stage 2 completed day 181/EoS. The final report will include a comprehensive analysis of all safety and immunogenicity data up to day 181/EoS. For immunogenicity analysis, the nAb or bAb assay will be used for all participants in the phase 1 study, and possibly for all participants in the phase 2 study.

Sequence listing

/>

Any of the mRNA sequences described herein can include a 5'utr and/or a 3' utr. The UTR sequences may be selected from the following sequences, or other known UTR sequences may be used. It is also understood that any mRNA described herein can also comprise poly (a) tails and/or caps (e.g., 7mG (5 ') ppp (5') NlmpNp). Furthermore, while many of the mrnas and encoded antigen sequences described herein include signal peptides and/or peptide tags (e.g., C-terminal His tags), it is understood that the indicated signal peptides and/or peptide tags may be replaced with different signal peptides and/or peptide tags, or the signal peptides and/or peptide tags may be omitted.

5’UTR：GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC(SEQ ID NO:29)

5’UTR：GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC(SEQ ID NO:30)

3’UTR：UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC(SEQ ID NO:31)

3’UTR：UGAUAAUAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC(SEQ ID NO:32)

Description of the embodiments

1. A combination vaccine comprising

A first messenger ribonucleic acid (mRNA) polynucleotide having an Open Reading Frame (ORF) encoding a first respiratory viral antigenic polypeptide from influenza virus; and

a second mRNA polynucleotide having an ORF encoding a second respiratory viral antigenic polypeptide from a coronavirus.

2. The vaccine of embodiment 1, wherein the vaccine comprises at least 2 mRNA polynucleotides having ORFs encoding antigenic polypeptides of a first respiratory virus from influenza virus.

3. The vaccine of embodiment 1, wherein the vaccine comprises at least 2 mRNA polynucleotides having ORFs encoding antigenic polypeptides of a second respiratory virus from a coronavirus.

4. The vaccine of any one of embodiments 1-8, wherein the vaccine comprises less than 15 mRNA polynucleotides.

5. The vaccine of embodiment 4, wherein the vaccine comprises 3-10 mRNA polynucleotides.

6. The vaccine of embodiment 4, wherein the vaccine comprises 4-10 mRNA polynucleotides.

7. The vaccine of embodiment 4, wherein the vaccine comprises 5-10 mRNA polynucleotides.

8. The vaccine of embodiment 4, wherein the vaccine comprises 8-9 mRNA polynucleotides.

9. The vaccine of any one of embodiments 1-8, wherein the first mRNA polynucleotide and the second mRNA polynucleotide are present in the combination vaccine in a ratio of 1:1.

10. The vaccine of any one of embodiments 1-9, wherein the vaccine comprises at least two mRNA polynucleotides encoding influenza virus antigenic polypeptides.

11. The vaccine of any one of embodiments 1-10, wherein the vaccine comprises at least three mRNA polynucleotides encoding influenza virus antigenic polypeptides.

12. The vaccine of any one of embodiments 1-11, wherein the vaccine comprises at least four mRNA polynucleotides encoding influenza virus antigenic polypeptides.

13. The vaccine of any one of embodiments 1-12, wherein the vaccine comprises at least two mRNA polynucleotides encoding coronavirus antigenic polypeptides.

14. The vaccine of any one of embodiments 1-13, wherein the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first viridae to the second viridae in a ratio of 4:1.

15. The vaccine of any one of embodiments 1-13, wherein the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first viridae to the second viridae in a ratio of 3:1.

16. The vaccine of any one of embodiments 1-13, wherein the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first viridae to the second viridae in a ratio of 5:1.

17. The vaccine of any one of embodiments 1-13, wherein the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first viridae to the second viridae in a ratio of 2:1.

18. The vaccine of any one of embodiments 1-13, wherein the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first viridae to the second viridae in a ratio of 4:2.

19. The vaccine of any one of embodiments 1-13, wherein the combination vaccine comprises mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first viral family, the second viral family, the third viral family in a ratio of 1:2.

20. The vaccine of any one of embodiments 1-19, wherein the combination vaccine is a multivalent RNA composition produced by a method comprising:

(a) Combining a linearized first DNA molecule encoding the first mRNA polynucleotide and a linearized second DNA molecule encoding the second mRNA polynucleotide into a single reaction vessel, wherein the first DNA molecule and the second DNA molecule are obtained from different sources; and

(b) Simultaneously transcribing the linearized first DNA molecule and the linearized second DNA molecule in vitro to obtain a multivalent RNA composition.

21. The vaccine of embodiment 20, wherein the different sources are first and second bacterial cell cultures, and wherein the first and second bacterial cell cultures are not co-cultured.

22. The vaccine of embodiment 20, wherein the amounts of the first DNA molecule and the second DNA molecule present in the reaction mixture prior to the start of the IVT have been normalized.

23. The vaccine of any one of embodiments 1-22, wherein the combination vaccine is a multivalent RNA composition, wherein the multivalent RNA composition comprises greater than 40% poly-a-tailed RNA.

24. The vaccine of any one of embodiments 1-23, wherein the combination vaccine is a multivalent RNA composition, wherein the first mRNA polynucleotide and the second mRNA polynucleotide each differ from each other by at least 100 nucleotides in length.

25. The vaccine of any one of embodiments 1-24, wherein the combination vaccine is a multivalent RNA composition, wherein the first and second (and optionally, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth or fifteenth) mRNA polynucleotides each comprise one or more non-coding sequences in an untranslated region (UTR), optionally a 5'UTR or a 3' UTR.

26. The vaccine of embodiment 25, wherein the non-coding sequence is located in the 3' utr of the mRNA upstream of the poly a tail of the mRNA.

27. The vaccine of embodiment 25, wherein the non-coding sequence is located in the 3' utr of the mRNA, downstream of the poly a tail of the mRNA.

28. The vaccine of embodiment 25, wherein the non-coding sequence is located in the 3' utr of the mRNA, between the last codon of the ORF of the mRNA and the first "a" of the poly a tail of the mRNA.

29. The vaccine of embodiment 25, wherein the non-coding sequence comprises 1 to 10 nucleotides).

30. The vaccine of any one of embodiments 25-29, wherein the non-coding sequence comprises one or more rnase cleavage sites.

31. The vaccine of embodiment 30, wherein the rnase cleavage site is an rnase H cleavage site.

32. The vaccine of any one of embodiments 1-31, wherein each of the mRNA polynucleotides in the combination vaccine is complementary to and does not interfere with each other mRNA polynucleotide in the combination vaccine.

33. The vaccine of any one of embodiments 1-32, wherein at least one of the respiratory virus antigenic polypeptides is derived from a naturally occurring antigen.

34. The vaccine of any one of embodiments 1-32, wherein at least one of the respiratory virus antigenic polypeptides is a stable version of a naturally occurring antigen.

35. The vaccine of any one of embodiments 1-32, wherein at least one of the respiratory virus antigenic polypeptides is a non-naturally occurring antigen.

36. The vaccine of any one of embodiments 1-33, wherein the vaccine further comprises an mRNA polynucleotide encoding a variant respiratory viral antigenic polypeptide, wherein the variant is a variant of any one of the first respiratory viral antigenic polypeptide or the second respiratory viral antigenic polypeptide.

37. The vaccine of any one of embodiments 1-36, wherein the second respiratory virus antigenic polypeptide is selected from the group consisting of MERS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH, and HCoV-HKU 1.

38. The vaccine of any one of embodiments 1-37, wherein the first respiratory virus antigenic polypeptide is influenza HA and/or influenza NA.

39. The vaccine of any one of embodiments 1-38, wherein the antigenic polypeptide comprises a fusion (F) protein, a spike (S) protein, and a Hemagglutinin Antigen (HA).

40. The vaccine of any one of embodiments 1-39, further comprising at least one Lipid Nanoparticle (LNP).

41. The vaccine of embodiment 40, wherein the LNP comprises 20% -60% ionizable amino lipids, 5% -25% non-cationic lipids, 25% -55% sterols, and 0.5% -15% PEG-modified lipids in a molar ratio.

42. A method for vaccinating a subject, the method comprising:

administering to the subject a combination vaccine, wherein the combination vaccine comprises a first messenger ribonucleic acid (mRNA) polynucleotide having an Open Reading Frame (ORF) encoding a first respiratory viral antigenic polypeptide from influenza virus; and a second mRNA polynucleotide having an ORF encoding a second respiratory viral antigenic polypeptide from a coronavirus.

43. The method of embodiment 42, wherein the subject is 65 years old or older.

44. The method of embodiment 42, wherein the subject is less than 18 years old.

45. The method of embodiment 42, wherein the method prevents respiratory tract infection in the subject.

46. The method of embodiment 42, wherein the method reduces the severity of respiratory tract infection in the subject.

47. The method of embodiment 42, wherein the subject is seronegative for at least one of the antigenic polypeptides.

48. The method of embodiment 42, wherein the subject is seronegative for all of the antigenic polypeptides.

49. The method of embodiment 42, wherein the subject is seropositive for at least one of the antigenic polypeptides.

50. The method of embodiment 42, wherein the subject is seropositive for all of the antigenic polypeptides.

51. The method of any one of embodiments 42-50, further comprising administering a booster vaccine.

52. The method of embodiment 51, wherein the booster vaccine is administered between 3 weeks and 1 year after the combination vaccine.

53. The method of embodiment 51 or 52, wherein the booster vaccine comprises at least one mRNA polynucleotide having an ORF encoding the first respiratory viral antigenic polypeptide or the second respiratory viral antigenic polypeptide.

54. The method of embodiment 51 or 52, wherein the booster vaccine comprises at least one mRNA polynucleotide having an ORF encoding each of the first respiratory viral antigenic polypeptide and the second respiratory viral antigenic polypeptide.

55. The method of embodiment 51 or 52, wherein the booster vaccine comprises at least one mRNA polynucleotide having an ORF encoding a variant of the first respiratory viral antigenic polypeptide or the second respiratory viral antigenic polypeptide.

56. The method of any one of embodiments 42-55, wherein the combination vaccine is a seasonal booster vaccine.

57. The method of any one of embodiments 42-56, wherein the combination vaccine is the vaccine of any one of embodiments 1-41.

58. A method of preventing or lessening the severity of a respiratory tract infection by administering to a subject an effective amount of the vaccine of any one of embodiments 1-41 to prevent or lessen the severity of a respiratory tract infection in a subject based on a single dose or a single dose plus a booster.

59. The method of any one of embodiments 42-58, wherein the combination vaccine is administered to the subject at a dose of 20 μg or 50 μg.

Equivalent scheme

All references, patents, and patent applications disclosed herein are incorporated by reference, and for each subject matter recited, in some cases, the entire contents of the document may be covered.

The indefinite articles "a" and "an" as used herein in the specification and embodiments and/or claims should be understood to mean "at least one" unless explicitly indicated to the contrary.

It should also be understood that in any method claimed herein that includes more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order of the steps or acts of the method recited, unless explicitly indicated to the contrary.

In the claims and in the above description, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "consisting of …," and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases "consisting of …" and "consisting essentially of …" should be closed or semi-closed transitional phrases, respectively, as described in section 2111.03 of the U.S. patent office patent inspection program manual.

The terms "about" and "substantially" preceding a numerical value mean ± 10% of the recited numerical value.

Where a range of values is provided, each value between and including the upper and lower ends of the range is specifically contemplated and described herein.

Claims

1. A combination vaccine comprising

A first messenger ribonucleic acid (mRNA) polynucleotide comprising an Open Reading Frame (ORF) encoding a first respiratory viral antigenic polypeptide, wherein the first respiratory viral antigenic polypeptide is an influenza viral antigen; and

A second mRNA polynucleotide comprising an ORF encoding a second respiratory viral antigenic polypeptide from a coronavirus;

lipid nanoparticles.

2. A combination vaccine comprising

A first messenger ribonucleic acid (mRNA) polynucleotide comprising an Open Reading Frame (ORF) encoding a first respiratory viral antigenic polypeptide, wherein the first respiratory viral antigenic polypeptide is an influenza viral antigen;

a second mRNA polynucleotide comprising an ORF encoding a second respiratory viral antigenic polypeptide from a second influenza virus;

a third mRNA polynucleotide comprising an ORF encoding a third respiratory viral antigenic polypeptide from a third influenza virus;

a fourth mRNA polynucleotide comprising an ORF encoding a fourth respiratory virus antigenic polypeptide from a fourth influenza virus;

a fifth mRNA polynucleotide comprising an ORF encoding a fifth respiratory viral antigenic polypeptide from the first coronavirus;

a sixth mRNA polynucleotide comprising an ORF encoding a sixth respiratory virus antigenic polypeptide from a second coronavirus;

lipid nanoparticles.

3. The combination vaccine of claim 2, wherein the first virus, the second virus, the third virus, and the fourth virus are selected from influenza a virus and influenza b virus.

4. The combination vaccine of claim 1 or 2, wherein the coronavirus, the first coronavirus, and/or the second coronavirus is a b coronavirus.

5. The combination vaccine of claim 1 or 2, wherein the coronavirus, the first coronavirus and/or the second coronavirus is selected from the group consisting of MERS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH and HCoV-HKU 1.

6. The combination vaccine of claim 1 or 2, wherein the first respiratory virus antigenic polypeptide is from influenza b virus.

7. The combination vaccine of claim 1 or 2, wherein the first respiratory virus antigenic polypeptide is from influenza a virus.

8. The combination vaccine of claim 1 or 2, wherein the first respiratory virus antigenic polypeptide is a Hemagglutinin Antigen (HA) or a Neuraminidase Antigen (NA).

9. The combination vaccine of claim 1 or 2, wherein the second respiratory viral antigenic polypeptide is from SARS-CoV.

10. The combination vaccine of claim 1 or 2, wherein the second respiratory viral antigenic polypeptide is from SARS-CoV-2.

11. The combination vaccine of claim 1 or 2, wherein the second respiratory virus antigenic polypeptide is from a non-SARS human coronavirus (HCoV).

12. The combination vaccine of any one of claims 1-11, wherein the vaccine comprises at least 2 mRNA polynucleotides comprising ORFs encoding influenza virus antigens.

13. The combination vaccine of any one of claims 1-12, wherein the vaccine comprises 2-4 mRNA polynucleotides comprising ORFs encoding influenza virus antigens.

14. The combination vaccine of any one of claims 1-12, wherein the vaccine comprises at least 2 mRNA polynucleotides comprising ORFs encoding respiratory viral antigenic polypeptides from coronaviruses.

15. The combination vaccine of any one of claims 1-14, wherein the vaccine comprises less than 15 mRNA polynucleotides.

16. The combination vaccine of claim 15, wherein the vaccine comprises 3-10 mRNA polynucleotides.

17. The combination vaccine of claim 15, wherein the vaccine comprises 4-10 mRNA polynucleotides.

18. The combination vaccine of claim 15, wherein the vaccine comprises 5-10 mRNA polynucleotides.

19. The combination vaccine of claim 15, wherein the vaccine comprises 8-9 mRNA polynucleotides.

20. The combination vaccine of any one of claims 1-19, wherein the vaccine comprises at least three mRNA polynucleotides encoding influenza virus antigenic polypeptides.

21. The combination vaccine of claim 20, wherein the vaccine comprises at least eight mRNA polynucleotides encoding influenza virus antigenic polypeptides.

22. The combination vaccine of claim 20, wherein the vaccine comprises at least two mRNA polynucleotides encoding coronavirus antigenic polypeptides.

23. The combination vaccine of any one of claims 1-22, wherein the first mRNA polynucleotide and the second mRNA polynucleotide are present in the combination vaccine in a ratio of 1:1.

24. The combination vaccine of any one of claims 1-22, wherein the combination vaccine comprises the codes from the influenza virus in a ratio of 4:1: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the coronaviruses.

25. The combination vaccine of any one of claims 1-22, wherein the combination vaccine comprises a 3:1 ratio of codes from the influenza virus: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the coronaviruses.

26. The combination vaccine of any one of claims 1-22, wherein the combination vaccine comprises a 2:1 ratio of codes from the influenza virus: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the coronaviruses.

27. The combination vaccine of any one of claims 1-22, wherein the combination vaccine comprises a 5:1 ratio of codes from the influenza virus: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the coronaviruses.

28. The combination vaccine of any one of claims 1-22, wherein the combination vaccine comprises a 4:2 ratio of codes from the influenza virus: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the coronaviruses.

29. The combination vaccine of any one of claims 1-22, wherein the combination vaccine comprises the codes from the influenza virus in a ratio of 1:2: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the coronaviruses.

30. The combination vaccine of any one of claims 1-22, wherein the combination vaccine comprises the codes from the first virus in a ratio of 8:2: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the second virus.

31. The combination vaccine of any one of claims 1-22, wherein the combination vaccine comprises the codes from the first virus in a ratio of 8:1: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the second virus.

32. The combination vaccine of claim 31, wherein the respiratory viral antigenic polypeptide of the first virus comprises HA and NA in a ratio of 4:4.

33. The combination vaccine of any one of claims 1-32, wherein each of the mRNA polynucleotides in the combination vaccine is complementary to and does not interfere with each other mRNA polynucleotide in the combination vaccine.

34. The combination vaccine of any one of claims 1-32, wherein at least one of the respiratory viral antigenic polypeptides is derived from a naturally occurring antigen.

35. The combination vaccine of any one of claims 1-32, wherein at least one of the respiratory viral antigenic polypeptides is a stable version of a naturally occurring antigen.

36. The combination vaccine of any one of claims 1-32, wherein at least one of the respiratory virus antigenic polypeptides is a non-naturally occurring antigen.

37. The combination vaccine of any one of claims 1-36, wherein the vaccine further comprises an mRNA polynucleotide encoding a structurally altered variant respiratory viral antigenic polypeptide, wherein the structurally altered variant is a structurally altered variant of either the first respiratory viral antigenic polypeptide or the second respiratory viral antigenic polypeptide.

38. The combination vaccine of any one of claims 1-36, wherein at least one of the first mRNA polynucleotide and the second mRNA polynucleotide is polycistronic.

39. The combination vaccine of any one of claims 1-36, wherein each of the first mRNA polynucleotide and the second mRNA polynucleotide is polycistronic.

40. A multivalent RNA composition comprising

A first messenger ribonucleic acid (mRNA) polynucleotide comprising an Open Reading Frame (ORF) encoding a first respiratory viral antigenic polypeptide from a first virus; and

wherein the multivalent RNA composition comprises greater than 40% poly-a-tailed RNA, and/or the first mRNA polynucleotide and/or the second mRNA polynucleotide differ from each other by at least 100 nucleotides in length.

41. The multivalent RNA composition of claim 40, wherein the composition is produced by a method comprising:

42. The multivalent RNA composition of claim 41, wherein the different sources are first and second bacterial cell cultures, and wherein the first and second bacterial cell cultures are not co-cultured.

43. The multivalent RNA composition of claim 42, wherein the amounts of the first DNA molecule and the second DNA molecule present in the reaction mixture prior to the start of the IVT have been normalized.

44. The multivalent RNA composition of claim 40 wherein the coronavirus is selected from the group consisting of MERS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH and HCoV-HKU 1.

45. A multivalent RNA composition comprising

2-15 mRNA polynucleotides each comprising a different Open Reading Frame (ORF) encoding a respiratory virus antigenic polypeptide, wherein at least one respiratory virus antigenic polypeptide is an influenza virus and at least one respiratory virus antigenic polypeptide is a coronavirus, and wherein each mRNA polynucleotide comprises one or more non-coding sequences in an untranslated region (UTR), optionally a 5'UTR or a 3' UTR.

46. The multivalent RNA composition of claim 45 wherein the non-coding sequence is located in the 3' UTR of the mRNA upstream of the poly A tail of the mRNA.

47. The multivalent RNA composition of claim 45 wherein the non-coding sequence is located in the 3' UTR of the mRNA downstream of the poly A tail of the mRNA.

48. The multivalent RNA composition of claim 45 wherein the non-coding sequence is located in the 3' UTR of the mRNA between the last codon of the ORF of the mRNA and the first "A" of the poly A tail of the mRNA.

49. The multivalent RNA composition of claim 45 wherein the non-coding sequence comprises 1 to 10 nucleotides.

50. The multivalent RNA composition of any one of claims 45-49, wherein the non-coding sequence comprises one or more rnase cleavage sites.

51. The multivalent RNA composition of claim 50 wherein the RNase cleavage site is an RNase H cleavage site.

52. The multivalent RNA composition of claim 45 wherein the coronavirus antigen is selected from the group consisting of MERS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH and HCoV-HKU 1.

53. A multivalent RNA composition comprising

A first messenger ribonucleic acid (mRNA) polynucleotide comprising an Open Reading Frame (ORF) encoding a first respiratory viral antigenic polypeptide from an influenza virus;

a second mRNA polynucleotide comprising an ORF encoding a second respiratory viral antigenic polypeptide from a coronavirus; and is also provided with

Wherein at least one of the respiratory viral antigenic polypeptides is derived from a naturally occurring antigen or a stable version of a naturally occurring antigen, and the multivalent RNA composition further comprises an mRNA polynucleotide encoding a structurally altered variant respiratory viral antigenic polypeptide, wherein the structurally altered variant is a structurally altered variant of either the first respiratory viral antigenic polypeptide or the second respiratory viral antigenic polypeptide.

54. The multivalent RNA composition of claim 53 where the coronavirus is selected from the group consisting of MERS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH and HCoV-HKU 1.

55. The multivalent RNA composition of any one of claims 53-54, wherein the structurally altered variant is a structurally altered variant of the first respiratory viral antigenic polypeptide.

56. The multivalent RNA composition of any one of claims 53-55, wherein the structurally altered variant is a structurally altered variant of the second respiratory viral antigenic polypeptide.

57. A multivalent RNA composition comprising

5 to 15 messenger ribonucleic acid (mRNA) polynucleotides each comprising an Open Reading Frame (ORF) encoding a different respiratory viral antigenic polypeptide, wherein the respiratory viral antigenic polypeptides are derived from two different viral families, wherein the two viral families include influenza virus and coronavirus; lipid nanoparticles.

58. The multivalent RNA composition of claim 57 wherein the composition has 3-6 mRNA polynucleotides comprising ORFs encoding influenza antigens.

59. The multivalent RNA composition of any one of claims 57-58, wherein the composition has 1-5 mRNA polynucleotides comprising ORFs encoding coronavirus antigens.

60. A multivalent RNA composition comprising

A set of at least 6 messenger ribonucleic acid (mRNA) polynucleotides each comprising an Open Reading Frame (ORF) encoding a respiratory viral antigenic polypeptide from a first virus or a second virus; wherein the first virus is an influenza virus, wherein the second virus is a coronavirus, and wherein the composition comprises the encoding from the first virus in a ratio of 4:1, 4:2, or 4:3: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the second virus.

61. The multivalent RNA composition of any one of claims 40-60, wherein the first mRNA polynucleotide and the second mRNA polynucleotide are present in the combination vaccine in a ratio of 1:1.

62. The multivalent RNA composition of any one of claims 40-60, wherein the multivalent RNA composition comprises the codes from the first virus in a ratio of 4:1: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the second virus.

63. The multivalent RNA composition of any one of claims 40-60, wherein the multivalent RNA composition comprises a 3:1 ratio of codes from the first virus: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the second virus.

64. The multivalent RNA composition of any one of claims 40-60, wherein the multivalent RNA composition comprises a 2:1 ratio of codes from the first virus: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the second virus.

65. The multivalent RNA composition of any one of claims 40-60, wherein the multivalent RNA composition comprises a 5:1 ratio of codes from the first virus: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the second virus.

66. The multivalent RNA composition of any one of claims 40-60, wherein the multivalent RNA composition comprises the codes from the first virus in a ratio of 4:2: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the second virus.

67. The multivalent RNA composition of any one of claims 40-60, wherein the multivalent RNA composition comprises the codes from the first virus in a ratio of 1:2: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the second virus.

68. The multivalent RNA composition of any one of claims 40-60, wherein the multivalent RNA composition comprises the codes from the first virus in a ratio of 8:1 or 8:2: mRNA polynucleotides of the respiratory viral antigenic polypeptides of the second virus.

69. The multivalent RNA composition of any one of claims 40-68, wherein the antigenic polypeptide comprises fusion (F) protein, spike (S) protein, and Hemagglutinin Antigen (HA).

70. The multivalent RNA composition of claim 69, further comprising a Neuraminidase (NA) antigen.

71. The multivalent RNA composition of any one of claims 40-70, further comprising at least one Lipid Nanoparticle (LNP).

72. The multivalent RNA composition of claim 71, wherein the LNP comprises a molar ratio of 20% -60% ionizable amino lipids, 5% -25% non-cationic lipids, 25% -55% sterols, and 0.5% -15% PEG-modified lipids.

73. The multivalent RNA composition of claim 72, wherein the ionizable amino lipid comprises the structure of compound 1:

74. the combination vaccine of any one of claims 1-39 or the multivalent RNA composition of any one of claims 40-73, wherein the respiratory viral antigenic polypeptide comprises a cell surface glycoprotein.

75. A method for vaccinating a subject, the method comprising:

administering to the subject a combination vaccine, wherein the combination vaccine comprises a first messenger ribonucleic acid (mRNA) polynucleotide comprising an Open Reading Frame (ORF) encoding a first respiratory viral antigenic polypeptide from influenza virus; and a second mRNA polynucleotide comprising an ORF encoding a second respiratory viral antigenic polypeptide from a coronavirus.

76. The method of claim 75, wherein the subject is 65 years old or older.

77. The method of claim 75, wherein the subject is less than 18 years old.

78. The method of claim 75, wherein the method prevents respiratory tract infection in the subject.

79. The method of claim 75, wherein the method reduces the severity of respiratory tract infection in the subject.

80. The method of claim 75, wherein the subject is seronegative for at least one of the antigenic polypeptides.

81. The method of claim 75, wherein the subject is seronegative for all of the antigenic polypeptides.

82. The method of claim 75, wherein the subject is seropositive for at least one of the antigenic polypeptides.

83. The method of claim 75, wherein the subject is seropositive for all of the antigenic polypeptides.

84. The method of any one of claims 75-83, further comprising administering a booster vaccine.

85. The method of claim 84, wherein the booster vaccine is administered between 3 weeks and 1 year after the combination vaccine.

86. The method of claim 84 or 85, wherein the booster vaccine comprises at least one mRNA polynucleotide comprising an ORF encoding the first respiratory viral antigenic polypeptide or the second respiratory viral antigenic polypeptide.

87. The method of claim 84 or 85, wherein the booster vaccine comprises at least one mRNA polynucleotide comprising an ORF encoding the first respiratory viral antigenic polypeptide and the second respiratory viral antigenic polypeptide.

88. The method of claim 84 or 85, wherein the booster vaccine comprises at least one mRNA polynucleotide comprising an ORF encoding a structurally altered variant of the first respiratory viral antigenic polypeptide or the second respiratory viral antigenic polypeptide.

89. The method of any one of claims 84-88, wherein the combination vaccine is a seasonal booster vaccine.

90. The method of any one of claims 75-89, wherein the combination vaccine is the vaccine of any one of claims 1-74.

91. A method of preventing or lessening the severity of a respiratory tract infection by administering to a subject an effective amount of the combination/multivalent vaccine of any of claims 1-74 to prevent or lessen the severity of a respiratory tract infection in a subject based on a single dose or a single dose plus a booster.

92. The method of any one of claims 75-91, wherein the combination vaccine is administered to the subject at a dose of 25 μg, 50 μg, or 100 μg.

93. The method of any one of claims 75-92, wherein each RNA polynucleotide of the vaccine is formulated in a separate LNP.

94. The method of any one of claims 75-93, wherein the RNA polynucleotides of the vaccine are co-formulated in LNP.

95. The combination vaccine of any one of claims 1-39 or the multivalent RNA composition of any one of claims 40-74, comprising mRNA polynucleotides encoding four HA antigens.

96. The combination vaccine or multivalent RNA composition of claim 95, wherein the four HA antigens are present in a ratio of 1:1:1:1.

97. The combination vaccine or multivalent RNA composition of claim 95 or 96, further comprising mRNA polynucleotides encoding four NA antigens.

98. The combination vaccine or multivalent RNA composition of claim 97, wherein the four NA antigens are present in a ratio of 1:1:1:1.

99. The combination vaccine or multivalent RNA composition of claim 98, wherein the ratio of HA antigen to NA antigen is 1:1.

100. The combination vaccine or multivalent RNA composition of claim 98, wherein the ratio of HA antigen to NA antigen is 3:1.

101. The method of any one of claims 75-94, wherein the combination vaccine comprises mRNA polynucleotides encoding four HA antigens.

102. The method of claim 101, wherein the four HA antigens are present in a ratio of 1:1:1:1.

103. The method of claim 101 or 102, further comprising mRNA polynucleotides encoding four NA antigens.

104. The method of claim 103, wherein the four HA antigens are present in a ratio of 1:1:1:1.

105. The method of claim 104, wherein the ratio of HA antigen to NA antigen is 1:1.

106. The method of claim 104, wherein the ratio of HA antigen to NA antigen is 3:1.

107. The combination vaccine of any one of claims 1-39, the multivalent RNA composition of any one of claims 40-74 and 95-100, and the method of any one of claims 75-94 and 101-106, wherein the coronavirus is a coronavirus b.