CN117716040A

CN117716040A - Compositions and methods for inhibiting nerve growth factor and treating/preventing atrial fibrillation

Info

Publication number: CN117716040A
Application number: CN202280053110.7A
Authority: CN
Inventors: R·阿罗拉
Original assignee: NORTHWEST UNIVERSITY
Current assignee: NORTHWEST UNIVERSITY
Priority date: 2021-06-14
Filing date: 2022-06-14
Publication date: 2024-03-15

Abstract

Provided herein are compositions and methods for inhibiting Nerve Growth Factor (NGF) and treating/preventing atrial fibrillation. In particular, inhibitors of NGF expression are administered to myocardial tissue of a subject to treat or prevent atrial fibrillation and/or autonomic nerve sprouting in the atria.

Description

Compositions and methods for inhibiting nerve growth factor and treating/preventing atrial fibrillation

Cross Reference to Related Applications

The present application claims priority from U.S. provisional patent application No. 63/210,338, filed on day 14 6 of 2021, and U.S. provisional patent application No. 63/237,933, filed on day 27 of 8 of 2021, both of which are incorporated herein by reference.

Sequence listing

The text of a computer readable sequence listing of 652 bytes in file size, entitled "39552-601_sequence_list_st25" created at 14, 6, 2022, filed herewith is incorporated by reference in its entirety.

Statement regarding federally sponsored

The present invention was completed with government support under HL140061 awarded by the national institutes of health (National Institutes of Health). The government has certain rights in this invention.

Technical Field

Background

Atrial Fibrillation (AF) is the most common Heart rhythm disorder (Benjamin E J, levy D, vaziri S M, D' boosting R B, belanger AJ, wolf P A. "Independent risk factors for atrial fibrillation in a population-based core.the Framingham Heart Study," JAMA1994;271:840-4; which is incorporated by reference in its entirety), and is the major risk factor for stroke and HF (Balasubramaniam R, kistler P M.AF and "Heart failure: the chicken or the egg. Current strategies for addressing AF, such as electrical ablation, do not address the specific underlying mechanisms of AF (Ben Morrison T, jared Bunch T, gersh B j. "Pathophysiology of concomitant atrial fibrillation and heart failure: implications for management," na.clin.practice.cardioview.med 2009;6:46-56; which is incorporated by reference in its entirety). Accordingly, recent studies have attempted to better define the underlying mechanisms of AF in order to improve the success of ablation and develop new therapies for AF.

Disclosure of Invention

In some embodiments, provided herein are methods of treating and/or preventing Atrial Fibrillation (AF) in a subject comprising administering to the subject an effective amount of a Nerve Growth Factor (NGF) inhibitor. In some embodiments, the subject has AF. In some embodiments, the subject is at elevated risk of AF. In some embodiments, the NGF inhibitor inhibits NGF expression. In some embodiments, the NGF inhibitor comprises a nucleic acid. In some embodiments, administering the nucleic acid comprises administering a vector (e.g., a plasmid, viral vector, non-viral vector, etc.) and/or transgene that encodes the nucleic acid and allows expression of the nucleic acid in a cell of the subject. In some embodiments, administering the nucleic acid comprises directly administering the nucleic acid to the subject. In some embodiments, the NGF inhibitor is administered to myocardial tissue of a subject. In some embodiments, the myocardial tissue comprises atrial or ventricular tissue. In some embodiments, the NGF inhibitor is administered to the left atrial appendage. In some embodiments, the nucleic acid is an antisense RNA, short hairpin RNA (shRNA), short interfering RNA (siRNA), or microrna (miRNA). In some embodiments, the nucleic acid is an NGF shRNA comprising at least 70% (e.g., 70%, 75%, 80%, 85%, 90%, 95%, 100% or a range therebetween) sequence identity to SEQ ID No. 1. In some embodiments, administering the NGF inhibitor comprises injecting the NGF inhibitor into a tissue of the subject. In some embodiments, the injection is performed by needle-free injection. In some embodiments, the injection is performed by microneedle injection. In some embodiments, the method further comprises assessing a parameter of the myocardial tissue (e.g., atrial tissue) status of the subject. In some embodiments, assessing a parameter of the atrial tissue state of the subject comprises monitoring electrophysiological measurements associated with AF or assessing neuroblastogenesis of a region of myocardial tissue prior to and/or after administration of an NGF inhibitor to the subject. In some embodiments, assessing a parameter of the atrial tissue state of the subject comprises monitoring electrophysiological measurements related to AF selected from the group consisting of AF onset, AF duration, AF onset inducibility, effective refractory period, conductivity, and conductivity inhomogeneity index.

In some embodiments, provided herein are compositions (e.g., pharmaceutical compositions) comprising a nucleic acid capable of inhibiting expression of Nerve Growth Factor (NGF). In some embodiments, the nucleic acid is an antisense RNA, short hairpin RNA (shRNA), short interfering RNA (siRNA), or microrna (miRNA). In some embodiments, the nucleic acid is a vector (e.g., plasmid, viral vector, non-viral vector, etc.) or transgene encoding an antisense RNA, short hairpin RNA (shRNA), short interfering RNA (siRNA), or microrna (miRNA). In some embodiments, the nucleic acid is an isolated nucleic acid encoding a small hairpin RNA to NGF mRNA. In some embodiments, NGF shRNA comprises at least 70% (e.g., 70%, 75%, 80%, 85%, 90%, 95%, 100%, or a range therebetween) sequence identity to SEQ ID NO. 1.

In some embodiments, provided herein is a composition (e.g., a pharmaceutical composition) comprising an NGF inhibitor herein for use in treating or preventing AF. In some embodiments, provided herein is a composition (e.g., a pharmaceutical composition) comprising an NGF inhibitor herein for use as a medicament. In some embodiments, provided herein is the use of a composition (e.g., a pharmaceutical composition) comprising an NGF inhibitor herein in the manufacture of a medicament.

Drawings

FIG. 1 targeted injection of NGF shRNA in the left atrial appendage prevented RAP-induced AF.

FIGS. 2A-B targeted injection of NGF shRNA in left and right atria prevented RAP-induced AF beyond (A) 28 day and (B) 12 week intervals.

Definition of the definition

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the embodiments described herein, some preferred methods, compositions, devices, and materials are described herein. Before describing the materials and methods of the present invention, however, it is to be understood that this invention is not limited to the particular molecules, compositions, methods, or protocols described herein as such may vary in accordance with routine experimentation and optimization. It is also to be understood that the terminology used in the present specification is for the purpose of describing only particular versions or embodiments, and is not intended to limit the scope of the embodiments described herein.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. However, in the event of conflict, the present specification, including definitions, will control. Thus, in the context of the embodiments described herein, the following definitions apply.

As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an inhibitor" is a reference to one or more inhibitors known to those skilled in the art, equivalents thereof, and so forth.

As used herein, the term "and/or" includes any and all combinations of the listed items, including any of the individually listed items. For example, "A, B and/or C" includes A, B, C, AB, AC, BC and ABC, each of which is considered to be described by the expression "A, B and/or C" alone.

As used herein, the term "comprising" and its linguistic variations mean the presence of a recited feature, element, method step, etc., without excluding the presence of additional features, elements, method steps, etc. Rather, the term "consisting of … …" and language variations thereof indicates the presence of an enumerated feature, element, method step, or the like, and excludes any non-enumerated feature, element, method step, or the like, except for commonly associated impurities. The phrase "consisting essentially of … …" means that the recited features, elements, method steps, etc., as well as any additional features, elements, method steps, etc., do not materially affect the basic properties of the composition, system, or method. Many embodiments herein are described using the open-ended "comprising" language. Such embodiments encompass a number of closed "consisting of … …" and/or "consisting essentially of … …" embodiments that may alternatively be claimed or described using such language.

As used herein, the term "subject" broadly refers to any animal, including humans and non-human animals (e.g., dogs, cats, cattle, horses, sheep, poultry, fish, crustaceans, etc.). As used herein, the term "patient" generally refers to a subject being treated for a disease or disorder.

As used herein, the term "preventing" refers to a prophylactic step taken to reduce the likelihood that a subject (e.g., a subject at risk) will develop or suffer from a particular disease, disorder, or condition (e.g., AF). The likelihood of developing a disease, disorder or condition in a subject need not be reduced to zero for prophylaxis; conversely, if the step reduces the risk of a disease, disorder, or condition in a population, the step prevents the disease, disorder, or condition in an individual subject within the scope and meaning herein.

As used herein, the term "treatment" or the like refers to obtaining a desired pharmacological and/or physiological effect for a particular disease, disorder or condition. Preferably, the effect is therapeutic, i.e. the effect partially or completely cures a disease/disorder/symptom in a subject suffering from the disease/disorder/symptom.

As used herein, the term "effective amount" refers to an amount of a composition sufficient to achieve a beneficial or desired result. An effective amount may be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or route of administration.

As used herein, the term "administration" refers to the act of administering a drug, prodrug, or other agent or therapeutic treatment to a subject or to cells, tissues and organs in vivo, in vitro, or ex vivo. Exemplary routes of administration to the human body may be by subarachnoid space of the brain or spinal cord (intrathecal), eye (ocular), mouth (oral), skin (topical or transdermal), nose (nasal), lung (inhalant), oral mucosa (buccal), ear, rectum, vagina, by injection (e.g., intravenous, subcutaneous, intratumoral, intraperitoneal, etc.), and the like.

As used herein, the term "co-administration" refers to the administration of at least two agents (e.g., an NGF inhibitor and one or more additional therapeutic agents) or therapies to a subject. In some embodiments, co-administration of two or more agents or therapies is simultaneous (e.g., in a single formulation/composition or in separate formulations/compositions). In other embodiments, the first agent/therapy is administered before the second agent/therapy. Those skilled in the art will appreciate that the formulation and/or the route of administration of the various agents or therapies used may vary. The appropriate dosage for co-administration can be readily determined by one skilled in the art. In some embodiments, when the agents or therapies are co-administered, the respective agents or therapies are administered at lower doses than appropriate for their administration alone. Thus, co-administration is particularly desirable in embodiments where co-administration of an agent or therapy reduces the necessary dose of a potentially harmful (e.g., toxic) agent and/or when co-administration of two or more agents results in a subject being susceptible to the beneficial effect of one of the agents by co-administration of the other agent.

As used herein, the term "pharmaceutical composition" refers to a combination of an active agent and an inert or active carrier, such that the composition is particularly suitable for in vitro, in vivo, or ex vivo diagnostic or therapeutic use.

As used herein, the term "pharmaceutically acceptable" or "pharmacologically acceptable" refers to a composition that does not substantially produce an adverse reaction, such as toxicity, allergy, or immune response, when administered to a subject.

As used herein, the term "pharmaceutically acceptable carrier" refers to any standard pharmaceutical carrier in a pharmaceutical carrier, including, but not limited to, phosphate buffered saline solutions, water, emulsions (e.g., such as oil/water or water/oil emulsions) and various types of wetting agents, any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintegrants (e.g., potato starch or sodium carboxymethyl starch), and the like. The composition may also include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants see, e.g., martin, remington' sPharmaceutical Sciences, 15 th edition, mack publication co., easton, pa. (1975), incorporated herein by reference in its entirety.

As used herein, the term "pharmaceutically acceptable salt" refers to any pharmaceutically acceptable salt (e.g., acid or base) of a compound of the invention that is capable of providing a compound of the invention or an active metabolite or residue thereof upon administration to a subject. As known to those skilled in the art, "salts" of the compounds of the present invention may be derived from inorganic or organic acids and bases. Examples of acids include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, p-toluenesulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, ethanesulfonic acid, formic acid, benzoic acid, malonic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid and the like. Other acids, such as oxalic acid, while not pharmaceutically acceptable per se, are useful in the preparation of salts useful as intermediates in obtaining the compounds of the invention and pharmaceutically acceptable acid addition salts thereof.

As used herein, the term "instructions for administering the compound to a subject" and grammatical equivalents thereof includes instructions for using the compositions contained in the kit to treat a disorder (e.g., a decision tree provided to a drug, route of administration, treating physician for correlating patient-specific characteristics with course of treatment).

As used herein, the term "operably linked" refers to the association of nucleic acid sequences on a polynucleotide such that the function of one of the sequences is affected by the other. For example, a regulatory DNA sequence is said to be "operably linked" to a DNA sequence encoding an RNA ("RNA coding sequence" or "shRNA coding sequence") or polypeptide if the two sequences are positioned such that the regulatory DNA sequence affects the expression of the coding DNA sequence (i.e., the coding sequence or functional RNA is under the transcriptional control of a promoter). The coding sequence may be operably linked to the regulatory sequence in a sense or antisense orientation. RNA coding sequences refer to nucleic acids that can be used as templates for synthesizing RNA molecules, such as shRNA. Preferably, the RNA coding region is a DNA sequence.

As used herein, the term "promoter" refers to a nucleotide sequence generally upstream (5') of its coding sequence that directs and/or controls expression of the coding sequence by providing for the recognition of RNA polymerase and other factors required for proper transcription. "promoter" includes the smallest promoter, which is a short DNA sequence consisting of a TATA-box and other sequences specifying the transcription initiation site, to which regulatory elements are added to control expression. "promoter" also refers to a nucleotide sequence that includes the smallest promoter plus regulatory elements capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter commonly referred to as enhancers. Thus, an "enhancer" is a DNA sequence that stimulates promoter activity and may be a natural element of a promoter or a heterologous element inserted to enhance promoter level or tissue specificity. It can operate in two orientations (sense or antisense) and can function even when the promoter moves upstream or downstream. Enhancers and other upstream promoter elements both bind to sequence-specific DNA-binding proteins that mediate their actions. Promoters may be derived entirely from the natural gene, or be composed of different elements derived from different promoters found in nature, or even be composed of synthetic DNA fragments. Promoters may also contain DNA sequences involved in the binding of protein factors that control the effectiveness of transcription initiation in response to physiological or developmental conditions. Any promoter known in the art that modulates expression of shRNA or RNA coding sequences is envisioned in the practice of the present invention.

As used herein, the term "reporter element" or "marker" refers to a polynucleotide encoding a polypeptide that can be detected in a screening assay. Examples of polypeptides encoded by reporter elements include, but are not limited to, lacZ, GFP, luciferase, and chloramphenicol acetyl transferase. See, for example, U.S. patent No. 7,416,849. Many reporter elements and marker genes are known in the art and are contemplated for use in the invention disclosed herein.

As used herein, the term "RNA transcript" refers to a product resulting from transcription of a DNA sequence catalyzed by an RNA polymerase. "messenger RNA transcript (mRNA)" refers to RNA that does not contain introns and can be translated into protein by a cell.

As used herein, the term "shRNA" (small hairpin RNA) refers to an RNA duplex in which a portion of the RNA is part of a hairpin structure (shRNA). In addition to the duplex portion, the hairpin structure may contain a loop portion located between the two sequences forming the duplex. The length of the loop may vary. In some embodiments, the loop is 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides in length. The hairpin structure may also contain a 3 'or 5' overhang portion. In some aspects, the overhang is a 3 'or 5' overhang of 0, 1, 2, 3, 4, or 5 nucleotides in length. In one aspect of the invention, the nucleotide sequence in the vector is used as a template for expression of a small hairpin RNA comprising a sense region, a loop region and an antisense region. Upon expression, the sense and antisense regions form a duplex. It is this shRNA-forming duplex that hybridizes to, for example, NGF mRNA and reduces NGF expression, reduces nerve sprouting and/or treats and/or prevents AF.

As used herein, the term "knockdown" or "knockdown technique" refers to a gene silencing technique in which the expression of a target gene or gene of interest is reduced as compared to the expression of the gene prior to the introduction of siRNA, which can result in the inhibition of the production of the target gene product. "double knockdown" is a knock down of two genes. The term "reduced" as used herein means that the target gene expression is reduced by 0.1 to 100%. For example, the expression may be reduced by 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or even 99%. The expression may be reduced by a reduction (%) in these intervals, for example, 2-4, 11-14, 16-19, 21-24, 26-29, 31-34, 36-39, 41-44, 46-49, 51-54, 56-59, 61-64, 66-69, 71-74, 76-79, 81-84, 86-89, 91-94, 96, 97, 98 or 99. Knock-down of gene expression may be guided by the use of shRNA.

As used herein, the term "vector" refers to any viral or non-viral vector, as well as any plasmid, cosmid, phage, or binary vector in double-stranded or single-stranded linear or circular form, which may or may not be self-transmissible or mobile, and which may be transformed into a prokaryotic or eukaryotic host cell by integration into the cell genome or may exist extrachromosomally (e.g., an autonomously replicating plasmid with an origin of replication). Any carrier known in the art may be used in the practice of the invention.

Detailed Description

Embodiments herein provide compositions and methods for inhibiting NGF expression and/or activity in a subject suffering from atrial fibrillation. Certain embodiments include inhibiting expression of NGF to reduce/inhibit/prevent autonomic nerve sprouting in the atria. During development of embodiments herein, experiments were performed with small hairpin RNA (NGF shRNA) directed against NGF mRNA using RNA interference (RNAi) based NGF inhibitors. Pharmaceutical compositions based on NGF shRNA inhibit expression of NGF genes, resulting in a lower incidence of AF. The principles of NGF inhibition for treating AF can be readily extended from the exemplary NGF shRNA demonstrated herein to other NGF inhibitors without undue experimentation. Details of the pharmaceutical compositions and methods are presented in greater detail in this disclosure.

In one aspect, a pharmaceutical composition for treating/preventing atrial fibrillation is provided. In some embodiments, the pharmaceutical composition comprises a small hairpin RNA (shRNA) directed against an NGF gene ("NGF shRNA"). The shRNA may be a single-molecule RNA that includes a sense sequence, a loop region, and an antisense sequence (sometimes referred to as a first region and a second region), which together form a hairpin loop structure. Preferably, the antisense and sense sequences are substantially complementary to each other (about 80% complementary or more), wherein in certain embodiments the antisense and sense sequences are 100% complementary to each other. In certain embodiments, the antisense and sense sequences are too short to be processed by Dicer, and thus act through alternative pathways of longer double stranded RNAs (e.g., shrnas, such as sshrnas, having antisense and sense sequences of about 16 to about 22 nucleotides in length (e.g., between 18 and 19 nucleotides in length). In addition, the antisense and sense sequences within a single molecule RNA of the invention may be the same length, or may differ in length by less than about 9 bases. The loop may be any length, preferably a length of 0 to 4 nucleotides or an equivalent length of a non-nucleotide linker, and more preferably an equivalent length of 2 nucleotides or a non-nucleotide linker (e.g., a non-nucleotide loop has a length equal to 2 nucleotides). In one embodiment, the ring is: 5'-UU-3' (rUrU) or 5'-tt-3', wherein "t" represents deoxythymidine (dTdT). Within any shRNA hairpin, the multiple nucleotides are ribonucleotides. In the case of a zero nucleotide loop, the antisense sequence is directly linked to the sense sequence, with a portion of one or both strands forming a loop. In a preferred embodiment of the zero nt circular shRNA, the antisense sequence is about 18 or 19nt and the sense sequence is shorter than the antisense sequence, so that one end of the antisense sequence forms a loop.

The hairpins of a representative shRNA can be organized into left-hand (L) hairpins (i.e., 5 '-antisense-loop-sense-3') or right-hand (R) hairpins (i.e., 5 '-sense-loop-antisense-3'). In addition, shRNA may also contain overhangs at the 5 'or 3' end of the sense or antisense sequence, depending on the organization of the hairpin. Preferably, if any, they are located at the 3' end of the hairpin and comprise 1 to 6 bases. The R-type hairpin preferably has an overhang, in which case a 2-nt overhang is preferred, and a UU or tt overhang is most preferred.

Modifications may be added to enhance the stability, functionality, and/or specificity of the shRNA and to minimize immunostimulatory properties. For example, the overhang may be unmodified, or may comprise one or more specific or stable modifications (such as halogen or O-alkyl modifications at the 2' position) or internucleotide modifications (such as phosphorothioate modifications). The overhangs may be ribonucleic acids, deoxyribonucleic acids, or a combination of ribonucleic acids and deoxyribonucleic acids.

In another non-limiting example of modifications that can be applied to a left-handed hairpin, 2' -O-methyl modifications (or other 2' -O-alkyl modifications, including but not limited to other 2' -O-alkyl modifications) can be added to the nucleotides at positions 15, 17, or 19 from the 5' antisense end of the hairpin, or any two or all three of these positions, as well as to each other nucleotide of the loop nucleotide and sense sequence (also referred to as nucleotide 9, 10, and 11) except from the 5' most nucleotide of the sense sequence, which should not have modifications that prevent "slice" activity. Any single modification or group of modifications described in the preceding sentence may be used alone or in combination with any other modification or group of modifications cited.

Ui-Tei, K.et al (nucleic acids Res. (2008) 36 (22): 7100-7109; incorporated by reference in its entirety) have observed that the specificity of siRNA can be increased by modifying the seed region of one or both strands. Such modifications are applicable to shRNA of the present disclosure. In another non-limiting example of modifications that can be applied to hairpins, nt 1-6 of the antisense sequence and nt 14-19 of the sense sequence can be 2' -O-methylated to reduce off-target effects. In a preferred embodiment, only nt 1-6 is modified from 2' -OH to 2' -H or 2' -O-alkyl.

Since the sense sequence of shRNA may enter RISC and compete with the antisense (targeting) strand, modifications that prevent phosphorylation of the sense sequence are valuable to minimize off-target features. Thus, desirable chemical modifications that prevent 5 'carbophosphorylation of the 5' most nucleotide of the right-hand shRNA of the invention may include, but are not limited to, the following modifications: (1) Adding a blocking group (e.g., 5 '-O-alkyl) to the 5' carbon; or (2) removal of a 5 '-hydroxy group (e.g., a 5' -deoxynucleotide) (see, e.g., WO 2005/078094; incorporated by reference in its entirety).

In addition to the modifications that enhance specificity, modifications that enhance stability may also be added. In some embodiments, modifications comprising 2 '-O-alkyl groups (or other 2' modifications) may be added to one or more, preferably all, of the pyrimidines (e.g., C and/or U nucleotides) of the sense sequence. Modifications (such as 2'f or 2' -O-alkyl of some or all of the C and U, respectively, of the sense sequence/region) or loop structures can enhance the stability of shRNA molecules without significantly altering target-specific silencing. It should be noted that while these modifications enhance stability, it may be desirable to avoid adding these modification modes to critical positions in the hairpin to avoid disrupting RNAi (e.g., interfering with "slice" activity).

In some embodiments of the invention, additional stabilizing modifications to the phosphate backbone may be included in the shRNA. For example, at least one phosphorothioate, phosphorodithioate, and/or methylphosphonate may be substituted for the phosphate groups at some or all 3' positions of nucleotides in the shRNA backbone or at any particular subset of nucleotides (e.g., any or all pyrimidines in the sense sequence of the oligonucleotide backbone), as well as any overhangs and/or phosphate groups in the loop structure present. These modifications may be used alone or in combination with other modifications disclosed herein.

Descriptions of modified shRNA of interest can be found in the following references (both of which are incorporated herein by reference in their entirety): Q.Ge, H.Eves, A.Dallas, P.Kumar, J.Shorenstein, S.A.Kazakov and B.H.Johnston (2010) minimum-length short hairpin RNAs: the Relationship of Structure and RNAi Activity.RNA 16 (1): 106-17 (12 months 1 th electronic edition 2009); and Q.Ge, A.Dallas, H.Ilves, J.Shorenstein, M.A.Behlke and B.H.Johnston (2010) Effects of Chemical Modification on the Potency, serum Stability, and Immunostimulatory Properties of Short shRNAs. RNA 16 (1): 118-30 (2009 11, 30 electronic edition).

Modified shRNA according to aspects of the invention may include additional chemical modifications for any of a variety of purposes, including 3' cap structures (e.g., inverted deoxythymidine), detectable labels conjugated to one or more positions in the shRNA (e.g., fluorescent labels, mass labels, radiolabels, etc.), or other conjugates (e.g., amino acids, peptides, proteins, sugars, carbohydrates, lipids, polymers, nucleotides, polynucleotides, etc.) that may enhance delivery, detection, function, specificity, or stability. The user may employ additional combinations of chemical modifications as desired.

Suitable NGF shRNA include those nucleic acids from about 20 nucleotides to about 80 nucleotides in length, with a portion of the nucleic acids having a double-stranded domain from about 15 nucleotides to about 25 nucleotides in length. In some aspects, the shRNA may include modified base or phosphodiester backbones to impart stability to tissue and intracellular shRNA. An exemplary NGF shRNA comprises SEQ ID NO. 1. In some embodiments, any shRNA capable of inhibiting NGF expression may be used in the compositions and methods herein. In certain embodiments, NGF shRNA having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions or deletions relative to SEQ ID No. 1 is provided.

As is generally known in the art, commonly used oligonucleotides are oligomers or polymers of ribonucleic acids or deoxyribonucleic acids having naturally occurring combinations of covalent bonds between purine and pyrimidine bases, sugars and nucleosides, including phosphate groups in phosphodiester linkages. However, it should be noted that the term "oligonucleotide" also encompasses various non-naturally occurring mimics and derivatives, i.e., modified forms, of naturally occurring oligonucleotides as described herein.

The shRNA molecules of the invention may be prepared by any method known in the art for synthesizing DNA and RNA molecules. These include techniques well known in the art for chemically synthesizing oligodeoxy-ribonucleotides and oligoribonucleotides, such as solid phase phosphoramidite chemical synthesis. Alternatively, the RNA molecule may be produced by in vitro and in vivo transcription of a DNA sequence encoding an antisense RNA molecule. Such DNA sequences may be incorporated into a variety of vectors incorporating a suitable RNA polymerase promoter, such as the T7 or SP6 polymerase promoters. Alternatively, depending on the promoter used, antisense cDNA constructs which synthesize antisense RNA constitutively or inductively can be stably introduced into the cell line.

shRNA molecules can be chemically synthesized using appropriately protected ribonucleoside phosphoramidites and conventional DNA/RNA synthesizers. Custom shRNA synthesis services are available from commercial suppliers such as Ambion (Austin, tex., USA) and Dharmacon Research (Lafayette, colo., USA).

Various well-known modifications to DNA molecules can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include, but are not limited to, adding flanking sequences of ribose or deoxyribonucleotide at the 5' and/or 3' end of the molecule, or using phosphorothioate or 2' O-methyl instead of phosphodiesterase linkages within the oligodeoxyribonucleotide backbone. The antisense nucleic acids of the invention can be constructed using chemical synthesis or enzymatic ligation reactions using methods known in the art. Antisense oligonucleotides can be synthesized using naturally occurring nucleotides or various modified nucleotides designed to increase the biostability of the molecule or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids (e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used).

The shRNA molecules herein may be various modified equivalents of any NGF shRNA structure. "modified equivalent" refers to a modified form of a particular shRNA molecule that has the same target specificity (i.e., recognizes the same mRNA molecule that is complementary to the particular unmodified shRNA molecule). Thus, the modified equivalent of the unmodified shRNA molecule may have modified ribonucleotides, i.e., modified ribonucleotides contained in the chemical structure of the unmodified nucleotide base, sugar, and/or phosphate (or phosphodiester bond).

In some embodiments, the modified shRNA molecules contain modified backbones or non-natural internucleoside linkages, e.g., modified phosphorus-containing backbones and non-phosphorus-containing backbones, such as morpholino backbones; siloxane, sulfide, sulfoxide, sulfone, sulfonate, sulfonamide, and sulfamate backbones; formylacetyl and thiocarboxyacetyl backbones; an olefin-containing backbone; methylene imino and methylene hydrazino backbones; amide backbones, and the like.

Examples of modified phosphorus-containing backbones include, but are not limited to, phosphorothioates, phosphorodithioates, chiral phosphorothioates, phosphotriesters, aminoalkyl phosphotriesters, alkylphosphonates, thioalkyl phosphonates, phosphinates, phosphoramidates, phosphorothioate amidites, thioalkyl phosphotriesters, and boro-phosphates, and various salt forms thereof. Examples of such non-phosphorus containing backbones are known in the art, such as U.S. patent No. 5,677,439, each of which is incorporated herein by reference.

Modified forms of shRNA compounds may also contain modified nucleosides (nucleoside analogues), i.e., modified purine or pyrimidine bases, such as 5-substituted pyrimidine, 6-azapyrimidine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4, 6-trimethoxybenzene, 3-methyluracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidine (e.g., 5-methylcytidine), 5-alkyluridine (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine), or 6-azapyrimidine or 6-alkylpyrimidine (e.g., 6-methyluridine), 2-thiouridine, 4-thiouridine, 5- (carboxymethyl) uridine, 5' -carboxymethyl aminomethyl-2-thiouridine, 5-carboxymethyl aminomethyluridine, 5-methoxyiminomethyl-2-thiouridine, 5-methylaminomethyl uridine, 5-methylcarbonylmethyluridine, 5-methoxyuridine, 5-methyl-2-thiouridine, 4-acetylcytidine, 3-methylcytidine, propyne, pigtail, huai Dinggan (wybutosine), wybutoxosine, beta-D-galactosyl-glycoside, N-2, N-6 and O-substituted purines, inosine, 1-methyladenosine, 1-methylainosine, 2-dimethylguanosine, 2-methyladenosine, 2-methylguanosine, propine, pigtail, N6-methyladenosine, 7-methylguanosine, 2-methylthio-N-6-isopentenyl adenosine, beta-D-mannosyl pigtail, uridine-5-oxyacetic acid, 2-thiocytidine, threonine derivatives, and the like. In addition, the modified shRNA compounds may also have substituted or modified sugar moieties, such as 2' -O-methoxyethyl sugar moieties.

Preferably, the 3' overhangs of the shRNA of the invention are modified to provide resistance to cellular nucleases. In one embodiment, the 3 'overhang comprises 2' -deoxyribonucleotides.

In some embodiments, provided herein are shRNA compounds that target different sites of mRNA corresponding to NGF. In addition, to help design shRNA for effective RNA interference (RNAi) -mediated silencing of any target gene, several shRNA supply companies maintain network-based design tools that take advantage of these general guidelines for "picking" shRNA when presented with mRNA or coding DNA sequences of the target gene. Examples of such tools can be found on websites of Dharmacon, inc (Lafayette, colo.), ambion, inc. (Austin, tex.). For example, selecting shRNA involves selecting unique sites/sequences of the target gene (i.e., sequences that do not have significant homology to genes other than the targeted gene) such that other genes are not inadvertently targeted by the same shRNA designed for this particular target sequence.

Another criterion to be considered is whether the target sequence includes known polymorphic sites. If so, shRNA designed to target one particular allele may not be able to target another allele effectively because single base mismatches between the target sequence and its complementary strand in a given shRNA greatly reduce the effectiveness of RNAi induced by the shRNA. Given the target sequence and such design tools and design criteria, one of ordinary skill in the present disclosure should be able to design and synthesize additional sihRNA compounds that can be used to reduce mRNA levels of NGF.

In some embodiments, the invention provides compositions of a polymer or excipient and one or more carriers encoding one or more shRNA molecules. The carrier may be formulated with a suitable carrier into a pharmaceutical composition and administered to the mammal using any suitable route of administration. Because of this accuracy, side effects typically associated with conventional drugs can be reduced or eliminated. In addition, shrnas are relatively stable, and like antisense, they can also be modified to achieve improved drug characteristics, such as increased stability, delivery capability, and ease of manufacture. Furthermore, shRNA molecules are highly effective in destroying target mRNA molecules because they utilize the natural cellular pathway, i.e., RNA interference. As a result, a therapeutically effective concentration of shRNA compound is relatively easy to obtain in a subject.

shRNA compounds may be administered to mammals via different routes by a variety of methods. They may also be delivered directly to a particular organ or tissue by any suitable topical application method, such as injection directly into the target tissue. In some embodiments, shRNA compounds are electroporated into cells after direct injection into the target tissue. Alternatively, they may be delivered encapsulated in liposomes by iontophoresis or by incorporation into other carriers such as hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres.

In vivo inhibition of expression of specific genes by intravenous injection of RNAi has been achieved in organisms including mammals. See, e.g., song E. Et al, "RNA interference targeting Fas protects mice from fulminant hepatitis," Nature Medicine,9:347-351 (2003); which is incorporated by reference in its entirety. One route of administration of the shRNA molecules of the invention involves injecting the vector directly into the desired tissue site, such as into diseased or non-diseased heart tissue, into fibrillated heart tissue, such as fibrillated PLA tissue. However, NGF shRNA or expression vectors encoding NGF shRNA are typically injected directly into myocardial tissue (e.g., atrial tissue) to effectively knock down NGF protein expression, inhibit nerve growth, and/or reduce or completely eliminate the presence of AF in a subject.

In some embodiments, one or more vectors comprising one or more shrnas of the invention are re-administered at any time interval after the first administration or at multiple time intervals after the first administration.

In some embodiments, the nucleic acid encoding the shRNA is formulated in a pharmaceutical composition prepared according to conventional pharmaceutical compounding techniques. See, e.g., remington' sPharmaceutical Sciences, 18 th edition (1990,Mack Publishing Co., easton, pa.). The pharmaceutical compositions of the invention comprise a therapeutically effective amount of a vector encoding an shRNA. In addition to the carrier, these compositions may contain pharmaceutically acceptable excipients, carriers, buffers, stabilizers, or other materials well known in the art. These substances should be non-toxic and should not interfere with the efficacy of the active ingredient. The carrier may take a variety of forms depending on the form of formulation desired for administration, such as intravenous, oral, intramuscular, subcutaneous, intrathecal, epidural or parenteral.

When the carriers of the present invention are prepared for administration, they may be combined with pharmaceutically acceptable carriers, diluents or excipients to form pharmaceutical formulations or unit dosage forms. The total active ingredient in these formulations comprises from 0.1% to 99.9% by weight of the formulation.

In some embodiments, the vector is suitably formulated and introduced into the cellular environment by any means that allows a sufficient portion of the sample to enter the cell to induce gene silencing, if any. Many formulations of the vector are known in the art and may be used as long as the vector enters the target cell so that it can function. For example, the carrier may be formulated in a buffer, such as a phosphate buffered saline solution comprising liposomes, micelle structures, and capsids. The pharmaceutical formulations of the carriers of the present invention may also take the form of aqueous or anhydrous solutions or dispersions, or alternatively, in the form of emulsions or suspensions. Pharmaceutical formulations of the carriers of the invention may include as optional ingredients solubilizers or emulsifiers, as well as salts of the type well known in the art. Specific non-limiting examples of carriers and/or diluents that can be used in the pharmaceutical formulations of the present invention include water and physiologically acceptable saline solutions. Other pharmaceutically acceptable carriers for preparing the composition for administration to an individual include, for example, solvents or vehicles such as glycols, glycerol, or injectable organic esters. The pharmaceutically acceptable carrier may contain a physiologically acceptable compound which acts, for example, to stabilize or increase the uptake of the shRNA encoding vector. Other physiologically acceptable carriers include, for example, carbohydrates such as glucose, sucrose, or dextran; antioxidants such as ascorbic acid or glutathione; a chelating agent; low molecular weight proteins or other stabilizers or excipients; brine; dextrose solution; fructose solution; ethanol; or oils of animal, vegetable or synthetic origin. The carrier may also contain other ingredients, such as preservatives.

It will be appreciated that the choice of pharmaceutically acceptable carrier (including physiologically acceptable compounds) depends on, for example, the route of administration of the composition. The carrier-containing composition may also contain a second agent, such as a diagnostic agent, a nutrient, a toxin, or another therapeutic agent. Many agents useful in the treatment of heart disease are known in the art and are contemplated for use in combination with the vectors of the present invention.

Vector formulations with cationic lipids can be used to facilitate transfection of the vector into cells. For example, cationic lipids (such as liposomes), cationic glycerol derivatives, and polycationic molecules (such as polylysine) can be used. Suitable lipids include, for example, oligofectamine and Lipofectamine (Life Technologies), which can be used according to the manufacturer's instructions.

In some embodiments, suitable amounts of carrier are introduced and these amounts may be determined empirically using standard methods. Typically, the effective concentration of the individual carrier species in the cellular environment is about 50 nanomolar or less, 10 nanomolar or less, or a composition having a concentration of about 1 nanomolar or less may be used. In other aspects, the methods use a concentration of about 200 picomoles or less, even in many cases about 50 picomoles or less. The effective concentration of any particular mammalian subject can be determined by one of skill in the art using standard methods.

In some embodiments, the shRNA is administered in a therapeutically effective amount. The actual amount administered, as well as the rate and time course of administration, will depend on the nature and severity of the condition, disease or disorder being treated. The prescription of treatment (e.g., decisions on dosage, time, etc.) is within the responsibility of the average physician or specialist and generally takes into account the condition, disorder or disease to be treated, the disorder of the individual mammalian subject, the site of delivery, the method of administration, and other factors known to the physician. Examples of techniques and protocols can be found in Remington's Pharmaceutical Sciences, 18 th edition (1990,Mack Publishing Co., easton, pa.).

Alternatively, targeted therapies can be used to more specifically deliver shRNA-encoding vectors to certain types of cells through the use of targeting systems (such as antibodies or cell-specific ligands). Targeting may be desirable for a variety of reasons, for example if the toxicity of the agent is unacceptable, or if it requires too high a dose, or if it cannot enter the target cell.

In some embodiments, shRNA is delivered into mammalian cells, particularly human cells, by gene therapy methods using DNA vectors from which shRNA compounds, such as small hairpin forms (shRNA), can be transcribed directly. Recent studies have demonstrated that although double stranded shrnas are very effective in mediating RNAi, short single stranded hairpin RNAs can also mediate RNAi, probably because they fold into intramolecular duplex that is processed into double stranded shRNA by cellular enzymes. This finding is significant and profound in that the generation of such shRNA can be readily achieved in vivo by transfecting cells or tissues with DNA vectors carrying short inverted repeats separated by small (e.g., 3, 4, 5, 6, 7, 8, 9) nucleotides that direct transcription of such small hairpin RNAs. Alternatively, RNAi caused by the encoded shRNA may be stable and heritable if a mechanism is included that directs integration of the vector or vector fragment into the host cell genome or ensures stability of the transcribed vector. These techniques have been used not only to "knock down" expression of specific genes in mammalian cells, but they have now been successfully used to knock down exogenously expressed transgenes as well as expression of endogenous genes in the brain and liver of living mice.

Gene therapy is performed according to generally accepted methods known in the art. See, for example, U.S. patent nos. 5,837,492 and 5,800,998 and references cited therein; which is incorporated by reference in its entirety. Vectors in gene therapy include those polynucleotide sequences that contain sequences sufficient to express the encoding polynucleotides. If the polynucleotide encodes an shRNA, expression will result in an antisense polynucleotide sequence. Thus, herein, the expression does not require a synthetic protein product. In addition to the shRNA encoded in the vector, the vector also contains a promoter functional in eukaryotic cells. The shRNA sequence is under the control of this promoter. Suitable eukaryotic promoters include those described elsewhere herein and known in the art. Expression vectors may also include sequences such as selectable markers, reporter genes, and other regulatory sequences conventionally used.

Thus, the amount of shRNA produced in situ is regulated by controlling factors such as the nature of the promoter used to direct transcription of the nucleic acid sequence (i.e., whether the promoter is constitutive or regulatable, strong or weak) and the copy number of the nucleic acid sequence encoding the shRNA sequence in the cell. Exemplary promoters include promoters recognized by pol I, pol II, and pol III. In some aspects, the preferred promoter is a pol III promoter, such as a U6 pol III promoter.

In some embodiments, provided herein are kits for inhibiting expression of a target gene in a cell, the kits comprising a chemically modified shRNA as described herein. "kit" refers to any system of delivery materials or reagents for performing the methods of the invention. In the case of a reaction assay, such delivery systems include systems that allow for storage, transport, or delivery of the reaction reagents (e.g., chemically modified shRNA in a suitable container, culture medium, etc.) and/or support materials (e.g., buffers, written instructions for performing the assay, etc.) from one location to another. For example, a kit includes one or more housings (e.g., a cassette) containing the relevant reagents and/or support materials. These contents may be delivered to the intended recipient together or separately. For example, a first container may contain chemically modified shRNA for use in an assay, while a second container contains a media RNA delivery agent (e.g., a transfection reagent).

As described above, the subject kits may further comprise instructions for performing the subject methods using the kit components. The instructions for practicing the subject methods are typically recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, or the like. Thus, the instructions may be present in the kit as a package insert, in a label of the kit container or a component thereof (i.e., associated with the package or sub-package), and the like. In other embodiments, the instructions exist as electronically stored data files residing on suitable computer readable storage media. In other embodiments, the actual instructions are not present in the kit, but means are provided for obtaining the instructions from a remote source (e.g., via the internet). Examples of such an embodiment are kits comprising a website in which the instructions can be viewed and/or from which the instructions can be downloaded. As with the description, this means for obtaining the description is recorded on a suitable substrate.

In addition to the subject databases, programs, and instructions, the kits may also include one or more control reagents, such as non-chemically modified shRNA.

The pharmaceutical compositions described herein have therapeutic efficacy in the treatment/prevention of AF. Pharmaceutical compositions comprising NGF shRNA have demonstrated activity in a human AF canine model accepted in the art. The results of NGF shRNA studies demonstrate the feasibility of a general strategy for inhibiting NGF activity or expression using NGF inhibitors to treat/prevent AF. Such inhibitors include oligonucleotide-based compounds that target NGF mRNA or protein, such as RNAi molecules, antisense RNAs, shRNA, etc., directed against NGF mRNA, as well as oligonucleotide-based aptamers directed against NGF polypeptides. In addition, small molecule organic compounds, peptides, antibodies or other agents that have anti-NGF activity by functionally specifically binding to or otherwise interfering with NGF protein functionality may also be used to treat and/or prevent AF. The embodiments described above with respect to administration, formulation, administration and use of NGF shRNA also find use with other agents in inhibiting NGF activity or expression.

In some embodiments, the NGF inhibitor comprises any suitable biologically active molecule (e.g., a molecule capable of inhibiting NGF function). In some embodiments, MGF inhibitors include macromolecules, polymers, molecular complexes, proteins, peptides, polypeptides, nucleic acids, carbohydrates, small molecules, and the like.

In some embodiments, the NGF inhibitor is an NGF inhibitory peptide. In some embodiments, the invention provides peptides of any suitable amino acid sequence capable of inhibiting one or more alleles of NGF. In some embodiments, the peptides provided or encoded by the compositions of embodiments of the invention can comprise any permutation of any standard amino acid (e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine) or non-standard amino acid (e.g., D-amino acids, chemically or biologically produced derivatives of common amino acids, selenocysteine, pyrrolysine, lanthionine, 2-aminoisobutyric acid, dehydroalanine, etc.). In some embodiments, the NGF inhibitory peptide is an inhibitor of NGF.

In some embodiments, the NGF inhibitory peptide is provided to the subject as an isolated or purified peptide. In some embodiments, NGF inhibitory peptides are provided to a subject as nucleic acid molecules encoding these peptides. In some embodiments, the peptides are optimized to enhance cell penetration (e.g., sequence optimization, sequence tags, labeling with small molecules, etc.).

In some embodiments, the NGF inhibitor is provided by an isolated nucleic acid comprising a minigene, wherein the minigene encodes a modified NGF peptide, wherein the peptide blocks the interaction site between NGF and an NGF binding partner in a cell (such as a human cell). In addition, the minigene may further comprise one or more of a promoter, a ribosome binding site, a translation initiation codon and a translation termination codon.

In some embodiments, the NGF inhibitor is provided as an isolated or purified polypeptide.

In some embodiments, the invention provides methods of inhibiting NGF-mediated signaling events in a cell or tissue. These methods comprise administering to a cell or tissue, preferably a human cell or tissue, one of a modified NGF peptide and an isolated nucleic acid comprising a minigene encoding the modified NGF peptide, whereby upon administration the NGF peptide inhibits an NGF-mediated signaling event in the cell or tissue.

In some embodiments, the NGF inhibitor comprises a small molecule. In some embodiments, the invention provides small molecule inhibitors of NGF. In some embodiments, the invention provides a small molecule drug or drug compound configured or capable of inhibiting NGF activity, functional expression, and the like.

In some embodiments, the invention provides RNAi molecules (e.g., RNAi molecules that alter NGF expression) as NGF inhibitors. In some embodiments, the invention targets expression of NGF genes using nucleic acid-based therapies. For example, in some embodiments, the invention uses a composition comprising an oligomeric antisense or RNAi compound, particularly an oligonucleotide, for modulating the function of a nucleic acid molecule encoding an NGF gene, ultimately modulating the amount of NGF protein expressed. In some embodiments, RNAi is used to inhibit NGF gene function. RNAi represents an evolutionarily conserved cellular defense that is used to control the expression of foreign genes in most eukaryotic organisms, including humans. RNAi is typically triggered by double stranded RNA (dsRNA) and causes sequence-specific mRNA degradation of homologous single stranded target RNA in response to the dsRNA. The mediators of mRNA degradation are small interfering RNA duplex (siRNA), which are typically produced from long dsRNA by enzymatic cleavage in cells. siRNA is typically about twenty one nucleotides in length (e.g., 21-23 nucleotides in length) and has a base pairing structure characterized by a 3' overhang of two nucleotides. After introduction of the small RNAs or RNAi into the cell, the sequence is believed to be delivered to an enzyme complex called RISC (RNA-induced silencing complex). RISC recognizes the target and cleaves it with an endonuclease. Notably, if a larger RNA sequence is delivered to a cell, the RNAse III enzyme (Dicer) will convert the longer dsRNA into a 21-23nt ds siRNA fragment. In some embodiments, the siRNA is a double stranded RNA molecule that is 18 to 30 nucleotides, preferably 19 to 25 nucleotides, most preferably 21 to 23 nucleotides or even more preferably 21 nucleotides long. siRNA is involved in the RNA interference (RNAi) pathway, where siRNA interferes with expression of a specific gene (e.g., NGF). siRNA naturally occurring in nature has a well-defined structure: short double-stranded RNA (dsRNA) with 2-nt 3' overhangs at either end. Each chain has a 5 'phosphate group and a 3' hydroxyl (- -OH) group. This structure is the result of processing by dicer, an enzyme that converts long dsRNA or small hairpin RNA into siRNA. siRNA can also be introduced exogenously (artificially) into cells to cause specific knockdown of a gene of interest (e.g. NGF). Genes of essentially any known sequence can thus be targeted based on sequence complementarity to appropriately tailored siRNAs. The double stranded RNA molecule or its metabolic processing products are capable of mediating target specific nucleic acid modifications, in particular RNA interference and/or DNA methylation. Exogenously introduced siRNA can have no overhangs at its 3 'and 5' ends, however, in some embodiments, at least one RNA strand has a 5 'overhang and/or a 3' overhang. Preferably, one end of the double strand has a 3' overhang of 1-5 nucleotides, more preferably 1-3 nucleotides, most preferably 2 nucleotides. The other end may be blunt or have a 3' overhang of up to 6 nucleotides. In general, any RNA molecule suitable for use as an siRNA and to inhibit NGF is contemplated in the present invention. In some embodiments, siRNA duplexes consisting of 21-nt sense and 21-nt antisense strands are provided that pair in a manner with 2-nt 3' overhangs. The sequence of the 2-nt 3' overhang contributes little specifically to target recognition limited to unpaired nucleotides adjacent to the first base pair. The 2 '-deoxynucleotides in the 3' overhang are as efficient as ribonucleotides, but synthesis is generally cheaper and potentially more nuclease resistant. Delivery of the siRNA can be accomplished using any method known in the art, for example, by combining the siRNA with saline and administering the combination intravenously or intranasally, or by formulating the siRNA in glucose (such as 5% glucose), or the cationic lipid and polymer can be used to deliver the siRNA in vivo Intravenously (IV) or Intraperitoneally (IP) via the systemic route. In some embodiments, provided herein are siRNA molecules that target and inhibit expression (e.g., knockdown) of NGF.

Transfection of siRNA into animal cells resulted in efficient, durable post-transcriptional silencing of specific Genes (Caplen et al, proc Natl Acad Sci U.S. A.2001;98:9742-7; elbashir et al, nature.2001;411:494-8; elbashir et al, genes Dev.2001;15:188-200; and Elbashir et al, EMBO J.2001;20:6877-88, all of which are incorporated herein by reference). Methods and compositions for RNAi with siRNA are described, for example, in U.S. Pat. No. 6,506,559, incorporated herein by reference.

siRNA is particularly effective in reducing the amount of target RNA and often reaches undetectable levels by extending the protein. Silencing effects can last several months and are very specific, as one nucleotide mismatch between the central regions of the target RNA and siRNA is often sufficient to prevent silencing (Brummelkamp et al, science 2002;296:550-3; and Holen et al, nucleic Acids Res.2002;30:1757-66, all of which are incorporated herein by reference).

Other molecules that achieve RNAi (and are used herein to inhibit expression of NGF) include, for example, micrornas (mirnas). The RNA species is a single stranded RNA molecule. The endogenous presence of miRNA molecules regulates gene expression by binding to complementary mRNA transcripts and triggering their degradation through a process similar to RNA interference. Thus, exogenous mirnas can be used as inhibitors of NGF after introduction into target cells. In some embodiments, provided herein are miRNA molecules that target and inhibit expression (e.g., knock down) of NGF.

Morpholino (or morpholino oligonucleotides) are synthetic nucleic acid molecules which are about 20 to 30 nucleotides in length, typically about 25 nucleotides. Morpholino binds to the complement of the target transcript (e.g., NGF) by standard nucleic acid base pairing. They have standard nucleobases which bind to morpholine rings instead of deoxyribose rings and are linked by phosphorodiamidate groups instead of phosphates. Ionization in the usual physiological pH range is prevented by replacement of anionic phosphates with uncharged phosphorodiamidite groups, such that morpholino in the organism or cell is an uncharged molecule. The entire backbone of morpholino is composed of these modified subunits. Unlike inhibitory small RNA molecules, morpholine does not degrade its target RNA molecule. Instead, they spatially block binding to target sequences within the RNA and prevent entry of molecules that might interact with the RNA. In some embodiments, provided herein are morpholino oligonucleotides that target and inhibit expression (e.g., knock down) of NGF.

Ribozymes (ribonucleases, also known as rnases or catalytic RNAs) are RNA molecules that catalyze chemical reactions. Many natural ribozymes catalyze their own cleavage or cleavage of other RNAs, but they have also been found to catalyze the aminotransferase activity of ribosomes. Non-limiting examples of well characterized small self-cleaving RNAs are hammerhead, hairpin, hepatitis delta virus and lead-dependent ribozymes selected in vitro, while group I introns are examples of larger ribozymes. The principle of catalytic self-cleavage is well established. Because hammerhead structures have been shown to integrate into heterologous RNA sequences and ribozyme activity can be transferred thereby into these molecules, catalytic antisense sequences can be engineered against virtually any target sequence, provided that the target sequence contains potentially matching cleavage sites. The basic principle of constructing hammerhead ribozymes is as follows: a region of interest (e.g., a portion of NGF) of RNA containing a GUC (or CUC) triplet is selected. Two oligonucleotide strands, typically 6 to 8 nucleotides each, are taken and a catalytic hammerhead sequence is inserted between them. In some embodiments, provided herein are ribozyme inhibitors of NGF.

In some embodiments, antisense compounds that specifically hybridize to one or more nucleic acids encoding NGF are used to modulate NGF expression. Specific hybridization of an oligomeric compound with its target nucleic acid can interfere with the normal function of the nucleic acid. Such modulation of the function of a target nucleic acid by a compound to which it specifically hybridizes is commonly referred to as "antisense".

In some embodiments, the invention relates to the use of any genetic manipulation for modulating NGF gene expression. Examples of genetic manipulation include, but are not limited to, gene knockout (e.g., removal of NGF genes from a chromosome using, for example, recombination), expression of antisense constructs with or without inducible promoters, and the like. Delivery of the nucleic acid construct to the cell in vitro or in vivo may be performed using any suitable method. A suitable method is to introduce the nucleic acid construct into a cell such that the desired event occurs (e.g., expression of the antisense construct). Genetic therapy may also be used to deliver siRNA or other interfering molecules expressed in vivo (e.g., by inducible promoter stimulation).

In some embodiments, NGF expression (and/or NGF activity) is inhibited by modifying an NGF sequence in a target cell. In some embodiments, the alteration of NGF is performed using one or more DNA binding nucleic acids, such as via RNA-guided endonuclease (RGEN). For example, changes can be made using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated (Cas) proteins. In general, a "CRISPR system" collectively refers to transcripts and other elements involved in the expression of or directing the activity of a CRISPR-associated ("Cas") gene, including sequences encoding Cas genes, tracr (trans-activated CRISPR) sequences (e.g., tracrRNA or active portion tracrRNA), tracr-mate sequences (including "direct repeats" and partially direct repeats of tracrRNA processing in the case of endogenous CRISPR systems), guide sequences (also referred to as "spacers" in the case of endogenous CRISPR systems), and/or other sequences and transcripts from a CRISPR locus. The CRISPR/Cas nuclease or CRISPR/Cas nuclease system can include a non-coding RNA molecule (guide) RNA that sequence-specifically binds DNA, as well as a Cas protein (e.g., cas 9) with nuclease function (e.g., two nuclease domains). One or more elements of the CRISPR system may be derived from a type I, type II or type III CRISPR system, for example from a specific organism comprising an endogenous CRISPR system, such as streptococcus pyogenes (Streptococcus pyogenes). In some aspects, cas nucleases and grnas (including fusions of crrnas and immobilized tracrrnas that are specific for target sequences (e.g., sequences within NGF) are introduced into cells. Typically, the target site at the 5' end of the gRNA targets the Cas nuclease to the target site, e.g., NGF, using complementary base pairing. The target site may be selected based on its position immediately 5' to the Protospacer Adjacent Motif (PAM) sequence, such as typically NGG or NAG. In this regard, the gRNA is targeted to a desired sequence by modifying the first 20, 19, 18, 17, 16, 15, 14, 12, 11, or 10 nucleotides of the guide RNA to correspond to the target DNA sequence (e.g., a sequence within NGF). In general, CRISPR systems are characterized by elements that promote the formation of CRISPR complexes at target sequence sites. Typically, a "target sequence" generally refers to a sequence to which a guide sequence is designed to have complementarity, wherein hybridization between the target sequence and the guide sequence promotes the formation of a CRISPR complex. Complete complementarity is not necessarily required provided that sufficient complementarity exists to cause hybridization and promote the formation of CRISPR complexes. The CRISPR system may induce a Double Strand Break (DSB) at the SRC-3 target site followed by disruption or alteration as discussed herein. In other embodiments, cas9 variants that are considered "nickases" are used to nick a single strand at a target site (e.g., within NGF). Pairs of nicking enzymes may be used, for example to improve specificity, each guided by a different pair of gRNA targeting sequences, such that when nicking is introduced simultaneously, a 5' overhang is introduced. In other embodiments, the catalytically inactive Cas9 is fused to a heterologous effector domain (such as a transcriptional repressor or activator) to affect gene expression (e.g., inhibit expression of NGF). In some embodiments, the CRISPR system is used to alter NGF, inhibit expression of NGF, and/or inactivate expression products of NGF. In some embodiments, the CRISPR/Cas9 or related systems are used to alter NGF genes in a subject to reduce expression and/or activity of the NGF genes or resulting proteins. In some embodiments, a CRISPR/Cas9 system is used to insert a nucleic acid encoding an NGF peptide or polypeptide or NGF inhibitor into the genetic material of a host. CRISPR is a DNA locus comprising short repeats of a base sequence. Each repetition is followed by a short segment of "spacer DNA" from previous exposure to the virus. CRISPR is typically associated with Cas genes encoding proteins associated with CRISPR. The CRISPR/Cas system is a form of prokaryotic immune system that confers resistance to foreign genetic elements such as plasmids and phages and provides for acquired immunity. CRISPR spacers recognize and cleave these exogenous genetic elements in a manner similar to RNAi in eukaryotic organisms. The CRISPR/Cas system can be used for gene editing. By delivering the Cas9 protein and the appropriate guide RNA into the cell, the genome of the organism can be cleaved at any desired location. Methods of inserting genes into host cells to produce engineered cells using CRISPR/Cas9 systems and other systems are described, for example, in us publication No. 20180049412; which is incorporated by reference herein in its entirety.

In some embodiments, the invention provides antibodies that target NGF proteins. Any suitable antibody (e.g., monoclonal, polyclonal, or synthetic) can be used in the methods of treatment disclosed herein. In a preferred embodiment, the antibody is a humanized antibody. Methods of humanizing antibodies are well known in the art (see, e.g., U.S. Pat. nos. 6,180,370, 5,585,089, 6,054,297, and 5,565,332; each of which is incorporated herein by reference in its entirety).

In some embodiments, the invention provides methods of enhancing the entry of an NGF inhibitor into a cell or tissue. In some embodiments, the invention provides for administration of an NGF inhibitor in combination with electroporation, electroosmosis or sonoporation. In some embodiments, the invention provides for administration of an NGF inhibitor with electroporation. In some embodiments, the invention provides coinjection/electroporation of tissue of a subject. In some embodiments, the invention provides for administration of an NGF inhibitor prior to, concurrent with and/or after electroporation. In some embodiments, electroporation provides a method of delivering a drug or nucleic acid (e.g., DNA) into a cell. In some embodiments, the tissue is electrically stimulated at the same time or shortly after administration of the drug or DNA (e.g., NGF inhibitor). In some embodiments, electroporation increases cell permeability. The permeability or pores are large enough to allow the drug and/or DNA to enter the cell. In some embodiments, the pores in the cell membrane are closed and the cell again becomes impermeable or less permeable. Certain devices for coinjection/electroporation are known in the art (U.S. patent No. 7,328,064, which is incorporated herein by reference in its entirety).

The following patent applications include compositions, devices, systems, and methods that may be used in embodiments herein: U.S. publication No. 20210038501; U.S. publication No. 20200237929; U.S. publication No. 20200206498; U.S. publication No. 20200185062; U.S. publication No. 20190111241; U.S. publication No. 20190076417; U.S. publication No. 20190032058; U.S. publication No. 20170172440; U.S. publication No. 20150366477; U.S. publication No. 20110137284; and U.S. publication No. 20090281019; each of which is incorporated by reference herein in its entirety.

Furthermore, although the canine model uses PLA as the model atrial tissue, the method is applicable to all atrial tissue. In some embodiments, the present invention provides compositions and methods for treating or preventing atrial fibrillation. In some embodiments, the invention provides treatment or prevention of a heart disease or condition selected from the list of: aortic dissection, cardiac arrhythmias (e.g., atrial arrhythmias (e.g., extra-atrial contractions, walk-atrial paces, multisource atrial tachycardia, atrial flutter, atrial fibrillation, etc.), junctional arrhythmias (e.g., supraventricular tachycardia, AV node reentry tachycardia, paroxysmal supraventricular tachycardia, junctional heart rhythm, junctional tachycardia, extra-systole, etc.), atrial arrhythmias, ventricular arrhythmias (e.g., extra-ventricular contractions, accelerated spontaneous ventricular rhythms, monomorphic ventricular tachycardia, polymorphic ventricular tachycardia, ventricular fibrillation, etc.), congenital heart diseases, myocardial infarction, dilated cardiomyopathy, hypertrophic cardiomyopathy, aortic regurgitation, aortic valve stenosis, mitral regurgitation, mitral valve stenosis, ehrlies-Fan Ke rade Syndrome (Ellis-van Creveld Syndrome), familial hypertrophic cardiomyopathy, holter-Orams Syndrome (Holt-Orams), syn-ord Syndrome (mardr), syn-mad) and syn-equi-chom diseases, and the like.

Experiment

Dogs experiencing Rapid Atrial Pacing (RAP) over several weeks exhibited increased Nerve Growth Factor (NGF) secretion from the Left Atrial Appendage (LAA), which is believed to be due to the more regular/organized AF in this region, resulting in more regular muscle cell activation (ref.30; incorporated herein by reference in its entirety). As more and more studies suggest an important role for LAA in the development of persistent AF, preferential NGF secretion in LAA is expected to lead to diffuse autonomic sprouting in the atrium through retrograde transport to the atrial ganglion plexus and stellate ganglion. In experiments conducted during development of embodiments herein, targeted injection of NGF shRNA (SEQ ID NO:1 or 2) in the LAA of canine subjects followed by 4 weeks of RAP resulted in a significant reduction in AF duration. Unlike control animals, dogs that received NGF shRNA did not develop AF during the follow-up period (fig. 1).

Following NGF shRNA injection in the left and right atria, animals were subjected for up to 12 weeks, followed by prolonged experiments from 12 weeks to 12 months, similarly producing inhibited AF duration over a period of 28 days (fig. 2A) and 12 weeks (fig. 2B).

It is expected that detailed assessment of innervation in both atria following targeted gene injection will reveal that targeted inhibition of NGF in LAA prevents RAP-induced neurosprouting and thereby prevents paroxysmal progression to persistent AF.

Sequence(s)

SEQ ID NO:1–CACTGGACTAAACTTCAGCAT

SEQ ID NO:2–GCATAGCGTAATGTCCATGTT

Sequence listing

<110> university of northwest (NORHTWESTERN UNIVERSITY)

<120> compositions and methods for inhibiting nerve growth factor and treating/preventing atrial fibrillation

<130> NWEST-39552.601

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<220>

<223> Synthesis

<400> 1

cactggacta aacttcagca t 21

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<220>

<223> Synthesis

<400> 2

gcatagcgta atgtccatgt t 21

Claims

1. A method of treating and/or preventing Atrial Fibrillation (AF) in a subject, comprising administering to the subject an effective amount of a Nerve Growth Factor (NGF) inhibitor.

2. The method of claim 1, wherein the subject has atrial fibrillation.

3. The method of claim 1, wherein the NGF inhibitor inhibits NGF expression.

4. The method of claim 1, wherein the NGF inhibitor comprises a nucleic acid.

5. The method of claim 4, wherein administering the nucleic acid comprises administering a vector and/or transgene encoding the nucleic acid and allowing expression of the nucleic acid in cells of the subject.

6. The method of claim 4, wherein administering the nucleic acid comprises directly administering the nucleic acid to the subject.

7. The method of claim 4, wherein the nucleic acid is an antisense RNA, short hairpin RNA (shRNA), short interfering RNA (siRNA), or microrna (miRNA).

8. The method of claim 4, wherein the nucleic acid is NGF shRNA comprising 70% sequence identity to SEQ ID No. 1.

9. The method of claim 8, wherein the NGF shRNA comprises 100% sequence identity to SEQ ID No. 1.

10. The method of claim 1, wherein the NGF inhibitor is administered to myocardial tissue of the subject.

11. The method of claim 10, wherein the myocardial tissue comprises atrial or ventricular tissue.

12. The method of claim 11, wherein the NGF inhibitor is administered to left and/or right atrial tissue.

13. The method of claim 12, wherein the NGF inhibitor is administered to the left atrial appendage.

14. The method of claim 1, wherein administering the NGF inhibitor comprises injecting the NGF inhibitor into a tissue of the subject.

15. The method of claim 14, wherein the injecting is performed by needleless injection.

16. The method of claim 1, further comprising assessing a parameter of atrial tissue state of the subject.

17. The method of claim 16, wherein assessing a parameter of atrial tissue state of the subject comprises monitoring electrophysiological measurements associated with AF or assessing neuro-sprouting of a region of the myocardial tissue before and/or after administration of the NGF inhibitor to the subject.

18. The method of claim 17, wherein assessing a parameter of atrial tissue state of the subject comprises monitoring electrophysiological measurements related to AF selected from the group consisting of AF onset, AF duration, AF onset inducibility, effective refractory period, conductivity, and conductivity inhomogeneity index.

19. A composition comprising a nucleic acid capable of inhibiting the expression of Nerve Growth Factor (NGF).

20. The composition of claim 19, wherein the nucleic acid is an antisense RNA, short hairpin RNA (shRNA), short interfering RNA (siRNA), or microrna (miRNA).

21. The composition of claim 19, wherein the nucleic acid is a vector or transgene encoding an antisense RNA, short hairpin RNA (shRNA), short interfering RNA (siRNA), or microrna (miRNA).

22. The composition of claim 19, wherein the nucleic acid is an isolated nucleic acid encoding a small hairpin RNA for NGF mRNA.

23. The composition of claim 22, wherein the nucleic acid is NGF shRNA comprising 70% sequence identity to SEQ ID No. 1.

24. The composition of claim 23, wherein the NGF shRNA comprises 100% sequence identity to SEQ ID No. 1.