CN117737136A - Optimized female fish fertility control method and application - Google Patents
Optimized female fish fertility control method and application Download PDFInfo
- Publication number
- CN117737136A CN117737136A CN202310060796.9A CN202310060796A CN117737136A CN 117737136 A CN117737136 A CN 117737136A CN 202310060796 A CN202310060796 A CN 202310060796A CN 117737136 A CN117737136 A CN 117737136A
- Authority
- CN
- China
- Prior art keywords
- fish
- star
- female
- homozygous
- deleted
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000251468 Actinopterygii Species 0.000 title claims abstract description 218
- 238000000034 method Methods 0.000 title claims abstract description 61
- 230000035558 fertility Effects 0.000 title claims abstract description 54
- 238000010362 genome editing Methods 0.000 claims abstract description 34
- 238000009360 aquaculture Methods 0.000 claims abstract description 32
- 244000144974 aquaculture Species 0.000 claims abstract description 32
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 31
- 238000005516 engineering process Methods 0.000 claims abstract description 30
- 230000016087 ovulation Effects 0.000 claims abstract description 24
- 230000013011 mating Effects 0.000 claims abstract description 23
- 210000000287 oocyte Anatomy 0.000 claims abstract description 22
- 230000035800 maturation Effects 0.000 claims abstract description 19
- 238000002360 preparation method Methods 0.000 claims abstract description 14
- 239000000583 progesterone congener Substances 0.000 claims abstract description 14
- 230000015572 biosynthetic process Effects 0.000 claims abstract description 12
- 238000003786 synthesis reaction Methods 0.000 claims abstract description 12
- 238000012214 genetic breeding Methods 0.000 claims abstract description 8
- 101150078937 STAR gene Proteins 0.000 claims description 30
- 238000012217 deletion Methods 0.000 claims description 26
- 230000037430 deletion Effects 0.000 claims description 26
- 230000001737 promoting effect Effects 0.000 claims description 12
- 238000010459 TALEN Methods 0.000 claims description 11
- 108010043645 Transcription Activator-Like Effector Nucleases Proteins 0.000 claims description 11
- 229960004407 chorionic gonadotrophin Drugs 0.000 claims description 10
- 238000002347 injection Methods 0.000 claims description 10
- 239000007924 injection Substances 0.000 claims description 10
- 108020004999 messenger RNA Proteins 0.000 claims description 10
- 238000012216 screening Methods 0.000 claims description 9
- 230000002710 gonadal effect Effects 0.000 claims description 8
- 238000000520 microinjection Methods 0.000 claims description 7
- 230000035772 mutation Effects 0.000 claims description 7
- 102000006771 Gonadotropins Human genes 0.000 claims description 6
- 108010086677 Gonadotropins Proteins 0.000 claims description 6
- 239000002622 gonadotropin Substances 0.000 claims description 6
- 230000008685 targeting Effects 0.000 claims description 6
- 239000003795 chemical substances by application Substances 0.000 claims description 5
- 238000001514 detection method Methods 0.000 claims description 5
- 235000013601 eggs Nutrition 0.000 claims description 5
- 239000012634 fragment Substances 0.000 claims description 5
- 238000012163 sequencing technique Methods 0.000 claims description 5
- 238000001976 enzyme digestion Methods 0.000 claims description 4
- 230000002194 synthesizing effect Effects 0.000 claims description 4
- 230000000903 blocking effect Effects 0.000 claims description 3
- 238000012545 processing Methods 0.000 claims description 3
- 230000004720 fertilization Effects 0.000 abstract description 9
- 210000002149 gonad Anatomy 0.000 abstract description 3
- 239000012528 membrane Substances 0.000 abstract description 3
- 241000252212 Danio rerio Species 0.000 description 23
- 230000000052 comparative effect Effects 0.000 description 15
- 230000002068 genetic effect Effects 0.000 description 11
- 238000009395 breeding Methods 0.000 description 10
- 230000001488 breeding effect Effects 0.000 description 10
- 230000006872 improvement Effects 0.000 description 10
- 238000011161 development Methods 0.000 description 7
- 230000001276 controlling effect Effects 0.000 description 6
- 238000010353 genetic engineering Methods 0.000 description 6
- 230000000694 effects Effects 0.000 description 5
- 241000252185 Cobitidae Species 0.000 description 4
- 239000000463 material Substances 0.000 description 4
- 208000020584 Polyploidy Diseases 0.000 description 3
- 230000008569 process Effects 0.000 description 3
- 239000000243 solution Substances 0.000 description 3
- 230000004083 survival effect Effects 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 101150012716 CDK1 gene Proteins 0.000 description 2
- 108091033409 CRISPR Proteins 0.000 description 2
- 101150077230 GAL4 gene Proteins 0.000 description 2
- 102000049867 Steroidogenic acute regulatory protein Human genes 0.000 description 2
- 108010018411 Steroidogenic acute regulatory protein Proteins 0.000 description 2
- 238000005520 cutting process Methods 0.000 description 2
- 101150049432 dnd gene Proteins 0.000 description 2
- 210000001161 mammalian embryo Anatomy 0.000 description 2
- 210000001672 ovary Anatomy 0.000 description 2
- 239000013612 plasmid Substances 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 108091008146 restriction endonucleases Proteins 0.000 description 2
- 241000894007 species Species 0.000 description 2
- 238000013518 transcription Methods 0.000 description 2
- 230000035897 transcription Effects 0.000 description 2
- 238000010354 CRISPR gene editing Methods 0.000 description 1
- 241001609213 Carassius carassius Species 0.000 description 1
- 241000252230 Ctenopharyngodon idella Species 0.000 description 1
- 241000252233 Cyprinus carpio Species 0.000 description 1
- 208000012239 Developmental disease Diseases 0.000 description 1
- 208000035240 Disease Resistance Diseases 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 206010064571 Gene mutation Diseases 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 241000276707 Tilapia Species 0.000 description 1
- 206010000210 abortion Diseases 0.000 description 1
- 231100000176 abortion Toxicity 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000009472 formulation Methods 0.000 description 1
- 102000034356 gene-regulatory proteins Human genes 0.000 description 1
- 108091006104 gene-regulatory proteins Proteins 0.000 description 1
- 229940094892 gonadotropins Drugs 0.000 description 1
- 238000000338 in vitro Methods 0.000 description 1
- 230000002452 interceptive effect Effects 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 239000008239 natural water Substances 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 230000017448 oviposition Effects 0.000 description 1
- 238000004806 packaging method and process Methods 0.000 description 1
- 230000037361 pathway Effects 0.000 description 1
- 238000003672 processing method Methods 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 230000002441 reversible effect Effects 0.000 description 1
- 238000002864 sequence alignment Methods 0.000 description 1
- 230000001568 sexual effect Effects 0.000 description 1
- 230000009261 transgenic effect Effects 0.000 description 1
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Farming Of Fish And Shellfish (AREA)
Abstract
The invention provides an optimized female fish fertility control method and application. The method uses gene editing technology to knock out the key coding gene of gonad progestogen synthesis of fish, blocks the synthesis of fish progestogen, prevents the maturation and ovulation of the oocyte of the obtained homozygous female fish from being blocked, and can not mate with wild male fish for spawning, thereby obtaining sterile female fish. After the obtained sterile female fish is treated by gonadotrophin and corresponding preparations, the natural mating and spawning capacity of the female fish with wild type male fish can be recovered, the higher fertilization rate and the higher membrane yield are achieved, and the surviving offspring individuals have no obvious difference from the wild type contemporaneous fish in morphology. By the mode, the method provided by the invention can be widely applied to various aquaculture fishes, so that effective control of female fish fertility in the aquaculture fishes is realized, ecological safety is protected, and the method has wide application prospects in the fields of aquaculture fish genetic breeding and ecological safety.
Description
Technical Field
The invention relates to the technical field of genetic engineering and the field of molecular biology, in particular to an optimized female fish fertility control method and application.
Background
In recent years, in order to increase the growth rate of aquaculture varieties, increase aquaculture yield, enhance disease resistance, and improve the quality of aquaculture varieties, many scholars have conducted extensive research in aquaculture-related fields using genetic manipulation techniques. However, once the genetically manipulated aquaculture material is released or escapes into natural water, natural propagation with wild type population is likely to occur, so that genetic manipulation sites are gradually infiltrated into the natural wild type population, thereby destroying the natural population genetic structure and genetic diversity, causing "genetic pollution" of wild species by artificial genetic manipulation sites, generating ecological safety risks which are difficult to predict and eliminate, and impeding the application and popularization of novel breeding technology based on genetic manipulation and aquaculture varieties based on genetic manipulation in aquaculture industry.
Fertility control refers to a technique of manually interfering with fertility of a target species so as to realize manual controllability of fertility. Fertility of the genetic operation aquaculture materials can be effectively controlled by establishing and optimizing fertility control technology, so that 'gene pollution' caused by drift of artificial genetic operation sites in wild type populations is prevented, and the genetic operation control technology is key for realizing application of novel breeding technologies such as gene editing and the like in industrial breeding with efficient improvement of production traits, and ecological safety of the natural populations is guaranteed. Meanwhile, the intellectual property of the aquatic product variety with the genetically improved characters can be effectively protected, the development power of the seed industry technology is ensured, and the sustainable development of the green and healthy of the aquaculture industry is promoted.
For fertility control, the invention patent with application number 201310049161.5 discloses a method for controlling fish reproduction, which comprises the steps of respectively constructing GAL4 gene transferred zebra fish homozygote and UAS-anti-sense dnd gene transferred zebra fish homozygote, and then hybridizing the GAL4 gene transferred zebra fish homozygote and the UAS-anti-sense dnd gene transferred zebra fish homozygote to obtain two-line hybrid offspring for reproductive abortion. According to the method, about 3% of egg cells in ovaries of two-line hybrid females are found to be in a fourth development stage through gonadal tissue sections, and the size and the number of lobular cavities in spermary of the two-line hybrid females are about 10% of those of a control. The method needs to construct two transgenic fishes, has complicated steps and involves the introduction of exogenous genes, so whether the method can be applied to economic fishes needs to be further studied.
The patent of the invention with the application number of 202111369875.5 discloses a loach CDK1 gene and application thereof in molecular breeding of sterile polyploid loaches, and the patent uses CRISPR/Cas9 technology to knock out the CDK1 gene of the polyploid loaches so as to obtain the sterile polyploid loaches. However, although the method can obtain sterile individuals, there is no fertility rescue method, so that sterile offspring cannot be obtained continuously for breeding practice, homozygous sterile offspring must be obtained continuously through mating of heterozygous parents and screening of offspring, sterile offspring can be obtained for breeding, and economic costs such as manpower, material resources and the like are obviously intolerable in large-scale breeding practice for the supply of a large number of seedlings of aquaculture fishes. Therefore, the method is difficult to popularize and apply in the aquaculture animals.
In view of the above, there is a need to design a method and application for controlling fertility of female fish optimally to solve the above problems.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide an optimized female fish fertility control method and application. The invention uses gene editing technology to specifically cut the key coding gene synthesized by gonadogestrin of fish, to obtain sterile female fish with high efficiency; and gonadotrophin and a preparation for promoting oocyte maturation and ovulation are adopted to treat the sterile female fish, so that the fertility of the female fish is better saved, and the control of the fertility of the female fish is realized.
In order to achieve the above object, the present invention provides an optimized female fish fertility control method, specifically:
knocking out key coding genes synthesized by gonadal progestogen of fish by adopting a gene editing technology, and blocking the synthesis of the gonadal progestogen of the fish so as to obtain the sterile female fish with the deleted homozygote;
after the sterile female fish with the deletion homozygote is treated by adopting a gonadotrophin and a preparation for promoting oocyte maturation and ovulation, the sterile female fish with the deletion homozygote can recover the natural mating and spawning capacities of the female fish with the wild male fish.
As a further improvement of the present invention, the key coding gene for gonadotropin synthesis is the regulatory protein coding gene (steroidogenic acute regulatory protein, star), i.e. the star gene, of the progestogen synthesis pathway.
As a further improvement of the present invention, the method for controlling fertility of female fish specifically comprises the steps of:
s1, knocking out star genes in fish by adopting a gene editing technology to obtain star deletion homozygous fish;
s2, screening star deletion homozygous female fish from the star deletion homozygous fish; oocytes of the star-deleted homozygous female fish are hindered from maturing and ovulation is blocked, and natural reproduction cannot be performed;
s3, treating the star-deleted homozygous female fish by adopting gonadotrophin and a preparation for promoting the maturation and ovulation of the star-deleted homozygous female fish oocyte;
s4, naturally mating the star-deleted homozygous female fish obtained after the treatment in the step S3 with the wild male fish.
As a further improvement of the present invention, in step S3, the gonadotrophin is human chorionic gonadotrophin and the agent promoting maturation and ovulation of the star-deleted homozygous female fish oocyte is 4-pregnan-17 a, 20 β -diol-3-one.
As a further improvement of the present invention, in step S3, the method of the processing is:
injecting said human chorionic gonadotrophin 8 hours prior to natural mating of said star-deleted homozygous female fish; subsequently, 6 hours before natural mating of the star-deleted homozygous female fish, a medicated bath treatment was performed with the 4-pregnane-17α,20β -diol-3-one.
As a further improvement of the present invention, in step S1, obtaining the star-deleted homozygous fish specifically comprises the steps of:
s11, knocking out star genes in fish by using a gene editing technology to obtain an F0 generation;
s12, hybridizing F0-generation male fish with wild female fish, amplifying and sequencing the obtained genome of F1-generation target detection fragments, and detecting F1-generation mutation conditions to obtain effectively mutated F1-generation star heterozygote fish;
s13, selfing the F1 generation star heterozygote, and obtaining the F2 generation star deletion homozygous fish through enzyme digestion, identification and screening.
As a further improvement of the present invention, in step S11, the knocking out the star gene in fish using the gene editing technique specifically includes the steps of:
p1, designing a star gene editing target site of fish based on a TALENs technology;
p2, editing target sites according to star genes of the fishes, designing targeting double arms and assembling and synthesizing TALENs mRNA; the targeting double arms comprise a left arm and a right arm;
p3, microinjection of fish fertilized eggs is carried out by taking targeted double-arm mRNA with a preset concentration as an injection for star gene editing.
As a further improvement of the present invention, in the step P1, the star gene editing target site of the fish is located on the second exon of the star gene, and a 22bpDNA sequence on the second exon of the star gene is taken as an intermediate sequence.
As a further improvement of the present invention, in the step P3, the predetermined concentration is 50 to 100 ng/. Mu.L, and the volume of the star gene-edited injectate injected at the time of the microinjection is 1.0 to 2.0nL.
In order to achieve the above purpose, the invention also provides application of the optimized female fish fertility control method in the fields of aquaculture fish genetic breeding and ecological safety.
The beneficial effects of the invention are as follows:
1. according to the optimized female fish fertility control method provided by the invention, the star genes of fishes are specifically cut by utilizing a gene editing technology, F1 generation star heterozygote with effective mutation can be obtained, selfing is carried out, F2 generation star deletion homozygous fish is screened out through enzyme cutting identification, so that the synthesis of fish progestogen is blocked, and all female fishes in the obtained star deletion homozygous fish can not mate with wild male fishes for spawning due to the fact that the synthesis of gonad progestogen is blocked, and the final maturation and ovulation of oocytes are blocked, so that sterile female fishes can be obtained. Meanwhile, the sterile female fish obtained based on the above method can be treated by using gonadotropins and agents promoting the maturation and ovulation of star-deleted homozygous female fish oocytes so that it can accomplish natural ovulation and fertilization, and the surviving offspring individuals are not significantly different from wild contemporaneous fish in morphology. Compared with the mode of simply treating the female fish with a preparation for promoting the maturation and ovulation of the star-deleted homozygous female fish oocyte, the invention further increases the use of gonadotrophin, can obviously improve the fertilization rate and the membrane-out rate of the treated female fish, and has better rescue effect on the fertility of the female fish. Therefore, the method provided by the invention not only can be used for efficiently obtaining the sterile female fish, but also can be used for effectively rescuing the fertility of the female fish by utilizing the gonadotrophin and the corresponding preparation, thereby realizing the control of the fertility of the female fish.
2. The optimized female fish fertility control method provided by the invention can be used for efficiently realizing manual control and optimization of female fish parent breeding by genetic operation, realizing controllable supply of sterile offspring seeds, effectively controlling fertility of the genetic operation aquaculture materials, preventing 'gene pollution' caused by drift of artificial genetic operation sites in wild type groups, fundamentally solving ecological safety problems of genetic operation application by using novel genetic breeding technology, and having important significance for genetic operation improvement of fishes and sustainable development and popularization of breeding research. Meanwhile, the intellectual property of the aquatic product variety with the genetically improved characters can be effectively protected, the development power of the seed industry technology is ensured, and the sustainable development of the green and healthy of the aquaculture industry is promoted.
3. star is highly expressed in the ovary and closely related to oocyte maturation and ovulation, widely occurring in fish, function conserved. The optimized female fish fertility control method provided by the invention can be applied to various aquaculture fishes to realize effective control of female fish fertility in the aquaculture fishes and protect ecological safety, and has wide application prospects in the fields of genetic breeding and ecological safety of the aquaculture fishes.
Drawings
Fig. 1 is a flow chart of the method for optimizing female fertility control provided by the invention.
FIG. 2 is a partial sequence alignment of star cDNA of a 3 month old wild type control zebra fish and a star deleted homozygous zebra fish provided by the present invention.
FIG. 3 is a schematic representation of the treatment of star-deleted homozygous females in example 1 and comparative example 1.
FIG. 4 is a bar graph of oviposition effects of treated and untreated star-deleted homozygous females of example 1 and comparative example 1.
FIG. 5 is a graph comparing the development of the offspring from the star-deleted homozygous zebra fish with that of the wild type contemporaneous fish of example 1 and comparative example 1.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in detail with reference to the accompanying drawings and specific embodiments.
It should be noted that, in order to avoid obscuring the present invention due to unnecessary details, only structures and/or processing steps closely related to aspects of the present invention are shown in the drawings, and other details not greatly related to the present invention are omitted.
In addition, it should be further noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.
The invention provides an optimized female fish fertility control method, which specifically comprises the following steps:
knocking out key coding genes synthesized by gonadal progestogen of fish by adopting a gene editing technology, and blocking the synthesis of the gonadal progestogen of the fish so as to obtain the sterile female fish with the deleted homozygote;
after the sterile female fish with the deletion homozygote is treated by adopting a gonadotrophin and a preparation for promoting oocyte maturation and ovulation, the sterile female fish with the deletion homozygote can recover the natural mating and spawning capacities of the female fish with the wild male fish.
By the mode, the invention can specifically cut the key coding genes synthesized by the gonadal progestogen of the fish by utilizing the gene editing technology, and can efficiently obtain the sterile female fish; and gonadotrophin and a preparation for promoting oocyte maturation and ovulation are adopted to treat the sterile female fish, so that the fertility of the female fish is better saved, and the control of the fertility of the female fish is realized.
Preferably, the key coding gene for gonadotropin synthesis is the star gene.
Preferably, the method for controlling fertility of female fish specifically comprises the following steps:
s1, knocking out star genes in fish by adopting a gene editing technology to obtain star deletion homozygous fish;
s2, screening star deletion homozygous female fish from the star deletion homozygous fish; oocytes of the star-deleted homozygous female fish are hindered from maturing and ovulation is blocked, and natural reproduction cannot be performed;
s3, treating the star-deleted homozygous female fish by adopting gonadotrophin and a preparation for promoting the maturation and ovulation of the star-deleted homozygous female fish oocyte;
s4, naturally mating the star-deleted homozygous female fish obtained after the treatment in the step S3 with the wild male fish.
By the mode, the star gene of the fish can be specifically cut by utilizing a gene editing technology, and the star deletion homozygote sterile female fish can be efficiently obtained; the sterile female fish can normally ovulate and fertilize after the treatment, the success rate, the fertilization rate, the membrane-out rate and the embryo survival rate of the sterile female fish can be tested and counted, and compared with a mode of singly using the preparation for treatment, the fertilization rate and the membrane-out rate of the sterile female fish are obviously improved.
Preferably, in step S1, obtaining the star-deleted homozygous fish specifically comprises the steps of:
s11, knocking out star genes in fish by using a gene editing technology to obtain an F0 generation;
s12, hybridizing F0-generation male fish with wild female fish, amplifying and sequencing the obtained genome of F1-generation target detection fragments, and detecting F1-generation mutation conditions to obtain effectively mutated F1-generation star heterozygote fish; its genotype is star+/-;
s13, selfing the F1 generation star heterozygote, and obtaining the F2 generation star deletion homozygous fish by enzyme digestion, identification and screening, wherein the genotype of the F1 generation star heterozygote is star-/-.
Preferably, in step S11, the knocking out the star gene in the fish by using the gene editing technology specifically includes the following steps:
p1, designing a star gene editing target site of fish based on a TALENs technology;
p2, editing target sites according to star genes of the fishes, designing targeting double arms and assembling and synthesizing TALENs mRNA; the targeting double arms comprise a left arm and a right arm;
p3, microinjection of fish fertilized eggs is carried out by taking targeted double-arm mRNA with a preset concentration as an injection for star gene editing.
Preferably, in step P1, the fish star gene editing target site is located on the second exon of star gene, and a 22bpDNA sequence on the second exon of star gene is taken as an intermediate sequence.
Preferably, in the step P3, the predetermined concentration is 50-00 ng/. Mu.L, and the volume of the star gene-edited injectate injected during the microinjection is 1.0-2.0 nL.
Preferably, in step S3, the gonadotropin is human chorionic gonadotrophin, and the agent that promotes maturation and ovulation of star-deleted homozygous female fish oocytes is 4-pregnan-17 a, 20 β -diol-3-one; the processing method comprises the following steps:
injecting said human chorionic gonadotrophin 8 hours prior to natural mating of said star-deleted homozygous female fish; subsequently, 6 hours before natural mating of the star-deleted homozygous female fish, medicated bath treatment with the 4-pregnane-17α,20β -diol-3-one; wherein, the concentration of human chorionic gonadotrophin is preferably 5 IU/mu L, and the injection volume is preferably 10 mu L; when treating star-deleted homozygous female fish in a medicated bath, the concentration of the 4-pregnan-17α,20β -diol-3-one formulation in the medicated bath is preferably 300 μg/L.
The optimized female fish fertility control method can be applied to various aquaculture fishes to effectively control female fish fertility in the aquaculture fishes, protect ecological safety and can be applied to the field of genetic breeding and ecological safety of the aquaculture fishes.
The method and application of the optimized female fertility control provided by the present invention will be described below with reference to specific examples and comparative examples.
Example 1
Referring to fig. 1, in this embodiment, zebra fish is taken as an example, and an optimized female fish fertility control method and application are provided, which specifically include the following steps:
s1, knocking out a star gene in zebra fish by adopting a gene editing technology to obtain star deletion homozygous fish, wherein the specific process is as follows:
s11, knocking out star genes of zebra fish by adopting a TALENs technology to obtain F0 generation, wherein the specific method comprises the following steps of:
1) The star gene editing target site of the zebra fish is designed on the second exon of the star gene according to the gene sequence information (NC_0071119.6, NCBI) of the zebra fish star in the NCBI database of the United states; a22 bp DNA sequence on the second exon of the star gene of zebra fish is taken as an intermediate sequence, and the intermediate sequence comprises a recognition site (GAGCTC) of a common restriction endonuclease SacI, and the gene sequence information is CCGAAGAAGGAGCTCCTTGCTC.
2) The star gene editing target site left arm and right arm of zebra fish respectively use 20 bp and 17bp of the middle sequence left and right as the binding sites of the two arms of TALENs, and the targeted two arms are assembled; the gene sequence information of the left arm was AGCACTTGGATAAACCACAT, and the gene sequence information of the right arm was ATGCAAGATCTCTTACT.
Linearizing the properly sequenced TALENs plasmid after assembly with restriction endonuclease SacI; TALENs target double arm mRNA transcription from linearized TALENs plasmids, specifically: mMESSAGE mMACHINE by Invitrogen corporation TM The SP6 Transcription kit synthesizes mRNA in vitro; measuring mRNA concentration with ultra-micro spectrophotometer, and packaging at-80deg.C.
3) Taking targeted double-arm mRNA with the concentration of 100 ng/mu L as an injection object for star gene editing, and injecting the injection object into a zebra fish embryo of 1-or 2-cells by using a microinjection instrument, wherein the injection volume is 1.0nL; and breeding the injected zebra fish eggs to sexual maturity to obtain F0 generation, and performing specific cutting on star genes to realize star gene editing and cause star gene mutation.
S12, hybridizing a zebra fish F0 generation male fish with a wild female fish to obtain a F1 generation, amplifying and sequencing a target detection fragment of a F1 generation genome, detecting F1 generation mutation conditions, and screening out an effectively mutated F1 generation star heterozygote zebra fish (star+/-); among the primers for amplifying and sequencing the target detection fragment, the sequences of the forward primer and the reverse primer of the star heterozygote zebra fish are TGACAGGTAAGAGCACTTTC and AGCCTGCATAAAGGAGTCTG respectively.
S13, selfing the F1 generation star heterozygote zebra fish with effective mutation, and screening out an effective mutation line (shown in figure 2) with 1bp deletion at a target site through enzyme digestion identification to obtain the F2 generation star deletion homozygous zebra fish (the genotype is star-/-).
S2, in the F2-generation star deletion homozygous fish, oocytes of female fish are mature, ovulation is blocked, normal reproduction cannot be carried out, natural mating is carried out with wild type males, and the spawning success rates are all 0.00%.
S3, injecting the Human Chorionic Gonadotrophin (HCG) 8 hours (0:00 a.m.) before natural mating of the star-deleted homozygous female fish; subsequently, 6 hours (2:00 a.m. -8:00 a.m.) before natural mating of the star-deleted homozygous female fish, medicated bath treatment (as shown in fig. 3B) was performed with 4-pregnane-17α,20β -diol-3-one, an agent that promotes oocyte maturation and ovulation. Wherein, the concentration of human chorionic gonadotrophin is 5 IU/mu L, the injection volume is 10 mu L, and the concentration of 4-pregnane-17 alpha, 20 beta-glycol-3-ketone in the medicated bath is 300 mu g/L.
S4, naturally mating the treated star deletion homozygous female fish with the wild male fish.
Test results show that the treated star-deleted homozygous female fish can normally ovulate and fertilize, and the spawning success rate of the treated star-deleted homozygous female fish is 60.00%, the fertilization rate is 50.82%, the membrane emergence rate is 88.51%, and the three-week survival rate is 69.36%.
The present embodiment is merely exemplified by zebra fish, and is not limited to the application field of the method for controlling fertility of female fish provided by the present invention. It will be appreciated by those skilled in the art that for various aquaculture fish containing star genes, gene editing can be performed according to the methods provided herein to achieve effective control of female fertility, all falling within the scope of the present invention. In other embodiments of the present invention, the variety of fish may be changed to a variety of aquaculture fish such as carp, crucian carp, grass carp, weever, tilapia, etc., and the same principle is used to achieve similar technical effects as in embodiment 1, so that no further description is given here. In addition, the optimized female fish fertility control method provided by the invention can be applied to various aquaculture fishes to realize effective control of female fish fertility in the aquaculture fishes and protect ecological safety, so that the method has wide application prospects in the fields of aquaculture fish genetic breeding and ecological safety.
Comparative example 1
For convenience of comparison with example 1, the present comparative example also uses zebra fish as an example, and provides an optimized female fertility control method, which differs from example 1 only in that step S3 is not injected with human chorionic gonadotrophin, but only 4-pregnane-17α,20β -diol-3-one is used for medicated bath treatment (as shown by A in FIG. 3).
The test results showed that the spawning success rate of star-deleted homozygous female fish obtained by medicated bath treatment with 4-pregnan-17 a, 20 ss-diol-3-one alone in the comparative example was 40.00%, fertilization rate was 18.34%, film yield was 47.81% and survival rate at three weeks was 55.03%, and a comparison graph with the corresponding data in example 1 is shown in fig. 4. As can be seen from fig. 4, in example 1, the injection of gonadotropin was further increased before the medicated bath, and the fertilization rate and the membrane-out rate of the treated females were significantly improved, and the fertility of females was better rescued, compared to the case of the medicated bath treatment using only the preparation for promoting the maturation and ovulation of the star-deleted homozygous females in comparative example 1.
Comparative example 2
For comparison with example 1 and comparative example 1, the present comparative example also uses zebra fish as an example, and offspring produced by natural mating of wild female and male fish are selected as comparative example 2, and spawning effect comparison test is performed.
Referring to FIG. 5, a comparative experiment was performed on spawning effects of the treated star-deleted homozygous female fish of example 1, the offspring produced by natural mating of the treated star-deleted homozygous female fish of comparative example 1 with the wild male fish, and the offspring produced by natural mating of the wild female fish with the male fish. The result shows that the surviving offspring produced by the star-deleted homozygous female fish has no obvious developmental disorder and has no obvious difference from the wild type contemporaneous fish in morphology, and the star-deleted homozygous female fish subjected to the two treatment modes in the example 1 and the comparative example 1 can restore the natural mating and spawning capacities of the star-deleted homozygous female fish and the wild type male fish, and the surviving offspring individuals have no obvious difference from the wild type contemporaneous fish in morphology.
In summary, the invention provides an optimized female fish fertility control method and application. The method uses gene editing technology to knock out the key coding gene of gonad progestogen synthesis of fish, blocks the synthesis of fish progestogen, prevents the maturation and ovulation of the oocyte of the obtained homozygous female fish from being blocked, and can not mate with wild male fish for spawning, thereby obtaining sterile female fish. After the obtained sterile female fish is treated by gonadotrophin and corresponding preparations, the natural mating and spawning capacity of the female fish with wild type male fish can be recovered, the higher fertilization rate and the higher membrane yield are achieved, and the surviving offspring individuals have no obvious difference from the wild type contemporaneous fish in morphology. By the mode, the method provided by the invention can be widely applied to various aquaculture fishes, so that effective control of female fish fertility in the aquaculture fishes is realized, ecological safety is protected, and the method has wide application prospects in the fields of aquaculture fish genetic breeding and ecological safety.
The above embodiments are only for illustrating the technical solution of the present invention and not for limiting the same, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications and equivalents may be made thereto without departing from the spirit and scope of the technical solution of the present invention.
Claims (10)
1. A method of optimizing female fertility control, characterized by:
knocking out key coding genes synthesized by gonadal progestogen of fish by adopting a gene editing technology, and blocking the synthesis of the gonadal progestogen of the fish so as to obtain the sterile female fish with the deleted homozygote;
after the sterile female fish with the deletion homozygote is treated by adopting a gonadotrophin and a preparation for promoting oocyte maturation and ovulation, the sterile female fish with the deletion homozygote can recover the natural mating and spawning capacities of the female fish with the wild male fish.
2. The method of optimizing female fertility control of claim 1, wherein: the key coding gene for synthesizing the gonadotropin is star gene.
3. The method of optimizing female fertility control of claim 1, wherein: the method specifically comprises the following steps:
s1, knocking out star genes in fish by adopting a gene editing technology to obtain star deletion homozygous fish;
s2, screening star deletion homozygous female fish from the star deletion homozygous fish; oocytes of the star-deleted homozygous female fish are hindered from maturing and ovulation is blocked, and natural reproduction cannot be performed;
s3, treating the star-deleted homozygous female fish by adopting gonadotrophin and a preparation for promoting the maturation and ovulation of the star-deleted homozygous female fish oocyte;
s4, naturally mating the star-deleted homozygous female fish obtained after the treatment in the step S3 with the wild male fish.
4. A method of optimizing female fertility control according to claim 3, wherein: in step S3, the gonadotrophin is human chorionic gonadotrophin, and the agent that promotes maturation and ovulation of star-deleted homozygous female fish oocytes is 4-pregnan-17 a, 20 β -diol-3-one.
5. The method of optimizing female fertility control of claim 4, wherein: in step S3, the method of the processing is as follows:
injecting said human chorionic gonadotrophin 8 hours prior to natural mating of said star-deleted homozygous female fish; subsequently, 6 hours before natural mating of the star-deleted homozygous female fish, a medicated bath treatment was performed with the 4-pregnane-17α,20β -diol-3-one.
6. A method of optimizing female fertility control according to claim 3, wherein: in step S1, obtaining the star-deleted homozygous fish specifically comprises the steps of:
s11, knocking out star genes in fish by using a gene editing technology to obtain an F0 generation;
s12, hybridizing F0-generation male fish with wild female fish, amplifying and sequencing the obtained genome of F1-generation target detection fragments, and detecting F1-generation mutation conditions to obtain effectively mutated F1-generation star heterozygote fish;
s13, selfing the F1 generation star heterozygote, and obtaining the F2 generation star deletion homozygous fish through enzyme digestion, identification and screening.
7. A method of optimizing female fertility control according to claim 3, wherein: in step S11, the knocking out the star gene in fish by using the gene editing technology specifically includes the following steps:
p1, designing a star gene editing target site of fish based on a TALENs technology;
p2, editing target sites according to star genes of the fishes, designing targeting double arms and assembling and synthesizing TALENs mRNA; the targeting double arms comprise a left arm and a right arm;
p3, microinjection of fish fertilized eggs is carried out by taking targeted double-arm mRNA with a preset concentration as an injection for star gene editing.
8. The method of optimizing female fertility control of claim 7, wherein: in the step P1, the star gene editing target site of the fish is positioned on the second exon of the star gene, and a 22bpDNA sequence on the second exon of the star gene is taken as an intermediate sequence.
9. The method of optimizing female fertility control of claim 7, wherein: in the step P3, the predetermined concentration is 50-100 ng/. Mu.L, and the volume of the star gene-edited injection injected during the microinjection is 1.0-2.0 nL.
10. Use of the method of optimized female fish fertility control of any one of claims 1-9 in the field of aquaculture fish genetic breeding and ecological safety.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310060796.9A CN117737136A (en) | 2023-01-20 | 2023-01-20 | Optimized female fish fertility control method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310060796.9A CN117737136A (en) | 2023-01-20 | 2023-01-20 | Optimized female fish fertility control method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117737136A true CN117737136A (en) | 2024-03-22 |
Family
ID=90278108
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310060796.9A Pending CN117737136A (en) | 2023-01-20 | 2023-01-20 | Optimized female fish fertility control method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117737136A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019222284A1 (en) * | 2018-05-14 | 2019-11-21 | The Broad Institute, Inc. | In situ cell screening methods and systems |
| US20210337776A1 (en) * | 2018-08-16 | 2021-11-04 | Lart Bio Co., LTD | Transgenic animals and transgenic embryos producing an engineered nuclease |
| CN114774413A (en) * | 2022-03-18 | 2022-07-22 | 中国水产科学研究院北戴河中心实验站 | Construction method, detection method and application of zebra fish roe disorder model |
| US20220275394A1 (en) * | 2020-10-19 | 2022-09-01 | Hubei Hongshan Laboratory | Application of a fragment of an isolated nucleotide sequence in construction of non-mineralized intermuscular bone of danio rerio |
| US20220338453A1 (en) * | 2021-04-16 | 2022-10-27 | Auburn University | Engineered catfish and uses thereof |
-
2023
- 2023-01-20 CN CN202310060796.9A patent/CN117737136A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019222284A1 (en) * | 2018-05-14 | 2019-11-21 | The Broad Institute, Inc. | In situ cell screening methods and systems |
| US20220229044A1 (en) * | 2018-05-14 | 2022-07-21 | The Broad Institute, Inc. | In situ cell screening methods and systems |
| US20210337776A1 (en) * | 2018-08-16 | 2021-11-04 | Lart Bio Co., LTD | Transgenic animals and transgenic embryos producing an engineered nuclease |
| US20220275394A1 (en) * | 2020-10-19 | 2022-09-01 | Hubei Hongshan Laboratory | Application of a fragment of an isolated nucleotide sequence in construction of non-mineralized intermuscular bone of danio rerio |
| US20220338453A1 (en) * | 2021-04-16 | 2022-10-27 | Auburn University | Engineered catfish and uses thereof |
| CN114774413A (en) * | 2022-03-18 | 2022-07-22 | 中国水产科学研究院北戴河中心实验站 | Construction method, detection method and application of zebra fish roe disorder model |
Non-Patent Citations (5)
| Title |
|---|
| HUANG P 等: "Targeted Mutagenesis in Zebrafish by TALENs", 《METHODS MOL BIOL》, vol. 1338, 31 December 2016 (2016-12-31), pages 191 - 206 * |
| LIU Y 等: "Genetic analysis of the reproductive axis in fish using genome-editing nucleases", 《SCI BULL》, vol. 62, no. 4, 4 January 2017 (2017-01-04), pages 302 - 308 * |
| SHANG G 等: "Steroidogenic acute regulatory protein and luteinizing hormone are required for normal ovarian steroidogenesis and oocyte maturation in zebrafish", 《BIOLOGY OF REPRODUCTION》, vol. 101, no. 4, 25 October 2019 (2019-10-25), pages 760 - 770 * |
| 于训 等: "半滑舌鳎基因编辑快速生长雄鱼通过现场验收", 《水产科技情报》, vol. 49, no. 2, 20 March 2022 (2022-03-20), pages 118 - 119 * |
| 通过基因敲除模型研究斑马鱼卵母细胞成熟以及脂肪代谢的机制: "通过基因敲除模型研究斑马鱼卵母细胞成熟以及脂肪代谢的机制", 《中国科学院大学》, 31 December 2017 (2017-12-31), pages 1 - 128 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Driever et al. | Zebrafish: genetic tools for studying vertebrate development | |
| CN113163740B (en) | Method for producing sterile and unisexual offspring | |
| Takeuchi et al. | Production of germ‐line chimeras in rainbow trout by blastomere transplantation | |
| Wong et al. | Transgenic approaches for the reproductive containment of genetically engineered fish | |
| CN110643636B (en) | Megalobrama amblycephala MSTNa & b gene knockout method and application | |
| Penman et al. | Patterns of transgene inheritance in rainbow trout (Oncorhynchus mykiss) | |
| JP2023116719A (en) | Disease model pig exhibiting stable phenotype, and production method thereof | |
| Ou et al. | Generation of myostatin gene-edited blotched snakehead (Channa maculata) using CRISPR/Cas9 system | |
| AU2598701A (en) | Controlling offspring's sex ratio by targeting transgenes onto the sex chromosomes | |
| CN108300738A (en) | A kind of preparation method of the humanized mouse model of the neutrophil leucocyte missing of NOD genetic backgrounds | |
| CN117737136A (en) | Optimized female fish fertility control method and application | |
| Chan et al. | Electroporation-based CRISPR/Cas9 mosaic mutagenesis of β-Tubulin in the cultured oyster | |
| CN117737122A (en) | Female fish fertility control method and application | |
| DK202170116A1 (en) | Genetically modified salmon which produce sterile offspring | |
| Chu et al. | Infertility control of transgenic fluorescent zebrafish with targeted mutagenesis of the dnd1 gene by CRISPR/Cas9 genome editing | |
| CN109897867B (en) | Gene modification method | |
| Hu et al. | A perspective on fish gonad manipulation for biotechnical applications | |
| CN113201515B (en) | Animal infertility related gene, sgRNA, application and animal model construction method | |
| CN116904523A (en) | Method for constructing female tilapia with egg laying behavior deletion by using gene editing technology | |
| EP4125347A1 (en) | Modified salmon which produce sterile offspring | |
| CN110643605B (en) | gRNA of megalobrama amblycephala MSTNa & b gene knockout and template thereof | |
| EP4130244A1 (en) | Temporary treatment medium, treatment kit, embryo developmental arrest inhibitor, method for inhibiting embryo developmental arrest, method for producing developmental engineering product, transfer method, therapeutic method, and developmental engineering product | |
| Titus | Gonads without glp-1: Silencing glp-1 in the Male Somatic Gonad in Caenorhabditis elegans | |
| Shahi et al. | Prospects and Challenges of Molecular Interventions for Enhancing Aquaculture Production in the Temperate Himalayas | |
| CN116555345A (en) | Method and application for researching animal model of GNE myopathy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |