CN117721051A - Bacillus bailii B16 and separation method and application thereof - Google Patents
Bacillus bailii B16 and separation method and application thereof Download PDFInfo
- Publication number
- CN117721051A CN117721051A CN202311805822.2A CN202311805822A CN117721051A CN 117721051 A CN117721051 A CN 117721051A CN 202311805822 A CN202311805822 A CN 202311805822A CN 117721051 A CN117721051 A CN 117721051A
- Authority
- CN
- China
- Prior art keywords
- bacillus
- petroleum
- culture
- petroleum hydrocarbon
- belicus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000193830 Bacillus <bacterium> Species 0.000 title claims abstract description 81
- 238000000926 separation method Methods 0.000 title description 7
- 239000003209 petroleum derivative Substances 0.000 claims abstract description 50
- 239000003208 petroleum Substances 0.000 claims abstract description 38
- 238000006731 degradation reaction Methods 0.000 claims abstract description 34
- 230000015556 catabolic process Effects 0.000 claims abstract description 32
- 239000004094 surface-active agent Substances 0.000 claims abstract description 21
- 239000000126 substance Substances 0.000 claims abstract description 15
- 239000002689 soil Substances 0.000 claims abstract description 13
- 238000009629 microbiological culture Methods 0.000 claims abstract description 3
- 238000004321 preservation Methods 0.000 claims abstract 2
- 238000000034 method Methods 0.000 claims description 18
- 239000001963 growth medium Substances 0.000 claims description 17
- 239000010802 sludge Substances 0.000 claims description 17
- 229910017053 inorganic salt Inorganic materials 0.000 claims description 14
- 239000000243 solution Substances 0.000 claims description 14
- 239000003921 oil Substances 0.000 claims description 13
- 230000000593 degrading effect Effects 0.000 claims description 10
- 229930195733 hydrocarbon Natural products 0.000 claims description 9
- 150000002430 hydrocarbons Chemical class 0.000 claims description 9
- 239000006228 supernatant Substances 0.000 claims description 9
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 9
- OKTJSMMVPCPJKN-UHFFFAOYSA-N Carbon Chemical compound [C] OKTJSMMVPCPJKN-UHFFFAOYSA-N 0.000 claims description 8
- 230000001580 bacterial effect Effects 0.000 claims description 8
- 229910052799 carbon Inorganic materials 0.000 claims description 8
- 238000012258 culturing Methods 0.000 claims description 7
- 238000010790 dilution Methods 0.000 claims description 5
- 239000012895 dilution Substances 0.000 claims description 5
- 238000000576 coating method Methods 0.000 claims description 4
- 239000002054 inoculum Substances 0.000 claims description 4
- 238000004519 manufacturing process Methods 0.000 claims description 4
- 241000193744 Bacillus amyloliquefaciens Species 0.000 claims description 3
- 239000000463 material Substances 0.000 claims description 3
- 239000000725 suspension Substances 0.000 claims description 3
- 238000005520 cutting process Methods 0.000 claims description 2
- 230000001105 regulatory effect Effects 0.000 claims description 2
- 239000010913 used oil Substances 0.000 claims description 2
- 230000000694 effects Effects 0.000 abstract description 9
- 238000012136 culture method Methods 0.000 abstract description 2
- 238000000354 decomposition reaction Methods 0.000 abstract 1
- 230000035764 nutrition Effects 0.000 abstract 1
- 235000016709 nutrition Nutrition 0.000 abstract 1
- 239000002609 medium Substances 0.000 description 13
- 238000012360 testing method Methods 0.000 description 12
- 230000000052 comparative effect Effects 0.000 description 10
- 239000007788 liquid Substances 0.000 description 9
- 238000011056 performance test Methods 0.000 description 9
- 241000894006 Bacteria Species 0.000 description 6
- VEXZGXHMUGYJMC-UHFFFAOYSA-N Hydrochloric acid Chemical compound Cl VEXZGXHMUGYJMC-UHFFFAOYSA-N 0.000 description 6
- 238000004945 emulsification Methods 0.000 description 6
- 241000894007 species Species 0.000 description 6
- 239000003876 biosurfactant Substances 0.000 description 5
- 238000002474 experimental method Methods 0.000 description 5
- 239000002699 waste material Substances 0.000 description 5
- 230000001954 sterilising effect Effects 0.000 description 4
- 230000008901 benefit Effects 0.000 description 3
- 239000012153 distilled water Substances 0.000 description 3
- 238000000605 extraction Methods 0.000 description 3
- 230000002906 microbiologic effect Effects 0.000 description 3
- VLKZOEOYAKHREP-UHFFFAOYSA-N n-Hexane Chemical compound CCCCCC VLKZOEOYAKHREP-UHFFFAOYSA-N 0.000 description 3
- 230000008569 process Effects 0.000 description 3
- 238000012216 screening Methods 0.000 description 3
- 238000004659 sterilization and disinfection Methods 0.000 description 3
- 229920001817 Agar Polymers 0.000 description 2
- 241000196324 Embryophyta Species 0.000 description 2
- 241001465754 Metazoa Species 0.000 description 2
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 2
- 239000008272 agar Substances 0.000 description 2
- 230000036541 health Effects 0.000 description 2
- 238000002955 isolation Methods 0.000 description 2
- 230000000813 microbial effect Effects 0.000 description 2
- 244000005700 microbiome Species 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 239000010705 motor oil Substances 0.000 description 2
- 239000012074 organic phase Substances 0.000 description 2
- 239000011435 rock Substances 0.000 description 2
- 241000193755 Bacillus cereus Species 0.000 description 1
- 239000002028 Biomass Substances 0.000 description 1
- 239000004215 Carbon black (E152) Substances 0.000 description 1
- 229930186217 Glycolipid Natural products 0.000 description 1
- 108010028921 Lipopeptides Proteins 0.000 description 1
- 102000004895 Lipoproteins Human genes 0.000 description 1
- 108090001030 Lipoproteins Proteins 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 239000005662 Paraffin oil Substances 0.000 description 1
- 238000003723 Smelting Methods 0.000 description 1
- 230000004913 activation Effects 0.000 description 1
- 239000003570 air Substances 0.000 description 1
- 150000001335 aliphatic alkanes Chemical class 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 229940041514 candida albicans extract Drugs 0.000 description 1
- 239000006285 cell suspension Substances 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 239000011248 coating agent Substances 0.000 description 1
- 239000003086 colorant Substances 0.000 description 1
- 150000001875 compounds Chemical class 0.000 description 1
- 239000000356 contaminant Substances 0.000 description 1
- 230000008094 contradictory effect Effects 0.000 description 1
- 230000009089 cytolysis Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000003113 dilution method Methods 0.000 description 1
- 230000001804 emulsifying effect Effects 0.000 description 1
- 239000000839 emulsion Substances 0.000 description 1
- 238000005265 energy consumption Methods 0.000 description 1
- 238000009472 formulation Methods 0.000 description 1
- 230000006870 function Effects 0.000 description 1
- 239000011521 glass Substances 0.000 description 1
- 231100000171 higher toxicity Toxicity 0.000 description 1
- 230000002209 hydrophobic effect Effects 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000011065 in-situ storage Methods 0.000 description 1
- 230000008595 infiltration Effects 0.000 description 1
- 238000001764 infiltration Methods 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 230000028744 lysogeny Effects 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 239000002245 particle Substances 0.000 description 1
- 239000002957 persistent organic pollutant Substances 0.000 description 1
- 150000003904 phospholipids Chemical class 0.000 description 1
- 239000011148 porous material Substances 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 230000001737 promoting effect Effects 0.000 description 1
- 230000009467 reduction Effects 0.000 description 1
- 238000007670 refining Methods 0.000 description 1
- 238000005067 remediation Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000004062 sedimentation Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 239000010865 sewage Substances 0.000 description 1
- 239000011780 sodium chloride Substances 0.000 description 1
- 230000004083 survival effect Effects 0.000 description 1
- 239000012137 tryptone Substances 0.000 description 1
- 239000012138 yeast extract Substances 0.000 description 1
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The disclosure provides bacillus belicus B16, which is preserved in China general microbiological culture Collection center (CGMCC) with a preservation number of CGMCC No.29175; the bacillus belicus B16 provided by the disclosure can generate a surfactant, so that the contact opportunity with petroleum hydrocarbon substances is improved, and the degradation speed and the degradation rate are improved; the petroleum hydrocarbon in petroleum can be directly taken as a unique nutrition source for decomposition and utilization; the strain has high activity and simple culture method, can be used for treating petroleum-polluted soil, and has wide prospect in the field of petroleum-polluted soil restoration.
Description
Technical Field
The disclosure relates to the technical field of microbial application, in particular to bacillus beijerinus B16, and a separation method and application thereof.
Background
With the continuous increase of energy demands, the petroleum exploitation quantity and exploitation range are continuously enlarged, so that petroleum pollution is increasingly serious, and ecological safety and human health are seriously threatened. The hazard of petroleum pollution is mainly caused by petroleum hydrocarbon (Petroleum hydrocarbons, PH), which is a persistent organic pollutant and causes serious damage to the ecosystem in the environment. The petroleum hydrocarbon directly enters the soil environment and then mostly enters the soil pores vertically, is tightly combined with soil particles and slowly released, or enters the water body through infiltration and leakage, and the short-chain alkane volatilizes to enter the atmosphere, so that the stability of an ecological system is destroyed, the human health is threatened, the animal and plant survival is limited, and the environment is deteriorated.
Bioremediation refers to the use of microbial degradation to reduce the content of petroleum hydrocarbon contaminants in soil, which are ultimately mineralized to produce CO 2 、H 2 O, biomass, etc., have less negative effects on the environment, lower cost and simple operation. But the bioremediation effect is unstable, the growth and propagation of microorganisms have higher requirements on in-situ environment, and the hydrophobicity of the surfaces of some bacteria with petroleum degradation function is lower, so that the contact opportunity of the bacteria and petroleum can be reduced, and the degradation effect is affected.
Therefore, development of novel efficient petroleum hydrocarbon degradation strains is urgently needed, unit cost reduction and synergy are realized, and ecological restoration is promoted.
Disclosure of Invention
In view of this, in order to at least partially solve at least one of the above-mentioned technical problems, the present disclosure provides bacillus beijerinckii B16, and a separation method and application thereof, which can adapt to petroleum hydrocarbon polluted environment, and can generate a surfactant during the growth process, thereby increasing the contact between bacteria and petroleum and improving the degradation effect of petroleum hydrocarbon.
As one aspect of the present disclosure, there is provided bacillus belicus (bacillus cereus) B16 deposited at the general microbiological center of the chinese microbiological bacterial culture collection center at the year 2023, month 11 and day 29, with the deposit address of the institute No. 3 of the north chen west road No. 1, the region of the korean yang of beijing city, and the deposit number of the same is CGMCC No.29175.
As another aspect of the disclosure, there is provided the use of bacillus beijerinus B16 for the production of surfactants.
As another aspect of the present disclosure, there is provided the use of bacillus belicus B16 for producing petroleum hydrocarbon-degrading substances.
As another aspect of the present disclosure, there is provided a method for enriching and isolating bacillus belicus B16, comprising:
putting the oil sludge into an inorganic salt culture medium, adding petroleum as a carbon source, and carrying out shaking culture;
sucking culture solution of shake culture, inoculating into fresh inorganic salt culture medium, repeating inoculating operation, and performing enrichment culture;
separating the strain obtained by enrichment culture by using a dilution plate coating method;
culturing the separated strain in a culture medium to obtain bacillus belicus B16.
The bacillus beijerinckii B16 strain provided by the embodiment of the disclosure can grow by taking petroleum as the only carbon source, and can produce a surfactant, so that the contact with petroleum hydrocarbon in the degradation process is increased, and the degradation of the petroleum hydrocarbon is rapid and efficient; meanwhile, the method has simple enrichment and separation methods and has the potential of large-area industrialized application; bacillus bailii B16 can be used for producing a surfactant and degrading petroleum hydrocarbon substances, and can be particularly used for petroleum, oil sludge, waste engine oil and oil-based rock debris, and can be applied to the fields of ecological restoration, sewage treatment, soil restoration and the like.
Drawings
FIG. 1 is a phylogenetic tree of the 16SrRNA sequences of Bacillus bailii B16 strain of example 1 of the present disclosure;
FIG. 2 is a flow chart of a method for enrichment and isolation of Bacillus bailii strain B16 of example 1 of the present disclosure;
FIG. 3 is a graph showing the comparison of the emulsification performance test of Bacillus bailii B16 strain of example 3 of the present disclosure with comparative examples 1 and 2;
FIG. 4 is a graph showing comparative petroleum hydrocarbon degradation performance tests of Bacillus bailii strain B16 of example 4 of the present disclosure and comparative examples 3 and 4;
fig. 5 is a graph showing comparison of the degradation performance test of bacillus belicus B16 strain of example 5 of the present disclosure with the sludge of the control group.
Detailed Description
For the purposes of promoting an understanding of the principles and advantages of the disclosure, reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe the same. It will be apparent that the described embodiments are some, but not all, of the embodiments of the present disclosure.
The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure. The terms "comprises," "comprising," and/or the like, as used herein, specify the presence of stated features, steps, operations, and/or components, but do not preclude the presence or addition of one or more other features, steps, operations, or components.
Similarly, in the foregoing description of exemplary embodiments of the disclosure, various features of the disclosure are sometimes grouped together in a single embodiment, figure, or description thereof for the purpose of streamlining the disclosure and aiding in the understanding of one or more of the various disclosed aspects. The description of the reference to the terms "one embodiment," "some embodiments," "examples," "specific examples," or "some examples," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present disclosure. In this specification, schematic representations of the above terms do not necessarily refer to the same embodiments or examples. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.
In addition, the technical solutions of the embodiments may be combined with each other, but it is necessary to be based on the fact that those skilled in the art can implement the technical solutions, and when the technical solutions are contradictory or cannot be implemented, the combination of the technical solutions should be considered as not existing, and not falling within the protection scope of the present disclosure.
In the process of implementing the disclosed concept, it is found that an important obstacle in the bioremediation process is that the hydrophobicity of hydrocarbons in petroleum is too strong, resulting in lower bioavailability, and thus, even if the proportion of hydrocarbon degrading bacteria is increased, an ideal remediation effect cannot be achieved.
Biosurfactants are complex high molecular compounds which are produced by microorganisms, plants and animals and can obviously change the interface state of a solution, are formed by connecting a polar hydrophilic head part and a nonpolar hydrophobic tail part, and are generally classified into glycolipids, phospholipids, lipoproteins and lipopeptides, polymeric biosurfactants and granular biosurfactants in 5 categories. Researches show that the petroleum hydrocarbon degrading bacteria capable of generating the surfactant have higher degradation capability and better stability. Therefore, the problems of high difficulty, high investment and high energy consumption in petroleum pollution treatment generated in petroleum exploitation, smelting and transportation are to be solved.
In order to solve the technical problems, the disclosure provides bacillus beijerinckii B16 which can grow by taking petroleum as a sole carbon source, can produce a surfactant, has the characteristic of rapid petroleum degradation, and can be widely applied to petroleum degradation. In addition, the strain has the advantages of simple culture method, high concentration of the petroleum hydrocarbon tolerance and wider application range, and can be directly used for treating petroleum polluted water and soil.
According to an embodiment of an aspect of the present disclosure, bacillus beijerinckii B16 is deposited in the general microbiological center of the China general microbiological culture collection center for 11 and 29 days of 2023, with a deposit address of 1 st scholar No. 3, and a deposit number of 29178, wherein a 16SrRNA sequence phylogenetic tree is shown in fig. 1.
According to the embodiment of the disclosure, the bacillus beijerinus B16 strain can grow by taking petroleum as the only carbon source, can produce a surfactant, has the characteristic of rapid petroleum degradation, and can be widely applied to petroleum degradation.
According to an embodiment of another aspect of the present disclosure, there is provided a use of bacillus beijerinus B16 for the production of a surfactant.
According to the embodiment of the disclosure, bacillus beijerinckii B16 can generate a larger amount of surfactant, so that the contact opportunity of the strain and petroleum hydrocarbon is improved when the petroleum hydrocarbon substances are degraded, and the degradation rate and the degradation speed of the strain on the petroleum hydrocarbon are greatly improved.
According to an embodiment of the present disclosure, a method of producing a surfactant includes:
inoculating bacillus belicus B16 into a culture medium for subculture;
centrifuging the strain after passage, and collecting supernatant;
regulating the pH value of the supernatant to 1.8-2.2, and settling to obtain the surfactant.
According to embodiments of the present disclosure, the surfactant may achieve a maximum sedimentation rate at a pH of 1.8 to 2.2, preferably a pH of 2.
According to embodiments of the present disclosure, hydrochloric acid, e.g., 6mol/L hydrochloric acid, may be used to adjust the pH of the supernatant.
According to an embodiment of the present disclosure, the culture medium for subculture may be, for example, an LB liquid medium, the culture temperature may be 30 to 37℃and the culture time may be 1 to 3 days.
According to an embodiment of another aspect of the present disclosure, there is provided an application of bacillus belicus B16 for degrading petroleum hydrocarbon substances.
According to the embodiment of the disclosure, bacillus beijerinus B16 can degrade petroleum hydrocarbon substances with higher efficiency.
Bacillus beijerinckii B16 is used to degrade petroleum hydrocarbons in water and soil according to embodiments of the present disclosure.
According to the embodiment of the disclosure, petroleum hydrocarbon substances mainly exist in water and soil, can pollute the environment, damage an ecological system, and the bacillus bailii B16 is used for restoring the ecological environment, so that the application range is wide.
According to an embodiment of the present disclosure, the petroleum hydrocarbon matter is derived from at least one of petroleum, sludge, used oil, oil-based cuttings.
According to the embodiment of the disclosure, a large amount of waste such as oil sludge, waste engine oil, oil-based rock debris and the like exists in the oil refining industry, most of the waste is discharged into an air, soil and water system to cause ecological environment damage, the bacillus belicus B16 can degrade petroleum hydrocarbon substances in the waste, has high concentration of the resistant petroleum hydrocarbon, can be directly applied to various petroleum hydrocarbon substances, and has a simple use method for repairing the ecological environment.
According to an embodiment of the present disclosure, the operation of degrading petroleum hydrocarbons includes:
inoculating bacillus bailii B16 bacterial suspension into petroleum hydrocarbon substances according to an inoculum size of 5-15% for degradation.
According to the embodiment of the disclosure, bacillus beijerinckii B16 can produce a surfactant, has high petroleum hydrocarbon tolerance concentration, and can achieve the effect of rapidly degrading petroleum hydrocarbon substances with low dosage; the bacillus beijerinckii B16 of the present disclosure may have an inoculation concentration in the range of 5% to 15%, for example, 5%, 7%, 9%, 10%, 11%, 13%, 15%, but is not limited to the values listed, and other values not listed in the range are equally applicable.
According to the embodiment of the disclosure, the concentration of petroleum hydrocarbon in the degraded petroleum hydrocarbon substance is 1-15%.
According to the embodiment of the disclosure, bacillus beijerinus B16 has degradation effect on oil sludge with the petroleum hydrocarbon concentration of 1% -15%, and is generally considered to be high-concentration pollution with the petroleum hydrocarbon concentration of >3%, and has higher toxicity; the strain can effectively degrade high-concentration petroleum hydrocarbon, the degradation rate can reach 60%, and the degradation rate for low-concentration petroleum hydrocarbon (1%) can reach 90%.
According to the embodiment of the disclosure, the temperature of degrading petroleum hydrocarbon by bacillus beijerinckii B16 is 30-37 ℃ and the time is 7-14 days.
According to the embodiment of the disclosure, bacillus beijerinus B16 is rapid in petroleum hydrocarbon degradation reaction, does not need a severe reaction temperature, and is simple and easy to operate.
According to an embodiment of another aspect of the present disclosure, there is provided a method for enriching and separating bacillus beliensis B16, fig. 2 is a flowchart of a method for enriching and separating bacillus beliensis B16 strain according to embodiment 1 of the present disclosure, as shown in fig. 2, the enriching and separating method of the present disclosure includes steps S1 to S4;
in the step S1, the oil sludge is put into an inorganic salt culture medium, petroleum is added as a carbon source, and shake cultivation is carried out;
in the step S2, sucking the culture solution and inoculating the culture solution into a fresh inorganic salt culture medium, and repeating the operation of inoculating to perform enrichment culture;
in step S3, separating the strain obtained by enrichment culture by using a dilution plate coating method;
in step S4, the isolated strain is cultured in a medium to obtain bacillus belicus B16.
According to the embodiment of the disclosure, bacillus beijerinckii B16 is obtained by enrichment culture, artificial domestication, separation and screening of piled sludge from an oilfield oil extraction factory for a period of time, and has the advantages of simple method and large-area industrialized application.
The present disclosure is further illustrated by the following examples, comparative examples and related test experiments. In the following detailed description, for purposes of explanation, numerous specific details are set forth in order to provide a thorough understanding of the embodiments of the present disclosure. It may be evident, however, that one or more embodiments may be practiced without these specific details. Moreover, the details of the various embodiments below may be arbitrarily combined into other viable embodiments without conflict.
The media formulations used in the examples of the present disclosure were as follows:
inorganic salt culture medium: naNO 3 1.5g，(NH 4 ) 2 SO 4 1.5～2g，K 2 HPO 4 1～1.5g，MgSO 4 ·7H 2 0.4-0.7 g of O, 0.3-0.5 g of KCl, 5-8 mL of microelement liquid, 1000mL of distilled water and pH value of 7.0-8.0;
wherein the microelement liquid comprises the following components: znSO (ZnSO) 4 ·7H 2 O 0.4～0.6g，CaCl 2 ·2H 2 O 0.3～0.5g，CuSO 4 ·5H 2 O 0.3～0.5g，MgSO 4 ·7H 2 O 0.3～0.5g，FeSO 4 ·7H 2 0.5-0.6 g of O and 1000mL of distilled water; sterilizing at 121deg.C for 20 min.
Inorganic salt plate medium: 15g of agar was added to the inorganic salt medium, followed by sterilization.
Petroleum screening medium: 10g of petroleum is added on the basis of an inorganic salt culture medium, and then sterilization treatment is carried out.
Lysis broth (lysogeny broth, LB) medium: 10g of tryptone, 5g of yeast extract and 10g of NaCl are dissolved in 1000mL of distilled water, and then sterilized.
LB plate medium: 15g of agar was added to the LB medium, followed by sterilization.
Example 1
Enrichment and isolation of bacillus belicus B16 is shown in figure 2.
Step S1: 5g of old sludge is obtained from piled sludge in an oilfield oil extraction factory, and the obtained sludge is added into a prepared inorganic salt culture medium, wherein the petroleum with the mass concentration of 10000mg/L is used as the sole carbon source. Placing into a shaking table, and culturing at 37deg.C and 180rpm/min for 5-7 days;
step S2: then the culture solution is sucked according to the proportion of 10 percent and inoculated into a fresh inorganic salt culture medium, and the seed enrichment culture is repeated for 4 to 6 times.
Step S3: the culture solution is prepared by adopting a gradient dilution method according to 10 1 、10 2 、10 3 、10 4 、10 5 、10 6 、10 7 Carrying out gradient dilution, respectively carrying out plate coating on culture solutions with different dilution gradients on LB plate culture mediums, placing the culture solutions in a constant temperature incubator, setting the temperature to 37 ℃, culturing for 2-4 days, selecting strains with different colors, different sizes and different colony forms, and carrying out streak separation culture to obtain 3 strains.
Step S4: and 3 strains obtained by screening and purifying in the step S2 are placed into a petroleum culture medium with petroleum as a unique carbon source for culture, and bacteria with the number of B16 are found to grow faster in the culture medium. The strain was subjected to 16S sequencing with 27F sequence: agagttttgatcctggcttag and 1492R sequences: TACGGYTACCTTTGTTACGACTT As a primer, PCR amplification was performed on bacterial 16SrRNA of the number B16, blast analysis was performed on NCBI with the existing sequence, and the sequence of the relevant strain was selected to construct a phylogenetic tree using MEGA7.0 software by Maximum LikelihoodTree method, and as a result, as shown in FIG. 1, it was determined to be Bacillus belicus (Bacillus velezensis), designated Bacillus velezensis B16.
The other 2 strains were identified as Bacillus belicus B4 and Bacillus belicus B6 using a similar method.
Example 2
Bacillus bailii B16 surfactant production method and yield measurement
Inoculating bacillus belicus B16 into LB liquid medium, and culturing at 180rpm and 37 ℃ for 24 hours; then transferring 10ml of the cell suspension to a new enrichment bottle, and culturing for 3 days under the same condition; centrifuging at 10000rpm for 10min, collecting supernatant, adjusting pH of supernatant to 2.0 with 6mol/L hydrochloric acid, settling in refrigerator at 4deg.C overnight, centrifuging at 10000rpm for 10min, and collecting lower precipitate to obtain surfactant.
The collected surfactant was dried in a bench freeze-dryer for at least 24 hours, and the yield of the obtained crude biosurfactant was measured by an electronic balance and found to be 0.46g/L for Bacillus bailii B16 biosurfactant.
Example 3
Bacillus bailii B16 emulsification test
2mL of bacterial liquid supernatant after activation culture is added into a 15mL glass test tube containing 2mL of organic phase (paraffin oil), and the bacterial liquid supernatant is vigorously vibrated for 2min by using an adjustable speed vortex mixer; after 24 hours at room temperature, the height of the emulsion layer and the total liquid height in the test tube are measured by a ruler, and the emulsifying capacity of the surfactant on the organic phase is calculated.
Comparative example 1
Bacillus bailii B4 emulsification test
The experimental method was the same as in example 3 except that Bacillus bailii B4 of the same species was used as the test subject.
Comparative example 2
Bacillus bailii B6 emulsification test
The experimental method was the same as in example 3 except that Bacillus bailii B6 of the same species was used as the test subject.
FIG. 3 is a graph showing the comparison of the emulsification performance test of Bacillus bailii B16 strain of example 3 of the present disclosure with comparative examples 1 and 2.
As can be seen from FIG. 3, the emulsification activity of Bacillus belicus B16 of example 3 can reach 90%, which is significantly higher than that of Bacillus belicus B4 and Bacillus belicus B6 of the same species.
Example 4
Petroleum hydrocarbon degradation performance test of bacillus bailii B16
The Bacillus bailii B16 obtained in example 1 was subjected to expansion culture with LB medium, inoculated into an inorganic salt medium having a petroleum mass concentration of 10000mg/L after 24 hours, placed on a shaking table at 37℃and 180r/min, subjected to shaking culture for 7-14 days, and the residual petroleum hydrocarbon was extracted with n-hexane, and analyzed for the petroleum hydrocarbon degradation performance of Bacillus bailii B16 by a gravimetric method.
Comparative example 3
Petroleum hydrocarbon degradation performance test of bacillus bailii B4
The experimental method was the same as that of example 4 except that Bacillus bailii B4 of the same species was used as the test subject.
Comparative example 4
Petroleum hydrocarbon degradation performance test of bacillus bailii B6
The experimental method was the same as in example 4 except that Bacillus bailii B6 of the same species was used as the test subject.
Fig. 4 is a graph showing the petroleum hydrocarbon degradation performance test of bacillus belicus B16 strain of example 4 and comparative examples 3 and 4 of the present disclosure.
As can be seen from fig. 4, the degradation rate of the total petroleum hydrocarbon of bacillus belicus B16 of example 4 is 96.67%, which is significantly higher than that of bacillus belicus B4 and bacillus belicus B6 of the same species.
Example 5
Testing of sludge degradation performance of bacillus bailii B16
Bacillus beleiensis B16 was inoculated into LB liquid medium, after shaking culture on a shaker at 37℃and 180r/min for 24 hours, bacterial suspension was collected, and inorganic salt medium without bacillus beleiensis was used as control group (CK), and the test was carried out under the same conditions: 5g of a sludge sample (the total petroleum hydrocarbon content of which is 87500 mg/kg) retrieved from the oil extraction area is weighed, bacterial liquid is inoculated into sludge soil according to an inoculum size of 10 percent, namely an experimental group, a control group is not inoculated, and after culturing for 7 days at 37 ℃, residual petroleum hydrocarbon is extracted by using normal hexane.
Fig. 5 is a graph showing comparison of sludge degradation performance tests of bacillus belicus B16 strain of example 5 of the present disclosure with a control group, wherein CK is the control group.
As can be seen from fig. 5, the remaining petroleum hydrocarbons in the experimental group and the blank group were analyzed by a gravimetric method, and after degradation for 7 days, the degradation rate of the total petroleum hydrocarbons was 65.71%.
While the foregoing is directed to embodiments of the present disclosure, other and further details of the invention may be had by the present application, it is to be understood that the foregoing description is merely exemplary of the present disclosure and that no limitations are intended to the scope of the disclosure, except insofar as modifications, equivalents, improvements or modifications may be made without departing from the spirit and principles of the present disclosure.
Claims (10)
1. Bacillus bailii (Bacillus velezensis) B16 is preserved in China general microbiological culture Collection center with a preservation number of CGMCC No.29175.
2. Use of bacillus belgium B16 according to claim 1, wherein the bacillus belgium B16 is used for the production of surfactants.
3. The use of claim 2, wherein the method of generating a surfactant comprises:
inoculating the bacillus belicus B16 into a culture medium for subculture;
centrifuging the strain after passage, and collecting supernatant;
and regulating the pH value of the supernatant to 1.8-2.2, and settling to obtain the surfactant.
4. Use of bacillus beleiensis B16 according to claim 1, wherein said bacillus beleiensis B16 is used for degrading petroleum hydrocarbon substances.
5. The use according to claim 4, wherein the bacillus belicus B16 is used for degrading petroleum hydrocarbon substances in water and soil.
6. The use according to claim 4, wherein the petroleum hydrocarbon is derived from at least one of petroleum, sludge, used oil, oil-based cuttings.
7. The use of claim 4, wherein the degrading petroleum hydrocarbon material comprises:
inoculating the bacillus beijerinckii B16 bacterial suspension into the petroleum hydrocarbon substances for degradation according to an inoculum size of 5% -15%, wherein the inoculum size is preferably 10%.
8. The use according to claim 4, wherein the concentration of petroleum hydrocarbons in the degraded petroleum hydrocarbon is 1% to 15%.
9. The use according to claim 4 or 7, wherein the bacillus belicus B16 degrades petroleum hydrocarbons at a temperature of 30-37 ℃ for a time of 7-14 days.
10. A method of enriching and isolating bacillus belgium B16 according to claim 1, comprising:
putting the oil sludge into an inorganic salt culture medium, adding petroleum as a carbon source, and carrying out shaking culture;
sucking the culture solution of the shake culture and inoculating the culture solution into a fresh inorganic salt culture medium, repeating the operation of inoculating, and carrying out enrichment culture;
separating the strain obtained by enrichment culture by using a dilution plate coating method;
culturing the separated strain in a culture medium to obtain the bacillus bailii B16.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311805822.2A CN117721051A (en) | 2023-12-26 | 2023-12-26 | Bacillus bailii B16 and separation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311805822.2A CN117721051A (en) | 2023-12-26 | 2023-12-26 | Bacillus bailii B16 and separation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117721051A true CN117721051A (en) | 2024-03-19 |
Family
ID=90205201
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311805822.2A Pending CN117721051A (en) | 2023-12-26 | 2023-12-26 | Bacillus bailii B16 and separation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117721051A (en) |
-
2023
- 2023-12-26 CN CN202311805822.2A patent/CN117721051A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5251003B2 (en) | Lubricating oil-decomposing microorganisms and microbial consortium, and method for purification of lubricating oil contaminated soil using them | |
| Burghal et al. | Mycodegradation of crude oil by fungal species isolated from petroleum contaminated soil | |
| CN103981119B (en) | The application of oily sludge petrochina efficient degrading bacteria and bacterium group | |
| CN111748483B (en) | Bacillus for degrading petroleum hydrocarbon and application thereof | |
| CN111187766B (en) | Preparation and application of Polycyclic Aromatic Hydrocarbon (PAHs) degrading microbial inoculum | |
| CN110846257A (en) | Microbial bacterium for degrading long-chain alkane and application thereof | |
| CN114854626B (en) | Pseudomonas strain for degrading polycyclic aromatic hydrocarbon pollutants and application thereof | |
| Nwinyi et al. | Biostimulation of spent engine oil contaminated soil using Ananas comosus and Solanum tuberosum peels | |
| CN108300674B (en) | Petroleum degrading bacteria, obtaining method thereof and application of petroleum degrading bacteria in crude oil degradation | |
| Ke et al. | Biotreatment of oil sludge containing hydrocarbons by Proteus mirabilis SB | |
| Priya et al. | Mass culture strategy for bacterial yeast co-culture for degradation of petroleum hydrocarbons in marine environment | |
| CN109777747B (en) | Oil sludge petroleum degrading strain and culture method and application thereof | |
| CN108102978B (en) | Degradation strain JN8 for petroleum hydrocarbons in oily sludge and application thereof | |
| Baruah et al. | Native hydrocarbonoclastic bacteria and hydrocarbon mineralization processes | |
| CN115449489A (en) | Oil reducing bacteria and composite microbial inoculum thereof, preparation method and application | |
| CN117721051A (en) | Bacillus bailii B16 and separation method and application thereof | |
| CN114107068B (en) | Fungus capable of degrading petroleum hydrocarbon and application of fungus in petroleum degradation | |
| CN109652339B (en) | Crude oil degrading strain and application thereof | |
| Hassanshahian et al. | Degradation of naphthalene by bacterial isolates from the Gol Gohar Mine, Iran | |
| CN112048453B (en) | Thermophilic bacterium for producing biological emulsifier and application thereof | |
| CN113403235B (en) | High-temperature-resistant petroleum hydrocarbon degrading bacteria, degrading bacteria composition, degrading bacteria microbial inoculum and application thereof | |
| TWI518180B (en) | Pseudomonas taoyuanensis s03 isolate having the emulsifying activity and the scavenging ability for benzene and/or naphthalene and uses of the same | |
| Husain et al. | Kinetic study of a bacterial consortium isolated from soil contaminated with crude oil | |
| Babalola et al. | Slurry-phase bioremediation of ogoni land crude oil contaminated soil | |
| CN115125158B (en) | Bacterial strain and microbial inoculum for degrading petroleum hydrocarbon and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |