CN117729911A

CN117729911A - Formulation of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione

Info

Publication number: CN117729911A
Application number: CN202280050237.3A
Authority: CN
Inventors: N·J·里德鲁埃霍; J·P·拉克什曼; S·K·M·拉亚班德拉; C·S·托勒; 范艺; D·哈代; 黄志红; J·C·洛伦; V·莫尔泰尼; D·肖; J·史密斯
Original assignee: Novartis AG
Current assignee: Novartis AG
Priority date: 2021-05-20
Filing date: 2022-05-18
Publication date: 2024-03-19

Abstract

Disclosed are formulations of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione and pharmaceutically acceptable salts thereof, methods of production thereof, and uses thereof, including in the treatment of ocular diseases and disorders such as dry eye and Meibomian Gland Dysfunction (MGD).

Description

Formulation of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione

1. Technical field

Provided herein are novel formulations of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione and pharmaceutically acceptable salts thereof, methods for the production thereof, and uses thereof, including in the treatment of ocular diseases and disorders such as Meibomian Gland Dysfunction (MGD).

2. Background art

The human tear film is composed of three layers. The mucus layer coats the cornea, forming the foundation, so that the tear film can adhere to the eye. The intermediate aqueous layer provides moisture and oxygen and other important nutrients to the cornea. The lipid outer layer is an oily film that seals the tear film on the eye and helps prevent evaporation of the underlying layers.

Most of the lipids that contribute to the tear film are formed in the meibomian glands, the exocrine glands of the whole urinary type, located at the margin of the eyelid on the medial side of the meibomian. Meibomian glands are primarily responsible for lipid production, and abnormal lipid secretion in these glands can affect various desired functions of the tear film. For example, the lipid layer of the tear film prevents evaporation, reduces the surface tension of tear fluid, thereby preventing tear fluid from escaping from the lid margin, and tear film lipids also play a role in the ability of the tear film to diffuse across the ocular surface, thereby affecting the interaction between the eyelid and the ocular surface to prevent damage to either surface. All of these properties of the tear film are affected by the lipids that the meibomian glands provide to the ocular surface and incorporate into the tear film.

Meibomian gland dysfunction can lead to lipid starvation, thereby destabilizing the tear film and causing reduced tear film break-up time and excessive evaporation of dry eye (see, e.g., sullivan et al, ann.ny acad.sci. [ new york academy of sciences ]966,211-222,2002). Meibomian Gland Dysfunction (MGD), also known as meibomian gland inflammation, posterior blepharitis or meibomian gland inflammation, is a chronic, diffuse abnormality of the meibomian glands that is generally characterized by end-duct obstruction and/or mass/volume changes in gland secretions (Nelson JD, et al, invest Ophthalmol Vis Sci [ ophthalmic and visual science survey ]2011; 52:1930-7). MGD is also characterized by meibum with higher viscosity and melting temperature, and a suboptimal tear lipid layer that does not prevent tear evaporation. It may lead to altered tear film, eye irritation symptoms, clinically significant inflammation and ocular surface disease. MGD often causes dry eye and may lead to blepharitis. Among up to about 70% of patients with overactive dry eye, the high medical demands of symptomatic MGD for about 3.5% of patients are not met.

MGD is also characterized by an elevated melting point of lipids, leading to solidification of the lipids and blockage of meibomian gland secretion. This can lead to cysts, infections and reduced lipid content in tears.

Common methods of treating meibomian gland dysfunction include mechanical treatment (e.g., lipflow) of the eyelid margin with heat or pressure applied to compress the gland or even mechanical probing of the meibomian tube. Other treatments include infrared devices that provide Intense Pulsed Light (IPL) treatment or chemicals to the eyelid margin to cause tear lipids to melt and secrete. For inflammation, glucocorticoids and antibiotics such as penicillin, doxycycline and tetracycline may be used, but the FDA has not approved glucocorticoids and antibiotics for this use. In addition, these therapies are not suitable for long-term use, either because of side effects or because of lack of proven efficacy. There is an unmet long-felt need for a safe and effective treatment for meibomian gland dysfunction that can improve lipid quality and tear film.

Liver X Receptors (LXRs) are ligand-activated transcription factors of the nuclear receptor superfamily, described first by Willy, P.J., et al, "LXR, a nuclear receptor that defines a distinct retinoid response pathway [ LXR, a nuclear receptor defining a unique retinoic acid response pathway ]," Genes & Development [ Gene & Development ]9:1033-1045 (Cold spring harbor laboratory Press (Cold Spring Harbor Laboratory Press)). LXR comprises two isoforms (lxrα and lxrβ) highly expressed in the epidermis. LXR transcriptionally regulates many processes involved in lipid homeostasis, including cholesterol transport and fatty acid synthesis. For example, stearoyl-coa desaturase 1 (SCD 1), an enzyme necessary for biosynthesis of monounsaturated fatty acids, has been reported to be a direct transcription target for LXR. See Shultz et al Genes & Dev [ Gene and development ]2000.14:2831-2838. Other biological pathways regulated by these effects of LXR include stimulation of epidermal lipid synthesis, which can increase lamellar body formation, secretion and processing in the corneal layer, resulting in the formation of lamellar membranes that regulate corneal barrier permeability. LXR also has complex interactions with inflammatory pathways. While LXR can down-regulate many inflammatory cytokines transcriptionally, it can down-regulate itself through inflammatory pathways. LXR's ability to reduce inflammation has been explored in indications such as atherosclerosis where macrophages play a pathological role.

In general, current treatments for meibomian gland dysfunction do not adequately address the etiology or pathology of the disease pharmacologically, and new treatments or therapies remain desirable.

3. Summary of the invention

3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione ("compound 1") is a bioactive LXR agonist, making the compound useful for treating ocular diseases such as MGD (see, e.g., example 3). However, its physical properties make it difficult to formulate compound 1 for therapeutic use (e.g., in a human subject). Compound 1 is poorly water-soluble, making it difficult to formulate a composition of compound 1 with the desired concentration of compound 1 for therapeutic use. For example, it was found that compound 1 had a solubility of only 0.025mg/ml at 10mM acetate, pH 4, and a solubility of only 0.001mg/ml at 10mM acetate, pH 5. In 10mM phosphate buffer at pH 7 (physiological pH), the solubility of Compound 1 was found to be below the limit of quantification. Furthermore, the melting temperature of compound 1 is only 118 ℃, which makes heat sterilization of compound 1 difficult. Despite these challenges, formulations of compound 1 have been developed, which can be used, for example, in the treatment of ocular diseases and disorders such as dry eye and MGD.

Thus, in various aspects, the invention provides formulations of compound 1 and pharmaceutically acceptable salts thereof, methods of producing the same, kits comprising the formulations of compound 1, and methods of using the formulations and kits, for example, for treating ocular diseases and disorders such as dry eye and Meibomian Gland Dysfunction (MGD).

In some aspects, the invention provides formulations comprising compound 1, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers, such as one or more castor oil-based solubilizing agents. In some embodiments, these formulations are aqueous suspensions intended for topical application to the eyelid of a subject (e.g., application to the eyelid by a finger or applicator of a subject). Exemplary features of the formulations of the present invention and components thereof are described in section 5.2 and in specific examples 1 to 203 and 229 below.

In other aspects, the invention provides kits comprising a formulation as described herein and a container, such as a single-use or multiple-use drop bottle (dropatainer). Exemplary features of the kit and its components are described in section 5.2 and specific examples 204-208 below.

In other aspects, the invention provides methods of making the formulations and kits described herein. Exemplary methods are described in section 5.3 and specific examples 209-228 below.

In further aspects, the invention provides methods of agonizing LXR in a subject's meibomian glands, methods of increasing the ratio of desaturated lipids to saturated lipids in a subject's eye, methods of lowering the melting temperature of meibum and/or increasing meibum outflow from a subject's meibomian glands, and methods of reducing meibum outflow obstruction from a subject's meibomian glands, comprising administering an amount of a formulation of compound 1 described herein to a subject, e.g., to the subject's eyelid (e.g., by a subject's finger or applicator). Exemplary features of such methods are described in section 5.4 and specific examples 230-237 below.

In still further aspects, the invention provides methods for treating dry eye (e.g., dry eye associated with Meibomian Gland Dysfunction (MGD)) and methods of treating Meibomian Gland Dysfunction (MGD) in a subject in need thereof, comprising administering to the subject, e.g., to the eyelid of the subject (e.g., by a finger or applicator of the subject), a therapeutically effective amount of a formulation of compound 1 described herein. Exemplary features of such methods are described in section 5.4 and specific examples 238-244 below.

In still further aspects, the invention provides formulations of compound 1 described herein for use in a method of agonizing LXR in a meibomian gland of a subject, a method of increasing the ratio of desaturated lipids to saturated lipids in an eye of a subject, a method of lowering the meibomian temperature and/or increasing meibomian outflow from the meibomian gland of a subject, a method of reducing meibomian outflow obstruction from the meibomian gland of a subject, a method of treating dry eye (e.g., associated with MGD), and a method of treating MGD. Exemplary features of such formulations for use are described in section 5.4 and specific examples 245-253 below.

In still further aspects, the invention provides irradiated compound 1 and pharmaceutically acceptable salts thereof. The irradiated compound 1 and pharmaceutically acceptable salts thereof can be used, for example, in the manufacture of medicaments, for example, for the treatment of diseases or conditions described herein, or in the manufacture of formulations described herein. Exemplary characteristics of irradiated compound 1 and pharmaceutically acceptable salts thereof and uses thereof are described in sections 5.2 through 5.4 and in specific examples 254 through 258 below.

4. Description of the drawings

FIG. 1 provides an illustrative X-ray powder diffraction pattern (XRPD) of the crystalline form of compound 1 (referred to herein as form A), showing the degree of 2-theta (2-theta) on the X-axis and the intensity on the Y-axis. A more detailed list of XRPD peaks for form a is set forth in table 1.

Fig. 2 provides an illustrative Differential Scanning Calorimetry (DSC) curve for a crystalline form of compound 1 (referred to herein as form a). DSC plots show the heat flow of the sample as a function of temperature at a rate of about 10K/min.

Fig. 3 provides an illustrative thermogravimetric analysis (TGA) curve of the crystalline form of compound 1 (referred to herein as form a). The TGA curve plots the percent weight loss of a sample as a function of temperature at a rate of about 10K/min.

Figure 4 shows the measured decrease in meibum melting temperature after administration of compound 1 at a concentration of 1% to the eyes of rats.

Figures 5A-5B show various formulations of compound 1. Fig. 5A: formulations that showed no significant sedimentation for 7 or 14 days; fig. 5B: formulations that showed significant sedimentation over 14 days.

Figures 6A-6C show rabbit meibomian glands exposed to compound 1 after topical administration of various compound 1 formulations. Fig. 6A: area Under Curve (AUC) from 0 to 12 hours of administration; fig. 6B: compound 1 concentration 12 hours after administration; fig. 6C: graph of compound 1 concentration measured at 0.5, 6 and 12 hours post-administration. Combined upper and lower meibomian glands from both eyes of animals, n=8.

5. Detailed description of the preferred embodiments

5.1. Definition of the definition

The terms "a" and "an" and "the" and similar terms as used herein (particularly in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

The term "carbomer" as used herein refers to synthetic high molecular weight polymers of acrylic acid, which are crosslinked, for example, with allyl ethers of allyl sucrose or pentaerythritol. These polymers are generally characterized as having carboxylic acid functional groups, and each functional group preferably contains 2 to 7 carbon atoms. Carbomers are available under the trade name from a variety of suppliersObtained. In a particular embodiment, the carbomer is a type B carbomer homopolymer. In particular embodiments, the carbomer is934P (carbomer 934P), 940, 941 or 974P. In particular embodiments, the carbomer is974P (carbomer 974P).

The term "castor oil-based solubiliser" as used herein refers to a compound or mixture of compounds comprising castor oil and/or derived from castor oil. For example, castor oil-based solubilisersIncluding solubilisers produced by reacting castor oil with ethylene oxide, or by reacting hydrogenated castor oil with ethylene oxide. Exemplary castor oil-based solubilizing agents include polyoxyethylene 40 hydrogenated castor oil (available from BASF corporation (BASF)) RH40 sold) and polyoxyethylated 35 castor oil (sold by Basoff company as +.>EL sales).

The term "compound 1" as used herein refers to 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione. In some embodiments, compound 1 is "form a". In some embodiments, form a is characterized by an XRPD pattern comprising one or more peaks selected from 7.2, 8.2, 10.7, 14.5, 15.0, 20.7, 21.8±0.2° 2θ. In some embodiments, form a is characterized by an XRPD pattern comprising two, three, or four representative peaks selected from 7.2, 8.2, 10.7, 14.5, 15.0, 20.7, 21.8±0.2° 2θ. In other embodiments, form a is characterized by an XRPD pattern comprising one or more peaks selected from figure 1, as shown in table 1.

The term "D90 particle size" as used herein refers to a diameter value at or below which 90% of the particles (by volume) in the volume particle size distribution have diameters equal to or lower than that value. Thus, for example, for a composition having a D90 particle size of 1 μm, 90% by volume of the particles have a diameter of 1 μm or less. The D90 particle size can be measured by laser diffraction. Exemplary laser diffraction particle size analyzers that may be used to measure D90 particle size include Microtrac S3500, sync, and Bluewave particle size analyzers.

The term "D50 particle size" as used herein refers to a diameter value at or below which 50% of the particles (by volume) in the volume particle size distribution have diameters equal to or lower than that value. Thus, for example, for a composition having a D50 particle size of 1 μm, 50% by volume of the particles have a diameter of 1 μm or less. The D50 particle size can be measured by laser diffraction. Exemplary laser diffraction particle size analyzers that may be used to measure D50 particle size include Microtrac S3500, sync, and Bluewave particle size analyzers.

The term "D10 particle size" as used herein refers to a diameter value at or below which 10% of the particles (by volume) in the volume particle size distribution have diameters equal to or lower than that value. Thus, for example, for a composition having a D10 particle size of 1 μm, 10% by volume of the particles have a diameter of 1 μm or less. D10 particle size can be measured by laser diffraction. Exemplary laser diffraction particle size analyzers that may be used to measure D10 particle size include Microtrac S3500, sync, and Bluewave particle size analyzers.

The term "liver X receptor" or "LXR" as used herein refers to nuclear receptors involved in cholesterol biosynthesis. As used herein, the term LXR refers to lxrα and lxrβ isoforms of proteins found in mammals and fragments thereof. Exemplary LXR protein sequences include UniProt identifier Q13133 (exemplary human lxrα protein sequence) and UniProt identifier P55055 (exemplary human lxrβ protein sequence).

The term "moisturizer" as used herein refers to a substance suitable for application to the skin that promotes the retention of moisture in the formulation containing the moisturizer and/or the skin to which the formulation is applied. Exemplary humectants include glycerin, propylene glycol, mannitol, and sorbitol.

The term "ophthalmically compatible" as used herein refers to formulations, polymers and other materials and/or dosage forms suitable for use in contact with ocular tissues of subjects (including humans and animals) without undue toxicity, irritation, allergic response, or other problem or complication (commensurate with a reasonable benefit/risk ratio).

As used herein, the term "pharmaceutically acceptable carrier" refers to a substance that can be used to prepare or use a formulation and includes, for example, suitable diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffers, emulsifiers, absorption delaying agents, salts, pharmaceutical stabilizers, binders, excipients, disintegrants, lubricants, wetting agents, humectants, sweeteners, flavoring agents, dyes, and combinations thereof, as known to those skilled in the art (see, e.g., remington The Science and Practice of Pharmacy [ leimington: pharmaceutical science and practice ], 22 nd edition, pharmaceutical publishing (Pharmaceutical Press), 2013, pages 1049-1070).

As used herein, the term "preservative" refers to a substance in a formulation that is used to extend shelf life and/or inhibit the growth of microorganisms (e.g., bacteria, fungi, viruses, and protozoa). Examples of preservatives other than quaternary ammonium salts include, for example, alkyl mercury salts of thiosalicylic acid (e.g., such as thiomersal, phenylmercuric nitrate, phenylmercuric acetate, or phenylmercuric borate), sodium perborate, sodium chlorite, parabens (e.g., such as, methyl or propyl parabens), alcohols (e.g., such as, chlorobutanol, benzyl alcohol, or phenethyl alcohol), guanidine derivatives (e.g., such as, chlorhexidine, or polyhexamethylene biguanide), sodium perborate, or sorbic acid, as appropriate.

The term "prevention" of any disease or disorder as used herein refers to the prophylactic treatment of a disease or disorder; or delay the onset or progression of a disease or disorder.

The term "salt" as used herein refers to an acid-addition salt or a base-addition salt of a compound provided herein. "salt" includes in particular "pharmaceutically acceptable salt". As used herein, "pharmaceutically acceptable salt" refers to a salt that retains the biological effectiveness and properties of compound 1 and is typically not biologically or otherwise undesirable. Those skilled in the art will appreciate that salts of compound 1, including pharmaceutically acceptable salts, may be prepared. These salts may be prepared in situ during the final isolation and purification of the compound, or by reacting the purified compound in free form with a suitable base or acid, respectively.

Pharmaceutically acceptable acid addition salts can be formed with inorganic and organic acids. Inorganic acids from which salts may be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like. Organic acids from which salts may be derived include, for example, acetic acid, propionic acid, glycolic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, sulfosalicylic acid, and the like. Pharmaceutically acceptable base addition salts, such as carboxylates, sulfonates, and phosphates, can be formed with inorganic and organic bases.

The term "stable" as used herein in reference to formulation parameters (e.g., viscosity, amount of bleed, pH, re-suspendability, etc.) means that the parameters do not change to an unacceptable extent over a defined shelf life (e.g., 6 weeks, 3 months, or 6 months of time), such as at 5 ℃, 25 ℃, or 40 ℃. For example, if a formulation has a specification for a given parameter, the parameter may be considered stable if the parameter is within the specification when measured before and after the storage period. For example, if the formulation has a viscosity specification of 200cPs to 400cPs, if the viscosity measured before and after storage is in the range of 200cPs to 400cPs, the viscosity may be considered stable for a defined shelf life.

The term "subject" as used herein refers to a living organism having one or more of the diseases or disorders described herein that can be treated by administration of the formulations described herein. Examples of subjects include mammals (e.g., humans and animals such as dogs, cows, horses, monkeys, pigs, guinea pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals). In certain embodiments, the subject is a primate. In certain embodiments, the subject is a human, e.g., a human having, at risk of having, or likely to have a disease described herein. In a particular embodiment, the subject is an adult at least 18 years old. In a particular embodiment, the subject is an adult from 18 to 75 years old. In some embodiments, the subject is a human child up to 18 years old.

The term "subject in need of treatment" refers to whether the subject would benefit from such treatment biologically, pharmaceutically or quality of life.

As used herein, the term "substantially pure" when used in reference to one form (such as form a) means a compound having a purity of greater than 90 wt%, including greater than 90 wt%, 91 wt%, 92 wt%, 93 wt%, 94 wt%, 95 wt%, 96 wt%, 97 wt%, 98 wt% and 99 wt%, and further including 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione equal to 100 wt%, based on the weight of the compound. The remaining materials contain one or more other forms of the compound, and/or reactive impurities and/or processing impurities resulting from its preparation. For example, the crystalline form of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione may be regarded as substantially pure because it is more than 90% pure by weight, as measured by means known and commonly accepted in the art at this time, with the remaining less than 10% by weight of the material comprising one or more other forms of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione and/or reactive impurities and/or processing impurities.

The term "substantially identical" as used herein with respect to X-ray diffraction peak positions means that typical peak positions and intensity variability are considered. For example, one skilled in the art will appreciate that peak positions (° 2θ) will exhibit variability between certain devices, typically up to ±0.2θ. Furthermore, it will be appreciated by those skilled in the art that the relative peak intensities will show variability between devices as well as variability due to crystallinity, preferred orientation, surface of prepared samples and other factors known to those skilled in the art, and should be taken as qualitative measurements only.

The term "therapeutically effective amount" as used herein refers to the amount of the formulation of compound 1 that will elicit a biological or medical response in a subject (e.g., increase enzyme or protein activity or inhibit, or ameliorate symptoms, alleviate a condition, slow or delay disease progression or prevent disease, etc.). In one embodiment, the term "therapeutically effective amount" refers to an amount of the article of manufacture that is effective to agonize LXR when administered to a subject, thereby at least partially alleviating, preventing, and/or ameliorating meibomian gland dysfunction. In another embodiment, the term "therapeutically effective amount" refers to an amount of a formulation provided herein that is effective to increase LXR activity when administered to a cell, or tissue, or non-cellular biological material or medium.

As used herein, the term "treating" of any disease or disorder refers to alleviating, moderating, delaying, alleviating, reversing, or ameliorating at least one symptom or sign of a condition in a subject. In one embodiment, the term "treatment" refers to alleviation, delay, alleviation, reversal, or amelioration of at least one symptom or sign selected from the group consisting of: abnormal meibomian gland secretion, meibomian gland dysfunction, dry eye, meibomian gland secretion, redness of the eyelid margin, burning and/or itching of the subject's eyes, ocular discomfort, corneal epithelial erosion, staining of the eyes and conjunctiva, and hypoplastic vision and/or vision blur. The term "treatment" may also mean preventing, delaying onset (i.e., the period prior to the clinical manifestation of the disease) and/or reducing the risk of developing or worsening the condition.

As used herein, the term "viscosity" refers to the viscosity of a composition (e.g., a formulation as described herein) measured by a viscometer at 25 ℃, unless otherwise defined in a particular context. In some embodiments, the viscosity is measured using a Brookfield viscometer with spindle CP-52 at 10rpm at 25 ℃.

The term "3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione related impurity" as used herein refers to an impurity in an article of manufacture that is due to the synthesis and/or degradation of compound 1 or a pharmaceutically acceptable salt thereof. High Pressure Liquid Chromatography (HPLC) can be used to quantify 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione related impurities.

An increase in the amount of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione related impurities can be reported after the pot life. For example, if the amount of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione related impurities before the storage period is 0.8% (where the sum of the amount of compound 1 or its pharmaceutically acceptable salt and all 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione related impurities is 100%) and after the storage period is 1.2%, then the amount of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione related impurities can be increased by 0.4% as the related impurities.

Unless otherwise indicated, the concentrations of all components are presented in units of weight/weight% (% w/w). As is generally understood, the% w/w value refers to the ratio of a particular component in the article, as measured by the ratio of the weight of that component to the total weight of the formulation.

5.2. Compound 1, formulation components and kit

In one aspect, the invention provides a formulation comprising compound 1 or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable carriers. Pharmaceutically acceptable carriers include, for example, solubilizing agents, viscosity enhancers, tonicity enhancers, humectants and pH adjusting agents. Exemplary characteristics of compound 1 and pharmaceutically acceptable salts are described in section 5.2.1, and exemplary pharmaceutically acceptable carriers that may be included in the formulations of the invention are described in section 5.2.2 (including sub-portions thereof). In some embodiments, the formulation may be self-preserving and does not include a preservative. In some embodiments, the formulation further comprises a preservative.

The formulations of the present invention are typically aqueous suspensions. A suspension is a heterogeneous mixture of fluids containing solid particles large enough to precipitate. The particles in suspension may be characterized by their particle size distribution, for example by D90, D50 and D10 values. For ophthalmic formulations, such as formulations intended for topical application to the eyelid of a subject (e.g., by spreading the formulation over the eyelid surface, such as with the subject's finger or applicator), a smaller particle size is desirable in order to avoid or limit eye irritation caused by large particles. Thus, in various embodiments, the aqueous suspensions of the present invention have a D90 particle size of no more than 20 μm, no more than 15 μm, no more than 10 μm, no more than 5 μm, no more than 3 μm, no more than 2 μm, or no more than 1 μm. In some embodiments, the D90 particle size is at least 0.5 μm or at least 6 μm.

The D50 particle size of a given formulation is less than its D90 particle size, and in some embodiments, the D50 particle size of the aqueous suspension of the present invention is no more than 5 μm, no more than 3 μm, no more than 2 μm, no more than 1 μm, no more than 0.9 μm, no more than 0.8 μm, no more than 0.7 μm, no more than 0.6 μm, no more than 0.5 μm, no more than 0.4 μm, or no more than 0.3 μm. In some embodiments, the D50 particle size is at least 0.2 μm, at least 0.3 μm, at least 0.4 μm, at least 0.5 μm, at least 0.6 μm, or at least 0.7 μm.

The D10 particle size of a given formulation is less than its D50 particle size, and in some embodiments, the D10 particle size of the aqueous suspension of the present invention is no more than 2 μm, no more than 1 μm, no more than 0.9 μm, no more than 0.8 μm, no more than 0.7 μm, no more than 0.6 μm, no more than 0.5 μm, no more than 0.4 μm, or no more than 0.3 μm. In some embodiments, the D10 particle size is at least 0.1 μm, at least 0.2 μm, at least 0.3 μm, or at least 0.1 μm.

The particle size of compound 1 or a pharmaceutically acceptable salt thereof as reflected by the D90 and/or D50 and/or D10 particle size may be reduced, for example, by wet milling of compound 1 or a pharmaceutically acceptable salt thereof with one or more components of the final formulation, for example, a solubilizing agent such as a castor oil-based solubilizing agent.

The formulations of the invention typically comprise 0.1% w/w to 5% w/w of compound 1 or a pharmaceutically acceptable salt thereof (e.g., at least 0.1% w/w, at least 0.3% w/w, at least 0.5% w/w, at least 1% w/w, at least 2% w/w, or at least 3% w/w to no more than 5% w/w, no more than 4% w/w, no more than 3% w/w, no more than 2% w/w, or no more than 1% w/w). In some embodiments, the formulation of the invention comprises 0.1% w/w, 0.2% w/w, 0.3% w/w, 0.4% w/w, 0.5% w/w, 1% w/w, 2% w/w, 3% w/t, or 5% w/w of compound 1 or a pharmaceutically acceptable salt thereof. Unless otherwise indicated, the weights or dosages referred to herein for compound 1 or a salt thereof provided herein are weights or dosages of the compound itself (rather than the salt thereof) which may be different for achieving the desired therapeutic effect. For example, the weight or dose of the corresponding salt of compound 1 suitable for the methods or compositions disclosed herein can be calculated based on the ratio of the molecular weights of the salt and the compound itself. In some embodiments, the formulations of the present invention comprise compound 1 in free (non-salt) form.

The formulations of the present invention are preferably stable during storage. Various parameters may be measured to assess stability, for example, the amount of total impurities (e.g., due to degradation of compound 1), particle diameter (e.g., D90, D50, D10), viscosity, permeation, pH, re-suspendability, and appearance. In some embodiments, the formulations of the invention exhibit stability to one, two, three, four, five, six, or seven of the following parameters when stored at 5 ℃, 25 ℃, or 40 ℃ for 6 weeks, 3 months, or 6 months: i) 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione related impurity; ii) D90 particle size; iii) Viscosity; iv) the amount of penetration; v) pH; vi) re-suspendability; vii) appearance.

In some embodiments, a formulation may be considered stable with respect to 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione related impurities for a given storage condition when the amount of impurities does not increase by more than 1% or 0.5% relative to the amount of impurities present prior to storage.

In some embodiments, a formulation may be considered stable with respect to D90 particle size for a given storage condition when the D90 particle size does not increase by more than 500%, 100%, 50% or 10% relative to the D90 particle size prior to storage.

In some embodiments, a formulation may be considered stable with respect to viscosity for a given storage condition when the viscosity at the end of storage is 70% to 150%, 80% to 125%, or 90% to 110% of the measured viscosity prior to storage.

In some embodiments, a formulation may be considered to have stability with respect to the permeation volume for a given storage condition when the permeation volume at the end of storage is 90% to 120% or 95% to 110% of the permeation volume measured prior to storage.

In some embodiments, a formulation may be considered stable with respect to pH for a given storage condition when the pH at the end of storage is no more than 0.1, 0.2, or 0.3 pH units higher or lower than the pH of the formulation prior to storage.

In some embodiments, when the re-suspendability at the end of storage is the same in quality as the re-suspendability of the pre-storage formulation, the formulation may be considered to have stability with respect to re-suspendability for a given storage condition. For example, formulations that appear uniform and non-caking before and after storage by visual inspection may be considered to have stability with respect to re-suspendability.

In some embodiments, when the appearance at the end of storage is qualitatively the same as the appearance of the pre-storage formulation, the formulation may be considered stable with respect to appearance for a given storage condition. For example, formulations that appear to be the same color before and after storage by visual inspection may be considered to have stability with respect to appearance.

In some embodiments, the formulations of the present invention that are aqueous suspensions may exhibit significant sedimentation upon storage for a period of time, by visual inspection. However, some formulations of the present invention advantageously do not exhibit significant sedimentation over a long period of time (e.g., 7 days or 14 days). As shown in section 6, several exemplary formulations of compound 1 exhibited no significant sedimentation when viewed on days 7 and 14, while other formulations, particularly those comprising Hydroxyethylcellulose (HEC), exhibited significant sedimentation. Thus, in some embodiments, the formulation of the present invention does not comprise HEC.

In another aspect, the invention provides a kit comprising a formulation of compound 1 described herein and a dropper bottle. A dropper bottle is a container comprising a bottle, a tip and a cap, which can be used to dispense a formulation in the form of drops. Drip bottles of various sizes are commercially available from various suppliers. In some embodiments, the formulations of the present invention may be packaged in drip bottles, for example for single or multiple use. Various sizes of droppers may be used, such as 4ml or 8ml droppers, optionally with a 15mm tip. The dropper tip may be selected to provide a desired drop size, for example, a tip providing a drop size of 30mg to 40 mg. In some embodiments, the kits of the invention comprise 4ml of formulation in an 8ml drop bottle. In other embodiments, the kits of the invention comprise 2ml of formulation in a 4ml drop bottle.

5.2.1. Compound 1 and pharmaceutically acceptable salts thereof

Compound 1 present in the formulations described herein may be in crystalline or amorphous form. Examples of crystalline forms of compound 1 include the form known as form a. The designations herein used to identify particular forms (e.g., "form a," etc.) should not be considered limiting of any other substance having similar or identical physical and chemical characteristics, but rather should be understood to be merely identifiers that should be interpreted in accordance with the characteristic information also presented herein. In certain embodiments, form a is substantially pure.

In certain embodiments, the formulations described herein comprise form a having an X-ray powder diffraction (XRPD) spectrum substantially the same as the XRPD shown in figure 1. In other embodiments, these formulations may comprise form a, characterized in that the XRPD pattern comprises one or more peaks selected from the group consisting of 7.2±0.2, 7.8±0.2, 8.2±0.2, 10.7±0.2, 11.6±0.2, 12.5±0.2, 13.8±0.2, 14.5±0.2, 15.0±0.2, 15.8±0.2, 17.7±0.2, 18.9±0.2, 20.7±0.2, 21.3±0.2, 21.8±0.2, 22.1±0.2, and 23.1±0.2. Thus, the XRPD pattern of form a may include one, two, three, or four representative peaks. In other embodiments, the formulation may comprise form a, characterized in that the XRPD pattern comprises one or more peaks selected from figure 1, as shown in table 1.

In certain embodiments, the formulations provided herein comprise form a having a Differential Scanning Calorimetry (DSC) curve substantially the same as the DSC curve shown in figure 2. In certain embodiments, the DSC curve is characterized by a single endothermic event representing melting of the compound, wherein melting begins at about 118.6 ℃ with a heating rate of 10K/min. In certain embodiments, the DSC curve is characterized by a single endothermic event at about 121.5 ℃ at a heating rate of 10K/min, which represents melting of the compound.

In certain embodiments, the formulations provided herein comprise form a having a thermogravimetric analysis (TGA) profile substantially the same as the TGA profile shown in fig. 3. In certain embodiments, the weight loss represents about 0.04% of the sample loss when the temperature is varied from about 30 ℃ to about 150 ℃. In certain embodiments, the weight loss represents less than about 0.5% of the sample loss when the temperature is varied from about 30 ℃ to about 150 ℃.

In other embodiments, the formulations provided herein comprise an amorphous form of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione.

It will be appreciated that there is inherent variability in the XRPD spectra or plots in values measured in 2theta degrees (° 2θ) due to, for example, instrument variations (including differences between instruments). Likewise, it should be understood that there is variability in XRPD peak measurements up to ±0.2° 2θ, however such peaks will still be considered to represent specific solid state forms of crystalline materials described herein. It will also be appreciated that other measurements from XRPD experiments and Karl fischer (Karl Fisher) analysis, such as relative strength and water content, may vary due to, for example, sample preparation and/or storage and/or environmental conditions, however, such measurements will still be considered to represent specific solid state forms of the crystalline materials described herein.

In some embodiments, the formulations of the present invention may comprise an amount of compound 1, or a pharmaceutically acceptable salt thereof, that has been sterilized. Compound 1 was found to be relatively unstable when sterilized by steam, and relatively stable when sterilized by gamma irradiation. Without being bound by theory, it is believed that the relative instability observed for steam sterilization is due to the relatively low melting temperature of compound 1. Thus, in some embodiments, the compounds 1 used in the formulations, processes and methods of the invention are sterilized by radiation (e.g., gamma radiation or X-ray radiation). In some embodiments, the compound 1 used in the formulations, processes and methods of the invention is sterilized by gamma radiation of 10kGy to 30kGy (e.g., 10kGy to 20kGy or 20kGy to 30 kGy).

5.2.2. Pharmaceutically acceptable carrier

The formulations of the present invention typically comprise one or more carriers selected from the group consisting of solubilizers, viscosity enhancers, tonicity enhancers, humectants and pH-adjusting agents. In some embodiments, the formulations of the present invention comprise at least one solubilizing agent, at least one viscosity enhancing agent, at least one humectant, optionally at least one tonicity enhancing agent, and optionally at least one pH adjusting agent. Exemplary solubilizing agents, viscosity enhancers, tonicity enhancers, humectants and pH adjusting agents are described in sections 5.2.2.1 to 5.2.2.5, respectively.

5.2.2.1. Solubilizer

A solubilizer is a component of a pharmaceutical formulation that is used to help solubilize one or more other components in the formulation, such as the active pharmaceutical ingredient. Solubilizing agents include, but are not limited to, tyloxapol (tyloxapol), fatty acid glycerol polyethylene glycol esters, fatty acid polyethylene glycol esters, polyethylene glycols, glycerol ethers, or cyclodextrins. As detailed in section 6 below, the solubility of compound 1 in various excipients was studied, and the solubility of compound 1 in castor oil-based solubilisers was found to be much higher than in the other studied solubilisers. Thus, the formulations of the present invention typically comprise one or more castor oil-based solubilisers, such as polyoxyethylene 40 hydrogenated castor oil and/or polyoxyethylene 35 castor oil. In some embodiments, the formulation of the present invention comprises a castor oil-based solubilizing agent that is polyoxyethylene 40 hydrogenated castor oil. In other embodiments, the formulation of the present invention comprises polyoxyethylated 35 castor oil. The amount of castor oil-based solubilizing agent included in the formulations of the present invention may range, for example, from 0.1% w/w to 5% w/w (e.g., at least 0.1% w/w, at least 0.2% w/w, at least 0.3% w/w, at least 0.4% w/w, or at least 0.5% w/w to no more than 5% w/w, no more than 4% w/w, no more than 3% w/w, no more than 2% w/w, or no more than 1% w/w). In some embodiments, the amount of castor oil-based solubilizing agent (e.g., polyoxyethylene 40 hydrogenated castor oil/or polyoxyethylene 35 castor oil) in the formulation is 0.5% or 1%.

5.2.2.2. Viscosity enhancing agent

The formulations of the present invention typically have a viscosity ranging from 50cPs to 600 cPs. In some embodiments, the formulation has a viscosity of at least 50cPs, at least 100cPs, at least 150cPs, at least 175cPs, or at least 200cPs and/or no more than 600cPs, no more than 500cPs, no more than 400cPs, no more than 350cPs, or no more than 300cPs. In some embodiments, the formulations of the present invention have a viscosity of 100cPs to 400cPs, 150cPs to 400cPs, or 200cPs to 400cPs.

The viscosity of the formulation may be adjusted by the inclusion of one or more viscosity enhancing agents. Examples of viscosity enhancers include, but are not limited to, polysaccharides such as hyaluronic acid and its salts, chondroitin sulfate and its salts, dextran, various polymers of the cellulose family, vinyl polymers, and acrylic polymers. The formulations of the present invention typically comprise carbomers, which are an acrylic acid-based polymer. In particular embodiments, the carbomer is a type B carbomer homopolymer, e.g974P (carbomer 974P). In some embodiments, the amount of type B homopolymer included in the formulations of the present invention may be at least 0.1% w/w, at least 0.2% w/w, at least 0.3% w/w, at least 0.4% w/t, at least 0.5% w/t to no more than 1% w/w, no more than 0.9% w/w, no more than 0.8% w/w, Not more than 0.7% w/w, not more than 0.6% w/w or not more than 0.5% w/w. In some embodiments, the amount of type B carbomer homopolymer is 0.5% w/w.

Salts such as sodium chloride tend to reduce the viscosity of carbomer-containing formulations. Thus, salts such as sodium chloride may be used to adjust the viscosity of carbomer-containing formulations. In some embodiments, the formulations of the present invention contain 0.1% to 0.5% w/w sodium chloride (e.g., at least 0.1% w/w or at least 0.2% w/w to no more than 0.5% w/w, no more than 0.4% w/w, or no more than 0.3% w/w). In some embodiments, the amount of sodium chloride in the formulation of the present invention is 0.25% w/w.

In some embodiments, the viscosity (or range of viscosities) of the formulations of the present invention may be selected such that the formulation has (1) a viscosity that is sufficiently high so as not to flow out of the fingertip and/or eyelid upon application, and/or (2) a viscosity that is sufficiently low so as to be easily dispensed from a dropper bottle or dropper dispenser. In some embodiments, the formulations of the present disclosure form droplets having a mass of 30mg to 40 mg.

5.2.2.3. Tension enhancer

The formulations of the invention typically have an osmolality ranging from 200 milliosmoles per kilogram (mOsm/kg) to 400mOsm/kg (e.g., at least 200mOsm/kg, at least 250mOsm/kg, at least 275mOsm/kg to no more than 400mOsm/kg, no more than 375mOsm/kg, or no more than 350 mOsm/kg). In some embodiments, the formulation has an osmolality of 250 to 350mOsm/kg.

If desired, the tension of the formulation may be adjusted by using a tension enhancer. Such agents may be ionic and/or nonionic, for example. Examples of ionic tonicity enhancing agents include, for example, alkali or alkaline earth halides, such as, for example, caCl ₂ KBr, KCl, liCl, naI, naBr or NaCl, na ₂ SO ₄ Or boric acid. Nonionic tonicity enhancing agents include, for example, urea, glycerin, sorbitol, mannitol, propylene glycol or dextrose. In some embodiments, the formulations of the present invention comprise an ionic tonicity enhancing agent, such as NaCl.

5.2.2.4. Humectant type

In some embodiments, the formulations of the present invention may comprise a humectant. The humectant may help the formulation of the present invention retain moisture, which may increase the amount of time before the aqueous formulation dries when applied to the skin (e.g., eyelid). Without being bound by theory, it is believed that the inclusion of a humectant in the formulation of the present invention may improve skin penetration of compound 1 or a pharmaceutically acceptable salt thereof and/or enhance delivery of compound 1 or a pharmaceutically acceptable salt thereof through the skin. Exemplary humectants that may be used in the present invention include glycerin, propylene glycol, mannitol, and sorbitol. Humectants such as glycerin may also have emollient properties. The concentration of the particular humectant in the formulation may vary depending on the agent selected. In some embodiments, the formulations of the present disclosure comprise glycerol, mannitol, or propylene glycol.

In some embodiments, the formulations of the present invention contain glycerol, for example in an amount ranging from 0.5% w/w to 3% w/w (e.g., at least 0.5% w/w or at least 1% w/w to no more than 3% w/w, or no more than 2% w/w). In some embodiments, the amount of glycerol in the formulation of the invention is 1.5% w/w.

In other embodiments, the formulations of the invention contain mannitol, for example in an amount ranging from 1% w/w to 5% w/w (e.g., at least 1% w/w or at least 2% w/w to no more than 5% w/w or no more than 4% w/w). In some embodiments, the amount of mannitol in the formulation of the present invention is 3% w/w.

pH regulator 5.2.2.5

For adjusting the pH, for example to physiological pH, acids and bases such as hydrochloric acid, sodium hydroxide and tromethamine may be used. In certain embodiments, the pH of the formulation is adjusted to the desired pH with one or more of hydrochloric acid, sodium hydroxide, and tromethamine. In some embodiments, the formulation of the present invention has a pH of 6.5 to 7.5 (e.g., at least 6.5, at least 6.6, at least 6.7, at least 6.8, or at least 6.9 to no more than 7.5, no more than 7.4, no more than 7.3, no more than 7.2, or no more than 7.1). In some embodiments, the pH of the formulation of the invention is from 6.9 to 7.1, e.g., 6.9, 7.0, or 7.1.

5.2.3. Exemplary formulations and kits

In various embodiments, the formulations of the present invention comprise compound 1 or a pharmaceutically acceptable salt thereof, polyoxyethylene 40 hydrogenated castor oil, a type B carbomer homopolymer, sodium chloride and glycerol or mannitol, and water. If pH adjustment is desired, pH adjustment may be performed using one or more of pH adjusters such as HCl, tromethamine, and sodium hydroxide. In some embodiments, the formulation does not include a preservative. In some embodiments, the formulation includes a preservative.

In some embodiments, the formulation of the present invention comprises:

a) 0.1% w/w to 3% w/w of compound 1 or a pharmaceutically acceptable salt thereof;

b) 0.1% w/w to 2.5% w/w polyoxyethylene 40 hydrogenated castor oil;

c) 0.1% w/w to 1% w/w B type carbomer homopolymer;

d) 0.1% w/w to 0.5% w/w sodium chloride;

e) 0.5% w/w to 3% w/w glycerol or 1% w/w to 5% w/w mannitol;

f) Optionally, a pH adjuster, such as HCl and/or tromethamine and/or NaOH, in an amount sufficient (qs) to provide a pH of 6.8 to 7.2; and

g) Water in an amount sufficient (qs) to 100%.

In other embodiments, the formulation of the present invention comprises:

b) 0.5% w/w to 1% w/w polyoxyethylene 40 hydrogenated castor oil;

c) 0.5% w/w B type carbomer homopolymer;

d) 0.25% w/w sodium chloride;

e) 1.5% w/w glycerol or 3% mannitol;

g) Water in an amount sufficient (qs) to 100%.

In other embodiments, the formulation of the present invention comprises:

a) 0.1%, 0.3%, 1% or 3% w/w compound 1;

b) 0.5% w/w polyoxyethylene 40 hydrogenated castor oil;

c) 0.5% w/w B type carbomer homopolymer;

d) 0.25% w/w sodium chloride;

e) 1.5% w/w glycerol;

f) Optionally, a pH adjuster, such as HCl and/or tromethamine and/or NaOH, in an amount sufficient (qs) to provide a pH of 7.0; and

g) Water in an amount sufficient (qs) to 100%.

In other embodiments, the formulation of the present invention comprises:

a) 0.1%, 0.3%, 1% or 3% w/w compound 1;

b) 0.5% w/w polyoxyethylene 40 hydrogenated castor oil;

c) 0.5% w/w B type carbomer homopolymer;

d) 0.25% w/w sodium chloride;

e) 3% w/w mannitol;

g) Water in an amount sufficient (qs) to 100%.

5.3. Methods for preparing formulations and kits

In some aspects, the invention provides methods for preparing the formulations and kits described herein. The methods of the invention typically comprise combining (a) a slurry comprising compound 1 or a pharmaceutically acceptable salt thereof and one or more solubilizing agents, such as castor oil-based solubilizing agents, with (b) one or more additional pharmaceutically acceptable carriers. For example, the formulation may be prepared by combining a slurry comprising compound 1 and a solubilizing agent with a preformed vehicle comprising all other components of the formulation.

For example, a slurry may be produced by milling a mixture comprising the one or more solubilizing agents and compound 1 or a pharmaceutically acceptable salt thereof to reduce the particle size of compound 1 or a pharmaceutically acceptable salt thereof to a desired particle size distribution. Milling may be performed until the desired D90 and/or D50 and/or D10 particle size is obtained, wherein longer milling times generally result in particles having smaller D90, D50 and D10 particle sizes. In some embodiments, milling may be performed for at least 12 hours, at least 18 hours, or at least 24 hours. In some embodiments, milling is performed for up to 24 hours, or up to 36 hours.

In some embodiments, milling is ball milling. Beads of various sizes may be used for ball milling, for example beads having a diameter of 1mm to 5 mm. In some embodiments, the bead is a 1mm bead. In other embodiments, the beads are 3 mm. In some embodiments, the bead is a zirconium bead.

In some embodiments, the slurry is made of compound 1 or a pharmaceutically acceptable salt thereof that has been sterilized by radiation (e.g., gamma radiation or X-ray radiation).

In some embodiments, the methods of the present invention for preparing a formulation include the step of combining a slurry with a vehicle comprising the remaining components of the formulation. In some embodiments, the method further comprises the step of preparing the slurry. Alternatively, the preparation of the slurry may be separate from the process used to prepare the complete formulation. For example, the slurry may be produced at one factory and combined with the vehicle at a different factory.

In some embodiments, the method may further comprise the step of preparing a kit described herein by filling a container (e.g., a dropper bottle) with the formulation. Sterile filling may be employed.

5.4. Use of formulations and kits

Without being bound by theory, LXR agonists are believed to be useful in the treatment of ocular diseases and disorders such as dry eye and MGD. Thus, in one aspect, the invention provides a method of agonizing LXR in the meibomian glands of a subject (e.g., a subject suffering from dry eye and/or MGD), the method comprising administering to the subject a therapeutically effective amount of a formulation of the invention.

In another aspect, the invention provides a method of inducing or increasing expression of stearoyl-coa desaturase-1 (SCD 1) in the meibomian glands of a subject, the method comprising administering to the subject a therapeutically effective amount of a formulation of the invention.

In another aspect, the invention provides a method of increasing the ratio of desaturated lipids to saturated lipids in the eye of a subject, the method comprising administering to the subject a therapeutically effective amount of a formulation of the invention.

In another aspect, the invention provides a method of reducing the meibum melting temperature and/or increasing meibum outflow from the meibomian glands of a subject, the method comprising administering to the subject a therapeutically effective amount of a formulation of the invention.

In another aspect, the invention provides a method of reducing meibum outflow obstruction from the meibomian glands of a subject, the method comprising administering to the subject a therapeutically effective amount of a formulation of the invention.

In some embodiments of the methods described above in this section, the subject has dry eye, e.g., over-evaporated dry eye, and/or meibomian gland dysfunction.

In certain aspects, provided herein are methods for treating an ocular disease or disorder, wherein the methods comprise administering to a subject in need thereof a therapeutically effective amount of a formulation of the invention.

In certain aspects, provided herein are methods for treating signs and/or symptoms of an ocular disease or disorder, wherein the methods comprise administering to a subject in need thereof a therapeutically effective amount of a formulation of the invention.

In certain embodiments, provided herein are methods for treating overactive dry eye (which may be caused by meibomian gland dysfunction), wherein the methods comprise administering a formulation of the present invention to a subject in need thereof.

In certain embodiments, provided herein are methods for treating meibomian gland dysfunction, wherein the methods comprise administering to a subject in need thereof a formulation of the present invention.

In certain embodiments, provided herein are methods for treating signs and/or symptoms of meibomian gland dysfunction, wherein the methods comprise administering to a subject in need thereof a therapeutically effective amount of a formulation of the present invention.

In some embodiments, the formulations of the invention may be administered to the eyelid of a subject. The application of the pharmaceutical composition may be with an applicator such as a subject's finger,Or other device capable of delivering the formulation to the eyelid to deliver the formulation to the meibomian glands.

In some embodiments, the patient's symptoms are assessed by asking the patient a series of questions. The questionnaire may evaluate a series of symptoms associated with ocular discomfort. In some embodiments, the questionnaire is a SPEED questionnaire. The SPEED questionnaire evaluates the frequency and severity of dry eye symptoms in patients. The questionnaire checks for the occurrence of symptoms on the day, for the past 72 hours, and for the past three months. A SPEED score is derived based on the patient's answer to the question to give a range of severity of the patient's symptoms. The SPEED questionnaire includes the following questions: 1) What dry eye symptoms you are experiencing, when are? 2) How often does you experience dry eyes, gritty feel, or itching? 3) How often do you experience eye soreness or irritation? 4) How often do you experience burning eyes or running water? 5) How often does you experience eye fatigue? And 6) how severe the symptoms are? In some embodiments, the questionnaire is an IDEEL questionnaire, which is similar to the SPEED questionnaire described above.

Meibomian gland compressibility is optionally determined to assess meibomian gland function. In normal patients, meibum is clear to pale yellow oil. When digital pressure is applied to the gland, meibum is expelled from the gland. Changes in meibomian gland compressibility are a potential indicator of MGD. In some embodiments, during extrusion, in addition to assessing liposome volume and lipid mass, the amount of physical force applied during extrusion is monitored.

Tear stability rupture time (TBUT) is an alternative marker of tear stability. Tear film instability is the central mechanism of dry eye and MGD. Low TBUT means the possibility of lipid layer damage and MGD. TBUT is optionally measured by examining the fluorescein burst time, defined as the time after blinking to initial rupture of the tear film. Fluorescein is optionally applied by wetting a commercially available fluorescein-impregnated strip with saline and applied to the inferior dome or bulbar conjunctiva. The patient is then asked to blink several times and move the eye. The fracture was then analyzed with a slit lamp, cobalt blue filter and a beam width of 4 mm. The patient is instructed to blink and the time from the upstroke of the last blink to the first tear film break or dry spot formation is recorded as a measurement.

Other methods of assessing MGD signs and/or symptoms include, but are not limited to: schirmer test, ocular surface staining, eyelid morphology analysis, meibomian gland imaging (meibomian), meibomian gland assay (meibomian), interferometry, evaporation assay, tear lipid composition analysis, fluorometry, meibomian gland viscometry (meiscometry), lipid layer thickness, meibomian desaturation index, meibomian gland loss osmometry, tear film kinetic index, reading speed, evaporation and tear turnover. Analysis of MGD signs and/or symptoms is performed by methods known to those of ordinary skill in the art and generally understood.

In some embodiments of the invention, the subject is diagnosed with meibomian gland dysfunction or dry eye or ocular surface disease.

In some embodiments, administration reduces signs and/or symptoms of meibomian gland dysfunction or dry eye or ocular surface disease. In particular embodiments, the administration of the formulation of the invention results in one or more of the following (or similar or equivalent tests):

i) The tear film break up time increases by at least 2, 3, 4 or 5 seconds;

ii) meibomian gland compression classification increased by 1 or 2 or 3 grades;

iii) The tear river increases by at least 10%;

iv) at least 10% reduction in corneal fluorescein staining, or

v) Schirmer test score increased by at least 2mm.

As used herein, "meibomian gland crush grading" refers to a scale used to assess the severity of meibomian gland dysfunction, such as Tomlinson, alan, et al (2011), "The International Workshop on meibomian Gland Dysfunction: report of the Diagnosis Subcommittee [ meibomian gland dysfunction international seminar: the diagnostic team Committee report ], "Investigative Ophthalmology & Visual Science [ ophthalmic study and Visual Science ], volume 52, phase 4, pages 2006-2049.

In a further aspect, the invention provides a formulation provided herein for use in a method described herein, for example in section 5.4.

6. Examples

The following examples are intended to illustrate the invention and should not be construed as limiting thereof. The temperatures are in degrees celsius. The structure of the end products, intermediates and starting materials is confirmed by standard analytical methods, such as microanalysis and spectroscopic features (e.g., MS, IR and NMR). Abbreviations used are conventional in the art. Unless defined otherwise, terms have their commonly accepted meanings.

6.1. Abbreviations (abbreviations)

/>

6.2. Analysis method

LCMS method 1:

instrument: waters AcQuity UPLC; column: acQuity UPLC BEH C ₁₈ 1.7 μm,2.1x30mm;2min run time, 2% solvent B from 0 to 0.1min, 2%. Fwdarw.98% solvent B: solvent A from 0.1 to 1.8min,98% solvent B lasting 0.2min. Solvent: solvent a=0.1% formic acid in water (v/v), solvent b=0.1% formic acid in acetonitrilev/v). Ultraviolet detection arrays 210-400; quality detection is 120-1250; column temperature 50 ℃; the flow rate is 1.0mL/min; the pH was 2.6.

LCMS method 2:

instrument: waters AcQuity UPLC; column: acQuity UPLC BEH C ₁₈ 1.7 μm 2.1x30mm;2min run time, 2% solvent B from 0 to 0.1min, 2%. Fwdarw.98% solvent B: solvent A from 0.1 to 1.8min,98% solvent B lasting 0.2min. Solvent: solvent a = 5mM ammonium hydroxide in water and solvent B = 5mM ammonium hydroxide in acetonitrile. Ultraviolet detection arrays 210-400; quality detection is 120-1250; column temperature 50 ℃; the flow rate is 1.0mL/min; pH 10.2.

LCMS method 3:

instrument: waters AcQuity UPLC; column AcQuity UPLC BEH C, 1.7 μm 2.1x50mm;5.2min run time, 2%. Fwdarw.98% solvent B: solvent A from 0 to 5.15min,98% solvent B from 5.15 to 5.20min. Solvent: solvent a = 5mM ammonium hydroxide in water and solvent B = 5mM ammonium hydroxide in acetonitrile. Ultraviolet detection arrays 210-400; quality detection is 120-1600; column temperature 50 ℃; the flow rate is 1.0mL/min; pH 10.2.

6.3. Example 1: synthesis of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione (Compound 1)

Synthesis of 6.3.1.2- (isobutylthio) phenol (intermediate-1)

2-mercaptophenol (8.00 mL,79 mmol) was added to a stirred suspension of potassium carbonate (21.91 g,159 mmol) in acetonitrile (200 mL) at room temperature. After 10min, 1-bromo-2-methylpropane (9.48 mL,87 mmol) was added. The mixture was then stirred at room temperature overnight. An additional portion of 0.3 equivalents of 1-bromo-2-methylpropane and 0.5 equivalents of potassium carbonate were added and the mixture was stirred for an additional day. After concentration in vacuo, the residue was dissolved in DCM and purified byFiltering to remove solid potassium carbonate. The filtrate was purified by column chromatography (0-20% EtOAc/heptane) to give 2- (isobutylthio) phenol (intermediate-1). ¹ H NMR(400MHz,CD ₂ Cl ₂ )δppm 7.50(dd,J＝7.70,1.59Hz,1H)7.25-7.32(m,1H)6.99(dd,J＝8.13,1.16Hz,1H)6.90(td,J＝7.52,1.34Hz,1H)6.76(s,1H)2.64(d,J＝6.97Hz,2H)1.72-1.88(m,1H)1.04(d,J＝6.60Hz,6H)。

Synthesis of 6.3.2.5- (chloromethyl) -3- (4-fluoro-3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazole (intermediate-2)

Step 1: to a solution of 4-fluoro-3- (trifluoromethyl) benzonitrile (15.0 g,79.32 mmol) in methanol (150 mL) was added dropwise 50% by weight aqueous hydroxylamine (52.4 mL,793.2 mmol) at room temperature in a 500mL 3-necked flask. The reaction mixture was stirred at room temperature for 16h, then concentrated in vacuo and the residue was diluted with water (100 mL). The mixture was extracted with ethyl acetate (3×150 mL) and the combined organic layers were dried over sodium sulfate, filtered and concentrated to give 4-fluoro-N-hydroxy-3- (trifluoromethyl) benzamidine. LCMS method 2: rt. =0.97 min; m/z 223.1[ M+H ] ]+；1H NMR(400MHz,(CD ₃ ) ₂ SO)δ9.88(s,1H),8.02-8.03(m,2H),7.51-7.56(m,1H),6.06(s,2H)。

Step 2: to a solution of 4-fluoro-N-hydroxy-3- (trifluoromethyl) benzamidine (16.0 g,72.0 mmol) in toluene (160 mL) was added chloroacetyl chloride (17.2 mL,216.2 mmol) dropwise at 0deg.C in a 500mL 3-necked flask. After the addition was complete, the cloudy yellow reaction mixture was heated to reflux for 6 hours. The clear reaction solution was then cooled to room temperature and quenched with ice-cold water. The organic layer was washed with saturated sodium bicarbonate solution (100 mL) and brine (100 mL); dried over sodium sulfate, filtered and concentrated. The crude product was purified by column chromatography using 3% -6% ethyl acetate-hexane to give 5- (chloromethyl) -3- (4-fluoro-3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazole (intermediate-2). 1H NMR(400MHz,(CD ₃ ) ₂ SO)δ8.38-8.39(m,1H),8.25-8.27(m,1H),7.73-7.78(m,1H),5.24(s,2H)。

Synthesis of 6.3.3.3- ((3- (4-fluoro-3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethylimidazolidine-2, 4-dione (intermediate-3)

A solution of 5- (chloromethyl) -3- (4-fluoro-3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazole (intermediate-2) (4.35 g,15.50 mmol) in DMF (25 mL) was treated with 5, 5-dimethylimidazolidine-2, 4-dione (2.98 g,23.25 mmol) and potassium carbonate (4.28 g,31.0 mmol). The reaction mixture was stirred at 60 ℃ for 2h, then poured into ice water (100 mL) and refrigerated overnight. The precipitate was collected and washed with ice water to give 3- ((3- (4-fluoro-3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethylimidazolidine-2, 4-dione (intermediate-3). LCMS method 1: m/z 373.2[ M+H ] ]+；1H NMR(400MHz,CDCl ₃ )δ8.29(dd,J＝6.7,1.9Hz,1H),8.23(ddd,J＝8.4,4.6,2.1Hz,1H),7.35-7.27(m,1H),5.00(s,2H),1.52(s,6H)。

6.3.4.3 Synthesis of- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione (Compound 1)

Step 1: to a solution of 3- ((3- (4-fluoro-3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethylimidazolidine-2, 4-dione (intermediate-3) (7.26 g,39.8 mmol) in DMF (100 mL) was added 2- (isobutylthio) phenol (intermediate-1) (4.94 g,13.27 mmol) and potassium carbonate (5.50 g,39.8 mmol). The mixture was heated at 90 ℃ overnight, then allowed to cool to room temperature, then diluted with saturated ammonium chloride solution. The mixture was extracted with EtOAc and the organic layer was washed with brine, dried over sodium sulfate, filtered and concentrated. By means of a fast columnThe residue was purified by chromatography (0-60% EtOAc/heptane) to give: 3- ((3- (4- (2- (isobutylthio) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethylimidazolidine-2, 4-dione. LCMS method 3: m/z [ M ]]＝535.4。1H NMR(400MHz,CD ₂ Cl ₂ )δ8.39(d,J＝2.0Hz,1H),8.11(dd,J＝8.7,2.1Hz,1H),7.49(dd,J＝5.8,3.5Hz,1H),7.34-7.19(m,2H),7.13-6.95(m,1H),6.80(d,J＝8.8Hz,1H),5.77(s,1H),4.99(s,2H),2.82(d,J＝6.9Hz,2H),1.84(dh,J＝13.3,6.8Hz,1H),1.55(s,6H),1.01(d,J＝6.8Hz,6H)。

Step 2: mCPBA (8.43 g,37.6 mmol) was added to a solution of 3- ((3- (4- (2- (isobutylthio) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethylimidazolidine-2, 4-dione (6.7 g,12.53 mmol) in dichloromethane (200 mL). After stirring for 1h, saturated sodium bicarbonate solution was added. The organic layer was washed with brine, dried over sodium sulfate, filtered and concentrated. The residue was purified by flash column chromatography (0-100% EtOAc/heptane) to give 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethylimidazolidine-2, 4-dione. LCMS method 3: m/z [ M+H ] ]+567.2；1H NMR(400MHz,(CD ₃ ) ₂ SO)δ8.55(s,1H),8.28(d,J＝2.1Hz,1H),8.25(dd,J＝8.7,2.2Hz,1H),8.03(dd,J＝7.9,1.7Hz,1H),7.82(ddd,J＝8.3,7.5,1.7Hz,1H),7.57(td,J＝7.6,1.0Hz,1H),7.33(dd,J＝8.2,1.0Hz,1H),7.15(d,J＝8.7Hz,1H),5.02(s,2H),3.36(d,J＝6.5Hz,2H),2.07(hept,J＝6.6Hz,1H),1.38(s,6H),0.98(d,J＝6.7Hz,6H)。

Step 3: 4- (2-bromoethyl) morpholine (7.09 g,25.8 mmol) was added to a mixture of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethylimidazolidine-2, 4-dione (7.3 g,12.88 mmol) and cesium carbonate (14.69 g,45.1 mmol) in DMF (100 mL). The mixture was stirred overnight. The mixture was diluted with ethyl acetate, then washed with water and brine in turn, dried over sodium sulfate, filtered and concentrated. The residue was purified by flash column chromatography (0-100% EtOAc/heptane followed by 1% triethylamine in EtOAc) to give 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl)) Phenyl) -1,2, 4-oxadiazol-5-yl-methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione (1). LCMS method 3: rt. =2.81 min; m/z [ M+H ]]+680.5。 ¹ H NMR(400MHz,CDCl3)δ8.38(d,J＝2.1Hz,1H),8.20-8.10(m,2H),7.64(ddd,J＝8.2,7.4,1.7Hz,1H),7.41(td,J＝7.6,1.1Hz,1H),7.04-6.97(m,2H),4.99(s,2H),3.71(br s,4H),3.48(s,2H),3.35(d,J＝6.6Hz,2H),2.65(s,2H),2.56(s,4H),2.26(hept,J＝6.7Hz,1H),1.52(s,6H),1.07(d,J＝6.7Hz,6H)。

6.4. Example 2: characterization of Compound 1 form A

6.4.1.3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione preparation

100mg/mL of a solution of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione was prepared in ethanol at 50 ℃. The clear solution was then allowed to cool slowly to room temperature. After the formation of the precipitate was completed, the resulting solid was collected using a filter and dried to give form a. Characterization of form a was performed using X-ray powder diffraction (XRPD), differential scanning calorimetry (DCA) and thermogravimetric analysis (TGA) techniques.

Powder diffraction by X-rays

X-ray powder diffraction (XRPD) data using cukα1 radiation on a D8 Advance diffractometer at room temperatureCollected with a germanium monochromator. Data were collected from 3 to 45 ° 2θ. Detector scanning on a solid LynxEye detector was performed using a scanning speed of 0.02 ° and 19.2 s/step per step. The samples were measured on zero background silicon wafers. Figure 1 shows XRPD of form a. />

6.4.3. Differential scanning calorimetry

Melting of form AThe melting characteristics were obtained from differential scanning calorimetry (DCA) thermograms recorded with TA Discovery Q5000 (thermo analytical). The samples were sealed in standard 40 μl aluminum pans, punched with a needle, and heated in DSC from 30deg.C to 300deg.C at a heating rate of 10K/min. During the measurement, dry N with a flow rate of 50mL/min was used ₂ The gas purged DSC equipment. Figure 2 shows the DSC profile for form a.

The DSC curve for form a (fig. 2) shows a single endothermic peak with an onset temperature of about 118.6 ℃ and a peak temperature of about 121.5 ℃ due to melting of the sample.

6.4.4. Thermogravimetric analysis

Form a was analyzed using thermogravimetric analysis (TGA). The loss on drying was determined by TGA using TA Discovery Q2000 (sammer analysis company) to give a weight-temperature curve. The samples were weighed into a 100. Mu.L aluminum crucible and sealed. The seal was punched with a needle hole and the crucible was heated in TGA from 30 ℃ to 300 ℃ at a heating rate of 10K/min. Using dry N ₂ And (5) gas purging. Figure 3 shows the TGA profile of form a.

The TGA profile (fig. 3) shows no significant mass loss before the sample melts. For example, a mass loss of only about 0.04 wt% is observed up to a temperature of about 150 ℃.

6.5. Example 3: biological Activity of Compound 1

LXR agonist compound 1 provided herein has been shown to induce stearoyl-coa desaturase-1 (SCD 1) expression, thereby increasing lipid desaturation of meibum and lowering meibum melting temperature, which may lead to reduced tear film evaporation and improved symptoms of meibomian gland dysfunction and evaporative over-intense dry eye. To investigate the effect of compound 1, SCD1 expression after treatment with compound 1 was evaluated. The change in overall desaturation index in SZ95 sebaceous cells following administration of compound 1 was also studied. Finally, in vivo measurement of the meibum melting temperature of compound 1 was studied.

Measurement of SCD1 expression in SZ95-SCD1-HiBit cells

SCD1 expression levels in SZ95 cells were quantified using the HiBiT system (Promega), where small peptide sequences (SmBiT) with larger proteins (LgBiT) restored luciferase activity and can generate luminescent signals for quantification. SZ95-SCD1-HiBit cells were generated by editing the SCD1 gene of SZ95 cells, resulting in the addition of an 8 amino acid linker sequence (gssggssg, SEQ ID NO: 1) at the carboxy terminus of the SCD1 protein followed by the addition of an 11 amino acid SmBiT sequence (vsgwrlfkkis, SEQ ID NO: 2). The gRNA targeting sequence used was actacaagagtggctgagtt (SEQ ID NO: 3), and the SCD1 insert oligonucleotide encoding the SmBiT sequence was:

1:5'gaagaaagtctccaaggccgccatcttggccaggattaaaagaaccggagatggaaactacaagagtggcggtagtagtggtggtagtagtggtgtgagcggctggcggctgttcaagaagattagctgagtttggggtccctcaggttcctttttcaaaaaccagccaggcagaggttttaatgtctgtttattaacta-3'(SEQ ID NO:4)。

The DNA sequence encoding SCD1 with linker and SmBiT tag at the carboxy terminal tail of the protein is:

Atgccggcccacttgctgcaggacgatatctctagctcctataccaccaccaccaccattacagcgcctccctccagggtcctgcagaatggaggagataagttggagacgatgcccctctacttggaagacgacattcgccctgatataaaagatgatatatatgaccccacctacaaggataaggaaggcccaagccccaaggttgaatatgtctggagaaacatcatccttatgtctctgctacacttgggagccctgtatgggatcactttgattcctacctgcaagttctacacctggctttggggggtattctactattttgtcagtgccctgggcataacagcaggagctcatcgtctgtggagccaccgctcttacaaagctcggctgcccctacggctctttctgatcattgccaacacaatggcattccagaatgatgtctatgaatgggctcgtgaccaccgtgcccaccacaagttttcagaaacacatgctgatcctcataattcccgacgtggctttttcttctctcacgtgggttggctgcttgtgcgcaaacacccagctgtcaaagagaaggggagtacgctagacttgtctgacctagaagctgagaaactggtgatgttccagaggaggtactacaaacctggcttgctgatgatgtgcttcatcctgcccacgcttgtgccctggtatttctggggtgaaacttttcaaaacagtgtgttcgttgccactttcttgcgatatgctgtggtgcttaatgccacctggctggtgaacagtgctgcccacctcttcggatatcgtccttatgacaagaacattagcccccgggagaatatcctggtttcacttggagctgtgggtgagggcttccacaactaccaccactcctttccctatgactactctgccagtgagtaccgctggcacatcaacttcaccacattcttcattgattgcatggccgccctcggtctggcctatgaccggaagaaagtctccaaggccgccatcttggccaggattaaaagaaccggagatggaaactacaagagtggcggtagtagtggtggtagtagtggtgtgagcggctggcggctgttcaagaagattagctga(SEQ ID NO:5)。

SZ95-SCD1-HiBit cells were seeded at a density of 3000 cells/30. Mu.l in 384 well cell culture white plates. Water was added to the edge holes to avoid evaporation. The cells were incubated at 37℃with 5% CO ₂ Is incubated overnight in a humidified incubator. Compounds tested were diluted in DMSO at a ratio of 1:3 using an agilent BRAVO automated liquid handling platform and after further serial dilutions added to cells at a final concentration starting at 18 μm. In each plate, 2- (3- (3- ((2-chloro-3- (trifluoromethyl) benzyl) (2, 2-diphenylethyl) amino) propoxy) phenyl) acetic acid was used as a reference compound. Cells in assay plates were incubated at 37℃with 5% CO ₂ Incubate in humidified incubator for 48h.

The assay plate was removed from the incubator and allowed to equilibrate to room temperature. Will beHiBiT assay reagents (Promega; nano-Glo HiBiT assay buffer, mixture of Nano-Glo HiBiT assay substrate and LgBiT protein, according to manufacturer's instructions) were added to the assay plate in volumes equal to the cell culture medium in each well. The plates were placed on an orbital shaker at 300-600rpm for 10min at room temperature and read using luminescence detection on an EnVision microplate reader for 1 second.

This assay measures the increase in SCD1 protein production in vitro. The results are shown in table 2 below. A is that _max Refers to the percentage EC of the tested compound compared to the reference compound 2- (3- (3- ((2-chloro-3- (trifluoromethyl) benzyl) (2, 2-diphenylethyl) amino) propoxy) phenyl) acetic acid ₅₀ 。

6.5.2. Whistle lipid assay (SLA)

The change in overall desaturation index in SZ95 sebaceous cells was quantified using a sentinel lipid assay after administration of compound 1. The assay measures a small subset of lipid analytes in meibum (known as "sentinel lipids") that will model the overall changes in the saturated and desaturated lipid populations in cells. To define this smaller subset of lipids, complete lipid profiles were recorded on the dose response curve of compound 1 (eight levels from 4nM to 10 uM). Elastic mesh regression models are applied to saturated and unsaturated lipids, respectively, to determine the smallest combination of coefficients and analytes that can be used to adequately model the total population of lipids. The elastic net model was able to reduce the behavior of 425 lipids to 11 lipids and the correlation between desaturation indices observed with the complete lipid pool containing 11 sentinel lipids was 0.96.

A medium flux assay was created using this reduced sentinel lipid collection. A single batch is defined as a triplicate instance of three unique plates (i.e., a single batch of cells is used to create nine plates for LC-MSMS analysis). Lipids were extracted from cells using a 1:1 mixture of methylene chloride/methanol containing 10nM deuterated triglyceride standard, which served as an internal standard for quantifying lipid abundance. The lipids were separated using a five minute HPLC gradient prior to mass spectrometry. The abundance of the whistle lipids and internal standard was measured on a triple quadrupole mass spectrometer using multiple reaction monitoring mode (MRM). Conversion of data from Total ion flow to nmol/10 ⁶ Individual cells, which are multiplied by the coefficients of the elastic net model to determine the effective desaturation and saturation content, and to determine the desaturation index in which to quantify the cells. To compare multiple batches of compounds to each other, the measured raw desaturation index was normalized by dividing by the desaturation index of DMSO-quantified cells, and then all data were evaluated as the fraction of compounds that increased the desaturation index to above 1.

According to 10 ⁴ SZ95 cells (immortalized human sebaceous gland cells) were seeded at a density of 135. Mu.l in Greiner bio-one96 well polypropylene plates pre-treated with 50. Mu.g/mL human plasma fibronectin (Sieimer technology (Thermo Fisher Scientific)). The cells were incubated at 37℃with 5% CO ₂ Is incubated overnight in a humidified incubator. Test compounds were diluted at a 1:3 ratio and added to cells at a final concentration starting at 10 μm. In each plate, 2- (3- (3- ((2-chloro-3- (trifluoromethyl) benzyl) (2, 2-diphenylethyl) amino) propoxy) phenyl) acetic acid was used as a positive control reference compound. Cell in assay plateAt 37℃with 5% CO ₂ Is incubated in a humidified incubator for 72h.

The medium was removed from the cells and the cells in the plates were washed three times with ice-cold phosphate buffered saline. The plates were heat sealed and stored in a freezer at-80 ℃ prior to whistle lipid measurement. The results of the whistle lipid measurement are shown in table 2.A is that _max The values refer to the percent EC of the tested compound compared to the reference compound 2- (3- (3- ((2-chloro-3- (trifluoromethyl) benzyl) (2, 2-diphenylethyl) amino) propoxy) phenyl) acetic acid ₅₀ 。

This data demonstrates that compound 1 robustly upregulates SCD1 protein production in SZ95 cells, which in turn increases the desaturation index of lipids produced by these cells. By increasing the desaturation index, the viscosity of meibum can be reduced, resulting in better meibum outflow in the body and improving the signs and symptoms of meibomian gland dysfunction and over-evaporated dry eye. These data demonstrate the potential of compound 1 to lower the melting temperature of meibum in vivo, thereby ameliorating the symptoms of evaporative over-intense dry eye (e.g., dry eye associated with MGD) and MGD.

6.5.3. In vivo measurement of reduced meibum melting temperature

The decrease in melting temperature of compound 1 on rat meibum was measured in naive Sprague Dawley rats. Vehicle or 1% suspension of compound 1 was administered to the test animals in the form of eye drops twice daily for fourteen days. Rat meibum was collected after administration of the compound and analyzed by differential scanning calorimetry to measure melting point. The decrease in meibum melting point in rats administered compound 1 was compared to vehicle.

Melting characteristics of meibum were obtained using a differential scanning calorimetry thermogram recorded on TA Discovery Q5000 (sammer analysis). The samples were sealed in standard 40 μl aluminum trays and subjected to a heat-cold-heat cycle, and the melting temperature was recorded at the second heating ramp. First, the sample is heated to 150 ℃ at 30K/minThen cooled to-30℃at 30K/min. Next, the sample was heated to 75deg.C at a basic heating rate of 2K/min, a modulation time of 60 seconds and a modulation temperature amplitude of 1deg.C. During the measurement, dry N with a flow rate of 50mL/min was used ₂ The gas purged DSC equipment. The onset of melting and peak temperature, referred to as melting point, are recorded.

The results of the measurement are shown in table 3 and fig. 4. Unpaired t-test analysis results with Welch correction were used.

As seen in the results presented herein, compound 1 reduced the in vivo meibum melting temperature and increased the in vitro meibum desaturation index.

6.6. Example 4: compound 1 is chemically stable when sterilized by gamma irradiation

The stability of compound 1 when sterilized by steam (autoclaving) was evaluated. Significant degradation of compound 1 was observed (data not shown). Gamma irradiation was then evaluated as an alternative sterilization technique. The sample of compound 1 was irradiated with gamma irradiation of 10-20kGy or 20-30 kGy. As shown in table 4, compound 1 was chemically stable upon gamma irradiation, with less than 0.5% degradation of compound 1 observed by HPLC.

6.7. Example 5: castor oil-based solubilisers are superior to other excipients in solubilising compound 1

The solubility of compound 1 in different excipients was evaluated. As shown in table 5, the solubility of compound 1 in castor oil-based solubilizers is typically at least one order of magnitude higher than other excipients. Compound 1 achieved relatively high solubility with castor oil-based solubilisers in the pH range 5-7. Advantageously, a relatively high solubility of compound 1 is observed in castor oil-based solubilisers at pH values approaching 7, which is the desired pH for ophthalmic administration.

/>

Selection based on solubility dataEL (polyoxyethylene 35 castor oil) and +.>RH40 (polyoxyethylene 40 hydrogenated castor oil) was used for further formulation screening studies.

6.8. Example 6: chemical stabilization of Compound 1 in Castor oil-based solubilizers

Stability of compound 1 in different excipients was evaluated. As shown in table 6, the stability of compound 1 in various excipients was generally higher when stored for 3 months, including in castor oil-based solubilisers, when measured by HPLC.

/>

6.9. Example 7: milling increases the solubility of compound 1

Wet ball milling was evaluated for compound 1 particle size and inEL、/>RH40 and tyrosolThe effect of the solubility of (c) in the solvent. The results are shown in tables 7A to 7I. Find->EL and->Both RH40 dissolved compound 1 better than tyloxapol. Along with->An increase in the RH40 concentration from 2% to 4% was observed for the soluble fraction of Compound 1. />RH40 appears to be the best wetting agent, whileEL also performs well.

/>

6.10. Example 8: viscosity of carbomer 974P and NaCl solution

A study was conducted to evaluate the viscosity of carbomer 974P and sodium chloride solutions at different concentrations. All viscosity measurements were made with a Brookfield viscometer at 25℃at 10RPM and spindle CP-52. The results are shown in Table 8. 0.5% w/w carbomer 974P and 0.25% NaCl were selected for inclusion in the compound 1 formulation.

/>

6.11. Example 9: compound 1 formulation without HEC showed less sedimentation

In view of the ball milling study and vehicle selection study described herein, eight formulations of compound 1 with various excipients were prepared. The components and initial characteristics of the formulations are shown in tables 9A and 9B.

/>

All formulations had a Z-average particle size of less than 1 μm. The final pH and solubility (soluble fraction) were obtained as expected (target pH 7.0 and target solubility greater than or equal to 0.1 mg/mL). The average droplet size is in a range suitable for ophthalmic use, and variability in droplet size is narrow.

The formulations were then assessed visually for sedimentation 7 and 14 days after storage at room temperature (about 20 ℃). As shown in fig. 5A-5B, formulations without HEC showed no significant sedimentation (fig. 5A), while those with HEC showed significant sedimentation at 14 days (fig. 5B).

6.12. Example 10: in PK studies, compound 1 formulation containing castor oil-based solubilizers performed better than the comparative formulation

Six compound 1 formulations were selected for PK studies, five of which contained vehicles with castor oil-based solubilisers and carbomers, and one contained HEC, which was previously used for dose range discovery studies (data not shown). The components of the formulation are shown in table 10.

Initial data for the formulations are shown in table 11.

Male rabbits were assigned to 6 treatment groups, one group corresponding to each of formulations 1 to 6 (groups 1 to 6, respectively). Each animal was fitted with an illisha white collar and removed two hours after dosing. 30 μl of the corresponding formulation was applied to the upper eyelid of both eyes, and 30 μl of the corresponding formulation was applied to the lower eyelid and spread over the entire eyelid. Meibomian gland samples were obtained from the upper, lower, left and right eyelids at 0.5, 6 and 12 hours. The results are shown in FIGS. 6A-6C.

Comparison of formulations 2 and 3 allows evaluation of the effect of glycerol on compound 1 exposure. Comparison of formulations 3 and 4 allows evaluation of the effect of increased soluble portion of compound 1 in the formulation on exposure to compound 1. Comparison of formulations 4 and 5 allowed comparison of the particle size of compound 1 exposure (< 1um and <3um, respectively). Comparison of formulations 4 and 6 allows evaluation of different intensities (1% and 3% of compound 1, respectively).

With respect to compound 1 exposure, formulations 2-6 perform better than formulation 1 (fig. 6A-6C). As shown in fig. 6A, the rank order of the formulations was 1<2<4<3 to 5<6 when considering the average AUC. As shown in fig. 6B, the rank order of the formulations was 1<2<5<3<4<6 when 12 hours time points were considered. As shown in fig. 6C, formulations 2-6 provided higher exposure of compound 1 than formulation 1 at the 6 hour and 12 hour time points, and formulations 4-6 provided higher exposure of compound 1 than formulations 1-3 at the 0.5 hour time point.

6.13. Example 11: colloidal stability of Compound 1 formulation under temperature cycling stress

Four compound 1 formulations were subjected to temperature cycling stress to evaluate stability. Two temperature cycles were performed. The first cycle involved incubation at 40 ℃ for 8 hours followed by 16 hours at 4 ℃ and repeated three times. The second cycle included incubation at-20 ℃ for 6 days followed by incubation at 25 ℃ and 60% relative humidity for 1 day. The results of the study are shown in table 12.

Although all four formulations had D50 values below 1 μm after temperature cycling (data not shown), surprisingly, only formulation a had D90 values below 3 μm after two temperature cycles, with no significant particle growth in the Particle Size Distribution (PSD) during either temperature cycle.

6.14. Example 12: compound 1 formulation stability study

Six compound 1 formulations were prepared and stored at 5 ℃, 25 ℃ and 40 ℃ for 6 months to evaluate their physical and chemical stability. Degradation of compound 1 (measured as total impurities associated with compound 1), particle size diameter, viscosity, permeation, pH, re-suspendability and appearance were evaluated at 6 weeks (6W), 3 months (3M) and 6 months (6M). The composition of the formulation is shown in table 13. The total impurities, particle size distribution, viscosity, permeation and pH values measured during the study are shown in tables 14A to 14E.

/>

As shown in Table 14A, the total impurities in the pre-storage formulation were 0.83-0.85 and increased by about 0.39% -0.46% after 6 months at 40 ℃.

As shown in tables 14B-1 to 14B-3, the particle size distribution remained stable, with the D90 value remaining below 10 μm at 6 months.

As shown in tables 14C-1 to 14C-3, the viscosity remained stable, with the viscosity at 6 months generally remaining near the initial viscosity.

As shown in tables 14D-1 to 14D-3, the permeation quantity remained stable with relatively small changes compared to the initial value measured at 6 months.

As shown in tables 14E-1 to 14E-3, the pH remained stable with only a slight change from the initial pH measured at 6 months.

The re-suspendability of the formulations did not change significantly during the study, as each formulation was observed to be a uniform suspension at each time point, without caking. Similarly, the appearance of the formulations did not change significantly during the study, as each formulation was white at each time point.

Stability studies indicate that these six formulations are stable when stored for up to at least six months under all storage conditions.

7. Detailed description of the preferred embodiments

While various specific embodiments have been illustrated and described, it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention. The invention is illustrated by the numbered examples listed below.

1. A formulation comprising 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable carriers.

2. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of at least 0.1% w/w.

3. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of at least 0.3% w/w.

4. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of at least 0.5% w/w.

5. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of at least 1% w/w.

6. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of at least 2% w/w.

7. The formulation of any one of embodiments 1-6, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of no more than 5% w/w.

8. The formulation of any one of embodiments 1-6, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of no more than 4% w/w.

9. The formulation of any one of embodiments 1-6, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of no more than 3% w/w.

10. The formulation of any one of embodiments 1 to 5, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of no more than 2% w/w.

11. The formulation of any one of embodiments 1-4, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of no more than 1% w/w.

12. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of 0.1% w/w.

13. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of 0.2% w/w.

14. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of 0.3% w/w.

15. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of 0.4% w/w.

16. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of 0.5% w/w.

17. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of 1% w/w.

18. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of 2% w/w.

19. The formulation of example 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of 3% w/w.

20. The formulation of any one of embodiments 1 to 19, wherein the one or more pharmaceutically acceptable carriers comprise one or more castor oil-based solubilizing agents.

21. The formulation of example 20, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of at least 0.1% w/w.

22. The formulation of example 20, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of at least 0.2% w/w.

23. The formulation of example 20, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of at least 0.3% w/w.

24. The formulation of example 20, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of at least 0.4% w/w.

25. The formulation of example 20, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of at least 0.5% w/w.

26. The formulation of example 20, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of at least 1% w/w.

27. The formulation of any one of embodiments 20 to 26, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of no more than 5% w/w.

28. The formulation of any one of embodiments 20 to 26, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of no more than 4% w/w.

29. The formulation of any one of embodiments 20 to 26, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of no more than 3% w/w.

30. The formulation of any one of embodiments 20 to 26, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of no more than 2% w/w.

31. The formulation of any one of embodiments 20 to 26, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of no more than 1% w/w.

32. The formulation of example 20, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of 0.5% w/w.

33. The formulation of example 20, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of 1% w/w.

34. The formulation of example 20, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of 5% w/w.

35. The formulation of any one of embodiments 20 to 34, wherein the one or more castor oil-based solubilizers comprises polyoxyethylene 40 hydrogenated castor oil and/or polyoxyethylene 35 castor oil.

36. The formulation of embodiment 35, wherein the one or more castor oil-based solubilizing agents comprises polyoxyethylene 40 hydrogenated castor oil.

37. The formulation of embodiment 35 or embodiment 36, wherein the one or more castor oil-based solubilizers comprises polyoxyl 35 castor oil.

38. The formulation of any one of embodiments 1 to 37, wherein the one or more pharmaceutically acceptable carriers comprise one or more carbomers.

39. The formulation of example 38, wherein the one or more carbomers are present in the formulation in an amount of at least 0.1% w/w.

40. The formulation of example 38, wherein the one or more carbomers are present in the formulation in an amount of at least 0.2% w/w.

41. The formulation of example 38, wherein the one or more carbomers are present in the formulation in an amount of at least 0.3% w/w.

42. The formulation of example 38, wherein the one or more carbomers are present in the formulation in an amount of at least 0.4% w/w.

43. The formulation of example 38, wherein the one or more carbomers are present in the formulation in an amount of at least 0.5% w/w.

44. The formulation of any one of embodiments 38 to 43, wherein the one or more carbomers are present in the formulation in an amount of no more than 1% w/w.

45. The formulation of any one of embodiments 38 to 43, wherein the one or more carbomers are present in the formulation in an amount of no more than 0.9% w/w.

46. The formulation of any one of embodiments 38 to 43, wherein the one or more carbomers are present in the formulation in an amount of no more than 0.8% w/w.

47. The formulation of any one of embodiments 38 to 43, wherein the one or more carbomers are present in the formulation in an amount of no more than 0.7% w/w.

48. The formulation of any one of embodiments 38 to 43, wherein the one or more carbomers are present in the formulation in an amount of no more than 0.6% w/w.

49. The formulation of any one of embodiments 38 to 43, wherein the one or more carbomers are present in the formulation in an amount of no more than 0.5% w/w.

50. The formulation of example 38, wherein the one or more carbomers are present in the formulation in an amount of 0.5% w/w.

51. The formulation of any one of embodiments 38 to 50, wherein the one or more carbomers comprise a type B carbomer homopolymer.

52. The formulation of any one of embodiments 1 to 51, wherein the one or more pharmaceutically acceptable carriers comprise one or more salts.

53. The formulation of embodiment 52, wherein the one or more salts comprise sodium chloride.

54. The formulation of example 53, wherein the sodium chloride is present in the formulation in an amount of at least 0.1% w/w.

55. The formulation of example 53, wherein the sodium chloride is present in the formulation in an amount of at least 0.2% w/w.

56. The formulation of any one of embodiments 53 to 55, wherein the sodium chloride is present in the formulation in an amount of no more than 0.5% w/w.

57. The formulation of any one of embodiments 53 to 55, wherein the sodium chloride is present in the formulation in an amount of no more than 0.4% w/w.

58. The formulation of any one of embodiments 53 to 55, wherein the sodium chloride is present in the formulation in an amount of no more than 0.3% w/w.

59. The formulation of example 53, wherein the sodium chloride is present in the formulation in an amount of 0.25% w/w.

60. The formulation of any one of embodiments 1 to 59, wherein the one or more pharmaceutically acceptable carriers comprise one or more tonicity enhancing agents.

61. The formulation of embodiment 60, wherein the one or more tonicity enhancing agents include an ionic tonicity enhancing agent.

62. The formulation of example 61, wherein the ionic tonicity enhancing agent is sodium chloride.

63. The formulation of any one of embodiments 1 to 62, wherein the one or more pharmaceutically acceptable carriers comprise one or more humectants.

64. The formulation of example 63, wherein the one or more humectants comprise glycerin.

65. The formulation of example 64, wherein the glycerol is present in the formulation in an amount of at least 0.5% w/w.

66. The formulation of example 64, wherein the glycerol is present in the formulation in an amount of at least 1% w/w.

67. The formulation of any one of embodiments 64 to 66, wherein the glycerol is present in the formulation in an amount of no more than 3% w/w.

68. The formulation of any one of embodiments 64 to 66, wherein the glycerol is present in the formulation in an amount of no more than 2% w/w.

69. The formulation of example 64, wherein the glycerol is present in the formulation in an amount of 1.5% w/w.

70. The formulation of any one of embodiments 63-69, wherein the one or more humectants comprise propylene glycol.

71. The formulation of any one of embodiments 63-70, wherein the one or more humectants comprises mannitol.

72. The formulation of example 71, wherein the mannitol is present in the formulation in an amount of at least 1% w/w.

73. The formulation of example 71, wherein the mannitol is present in the formulation in an amount of at least 2% w/w.

74. The formulation of any one of embodiments 71 to 73, wherein the mannitol is present in the formulation in an amount of no more than 5% w/w.

75. The formulation of any one of embodiments 71 to 73, wherein the mannitol is present in the formulation in an amount of no more than 4% w/w.

76. The formulation of example 71, wherein the mannitol is present in the formulation in an amount of 3% w/w.

77. A formulation, the formulation comprising:

a) 0.1% w/w to 3% w/w 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof;

b) 0.1% w/w to 2.5% w/w polyoxyethylene 40 hydrogenated castor oil;

c) 0.1% w/w to 1% w/w B type carbomer homopolymer;

d) 0.1% w/w to 0.5% w/w sodium chloride;

e) 0.5% w/w to 3% w/w glycerol or 1% w/w to 5% w/w mannitol;

f) Optionally, HCl and/or tromethamine and/or NaOH in an amount sufficient (qs) to provide a pH of 6.8 to 7.2; and

g) Water in an amount sufficient (qs) to 100%.

78. The formulation of example 77, comprising:

b) 0.5% w/w to 1% w/w polyoxyethylene 40 hydrogenated castor oil;

c) 0.5% w/w B type carbomer homopolymer;

d) 0.25% w/w sodium chloride;

e) 1.5% w/w glycerol or 3% mannitol;

g) Water in an amount sufficient (qs) to 100%.

79. The formulation of example 77 or example 78, comprising 0.1% w/w 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof.

80. The formulation of example 77 or example 78, comprising 0.3% w/w 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof.

81. The formulation of example 77 or example 78, comprising 1% w/w 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof.

82. The formulation of example 77 or example 78, comprising 3% w/w 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof.

83. The formulation of any one of embodiments 77 to 82, comprising 0.5% w/w polyoxyethylene 40 hydrogenated castor oil.

84. The formulation of any one of embodiments 77 to 82, comprising 1% w/w polyoxyethylene 40 hydrogenated castor oil.

85. The formulation of any one of embodiments 77 to 84, comprising 1.5% w/w glycerol.

86. The formulation of any one of embodiments 1 to 85, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is radiation sterilized.

87. The formulation of example 86, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof is gamma-irradiated.

88. The formulation of example 86, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof is irradiated with X-rays.

89. The formulation of any one of embodiments 1 to 88, comprising 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione.

90. The formulation of any one of embodiments 1 to 88, comprising a pharmaceutically acceptable salt of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione.

91. The formulation of any one of embodiments 1-89, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione is form a.

92. The formulation of any one of embodiments 1 to 91, wherein the formulation is an ophthalmic formulation.

93. The formulation of any one of embodiments 1 to 92, wherein the formulation is a topical formulation.

94. The formulation of embodiment 93, wherein the formulation is a topical formulation for application to skin.

95. The formulation of example 94, which is a topical formulation for application to the eyelid.

96. The formulation of any one of embodiments 1 to 95, which is an aqueous suspension.

97. The formulation of example 96, wherein the particles in the aqueous suspension have a D90 particle size of no more than 20 μm.

98. The formulation of example 97, wherein the D90 particle size is no more than 15 μm.

99. The formulation of example 97, wherein the D90 particle size is no more than 10 μm.

100. The formulation of example 97, wherein the D90 particle size is no more than 5 μm.

101. The formulation of example 97, wherein the D90 particle size is no more than 3 μm.

102. The formulation of example 97, wherein the D90 particle size is no more than 2 μm.

103. The formulation of example 97, wherein the D90 particle size is no more than 1 μm.

104. The formulation of any one of embodiments 97-103, wherein the D90 particle size is at least 0.5 μιη.

105. The formulation of example 104, wherein the D90 particle size is at least 0.6 μm.

106. The formulation of any one of embodiments 96-105, wherein particles in the aqueous suspension have a D50 particle size of no more than 5 μιη.

107. The formulation of example 106, wherein the D50 particle size is no more than 4 μm.

108. The formulation of example 106, wherein the D50 particle size is no more than 3 μm.

109. The formulation of example 106, wherein the D50 particle size is no more than 2 μm.

110. The formulation of example 106, wherein the D50 particle size is no more than 1 μm.

111. The formulation of example 106, wherein the D50 particle size is no more than 0.9 μm.

112. The formulation of example 106, wherein the D50 particle size is no more than 0.8 μm.

113. The formulation of example 106, wherein the D50 particle size is no more than 0.7 μm.

114. The formulation of example 106, wherein the D50 particle size is no more than 0.6 μm.

115. The formulation of example 106, wherein the D50 particle size is no more than 0.5 μm.

116. The formulation of example 106, wherein the D50 particle size is no more than 0.4 μm.

117. The formulation of example 106, wherein the D50 particle size is no more than 0.3 μm.

118. The formulation of any one of embodiments 106 to 117, wherein the D50 particle size is at least 0.2 μιη.

119. The formulation of any one of embodiments 106 to 116, wherein the D50 particle size is at least 0.3 μιη.

120. The formulation of any one of embodiments 106 to 115, wherein the D50 particle size is at least 0.4 μm.

121. The formulation of any one of embodiments 106 to 114, wherein the D50 particle size is at least 0.5 μm.

122. The formulation of any one of embodiments 106 to 113, wherein the D50 particle size is at least 0.6 μm.

123. The formulation of any one of embodiments 106 to 112, wherein the D50 particle size is at least 0.7 μm.

124. The formulation of any one of embodiments 96-123, wherein particles in the aqueous suspension have a D10 particle size of no more than 2 μιη.

125. The formulation of example 124, wherein the D10 particle size is no more than 1 μm.

126. The formulation of example 124, wherein the D10 particle size is no more than 0.9 μm.

127. The formulation of example 124, wherein the D10 particle size is no more than 0.8 μm.

128. The formulation of example 124, wherein the D10 particle size is no more than 0.7 μm.

129. The formulation of example 124, wherein the D10 particle size is no more than 0.6 μm.

130. The formulation of example 124, wherein the D10 particle size is no more than 0.5 μm.

131. The formulation of example 124, wherein the D10 particle size is no more than 0.4 μm.

132. The formulation of example 124, wherein the D10 particle size is no more than 0.3 μm.

133. The formulation of example 124, wherein the D10 particle size is no more than 0.2 μm.

134. The formulation of any one of embodiments 124-133, wherein the D10 particle size is at least 0.1 μm.

135. The formulation of any one of embodiments 124-132, wherein the D10 particle size is at least 0.2 μm.

136. The formulation of any one of embodiments 124-131, wherein the D10 particle size is at least 0.3 μm.

137. The formulation of any one of embodiments 124-130, wherein the D10 particle size is at least 0.4 μm.

138. The formulation of any one of embodiments 97 to 137, wherein D90 and/or D50 and/or D10 particle size is measured by a Microtrac S3500 particle size analyzer.

139. The formulation of any one of embodiments 97 to 137, wherein D90 and/or D50 and/or D10 particle size is measured by a Microtrac Sync particle size analyzer.

140. The formulation of any one of embodiments 97 to 137, wherein D90 and/or D50 and/or D10 particle size is measured by a Microtrac Bluewave particle size analyzer.

141. The formulation of any one of embodiments 1 to 140, wherein the formulation has a viscosity such that the formulation does not flow out of the fingertip and/or eyelid upon application.

142. The formulation of any one of embodiments 1 to 141, wherein the formulation has a viscosity such that the formulation can be dispensed as droplets from a dropper bottle and/or a drop dispenser.

143. The formulation of example 142, wherein the droplet has a mass of 30mg to 40 mg.

144. The formulation of any one of embodiments 1 to 143, wherein the viscosity of the formulation is at least 50cPs.

145. The formulation of example 144, wherein the viscosity of the formulation is at least 100cPs.

146. The formulation of example 144, wherein the viscosity of the formulation is at least 150cPs.

147. The formulation of example 144, wherein the viscosity of the formulation is at least 175cPs.

148. The formulation of example 144, wherein the viscosity of the formulation is at least 200cPs.

149. The formulation of any one of embodiments 1 to 148, wherein the viscosity of the formulation does not exceed 600cPs.

150. The formulation of example 149, wherein the viscosity of the formulation does not exceed 500cPs.

151. The formulation of example 149, wherein the viscosity of the formulation does not exceed 400cPs.

152. The formulation of example 149, wherein the viscosity of the formulation does not exceed 350cPs.

153. The formulation of example 149, wherein the viscosity of the formulation does not exceed 300cPs.

154. The formulation of any one of embodiments 1 to 153, wherein the pH of the formulation is 6.5 to 7.5.

155. The formulation of example 154, wherein the pH of the formulation is at least 6.6.

156. The formulation of example 154, wherein the pH of the formulation is at least 6.7.

157. The formulation of example 154, wherein the pH of the formulation is at least 6.8.

158. The formulation of example 154, wherein the pH of the formulation is at least 6.9.

159. The formulation of any one of embodiments 154 to 158, wherein the pH of the formulation does not exceed 7.4.

160. The formulation of any one of embodiments 154 to 158, wherein the pH of the formulation does not exceed 7.3.

161. The formulation of any one of embodiments 154 to 158, wherein the pH of the formulation does not exceed 7.2.

162. The formulation of any one of embodiments 154 to 158, wherein the pH of the formulation does not exceed 7.1.

163. The formulation of embodiment 154, wherein the pH of the formulation is from 6.9 to 7.1.

164. The formulation of example 154, wherein the pH of the formulation is 7.0.

165. The formulation of any one of embodiments 1 to 164, wherein the formulation has an osmolality of at least 200mOsm/kg.

166. The formulation of example 165, wherein the formulation has an osmolality of at least 250mOsm/kg.

167. The formulation of example 165, wherein the formulation has an osmolality of at least 275mOsm/kg.

168. The formulation of any one of embodiments 1 to 167, wherein the formulation has an osmolality of no more than 400mOsm/kg.

169. The formulation of example 168, wherein the formulation has an osmolality of no more than 375mOsm/kg.

170. The formulation of example 168, wherein the formulation has an osmolality of no more than 350mOsm/kg.

171. The formulation of any one of embodiments 1 to 170, which, when dispensed from an 8ml dropper bottle having a 15mm flat tip, forms droplets having an average mass of 30mg to 40 mg.

172. The formulation of any one of embodiments 1 to 171, further comprising a preservative.

173. The formulation of any one of embodiments 1 to 171, which does not comprise a preservative.

174. The formulation of any one of embodiments 1 to 173, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione-related impurities increase by no more than 1% after the formulation is stored at 5 ℃ for 6 months.

175. The formulation of any one of embodiments 1 to 173, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione-related impurities increase by no more than 0.5% after the formulation is stored at 5 ℃ for 6 months.

176. The formulation of any one of embodiments 1 to 173, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione-related impurities increase by no more than 1% after the formulation is stored at 25 ℃ for 6 months.

177. The formulation of any one of embodiments 1 to 173, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione-related impurities increase by no more than 0.5% after the formulation is stored at 25 ℃ for 6 months.

178. The formulation of any one of embodiments 1 to 173, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione-related impurities increase by no more than 1% after the formulation is stored at 40 ℃ for 6 months.

179. The formulation of any one of embodiments 1 to 173, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione-related impurities increase by no more than 0.5% after the formulation is stored at 40 ℃ for 6 months.

180. The formulation of any one of examples 174 to 179, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione related impurities increase by at least 0.2%, 0.3% or 0.4% when the formulation is stored for 6 months.

181. The formulation of any one of embodiments 1 to 180, wherein the D90 particle size of the formulation does not increase by more than 10% after storage of the formulation at 5 ℃ for 6 months.

182. The formulation of any one of embodiments 1 to 180, wherein the D90 particle size of the formulation does not increase by more than 500% after storage of the formulation at 25 ℃ for 6 months.

183. The formulation of any one of embodiments 1 to 180, wherein the D90 particle size of the formulation does not increase by more than 100% after storage of the formulation at 25 ℃ for 6 months.

184. The formulation of any one of embodiments 1 to 180, wherein the D90 particle size of the formulation does not increase by more than 50% after storage of the formulation at 25 ℃ for 6 months.

185. The formulation of any one of embodiments 1 to 180, wherein the D90 particle size of the formulation does not increase by more than 10% after storage of the formulation at 25 ℃ for 6 months.

186. The formulation of any one of embodiments 1 to 180, wherein the D90 particle size of the formulation does not increase by more than 500% after storage of the formulation at 40 ℃ for 6 months.

187. The formulation of any one of embodiments 1 to 180, wherein the D90 particle size of the formulation does not increase by more than 100% after storage of the formulation at 40 ℃ for 6 months.

188. The formulation of any one of embodiments 1 to 180, wherein the D90 particle size of the formulation does not increase by more than 50% after storage of the formulation at 40 ℃ for 6 months.

189. The formulation of any one of embodiments 1 to 188, wherein the viscosity of the formulation remains stable after 6 months of storage at 5 ℃.

190. The formulation of any one of embodiments 1 to 189, wherein the viscosity of the formulation remains stable after storage for 6 months at 25 ℃.

191. The formulation of any one of embodiments 1 to 190, wherein the viscosity of the formulation remains stable after storage at 40 ℃ for 6 months.

192. The formulation of any one of embodiments 1 to 191, wherein the permeation amount of the formulation remains stable after storage at 5 ℃ for 6 months.

193. The formulation of any one of embodiments 1 to 192, wherein the permeation amount of the formulation remains stable after storage for 6 months at 25 ℃.

194. The formulation of any one of embodiments 1 to 193, wherein the permeation amount of the formulation remains stable after storage at 40 ℃ for 6 months.

195. The formulation of any one of embodiments 1 to 194, wherein the pH of the formulation remains stable after storage at 5 ℃ for 6 months.

196. The formulation of any one of embodiments 1 to 195, wherein the pH of the formulation remains stable after storage for 6 months at 25 ℃.

197. The formulation of any one of embodiments 1 to 196, wherein the pH of the formulation remains stable after storage at 40 ℃ for 6 months.

198. The formulation of any one of embodiments 1 to 197, wherein the re-suspendability of the formulation remains stable after 6 months of storage at 5 ℃.

199. The formulation of any one of embodiments 1 to 198, wherein the re-suspendability of the formulation remains stable after storage for 6 months at 25 ℃.

200. The formulation of any one of embodiments 1 to 199, wherein the re-suspendability of the formulation remains stable after storage for 6 months at 40 ℃.

201. The formulation of any one of embodiments 1 to 200, which is an aqueous suspension and which does not exhibit significant sedimentation over a period of 7 days by visual inspection.

202. The formulation of any one of embodiments 1 to 201, which is an aqueous suspension and which does not exhibit significant sedimentation over a period of 14 days by visual inspection.

203. The formulation of any one of embodiments 1 to 202, which does not comprise Hydroxyethylcellulose (HEC).

204. A kit comprising the formulation of any one of embodiments 1 to 203 and a dropper bottle.

205. The kit of embodiment 204, wherein the dropper bottle is a 2ml to 15ml dropper bottle.

206. The kit of embodiment 205, wherein the dropper bottle is a 4ml dropper bottle, and optionally wherein the dropper bottle contains 2ml of the formulation.

207. The kit of embodiment 205, wherein the dropper bottle is an 8ml dropper bottle, optionally wherein the dropper bottle contains 4ml of the formulation.

208. The kit of any one of embodiments 204 to 207, wherein the formulation is located within the dropper bottle.

209. A method of preparing a formulation, the method comprising combining a slurry comprising (a) 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, and one or more solubilizing agents, optionally comprising one or more castor oil-based solubilizing agents, with (b) one or more additional pharmaceutically acceptable carriers.

210. The method of example 209, further comprising the step of sterilizing 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof by irradiation.

211. The method of embodiment 210, wherein the radiation is gamma radiation.

212. The method of embodiment 210, wherein the radiation is X-ray radiation.

213. The method of any one of embodiments 210 to 212, wherein the step of sterilizing 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof precedes the slurry formation.

214. The method of any of embodiments 209 to 213 wherein the slurry is the product of a process comprising combining 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, with one or more solubilizing agents to form a mixture and then milling the mixture.

215. The method of embodiment 214, wherein the method of forming the slurry comprises milling the mixture until the D90 of the particles in the mixture is less than no more than 20 μm, no more than 15 μm, no more than 10 μm, no more than 5 μm, no more than 3 μm, no more than 2 μm, or no more than 1 μm.

216. The method of embodiment 214 or embodiment 215, wherein the method of forming the slurry comprises milling the mixture until the D50 of the particles in the mixture is no more than 5 μιη, no more than 4 μιη, no more than 3 μιη, no more than 2 μιη, or no more than 1 μιη.

217. The method of any of embodiments 214-216, wherein the method of forming the slurry comprises milling the mixture until D10 of particles in the mixture is no more than 2 μιη or no more than 1 μιη.

218. The method of any of embodiments 214 to 217, wherein the method of forming the slurry comprises milling the mixture for at least 12 hours.

219. The method of embodiment 218, wherein the method of forming the slurry comprises grinding the mixture for at least 18 hours.

220. The method of embodiment 219, wherein the method of forming the slurry comprises milling the mixture for at least 24 hours.

221. The method of any of embodiments 214 to 220, wherein the method of forming the slurry comprises milling the mixture for up to 24 hours.

222. The method of any of embodiments 214 to 220, wherein the method of forming the slurry comprises milling the mixture for up to 36 hours.

223. The method of any one of embodiments 214 to 222, wherein the milling is ball milling.

224. The method of example 223, wherein the ball milling is performed with beads having a diameter of 1mm to 5 mm.

225. The method of example 224, wherein the beads have a diameter of 1 mm.

226. The method of example 224, wherein the beads have a diameter of 3 mm.

227. The method of any of embodiments 214-226, further comprising the step of forming the slurry.

228. The method of any one of embodiments 209 to 227, wherein the formulation is according to any one of embodiments 1 to 203.

229. A formulation produced by the method of any one of embodiments 209 to 228.

230. A method of agonizing LXR in the meibomian glands of a subject, the method comprising administering to the subject a therapeutically effective amount of the formulation of any of embodiments 1 to 203.

231. A method of inducing or increasing stearoyl-coa desaturase-1 (SCD 1) expression in the meibomian glands of a subject, comprising administering to the subject a therapeutically effective amount of the formulation of any of embodiments 1 to 203.

232. A method of increasing the ratio of desaturated to saturated lipids in the eye of a subject, comprising administering to the subject a therapeutically effective amount of the formulation of any one of embodiments 1-203.

233. A method of lowering the meibomian melting temperature and/or increasing meibum outflow from the meibomian glands of a subject, the method comprising administering to the subject a therapeutically effective amount of the formulation of any of embodiments 1 to 203.

234. A method of reducing meibum outflow obstruction from the meibomian glands of a subject, the method comprising administering to the subject a therapeutically effective amount of the formulation of any one of embodiments 1 to 203.

235. The method of any of embodiments 230-234, wherein the subject has dry eye.

236. The method of embodiment 235, wherein the dry eye is evaporative dry eye.

237. The method of any one of embodiments 230-236, wherein the subject has Meibomian Gland Dysfunction (MGD).

238. A method of treating dry eye in a subject in need of treatment, the method comprising administering to the subject a therapeutically effective amount of the formulation according to any one of embodiments 1-203.

239. The method of embodiment 238, wherein the dry eye is evaporative dry eye.

240. The method of embodiment 238 or embodiment 239, wherein the dry eye condition is associated with Meibomian Gland Dysfunction (MGD).

241. A method of treating Meibomian Gland Dysfunction (MGD) in a subject in need of treatment, the method comprising administering to the subject a therapeutically effective amount of the formulation according to any one of embodiments 1 to 203.

242. The method of any one of embodiments 230-241, wherein the formulation is administered to one or more eyelids of the subject.

243. The method of embodiment 242, wherein the formulation is applied by an applicator.

244. The method of embodiment 243, wherein the applicator is a finger.

245. The formulation of any one of embodiments 1 to 203, for use in a method of agonizing LXR in a meibomian gland of a subject.

246. The formulation of any one of embodiments 1 to 203, for use in a method of inducing or increasing stearoyl-coa desaturase-1 (SCD 1) expression in the meibomian glands of a subject.

247. The formulation of any one of embodiments 1 to 203 for use in a method of increasing the ratio of desaturated lipid to saturated lipid in the eye of a subject.

248. The formulation of any one of embodiments 1 to 203 for use in a method of lowering the meibum melting temperature and/or increasing meibum outflow from the meibomian glands of a subject.

249. The formulation of any one of embodiments 1 to 203, for use in a method of reducing meibum outflow obstruction from the meibomian glands of a subject.

250. The formulation according to any one of embodiments 1 to 203 for use in a method of treating dry eye in a subject in need thereof, optionally wherein the dry eye is overactive dry eye.

251. The formulation for use according to embodiment 250, wherein the dry eye condition is dry eye associated with Meibomian Gland Dysfunction (MGD).

252. The formulation of any one of embodiments 1 to 203, for use in a method of treating Meibomian Gland Dysfunction (MGD) in a subject in need thereof.

253. The formulation for use according to any one of embodiments 245 to 252, wherein in the method the formulation is applied to one or more eyelids of the subject, optionally through an applicator, optionally wherein the applicator is a finger.

254.3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof, which is irradiated.

255. The 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof of example 254, which is gamma-irradiated.

256. The irradiated 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof of example 254 which is irradiated with X-rays.

257. Use of 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione or a pharmaceutically acceptable salt thereof according to any one of embodiments 254 to 256 in the manufacture of a medicament.

258. The use of embodiment 257, wherein the medicament is a formulation according to any one of embodiments 1-203.

8. Incorporated by reference

All publications, patents, patent applications, and other documents cited in this application are hereby incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent application, or other document was specifically and individually indicated to be incorporated by reference for all purposes. In the event of any inconsistency between the teachings of the present specification and one or more of the references incorporated herein, the teachings of the present specification are contemplated.

Claims

1. A formulation comprising 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers.

2. The formulation of claim 1, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is present in the formulation in an amount of at least 0.1% w/w, at least 0.3% w/w, at least 0.5% w/w, at least 1% w/w, or at least 2% w/w, and no more than 5% w/w, no more than 4% w/w, no more than 3% w/w, no more than 2% w/w, or no more than 1% w/w.

3. The formulation of any one of claims 1 to 2, wherein the one or more pharmaceutically acceptable carriers comprise one or more castor oil-based solubilizing agents, wherein the one or more castor oil-based solubilizing agents are present in the formulation in an amount of at least 0.1% w/w, at least 0.2% w/w, at least 0.3% w/w, at least 0.4% w/w, at least 0.5% w/w, or at least 1% w/w, and no more than 5% w/w, no more than 4% w/w, no more than 3% w/w, no more than 2% w/w, or no more than 1% w/w.

4. A formulation according to claim 3 wherein the one or more castor oil-based solubilisers comprise polyoxyethylene 40 hydrogenated castor oil and/or polyoxyethylene 35 castor oil.

5. The formulation of any one of claims 1 to 4, wherein the one or more pharmaceutically acceptable carriers comprise one or more carbomers, wherein the one or more carbomers are present in the formulation in an amount of at least 0.1% w/w, at least 0.2% w/w, at least 0.3% w/w, at least 0.4% w/w, or at least 0.5% w/w, and no more than 1% w/w, no more than 0.9% w/w, no more than 0.8% w/w, no more than 0.7% w/w, no more than 0.6% w/w, or no more than 0.5% w/w.

6. The formulation of claim 5, wherein the one or more carbomers comprises a type B carbomer homopolymer.

7. The formulation of any one of claims 1 to 6, wherein the one or more pharmaceutically acceptable carriers comprise one or more salts, wherein the one or more salts comprise sodium chloride present in the formulation in an amount of at least 0.1% w/w, or at least 0.2% w/w, and no more than 0.5% w/w, no more than 0.4% w/w, no more than 0.3% w/w, or wherein the sodium chloride is present in the formulation in an amount of 0.25% w/w.

8. The formulation of any one of claims 1 to 7, wherein the one or more pharmaceutically acceptable carriers comprise one or more tonicity enhancing agents.

9. The formulation of claim 8, wherein the one or more tonicity enhancing agents include an ionic tonicity enhancing agent, wherein the ionic tonicity enhancing agent is sodium chloride.

10. The formulation of any one of claims 1 to 9, wherein the one or more pharmaceutically acceptable carriers comprise one or more humectants, wherein the one or more humectants comprise glycerin, wherein the glycerin is present in the formulation in an amount of at least 0.5% w/w, or at least 1% w/w, and no more than 3% w/w, or no more than 2% w/w, or wherein the glycerin is present in the formulation in an amount of 1.5% w/w.

11. The formulation of any one of claims 10 to 10, wherein the one or more humectants comprises propylene glycol or mannitol, and wherein the mannitol is present in the formulation in an amount of at least 1% w/w, or at least 2% w/w and no more than 5% w/w, or no more than 4% w/w, or wherein the mannitol is present in the formulation in an amount of 3% w/w.

12. A formulation, the formulation comprising:

b) 0.1% w/w to 2.5% w/w polyoxyethylene 40 hydrogenated castor oil;

c) 0.1% w/w to 1% w/w B type carbomer homopolymer;

d) 0.1% w/w to 0.5% w/w sodium chloride;

e) 0.5% w/w to 3% w/w glycerol or 1% w/w to 5% w/w mannitol;

g) Water in an amount sufficient (qs) to 100%.

13. The formulation of claim 12, comprising 0.1% w/w, 0.3% w/w, 1% w/w, or 3% w/w 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, and 0.5% w/w, 1% w/w, or 1.5% w/w polyoxyethylene 40 hydrogenated castor oil.

14. The formulation of any one of claims 1 to 3, wherein the 3- ((3- (4- (2- (isobutylsulfonyl) phenoxy) -3- (trifluoromethyl) phenyl) -1,2, 4-oxadiazol-5-yl) methyl) -5, 5-dimethyl-1- (2-morpholinoethyl) imidazolidine-2, 4-dione, or a pharmaceutically acceptable salt thereof, is subjected to radiation sterilization, gamma irradiation, or X-ray irradiation.

15. The formulation of any one of claims 1 to 14, wherein the formulation is an ophthalmic formulation or a topical formulation for application to the skin or eyelid.

16. The formulation of any one of claims 1 to 15, which is an aqueous suspension, wherein the particles in the aqueous suspension have a D90 particle size of no more than 20 μιη, no more than 15 μιη, no more than 10 μιη, no more than 5 μιη, no more than 3 μιη, no more than 2 μιη, or no more than 1 μιη, and at least 0.5 μιη, at least 0.6 μιη.

17. The formulation of any one of claims 1 to 16, wherein the formulation has a viscosity of at least 50cPs, at least 100cPs, at least 150cPs, at least 175cPs, or at least 200cPs, and no more than 600cPs, no more than 500cPs, no more than 400cPs, no more than 350cPs, or no more than 300cPs.

18. The formulation of any one of claims 1 to 17, wherein the formulation has a pH of 6.5 to 7.5, and wherein the formulation has an osmolality of at least 200mOsm/kg, at least 250mOsm/kg, or at least 275mOsm/kg, and no more than 400mOsm/kg, no more than 375mOsm/kg, or no more than 350mOsm/kg.

19. The formulation of any one of claims 1 to 18, which does not comprise Hydroxyethylcellulose (HEC).

20. A method of agonizing LXR in the meibomian glands of a subject, the method comprising administering to the subject a therapeutically effective amount of the formulation of any one of claims 1 to 19.

21. A method of inducing or increasing stearoyl-coa desaturase-1 (SCD 1) expression in the meibomian glands of a subject, the method comprising administering to the subject a therapeutically effective amount of the formulation of any one of claims 1 to 19.

22. A method of increasing the ratio of desaturated to saturated lipids in a subject's eye, comprising administering to the subject a therapeutically effective amount of the formulation of any one of claims 1-19.

23. A method of lowering the meibomian melting temperature and/or increasing meibum outflow from the meibomian glands of a subject, the method comprising administering to the subject a therapeutically effective amount of the formulation of any of claims 1 to 19.

24. A method of reducing meibum outflow obstruction from the meibomian glands of a subject, the method comprising administering to the subject a therapeutically effective amount of the formulation of any one of claims 1 to 19.

25. A method of treating dry eye or Meibomian Gland Dysfunction (MGD) in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the formulation of any of claims 1 to 19.