CN117721118A - Plant temperature-sensitive genic male sterile mutant tms19 and application thereof - Google Patents

Abstract

The invention discloses a plant temperature-sensitive genic male sterile mutant tms19 and application thereof, wherein the nucleotide sequence of the plant temperature-sensitive genic male sterile mutant tms19 comprises a nucleotide sequence shown as SEQ ID No.1 in a sequence table. The inventor obtains a recessive homozygous mutant temperature sensitive genic male sterile mutant tms19 through mutant screening. Agronomic trait statistics indicate that: tms19 mutant plants were highly sterile at high temperature and had progressively higher fertility as temperature was reduced. Cytological experiments showed that: under the high temperature condition, the tms19 mutant has abnormal vacuolation of tapetum, abnormal inner wall structure of pollen and gradual pollen collapse and abortion in the later period of anther development. Further researches of the inventor show that the tms19 gene is a brand new temperature-sensitive gene, plays an important role in the tapetum and microspores in the late stage of anther development of rice, and mutation of the gene can lead to a strong high-temperature sterile phenotype. Has certain potential in the application of two-line hybrid rice.

Description

Plant temperature-sensitive genic male sterile mutant tms19 and application thereof

Technical Field

The invention relates to the field of agriculture, in particular to a plant temperature-sensitive genic male sterile mutant gene tms19 and application thereof, wherein the temperature-sensitive genic male sterile mutant gene tms19 is highly sterile under a high temperature condition, and fertility is gradually increased along with temperature reduction.

Background

In agricultural production, plant male sterility provides an important pathway and germplasm resource for heterosis (heterosis) utilization.

Male sterility includes cytoplasmic male sterility (CMS: cytoplasmic male sterility) which is caused by mitochondrial genes and related nuclear genes, and nuclear male sterility (GMS: genic male sterility) which is caused by nuclear genes alone (Vedel et al, 1994). The male sterile plants provide important materials for heterosis utilization of hybrid crops, and also provide important research materials for stamen development, pollen development and nuclear gene interaction (Chen and Liu, 2014). Heterosis (Heterosis) refers to the phenomenon whereby the post-representation produced by crossing two inbred lines is now superior to the parent. For example, the yield of hybrid crops is 15-50% higher than that of inbred varieties (Tester and Langridge, 2010). Male sterility of plants has prompted the development of hybrid crops, making an important contribution to improving crop yield in countries around the world (Fan and Zhang, 2017). Heterosis utilization produces tremendous economic benefit in the world's grain production. In major crops such as corn, rice, sorghum, rapeseed, and sunflower, more than half of the crop yield is derived from hybrid varieties (Qing et al, 2007). Although hybrid crops have a series of excellent properties such as high yield, disease resistance, stress resistance and the like, the breeding process of hybrid crops still has a plurality of problems. Especially in self-pollinated crops, emasculation is often required to prevent self-setting. The manner of castration is typically manual castration, chemical castration and mechanical castration. These approaches have the disadvantages of high cost, low efficiency, and environmental pollution. In such cases, natural male sterile lines become an important breeding material that is not desirable when encountered. In the crossbreeding history of rice, the wild abortive sterile plant found by Mr. Yuan Longping in 1964 lays a solid foundation for the development of three-line hybrid rice (Yuan, 1966). In 1972, the university of Wuhan hybridized with Jiangxi local variety lotus pond early with Hainan red mango wild rice as female parent, the sterile plant appears in F2 generation, the sterile line and maintainer line of Cheng Gonglian type are bred in lotus pond early backcross in 1974, and the breeding of the red lotus sterile line enriches the genetic diversity of cytoplasm in the three-line hybrid rice (Zhu, 2016, zhu K, 2000). The Gambiaka koku and Dissi of Sichuan agricultural university are respectively hybridized with Gambiaka koku and Dissi of Gambiaka, sabina and Sabina, and the anther of the Gambiaka and Dissi is small, malformed and pollen-iodine-abortive, so that the Gambiaka and D-sterile lines are respectively bred.

The research on the genes for controlling photo-thermo-sensitive male sterility can help people to better use and understand the precious germplasm resource, thereby being better applied to agricultural production. NK58S has been the earliest discovered photosensitive male sterile mutant and has been the focus of research by scientists.

In recent years, the research of two-line hybrid rice has been developed, a series of indica rice and japonica rice sterile lines practical in production are bred, and a large number of new varieties of two-line hybrid rice are bred and promoted in large scale in production. However, the photo-thermo-sensitive sterile line germplasm resources used for breeding two-line hybrid rice at present are single, and most sterile sites are derived from NK58S and AnS-1. In addition, the inventor still needs to be more deeply researched on molecular mechanisms generated by photo-thermo-sensitive phenomena in two-line hybrid rice and functions of related genes thereof. The study uses chemically mutagenized rice mutants as materials to screen out plants with a temperature-sensitive genic male sterile phenotype. Based on the gene, the inventor identifies a temperature sensitive sterile mutant tms19 controlled by recessive single genes through phenotype observation and genetic analysis. The corresponding gene TMS19 was cloned, which encodes a mitochondrial-localized PPR protein, the function of which may be related to RNA editing. The temperature-sensitive gene regulates and controls the pollen development of rice mainly by influencing the accumulation of active oxygen. Among the photo-thermo-sensitive rice genes reported at present, a gene encoding PPR protein has not been found yet. The research of the sterile gene is helpful to find a better sterile line for the two-line hybrid rice, clone a new temperature-sensitive gene, and enrich the germplasm resources of the two-line hybrid rice. And the molecular mechanism behind the phenomenon can be revealed by researching the reason that the mutant generates the photo-thermo-sensitive phenomenon. Provides a theoretical basis for breeding photo-thermo-sensitive genic male sterile rice.

At present, more than 20 nuclear sterile lines based on response to illumination and temperature are approximately positioned, but cloned genes are still very limited, and although a certain degree of breakthrough is achieved, further intensive research is needed, and resources of photo-thermo-sensitive genes are relatively less, so that the development of new photo-thermo-sensitive gene resources is necessary.

Disclosure of Invention

The inventors of the present application conducted a large number of rice mutagenesis experiments in a laboratory and introduced mutants obtained by mutagenesis into plant cells to cultivate corresponding seeds, planted offspring obtained from the seeds, and analyzed the shape of the large number of mutagenized mutants. The inventor obtains a temperature sensitive sterile plant when using the flower 11 in japonica rice as a mutagenesis material and screening the plant by Ethyl Methylsulfonate (EMS) mutagenesis, and locates the influencing genes therein from the temperature sensitive sterile plant: thermo-sensitive genic male sterile mutant tms19 with homozygous recessive mutation. Specifically, the inventors cloned a novel gene TMS19 located on chromosome 2 by high throughput sequencing, and encoded the product of TMS19 as a PPR family protein located on mitochondria. A single base mutation occurs at 620 th position of the gene exon sequence, and T is switched to C, so that the temperature-sensitive phenotype of tms19 mutant is caused. The corresponding 207 th valine Val of its amino acid sequence is changed to alanine Ala.

Through various experimental verification on the mutant plant, the mutant has the following characteristics:

agronomic trait statistics indicate that: tms19 mutant plants were highly sterile at high temperature and had progressively higher fertility as temperature was reduced. Cytological experiments showed that: under the high temperature condition, the tms19 mutant has abnormal vacuolation of tapetum, abnormal inner wall structure of pollen and gradual pollen collapse and abortion in the later period of anther development. The results of RT-PCR and QRT-PCR show that the gene is a ubiquitously expressed gene, but the expression level in anthers is slightly high. In situ hybridization experiments show that the TMS19 gene has higher transcription level in tapetum and microspores at 10/11 th stage of anther development. The immunohistochemical result shows that TMS19 protein has stronger expression level in tapetum and microspore in 10/11 th stage of anther development.

The research of the inventor shows that the Tms19 gene is a brand new temperature-sensitive gene which plays an important role in the tapetum and microspores in the late stage of the anther development of rice, and the mutation of the gene can lead toIntense high temperature sterile phenotypeAnd the sterility mechanism is obviously different from other temperature sensitive sterility genes. Has good prospect in the application of two-line hybrid rice.

The technical scheme of the invention is as follows:

a plant temperature-sensitive genic male sterile mutant tms19, wherein the nucleotide sequence of the plant temperature-sensitive genic male sterile mutant tms19 comprises a nucleotide sequence shown in SEQ ID No.1 in a sequence table.

On the other hand, the invention provides an amino acid sequence of the plant temperature-sensitive genic male sterile mutant, which is shown as a sequence table ID No. 2.

In another aspect, the invention provides an expression vector containing the plant temperature sensitive genic male sterile mutant tms19 or the amino acid sequence.

In another aspect, the invention provides an application of the plant temperature-sensitive genic male sterile mutant tms19 or a corresponding amino acid sequence in preparing recessive male genic male sterile transgenic plants.

In another aspect, the invention provides the use of the plant temperature-sensitive genic male sterile mutant tms19 or a corresponding amino acid sequence in plant breeding, the use comprising

(1) Introducing the plant temperature sensitive genic male sterile mutant tms19 or a corresponding amino acid sequence into a target plant, wherein the phenotype of the plant is shown as high temperature male sterility and low temperature fertility recovery;

(2) Or introducing the sterile plant into other varieties of plants through hybridization, wherein the sterile plants obtained in the F2 generation can also show a temperature-sensitive sterile phenotype;

(3) Or (3) using the sterile plants obtained in (1) and (2) as female parent, using different plant varieties as male parent to make hybridization, and cultivating hybridization target plant to obtain correspondent hybridization seed.

In another aspect, the invention provides a method for cultivating a fertility restorer plant whose pollen development is affected by temperature, the method comprising introducing the plant temperature sensitive genic male sterile mutant tms19 or a corresponding amino acid sequence into plant seed cells, and cultivating the corresponding plant using plant seeds into which the temperature sensitive genic male sterile mutant tms19 has been introduced.

In another aspect, the invention provides a plant seed or plant with restorable fertility, comprising the nucleotide sequence or corresponding amino acid sequence of tms19 of the plant temperature sensitive genic male sterile mutant in the gene sequence of the plant seed or plant.

In another aspect, the invention provides a method of modulating a Wen Minyo trait in a plant comprising the steps of: the TMS19 gene in the wild type plant is replaced by a nucleotide sequence shown as SEQ ID No.1 in the sequence table, or the corresponding protein of the TMS19 gene is replaced by an amino acid sequence shown as SEQ ID No. 2.

In another aspect, the invention provides the use of tms19 or a corresponding amino acid sequence of a thermo-sensitive genic male sterile mutant of a plant for modulating or providing a Wen Minyo trait of the plant, or as a selectable marker for a transgenic plant, the selectable marker being a reversible change in a Wen Minyo trait, the reversible change in the Wen Minyo trait being a trait in which the plant exhibits fertility restoration under low temperature conditions; under high temperature conditions, plants exhibit sterility traits.

For the above nucleotide sequences, the above expression vectors, the above uses and the above methods or uses, the plant is a monocotyledonous plant comprising at least rice, maize and soybean.

The sequences of the invention are as follows (same as in sequence tables 1 and 2):

TMS19 CDS

ATGCGCGGGCGCATGGCCTCCTCGGCCTCCGCCGCGGCTCTCCTGCCCCTCCCCTCTCCTTCCTGCTCCTCCTCGGAGGACTCCGACGACGGAAAGCACCTCCCGTCTCCTCCCGCACCGGAGGCGAACACCCCGCCTACGCAGCAGCAGAAGCGGCGGCGGCTGGAGCGAGACTACAACGTGGCCATGAAAGCCCTGGCGCTCGCCGGCGACTTGGACGAGGTGGTCGCTGTCTTTGCTGAGCTAAAGCGGACTGCCGCCGACGGTGGTGATGGCGGCGCGCCGCCCAACGTGCTGTGCTATAACACGCTCGTCAATGCGCTCGCGGAGGCCGGTCGCGAGGGGGAGGCCCTCAAGGCGTTCGATGAAATGCTCGCGTCGGGTGTAGCGCCCAACGCGTCGTCACAAAACATCCTGATCAAGATGCACGCAAGGCGGTCGGAGTTTGACCTTGCTTGGGAGCTTATCCACAAGAGCGGGGTGGAGCCTGACGTTGGTACGTACTCAACGCTCATCGCGGGCCTGTGCCGGGCAGGTAAGATCGTTGAGGCGTGGGGCGTGCTTGACTGGATGCTGGAGAAGAACTGCCGCCCGATGGTGCAGACTTACACGCCCATAGCACAAGCATATTGCCGCGATGGCCGCATCGTGGAGGCCAAGCTGCTGATGGCCGAGATGGAACGTCTTGGCTGCCTTCCCAACGTCGTCACATACAATGTTCTAATCAGGGCCTTGTGTGATGATGACAAATTTGATGAAGTTGAACAGGTTTTAATGGAAAGTAGTACCAAAGATTGGAAGCCCAGTACGGTCACGTACAATATATATATGAATGGCCTCTGCAAGAAAGGTAAGGCTAAGGAAGCACTTGAGCTGTTGGATGTTATGTTAGGTGAGGGATTGGAACCCACAGCTTATACTTGGAGTATTCTTCTGAATTGCCTTTGCCATTCCTCAAGACTTTTGGATGCTATATACTTGTTAGAGAGGAGCACAGAGTTGAAATGGTATGCTGGTGTTGTTGCATACAACACTGTAATGAGCAGTTTGTGTGAGATGGGCAAATGGAGGGGTATTATGAAGCTATTAACAGATATGATCAAAAAAGGTATCGAGCCAAACACAAGGACGTTCAACATTTTGATTCGTAGTCTTTGTGTTGGGGGAAAGTCCTCCTTAGCCAAGAGCTTGATCCATAGTCTAGGATTTGCTGCAAATGTGGTGACATACAATATACTCCTTCATTGGTTTTACTACCATGGAAAGTTAACTGAAGCGAATCGCTTAATTTCAGTAATGGAGGAAAAGAATATTGCTCCAGATGAAGTCACCTATACTATAATAATTGATGGATTATGCAGAGAAAGGAAATTTGATGCAGCTACTGCTTGTTTTCTTAAATCACTTACAAGTGGGCTATCGATGGATGTTCTTACTGTCCTTCTCAACAGGCTTGTTTATGCTGATAAAATATGGGAAATCAATCGCATATTTGATGGAAAAGATTTTGTCCCTGATCATCATGTTTTTGACCTTACAATTAGAACATTCTGTAGGGTTGGCTATTGTCACTATAGAACTTTTTATAAGCTAAACCTTATTCTGGATGCGATGTTGAAAAGGAAGTAA

TMS19 protein

MRGRMASSASAAALLPLPSPSCSSSEDSDDGKHLPSPPAPEANTPPTQQQKRRRLERDYNVAMKALALAGDLDEVVAVFAELKRTAADGGDGGAPPNVLCYNTLVNALAEAGREGEALKAFDEMLASGVAPNASSQNILIKMHARRSEFDLAWELIHKSGVEPDVGTYSTLIAGLCRAGKIVEAWGVLDWMLEKNCRPMVQTYTPIAQAYCRDGRIVEAKLLMAEMERLGCLPNVVTYNVLIRALCDDDKFDEVEQVLMESSTKDWKPSTVTYNIYMNGLCKKGKAKEALELLDVMLGEGLEPTAYTWSILLNCLCHSSRLLDAIYLLERSTELKWYAGVVAYNTVMSSLCEMGKWRGIMKLLTDMIKKGIEPNTRTFNILIRSLCVGGKSSLAKSLIHSLGFAANVVTYNILLHWFYYHGKLTEANRLISVMEEKNIAPDEVTYTIIIDGLCRERKFDAATACFLKSLTSGLSMDVLTVLLNRLVYADKIWEINRIFDGKDFVPDHHVFDLTIRTFCRVGYCHYRTFYKLNLILDAMLKRK

technical effects

The tms19 mutant provided by the invention excessively accumulates anther ROS in the S10 and S11 phases under the high temperature condition. Abnormal changes in ROS signaling can lead to advanced or delayed degradation of the anther tapetum, which in turn affects pollen fertility. During high temperature, a large amount of ROS in the anther of the mutant appear in the S10 and S11 phases, so that the oxidative stress of tapetum cells is caused, the normal development of microspores is further influenced, better sterility performance can be brought to plants, the fruiting rate of plants containing the mutant is obviously lower than that of the plants of the existing tms5 isothermal sensitive sterile mutant, the plants containing the mutant are applied to the breeding process, the breeding efficiency is higher, and the sterile plants with high purity can be obtained more easily.

Drawings

FIG. 1 shows the phenotypic comparison of wild type and tms19 mutant plants under different conditions, wherein (a-c) wild type and tms19 mutant plants were compared for their phenotype after heading, (d, g, j) wild type and tms19 mutant anthers at high and low temperatures, (f, i, l) wild type and tms19 mutant pollen potassium iodide staining results at high and low temperatures, (m) statistics of setting rate of tms19, tms5, and tms18 during high temperatures (> 28 ℃), (n) during low temperatures (< 24 ℃), tms19, tms5, tms15, and tms18 (see Zhang et al, plant Biotechnol J.20:2023-2035.2023) (one rice photo-thermo-sensitive sterility variant tms18 and its use/ZL 202011109557.0)), setting rate statistics (2020-2022).

FIG. 2 shows the comparison of the pollen phenotype observation of tms19 mutant and the analysis of the internal and external wall structures in the high and low temperature environment. Wherein, (a) a wild type (ZH 11) and tms19 pollen scanning electron microscope pictures under the high and low temperature conditions, (b) Basic fuchsin and fluorescent brightening agent 28 (FB-28) are used for co-dyeing the inner and outer walls of the wild type (ZH 11) and tms19 pollen under the high and low temperature conditions, a laser confocal microscope picture is taken, (tms 19-HT represents high temperature and tms19-LT represents low temperature).

Fig. 3 is: semi-thin cut results plots for wild-type and tms19 mutant anthers, where (a-d): semi-thin sections of wild-type phase 8-11 anthers; (e-h) semi-thin sections of tms19 mutant (high temperature) phase 8-11 anthers; (i-l) semi-thin sections of tms19 mutant (low temperature) phase 8-11 anthers, E: a epidermis; en: an inner wall; ML: a middle layer; t: a tapetum layer; tds: tetrad; msp: microspores; BP: binuclear pollen grains; AT: abnormal tapetum; AMsp: abnormal microspores; ABP: abnormal binuclear pollen grains, scale 20 μm in the figure.

FIG. 4 is a transmission electron microscope view of the anthers of the wild type and tms19 mutants, wherein (a-c): results of wild type stage 9-11 pollen transmission electron microscopy (d): the result of the transmission electron microscope of the tapetum of the wild anther at the 10-stage. (e-g): observing tms19 mutant at 9-11 stage pollen transmission electron microscope; (h): results of the tms19 mutant phase 10 tapetum transmission electron microscopy; msp: microspores; ex: pollen wall; AEx: abnormal pollen wall; BP: binuclear pollen; ABP: abnormal binuclear pollen; ba: a columnar body; se, outer layer of outer wall; ne: an outer wall inner layer; APC: coating abnormal pollen; t: a tapetum layer; ub: wushi body; AUb: abnormal Ubbelohde body. Scale in the figure: the left large graph of (a), (b), (c), (e), (f), (g) is 5 μm; the right panel A is 500nm; the right panels of (b) and (h) are 2 μm; the remainder were 1. Mu.m.

FIG. 5 is a comparison of cloning and expression analysis of TMS19 gene, wherein (a) structural pattern of TMS19 gene, mutation site is located at 620 th position. (b) RT-PCR analysis of TMS19 expression level. Pa: palea wheel; le: palea. (c) qRT-PCR analysis of TMS19 expression level. Other L1, L2, L3, L4: anther length = 0.5mm, 1mm, 1.5mm, 2mm. (d, e, f) tms19 and tms19-comp complementing plants under high temperature conditions. (g-n) transcription of TMS19 was detected using RNA probe in situ hybridization. (o-t) immunohistochemical detection of TMS19-GFP expression using GFP antibody.

FIG. 6 shows the comparison of the protein structure and evolution analysis of TMS 19;

FIG. 7 shows (a-d) 35S. TMS19-GFP plasmid cotransformed with Mito-Tracker Red CMXRos in rice protoplasts, mitochondria marked with dye exhibiting red fluorescence. (e-h) 35S TMS19-GFP alone was transfected into rice protoplasts. (i-l) Mito-Tracker Red CMXRos stain rice protoplasts, mitochondria are dye-labeled with red fluorescence;

FIG. 8 is a view of the change in ROS during development of WT and tms19 anthers, NBT staining of (a-f) WT (ZH 11) anthers, a-f: anther at 7-12 days. (g-l) NBT staining of tms19-HT (high temperature) anthers, g-l: anther at 7-12 days. (m-r) NBT staining of tms19-LT (Low temperature) anthers, m-r: anther at 7-12 days.

FIG. 9 is a schematic diagram showing degradation of tms19 pollen nuclei at high temperature.

Detailed Description

The present invention will be described in detail below with reference to the drawings and examples thereof, but the scope of the present invention is not limited to the examples.

The inventors of the present application selected temperature sensitive sterile mutants by mutagenesis using flower 11 (Oryza sativa ssp. Japonica, ZH 11) in a japonica variety as a material. Mutagenesis and selection of mutants was described in Zhang et al 2007. Planting the M1 generation after mutagenesis treatment in a field, and cutting out the snapping seeds with higher fruiting rate of each strain of the M1 generation after the M1 generation is normally fruiting, and mixing and harvesting the snapping seeds as M2 generation seeds. And in the early spring and summer of the second year, the M2 generation seeds are planted, the male sterile phenotype plants are screened out by utilizing the high temperature condition, the stump is cut on the male sterile plants obtained by screening, natural screening under the low temperature condition is carried out, fertility restoration conditions of each plant of materials are observed, and the possible temperature-sensitive sterile plants are harvested and average setting percentage is counted.

Through a large number of experiments, the inventor screens and obtains a temperature-sensitive genic male sterile line. Sequencing and verification prove that the mutant contained in the gene sequence is positioned, the mutant is named tms19, the gene sequence of the tms19 mutant is shown as SEQ ID No.1 in a sequence table, and the amino acid sequence is shown as SEQ ID No. 2.

The materials and test methods used in the present invention are described below:

plant material: the rice lines used in the invention are wild japonica rice ZH11, tms19 (temperature sensitive male-sterile line generated by EMS mutagenesis), transgenic complementary lines tms19-comp and CRISPR knockout plants tms19-15d. The materials are planted in a plant garden and a test field of Shanghai university.

Phenotypic analysis

Plants and ear phenotypes were photographed using a Nikon D7000 digital camera (Nikon, japan). Anther phenotypes were photographed using an Olympus SZX10 dissecting microscope. Olympus BX51 fluorescence microscope was used to capture the iodination results of pollen. The pollen inner and outer walls were co-stained with basic fuchsin and fluorescent whitening agent, and observed by laser confocal microscopy FV3000 (Olympus, japan), staining method was described in detail (Jia et al, 2021; yang et al, 2022). The cytological phenotype of each material was observed by semi-thin section, transmission electron microscopy (JEOL, tokyo, japan) and scanning electron microscopy (Hitachi, tokyo, japan). The embedding and observation procedure is described in the laboratory preliminary study (Lou et al, 2014).

Agronomic trait statistics (temperature sensitive)

Each batch of tms19, ostms15, ostms18, and tms5 (ZH 11) seeds germinated 1 time per week and were transplanted to the field (Shanghai, voxian) at a seedling height of about 20 cm. The temperature-sensitive properties of the mutants were analysed statistically by recording the average temperature and the corresponding setting rate during the booting period of each batch of plants (Zhang et al 2022).

Comet experiment

Pollen grains of rice were collected, suspended in low-melting agarose, and smeared on a glass slide. After agarose solidification, the slide glass is soaked in lysis buffer and alkaline buffer to remove cell membrane and protein of pollen. Finally, the slide was electrophoresed for 10 minutes, and the DNA that disintegrated the nuclei moved faster than the whole nuclear DNA. Followed by staining with propidium iodide and analysis with confocal microscopy (Xue et al 2020).

ROS content determination

Rice anthers at different developmental stages were glumes stripped, immersed in 10mM potassium citrate buffer (pH 6.0) containing 0.5mM nitroblue tetrazolium (NBT), evacuated in a vacuum for 5min, incubated at 25 ℃ for 6h for detection of superoxide anion (O-2) content and profile (Hu et al 2011; xie et al 2014). H2O2 in anthers was stained with 2, 7-dichlorofluorescein diacetate (H2 DCF-DA, sigma-Aldrich, USA). The rice anther is stripped of glume, soaked in 5 mu M H2DCF-DA dye liquor, vacuumized for 5min by a vacuum instrument, and then incubated for 2-3 h at 25 ℃. Dye liquor was washed off, the anthers were tableted, photographed with a confocal microscope, and fluorescent intensity was quantified using ImageJ software (Xie et al, 2014; wu et al, 2023).

Immunohistochemistry

The ears of ZH11 and tms19-gfp (gpf is a green fluorescent protein, an existing protein) were immersed in FAA solution, evacuated for 15min and fixed at 4℃for 1-3 days. Paraffin embedding is carried out after dehydration and decoloration through gradient alcohol and dimethylbenzene. The sections were cut using an MR2 rotary microtome (RMC, USA) with a section thickness of 8. Mu.m. The sections were dewaxed and rehydrated. Endogenous peroxidase was blocked by a 3% H2O2 soak treatment for 10min, and the sections were placed in a boiling sodium citrate solution (0.01 m, ph=6.0) for antigen retrieval. Sections were soaked in 5% BSA for 30min for antigen blocking and incubated with GFP antibody (antibody 1:1000) and secondary antibody (antibody 1:1000), respectively. Immunostaining was then performed using SABC-Kit and DAB (Beyotime, china).

In situ hybridization

The embedded blocks of ZH11 spikelets were sectioned to a slice thickness of 7 μm. A350 bp specific fragment on TMS19 CDS was cloned into the pBluescript-SK vector (Stratagene, USA). The vector was digested with the endonucleases BamHI and EcoRI, respectively. The cleavage products were used as transcription templates, and sense and antisense probes were transcribed using T7 and T3 RNA transcriptases, respectively, while using digoxin markers (Roche,

switzerland). RNA hybridization and immunological detection procedures are described in detail (Zhu et al,2011; han et al, 2021). Finally, the analysis was photographed by an optical microscope.

Identification of temperature-sensitive properties of tms19

In order to verify the temperature-sensitive property of the plant, the inventor observes and records the growth condition of the plant under different temperature conditions. As shown in FIG. 1, the snapping from which the snapping was withdrawn at high temperature (> 28 ℃) was highly sterile (FIG. 1-b), and the fertility of tms19 was gradually restored to normal in a low temperature environment (< 24 ℃) (FIG. 1-c). Under high temperature conditions, the anther of tms19 mutant became smaller (FIG. 1-h). Potassium iodide staining indicated: most of the mutant pollen exhibited a shrunken morphology, a few of the morphologically normal pollen, but none of them stained a normal deep blue (FIG. 1-i). During the low temperature period, the tms19 mutant had full pollen morphology and uniform size, and the potassium iodide staining was restored to normal (FIG. 1-l). In order to study the temperature sensitive property of the mutant, namely the correlation between the setting rate and the temperature change condition. The inventors germinated a batch of tms19, tms5, tms19 and tms18 seeds every other week starting at 5 months of the year, 2020 to 2022. And in the later stage, the booting time of the plants in each stage and the average temperature in the stage are respectively counted. Statistical results show that the setting rate of tms19 mutant increases gradually with decreasing booting stage temperature. When the average air temperature was higher than 28 ℃, tms19 mutant was highly sterile (FIG. 1-m), with a setting rate of less than 5%. When the average air temperature is lower than 24 ℃, the fertility of the mutant is obviously recovered (figure 1-n), and the fruiting rate is improved to 38%. The data indicate that: the high temperature sterility of tms19 mutants was superior to tms5, similar to tms19 and tms18, at average air temperatures above 28 ℃ (fig. 1-m); at temperatures below 24 c, the low temperature recovery is slightly lower than tms5 and tms18, comparable to tms18 (fig. 1-n). These results indicate that tms19 has a stable temperature-sensitive phenotype and has considerable application potential in the production of two-line hybrid rice.

Temperature sensitive sterility mechanism of the mutant

Through research on tms19, tms19 mutant showed that pollen inner wall was abnormal in development under high temperature condition, but the morphological structure of pollen outer wall was not significantly different from that of wild type (fig. 2). The rapid clearance of reactive oxygen species to lower levels in the anthers at the S10, S11 stage of development of the wild rice ZH11 anther may suggest that during normal anther development, higher ROS at this stage may affect pollen development. Under high temperature conditions, the tms19 mutant S10, S11 anther ROS accumulated excessively (fig. 7). Thus, excessive accumulation of ROS is a major cause of male sterility.

ROS can mediate stress as a signaling molecule, but excessive ROS can damage cells (Baxter et al, 2014). ROS can often lead to peroxidation of intracellular lipids and oxidative denaturation of DNA, proteins, and high temperature induced ROS accumulation can cause extensive biochemical damage in cells such as cell membrane degradation, mRNA transcription and protein translation reduction, ultimately leading to apoptosis (De Storme et al, 2014). At high temperatures, a large number of mitochondria are highly likely to lead to a dramatic increase in ROS content, an oxygen metabolism byproduct (Mittler, 2017), which produces a large number of high temperature inducements ROS (Heat induced ROS) in anthers. In TMS19 mutants, these dysfunctional mitochondria also produce large amounts of ROS (Mitochondrion derived ROS) due to mutations in TMS19 protein, resulting in defective mitochondrial function. These ROS of different origins accumulate in large amounts, leading to oxidative stress of anther tissue and pollen, and thus to plant abortion. Development of the tapetum is closely coordinated with development of microspores, normal function and timely degradation of the tapetum are critical to pollen development (Roger et al, 2010).

The presence of large amounts of ROS in the mutant anthers at S10 and S11 may also lead to oxidative stress of the tapetum cells, further affecting the normal development of microspores. The rapid clearance of reactive oxygen species to lower levels in the anthers at the S10, S11 stages of anther development in wild type rice may suggest that higher ROS may affect pollen development during normal anther development. Under high temperature conditions, the tms19 mutant S10, S11 anther ROS accumulated excessively (fig. 7). Abnormal changes in ROS signaling can lead to advanced or delayed degradation of the anther tapetum, which in turn affects pollen fertility. (Hu et al,2011;Yu et al,2017). During high temperatures, large amounts of ROS in mutant anthers occur in S10 and S11, which may also lead to oxidative stress of tapetal cells, further affecting the normal development of microspores. During low temperature, the ROS content of the mutant anther at S10, S11 phase is restored to normal level. Although the mitochondrial function of tms19 mutants is still impaired, high temperature induced ROS are not produced in anthers. Due to the dose effect, it is not sufficient to produce a fatal injury to all pollen cells, at which time the mutant regains partial fertility.

RT-PCR and qRT-PCR

Total RNA was isolated from anthers of different periods of wild type ZH11 using the TRIzol kit (Invitrogen, USA). Reverse transcription of the cDNA was performed using TransScript Fly First-Strand cDNA Synthesis SuperMix (TransGen Biotech, china). The semi-quantitative method of RT-PCR is described in detail in (Xiong et al 2016). SYBR Green Real-time PCR Master Mix (Toyobo, japan) and ABI 7300system (Life Technologies, USA) were used in qRT-PCR analysis. OsACTIN was used as an internal reference gene in the experiment. Each experiment was performed in 3 biological replicates.

Subcellular localization

The full-length cDNA of TMS19 was cloned into the pCAMBIA1300 vector driven by the 35S promoter to construct a 35S: TMS19: GFP fusion protein. Preparation of Rice protoplasts 10. Mu.l of plasmid was added to 100. Mu.l of protoplast suspension and incubated for 12-16h in the dark. Protoplasts were stained for 10-15min using MitoTracker Red CMXRos (Invitrogen) as mitochondrial Marker and fluorescence was observed with confocal microscopy.

In order to observe whether tms19 mutant pollen has structural defects in high temperature environment, the inventor observes tms19 and wild ZH11 pollen in maturity stage through a scanning electron microscope. The experimental results show that: the tms19-HT has a large amount of pollen collapse and deformation in the medicine chamber cavity, and the pollen wall is sunken and adhered to the inner wall of the anther. The inventors also observed the tms19-LT mutant mature period anthers and pollen in a low temperature environment by scanning electron microscopy, while taking ZH11 pollen as a control. The observation results show that: the mutant anther in the low-temperature environment has normal morphological structure, the outer wall of the anther is normal, and the pollen morphology is full (figure 2-a). This suggests that different ambient temperatures do have a significant impact on the pollen development process of tms19 mutants. Morphological analysis is carried out on pollen by a scanning electron microscope, and the inventor finds that the pollen outer wall structure of tms19 mutant pollen is relatively complete under the high temperature condition. To see if there is abnormality in the inner wall structure of tms19 pollen, the inventors stained the outer and inner walls of tms19 pollen under wild-type, high and low temperature conditions with Basic fuchsin and fluorescent whitening agent 28 (Flourescent Brightener-28) and observed with a laser confocal microscope. The outer wall of the pollen may be colored by basic fuchsin and excited to red fluorescence under a confocal microscope. The pollen inner wall may be colored by fluorescent whitening agent 28, which is excited to green fluorescence under confocal microscopy. The results show that: the outer and inner walls of wild type pollen may be normally colored, presenting regular and continuous circular outer (red) and inner (green) walls, with the inner and outer walls closely conforming (fig. 2-b, ZH 11). Under high temperature conditions, the pollen outer wall and inner wall of tms19 mutant showed irregular forms of shrinkage and curling while staining normally (FIG. 2-b, tms 19-HT). Under low temperature conditions, both the pollen outer wall and inner wall of tms19 mutant stained normally, as with wild type (FIG. 2-b, tms 19-LT). In summary, defects in the inner wall of tms19 pollen at high temperature may be a direct cause of sterility.

Applicants found that the TMS19 gene affected development of the tapetum and microspores of rice anthers

Specifically, in order to study the role of the TMS19 gene in the anther development process of rice, the inventors observed the anther development process of mutants in a high temperature environment through semi-thin sections. Experimental results show that the tms19 mutant anther has no obvious difference from the wild anther in early development stage, the development and differentiation of epidermis, inner wall, middle layer and tapetum of the anther can be normally carried out, and microspores can also be normally developed. However, abnormal vacuolization of tapetum cells was observed at stage 10, and tapetum was further degraded abnormally in the chamber of the drug chamber at stage 11, with a lightening. At stages 10 to 11 of anther development, most microspores fail to form normal sickle-shaped binuclear pollen grains and collapse and deformation occurs with degradation of the cell contents, ultimately leading to microspore abortion (fig. 3-g, h). Under low temperature condition, tms19 mutant has normal pollen and tapetum cell development, and can form normal pollen (figure 3-k, l)

The inventors observed anther sections at stages 9-11 by transmission electron microscopy and showed that: the cell membrane of part of microspores of the mutant was similarly wall-separated from the pollen wall at stage 9 compared to the wild type, while the pattern of sporopollen deposition on the pollen outer wall was sparse compared to the wild type (fig. 4-a, e). In stage 10, the mutant pollen wall was able to distinguish between the outer and inner double layer structures of the outer wall, but the typical I-shaped outer wall structure was not present and no columnar layer could be observed (FIGS. 4-b, f). Compared with the synchronous wild pollen wall, the sporopollen deposited on the outer wall is larger in particle size, loose in combination, and larger in gap between the inner layer and the outer layer than normal pollen. The mutant pollen at stage 11 failed to form normal sickle-shaped double-core pollen grains, the pollen collapsed entirely, the pollen wall pressed inward, the pollen contents were absent (fig. 4-c, g). By observing the structures of the pollen wall of the comparison mutant and the wild pollen wall, the wild pollen wall has a clear layered structure, and is respectively an outer wall layer, a columnar body, an inner wall layer and an inner wall from outside to inside; however, the pollen wall of the contemporaneous mutant is thicker, the layering is not obvious, only the structure similar to the outer layer and the inner layer of the outer wall can be observed, and the columnar structure and the inner wall structure cannot be observed. To observe that the development of the tapetum of the tms19 mutant was affected, the inventors also performed transmission electron microscopy on the tapetum of the mutant and wild type phase 10. The results showed that there are large numbers of transport vesicles inside the wild type tapetum cells, and large numbers of Ubbelopsis on the side near the chamber of the drug chamber (FIG. 4-d). While the lack of transport vesicles in the cells in the tapetum of the mutant, while the Ubbelohde shape structure near the side of the chamber near the drug chamber all showed abnormalities (FIG. 4-h). These results suggest that TMS19 may affect both microspore pollen wall development and function in tapetum cells during anther development.

For rapid and efficient cloning into the TMS19 gene, the inventors selected a method of high throughput sequencing to locate the mutation site. The inventor backcrosses the tms19 mutant with the genetic background purified generation with the wild ZH11 again, thereby obtaining a fertile F1 generation, and selfing the F1 generation heterozygous plant to obtain the seeds of the F2 generation segregating group. F2 generation groups are planted in a high-temperature environment, and the F2 generation groups are used as genetic segregation groups for high-throughput sequencing. The inventor respectively takes 50 plants of sterile plants and fertile plants in the separated population to mix pools respectively, takes large-drawing DNA as a sequencing group, and simultaneously extracts ZH11 leaf DNA as a control group. Sequencing results show that a single base mutation occurs in the coding sequence of TMS19 gene on chromosome 2 of TMS19 mutant. The total length of the gene is 7704bp, only one exon region is provided (figure 4-a), and no related report exists at present. Based on the sequencing result, the inventor designs PCR primers by using the exon sequence of TMS19 gene as a template, and uses TMS19 mutant and ZH11 genome DNA as PCR reaction templates to amplify the exon sequence and send the amplified exon sequence to a company for sequencing. Sequencing results showed that mutation of the 620 th base of the exon sequence from thymine to cytosine (T.fwdarw.C) resulted in mutation of the amino acid encoded by the gene from valine (Val, GTA) to alanine (Ala, GCA) in the mutant compared to the wild type. To further verify whether the temperature sensitive sterile phenotype of TMS19 mutants resulted from single base mutation of TMS19, the inventors amplified the full-length coding sequence of TMS19 and the promoter sequence upstream of its start codon using wild-type ZH11 genomic DNA as template. The inventor recovers the amplified TMS19 gene fragment and constructs the TMS19 gene fragment on a binary vector pCAMBIA1300, and transfers the connection product into the TMS19 mutant. And (3) extracting DNA after the transgenic plants are taken, amplifying TMS19 fragments, and screening positive plants which have the genetic background of TMS19 and contain the transgenic vectors at the same time after sequencing comparison. And culturing the transgenic complementary plant in a high-temperature environment, and observing that the growth condition of the complementary plant is consistent with that of the wild type, the phenotype of the plant is not obviously different, and the complementary plant is normally fertile and is not different from that of the wild type.

In order to determine the expression condition of TMS19 gene in wild rice, the inventor respectively extracts RNA from root, stem, leaf, glume and anther of ZH11 plant in booting stage and different development stages, obtains cDNA through reverse transcription, uses the cDNA as a template of RT-PCR, and respectively detects the expression quantity of the gene in different tissues. The RT-PCR experiment result shows that TMS19 gene is expressed in each tissue of plant, but the expression amount of the gene is highest in the later stage of anther development according to the brightness of the band (FIG. 4-b). To better understand the expression of TMS19 at different stages of anther development, the inventors divided it into four categories according to the length of anther, corresponding to stages 1-7, 7-8b, 8b-9, 10 and later of anther development, respectively (Zhang et al 2011). Respectively collecting wild anthers at different periods to extract RNA, carrying out reverse transcription to obtain cDNA, and then carrying out qRT-PCR. Experimental data indicate that the expression level of TMS19 gene in anther is far higher than other tissues, and the expression level is highest before 7 and after 10 periods of anther development (FIG. 4-c).

In order to further determine the expression patterns of the mutant in different tissues of anther, the inventor designs a specific RNA probe and performs an in situ hybridization experiment. Experimental results show that the gene has higher transcription level in tapetum fine and microspores at 10 th and 11 th phases of anther development (FIG. 4 g-n). The inventors constructed the pCAMBIA1300 expression vector pTMS19 of TMS19 and GFP tag fusion protein. Transferring the constructed fusion protein carrier into tms19 mutant, and screening positive seedlings through identification. However, the GFP fluorescence signal could not be detected by observing the anthers at each stage of their development by laser confocal microscopy. Thus, the inventors used immunohistochemical methods to detect the expression profile of TMS19:GFP fusion protein. The inventor takes anther of transgenic plants as an immunohistochemical experimental material, prepares the blocks after paraffin embedding, and uses a polyclonal antibody (rabbit source) which specifically binds GFP protein for experiments. The results of immunohistochemical experiments also showed that TMS19 protein was highly expressed in tapetum cells and microspores at stage 10/11 (FIG. 4 o-t). In summary, TMS19 may play a role in late anther development.

Protein structure and evolution analysis of TMS19

To further understand the structure and function of TMS19 protein, the inventors used the UniProt protein database (https:// www.uniprot.org /) and the alpha fold protein structure database (https:// alpha fold.ebi.ac. Uk) to predict protein structure (FIG. 5-a). The prediction result shows that the coding product of the TMS19 gene is an unknown functional PPR protein, the protein belongs to PLS subfamily, the N-end and C-end domains are unknown, the protein has 12 PPR motif: of which 3 are L-shaped and 9 are S-shaped. The full-length amino acid sequence of TMS19 protein was searched and matched by using NCBI's online protein sequence alignment tool BLASTP (https:// blast. NCBI. Nlm. Nih. Gov/blast. Cgi), and proteins homologous to the TMS19 protein sequence in different species were retrieved, wherein 25 protein sequences with E-value of zero were included, and the proteins belong to 15 species. By using sequence alignment software MEGAX to perform multiple sequence alignment on these 25 protein sequences, a phylogenetic tree related to TMS19 protein was constructed (FIG. 5-b). The results show that the TMS19 protein has homology only in monocots. The PPR protein sequences are roughly divided into three major classes, wherein one of the proteins with the closest relatedness to TMS19 protein is from indica rice, and the other is from brachypodium distachyon, which indicates that the PPR protein is highly conserved in monocotyledonous plant groups and possibly plays an important role in monocotyledonous plants. Meanwhile, the TMS19 protein possibly belongs to a class of proteins which are independently evolved in the late evolution stage of monocotyledonous plants in the plant evolution process and are suitable for the environment.

TMS19 localizes to ROS homeostasis affecting anthers by mitochondria

To determine the precise location and specific function of TMS19 protein in rice cells, the inventors constructed a 35S: TMS19-GFP vector, and prepared rice protoplasts (see materials and methods for protoplast preparation) for transformation of GFP tag protein vectors. The results show that a punctiform distribution of fluorescent signals in the cytoplasm was observed in cells transformed with the 35S:: TMS19-GFP plasmid (FIG. 5-E/F/G/H). In terrestrial plants, most PPR family proteins are localized mainly within semi-autonomous organelles such as mitochondria or chloroplasts (colombit et al, 2013). However, by transforming 35S:TMS 19-GFP into rice protoplasts, co-localization of the protein with chloroplasts was not found (FIG. 6-b). To investigate whether TMS19 localizes to mitochondria, the inventors used the mitochondrial specific dye Mito-Tracker Red CMXRos, co-transfecting rice protoplasts transformed with 35S:: GFP-TMS19 plasmid (FIG. 6-a). The experimental results showed that the green fluorescent signal of GFP fusion protein was highly overlapped with the red fluorescent signal of Mito-Tracker Red CMXRos, indicating localization of TMS19 protein to mitochondria.

Mitochondrial function is impaired, often resulting in reactive oxygen species bursts. The inventors observed the generation and variation of ROS in rice anthers at different developmental stages and in different tissue cells. The results indicate that in wild rice, there is a significant ROS signal in the anthers at stages 7-9 (FIGS. 7 a-c). Anther development 10, 11 is the phase of microspores for PM I and PM II, and also the pollen inner wall synthesis phase. During this period, the ROS signal of the anther was barely detectable (FIGS. 7 d-e). The PM I and PM II processes, which may be microspores, are relatively sensitive to ROS. The rice itself has mechanisms to maintain low levels of ROS during this period. A stronger ROS signal appears again after pollen has developed (stage 12) (fig. 7-f). In the tms19 mutant, there was strong ROS accumulation at all phases of anther development, including phases 10-11 of PM I and PM II, at high temperature (FIG. 7 g-k). It is possible that excessive ROS accumulation during this period affects the PM I and PM II processes. The pollen inner wall is controlled by the microspore genome itself, and defects in PM I and PM II also affect pollen inner wall formation, resulting in sterility. Under the low temperature condition, the content of ROS in the anther at the phase of tms19 10-11 is obviously reduced (fig. 7 p-q), which shows that the anther can effectively remove ROS at the low temperature, and PM I and PM II can be ensured to normally run, so that fertility is restored. The above results indicate that the difference in pollen fertility of tms19 at high and low temperatures is caused by the difference in ROS content. During high temperatures, the anthers of tms19 are not functional enough to support their elimination of excessive ROS, resulting in the accumulation of ROS in large quantities, affecting the formation of pollen inner walls and thus leading to sterility.

Tms19 maintains low ROS levels and microspores develop to mature pollen at low temperatures.

Pollen nuclear degradation is the main cause of tms19 mutant sterility under high temperature conditions

High temperature and ultraviolet stress can increase pollen reactive oxygen levels, thereby affecting pollen viability (Zechmann et al,2011; xue et al, 2020). Under high temperature conditions, tms19 mutant anthers accumulate large amounts of ROS in PM i phase (phase 10) and PM ii phase (phase 11), suggesting that pollen abortion during tms19 high temperature may be associated with abnormal accumulation of ROS. An increase in ROS leads to cleavage of pollen nuclear DNA (Xue et al 2020). The inventors have suggested that excessive accumulation of ROS in tms19 at high temperature also causes degradation of pollen nuclei. The inventors used Comet Assay (Comet Assay) to detect DNA fragmentation in pollen nuclei (Xue et al 2020). The proportion of cell nuclei with different damage degrees is analyzed by collecting mutant pollen under the conditions of high-temperature sterility and low-temperature fertility and performing comet electrophoresis. The inventors split the DNA damage class into four groups: the cell nucleus with little or no comet tail DNA content is defined as <1%, the cell nucleus with less than 30% comet tail DNA content is defined as 1% -30%, the cell nucleus with 30% -70% comet tail DNA content is defined as 30% -70%, and the cell nucleus with greater than 70% comet tail DNA content is defined as >70%. Under the high temperature condition, the ratio of three damage degrees in the ZH11 pollen is 9%, 50%, 11% and 31% respectively. the proportion of four DNA damage types in tms19 pollen is 4%, 36%, 16% and 44% respectively. Under the low temperature condition, the ratio of three damage degrees in tms19 pollen is 5%, 58%, 19% and 18% respectively. This result indicates that the nuclear DNA of tms19 pollen is more susceptible to damage at high temperature. While during low temperatures the degree of DNA damage in pollen is greatly reduced. Since the inner wall of pollen is controlled by microspore self genome, mutant genome under high temperature condition is lost to influence the formation of inner wall to result in sterility. Because a large amount of pollen can be formed in anthers, the damage degree is reduced to a certain extent under the low-temperature condition, and partial functional pollen can be formed so as to restore fertility.

While the principles of the invention have been described in detail in connection with the preferred embodiments thereof, it should be understood by those skilled in the art that the foregoing embodiments are merely illustrative of the implementations of the invention and are not intended to limit the scope of the invention. The details of the embodiments are not to be taken as limiting the scope of the invention, and any obvious modifications based on equivalent changes, simple substitutions, etc. of the technical solution of the invention fall within the scope of the invention without departing from the spirit and scope of the invention.

Claims (10)

1. The plant temperature-sensitive genic male sterile mutant tms19 is characterized in that the nucleotide sequence of the plant temperature-sensitive genic male sterile mutant tms19 comprises a nucleotide sequence shown as SEQ ID No.1 in a sequence table.

2. The amino acid sequence of the plant temperature-sensitive genic male sterile mutant is shown as a sequence table ID No. 2.

3. An expression vector comprising the plant temperature sensitive genic male sterile mutant tms19 of claim 1 or the amino acid sequence of claim 2.

4. Use of a plant temperature-sensitive genic male sterile mutant tms19 or a corresponding amino acid sequence according to claim 1 for the preparation of a recessive male genic male sterile transgenic plant.

5. Use of the plant temperature-sensitive genic male sterile mutant tms19 or the corresponding amino acid sequence of claim 1 in plant breeding, said use comprising (1) introducing said plant temperature-sensitive genic male sterile mutant tms19 or the corresponding amino acid sequence into a plant of interest, the phenotype of which shows high temperature sterility, low temperature fertility recovery;

(2) Or introducing the sterile plant into other varieties of plants through hybridization, wherein the sterile plants obtained in the F2 generation can also show a temperature-sensitive sterile phenotype;

(3) Or (3) using the sterile plants obtained in (1) and (2) as female parent, using different plant varieties as male parent to make hybridization, and cultivating hybridization target plant to obtain correspondent hybridization seed.

6. A method of growing a fertility restorer plant affected by temperature in plant pollen development, the method comprising introducing the plant temperature sensitive genic male sterile mutant tms19 or a corresponding amino acid sequence into plant seed cells, and performing corresponding plant cultivation using plant seeds into which the plant temperature sensitive genic male sterile mutant tms19 has been introduced.

7. A plant seed or plant with recoverable fertility, characterized in that the plant seed or plant gene sequence comprises the nucleotide sequence or corresponding amino acid sequence of the plant temperature sensitive sterile mutant tms19.

8. A method of modulating a Wen Minyo trait in a plant comprising the steps of: the TMS19 gene in the wild type plant is replaced by a nucleotide sequence shown as SEQ ID No.1 in the sequence table, or the corresponding protein of the TMS19 gene is replaced by an amino acid sequence shown as SEQ ID No. 2.

9. Use of a plant temperature sensitive genic male sterile mutant tms19 according to claim 1 for modulating or providing a Wen Minyo trait in a plant or as a selectable marker for a transgenic plant, the selectable marker being a reversible change in the Wen Minyo trait, the reversible change in the Wen Minyo trait being a trait in which the plant exhibits fertility restoration under low temperature conditions; under high temperature conditions, plants exhibit sterility traits.

10. The nucleotide sequence according to claims 1-2, the expression vector according to claim 3, the use according to claims 4-5 and the method according to claims 6-7 or the use according to claims 8-9, characterized in that the plant is a monocot comprising at least rice, maize and soybean.