CN117701773A - Primer and probe for detecting bovine respiratory syncytial virus RT-RAA, kit and application - Google Patents

Abstract

The invention discloses a primer, a probe, a kit and application for detecting bovine respiratory syncytial virus RT-RAA, and belongs to the technical field of gene detection. The invention discloses a primer and a probe for detecting bovine respiratory syncytial virus (RT-RAA), a kit and application, wherein the primer and the probe are designed aiming at BRSV F genes, and a RT-RAA detection method for BRSV is established for the first time, and has high sensitivity and strong specificity.

Description

Primer and probe for detecting bovine respiratory syncytial virus RT-RAA, kit and application

Technical Field

The invention relates to the technical field of gene detection, in particular to a primer, a probe, a kit and application for detecting bovine respiratory syncytial virus RT-RAA.

Background

Bovine respiratory syncytial virus (Bovine respiratory syncytial virus, BRSV) belongs to the genus pneumovirinae, subfamily pneumovirinae of the family paramyxoviridae, order mononegavirales, is an enveloped virus with a non-segmented, single-stranded, negative-stranded RNA genome. The BRSV genome comprises 10 open reading frames for encoding a protein. The F protein of BRSV contains 574 amino acids and is highly conserved between different BRSV isolates, and partial sequence analysis of the different strains showed 1.8% and 0.8% amino acid and nucleotide variation, respectively. The F protein is an indispensable virus replication, is synthesized into an inactive precursor F0, and has been studied to show that cattle, sheep, goats and the like are easy to infect, but mainly occur in weaned calves and young cows of intensive culture. BRSV replicates predominantly in ciliated airway epithelial cells and type ii lung cells of the lung and induces mild lesions of bronchointerstitial pneumonia, epithelial cell necrosis, exudative or proliferative pneumonia, occasional syncytial cells. Bovine respiratory syncytial virus was first discovered in europe in the 20 th century 70 and has been widely prevalent worldwide, and at present, BRSV isolation from bovine bodies has been reported in europe, america, africa and asia. In 2007, heilongjiang of China was first isolated to BRSV. The incidence of BRSV infection in calves is relatively high, up to 60%, and the mortality is about 20%, resulting in significant economic losses to the global cattle industry.

In clinical detection of BRSV and epidemiological studies, current methods of BRSV diagnosis are mainly enzyme-linked immunosorbent assay (ELISA) and RT-PCR. The above methods often result in false negative results due to the low and unstable replication of the virus, which is not sensitive enough.

Therefore, providing a primer, a probe, a kit and an application for detecting bovine respiratory syncytial virus RT-RAA is a problem to be solved by those skilled in the art.

Disclosure of Invention

In view of the above, the invention provides a primer, a probe, a kit and application for detecting bovine respiratory syncytial virus RT-RAA.

The recombinase-mediated isothermal amplification technology (reverse transcription recombinase aid amplification, RT-RAA) is to utilize a recombinase-primer complex and a single-stranded binding protein to open DNA double chains under the constant temperature condition, complete nucleic acid amplification under the action of DNA polymerase, and realize real-time monitoring of RT-RAA reaction process by introducing probes and analyzing fluorescent signals. The RT-RAA has the advantages of rapidness, simplicity, convenience, specificity, good sensitivity and the like, and has unique advantages in practical clinical application compared with other detection methods. Therefore, the primer and the probe are designed aiming at the BRSV F gene, and the RT-RAA detection method of the BRSV is established for the first time, and the sensitivity and the specificity are high.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

a bovine respiratory syncytial virus RT-RAA detection primer and probe, the primer and probe sequences are as follows:

BRSV F1：5’-TGTCAAGTAATGTTCAAATAGTYAGGCAAC-3’；SEQ ID NO.1；

BRSV R1：5’-CAATACCACCCACGATCTGTCCTAGTTAAG-3’；SEQ ID NO.2；

Probe：TATTTATGGAGTTATAGACACCCCCTGTTGGAAACTACACA CCTCTC；SEQ ID NO.7；

adding a fluorescence-labeled reporter group FAM after 29 th base at the 5 'end of the probe, adding a fluorescence quenching group BHQ after 16 th base at the 3' end of the probe, labeling THF between 30 th base and 31 st base at the 5 'end of the probe, and performing C3-spacer blocking modification at the 3' end.

Further, the application of the RT-RAA detection primer and the probe of the bovine respiratory syncytial virus in preparation of BRSV detection reagents.

Further, the kit for detecting the bovine respiratory syncytial virus RT-RAA comprises the primer and the probe for detecting the bovine respiratory syncytial virus RT-RAA.

Further, the bovine respiratory syncytial virus RT-RAA detection kit is applied to detection of BRSV.

Further, a method for detecting BRSV for non-diagnostic purposes, comprising the steps of:

(1) Collecting a tissue sample to be tested, and extracting virus nucleic acid as a template;

(2) Carrying out RT-RAA reaction by using the RT-RAA detection primer and the probe of the bovine respiratory syncytial virus or the kit;

(3) And (3) result judgment: when a typical amplification curve appears and the peak time is less than or equal to 18min, the BRSV exists in the sample; no typical amplification curve, or peak time >18min, was present, indicating no BRSV in the sample.

Further, the RT-RAA reaction condition is 39 ℃ for 20min.

Compared with the prior art, the invention discloses a primer and a probe for detecting bovine respiratory syncytial virus RT-RAA, a kit and application, wherein the primer and the probe are designed according to the conserved region of F gene fragments of BRSV, and a recombinant plasmid standard pBRSV-F based on the virus F gene is constructed. And (3) establishing a BRSV recombinase-mediated isothermal nucleic acid amplification (RT-RAA) technology, and finishing detection at a constant temperature of 39 ℃ within 20min. The method is used for detecting common bovine-derived viruses such as Infectious Bovine Rhinotracheitis Virus (IBRV), bovine parainfluenza virus type 3 (BPIV 3), bovine Viral Diarrhea Virus (BVDV), bovine Rotavirus (BRV) and Bovine Respiratory Syncytial Virus (BRSV), and the results show that the method has no cross reaction to other viruses except the BRSV, is negative and has good specificity. The recombinant plasmid standard pBRSV-F is transcribed into a standard RNA in vitro; diluted to 10 ⁸ Copy/. Mu.L-10 ⁰ The copy/. Mu.L was used as a template to detect a minimum copy of 10 ² Copy/. Mu.l, sensitivity was 100-fold higher than for RT-PCR; the results of the inter-batch repeat test and the intra-batch repeat test show that the method has good repeatability. By adopting the method to detect 40 bovine-derived clinical samples, the positive rate is 7.5% (3/40), and the detection result is consistent with RT-PCR. The BRSV real-time fluorescence RT-RAA detection method established for the first time in the test is simple, efficient, specific and sensitive, and provides a feasible technology for clinical screening of BRSV.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments or the description of the prior art will be briefly described below, and it is obvious that the drawings in the following description are only embodiments of the present invention, and that other drawings can be obtained according to the provided drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram showing the results of screening BRSV-based RT-RAA primer pairs of the present invention;

wherein M: a marker; the number 1 is BRSV F1/R1; the number 2 is BRSV F2/R2; the number 3 is BRSV F3/R3;

FIG. 2 is a diagram showing the results of specific primary screening of BRSV-based RT-RAA primer pairs of the present invention;

wherein M: a marker; primer pairs (BRSV F1/R1 for numbers 1-5, BRSV F2/R2 for numbers 6-10, BRSV F3/R3 for numbers 11-15); adding templates (BVDV for numbers 1,6 and 11, BRSV for numbers 2,7 and 12, BPIV3 for numbers 3,8 and 13, IBRV for numbers 4,9 and 14, and non-nucleic acid water for numbers 5, 10 and 15);

FIG. 3 is a diagram showing the detection of viral nucleic acids of BRSV, BPIV3, BVDV, IBRV, BRV using a fluorescence RT-RAA system of the present invention, at 39deg.C for 20min;

FIG. 4 is a drawing showing the detection of positive plasmid pBRSV-F standard by agarose gel electrophoresis in accordance with the present invention;

wherein M: a marker; numbers 1-6 are positive plasmid standards;

FIG. 5 is a graph showing the concentration of 10 using fluorescence RT-RAA system according to the present invention ¹⁰ Copy/. Mu.l of standard RNA was detected, at 39℃for 20min;

FIG. 6 is a graph showing the concentration of 10 using fluorescence RT-RAA system according to the present invention ⁸ ～10 ⁰ Copy/. Mu.l RNA standard was tested and maintained at 39℃for 20min;

FIG. 7 is a graph showing the concentration of 10 by ordinary PCR according to the present invention ⁸ ～10 ⁰ Copy/. Mu.l RNA standard was tested;

FIG. 8 is a graph showing the results of a repeatability test of the present invention;

wherein A: batch-to-batch repeatability test; b: in-batch repeatability test;

FIG. 9 is a graph showing the results of the clinical sample testing of the present invention;

wherein A: detecting 40 clinical sample nucleic acids by using a fluorescence RT-RAA system, wherein the temperature is 39 ℃ for 20min; b: detecting 40 clinical sample nucleic acids by using common PCR;

among them, samples No. 7, 10, 32 were positive.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Viral nucleic acids such as Bovine Respiratory Syncytial Virus (BRSV), infectious Bovine Rhinotracheitis Virus (IBRV), bovine parainfluenza virus type 3 (BPIV 3), bovine Viral Diarrhea Virus (BVDV), bovine Rotavirus (BRV) and the like are all stored in the laboratory; bovine tissue samples were collected from the Hebei animal epidemic prevention control center and stored at-80 ℃.

The RT-RAA nucleic acid amplification kit (basic type) is available from Hangzhou mass-measuring biotechnology Co., ltd; the RT-RAA nucleic acid amplification kit (fluorescent type) is available from Hangzhou mass-measuring biotechnology Co., ltd; t7RiboMAXExpress Large Scale RNA Production System is available from Promega corporation; RNeasy Mini Kit was purchased from QIAGEN.

Example 1 design and screening of primers and probes

BRSV F gene sequences were downloaded from NCBI (AF 188556.1) and multiple sequence alignment was performed using RNAMAN, the highly conserved regions of the F gene were selected, and 3 pairs of primers were designed using Primer Premier 5.0 software (table 1). And (3) primarily judging the primers by using a basic RT-RAA kit, screening the optimal primer pair, and designing a probe according to the optimal primer pair.

The primers and probes were synthesized by Shanghai Biotechnology Co.

TABLE 1 primer sequences

The probe sequence is as follows:

TATTTATGGAGTTATAGACACCCCCTGTTGGAAACTACACACCTCT C；SEQ ID NO.7。

adding a fluorescence-labeled reporter group FAM after 29 th base at the 5 'end of the probe, adding a fluorescence quenching group BHQ after 16 th base at the 3' end of the probe, labeling dSpacer (tetrahydrofuran, THF) between 30 th base and 31 st base at the 5 'end of the probe, and performing C3-spacer blocking modification at the 3' end.

The modified probes were as follows:

TATTTATGGAGTTATAGACACCCCCTGTT(FAM-dT)G(THF)G(BHQ1-dT)AAACTACACACCTCTC-C3-spacer。

the machine extraction laboratory stores BRSV positive nasal swab disease material RNA nucleic acid as an amplified template for a basic RT-RAA reaction, and incubates at 39 ℃ for 30min, and the reaction product is detected by 1% (w/v) Agarose Gel Electrophoresis (AGE). First, primer pairs were initially determined based on the band conditions of the electrophoresis experiments (FIG. 1), then specific screening was performed, incubation was performed at 39℃for 30min, and the reaction products were detected by 1% (w/v) Agarose Gel Electrophoresis (AGE), and the optimal primer pairs were determined, and the results are shown in FIG. 2. The bands amplified by BRSV F1/R1 are the coarsest and brightest and do not cross-react with Infectious Bovine Rhinotracheitis Virus (IBRV), bovine parainfluenza virus type 3 (BPIV 3), bovine Viral Diarrhea Virus (BVDV). BRSV F1/R1 is therefore selected as the optimal primer pair for probe design.

Example 2 specificity test

Viral nucleic acids such as Infectious Bovine Rhinotracheitis Virus (IBRV), bovine parainfluenza virus type 3 (BPIV 3), bovine Viral Diarrhea Virus (BVDV), bovine Rotavirus (BRV), bovine Respiratory Syncytial Virus (BRSV) and the like are used as templates, and BufferA 25 mu L, an upstream primer (10 mu M) and a downstream primer (2 mu L, ddH) are sequentially added according to RT-RAA fluorescent kit instruction ₂ O12.9. Mu.L, probe (10. Mu.M) 0.6. Mu.L, template 5. Mu.L, and finally BufferB 2.5. Mu.L were added to make a total of 50. Mu.L system. After mixing well, the test cell tube was placed in a Genchek fluorescence detector and the test was started (39 ℃ C. For 20 min). The BRSV quasi-positive viral nucleic acid was used as Positive Control (PC) and the non-nucleic acid was used as Negative Control (NC), to evaluate the construction of the present inventionSpecificity of the RT-RAA method.

As shown in FIG. 3, the BRSV virus nucleic acid shows obvious fluorescent signals in the first 10 cycles, the amplification curve is positive, and other virus nucleic acids and non-nucleic acid are negative, which indicates that the method has better specificity.

EXAMPLE 3 construction and identification of recombinant plasmids

The RNA of the mechanically extracted BRSV is used as a template, and the primer BRSVF1/R1 is utilized to carry out PCR by a One-step method, so that partial sequences of the BRSV F gene are obtained by amplification, wherein the reaction system comprises 1 mu L of the RNA template, 0.4 mu L of each of upstream and downstream primers (10 mu M), 2 XTS One-Step Reaction Mix mu L, 0.4 mu L, RNase-free Water 7.8 mu L of a transScript One-Stepenzyme Mix and 20 mu L of a detection total system; the reaction procedure is 45℃for 15-30 min,94℃for 2-5min,30 cycles (94℃for 30s,56℃for 30S,72℃for 1 min) and 72℃for 10min. The PCR product was purified and recovered, double digestion was performed on the target gene and plasmid pET-28a using restriction enzymes (Xho I and Bam HI), the digested product was ligated using T4 ligase, transformed into DH5 alpha competent cells, and then subjected to positive bacteria detection (FIG. 4). The recombinant plasmid pBRSV-F was successfully constructed and identified by sequencing by Shanghai Biotechnology Co.

The recombinant plasmid was constructed and sequenced to identify the correct plasmid, which was used as a plasmid standard and designated pBRSV-F.

Example 4 in vitro transcription and preparation of standards

The DH5 alpha competent cells were transformed with the plasmid, positive clones were selected, and cultured overnight with 100. Mu.g/ml of a Carna-resistant LB medium at 37℃with 200r/min shaking. Plasmids were extracted using the TaKaRa plasmid miniprep kit and digested with restriction enzymes (ScaI and BamHI). After recovering the product, RNase enzyme was added to the product to eliminate RNA. Then, in vitro transcription was performed using a RiboMAXTM Express Large Scale RNA-T7 kit from Promega, and Dnase was added to the in vitro transcription product at 37℃for 30min to remove the DNA template. The RNA was purified using the RNeasy Mini Kit of QIAGEN, and the concentration of the purified RNA was measured using a spectrophotometer and expressed by the following formula: copy/μl=6.02×10 ²³ X mass concentration (ng/. Mu.L). Times.10 ^-9 /(RNA base number X)340). Calculating copy number per microliter of in vitro transcription RNA template, and adjusting the RNA template to 10 ¹⁰ Copy/. Mu.l and continue 10-fold gradient dilution to obtain 10 ⁸ ～10 ⁰ Copy/. Mu.l RNA standard.

The standard RNA template obtained by in vitro transcription is 10 ¹⁰ Copy/. Mu.l, standard RNA template was detected using fluorescence RT-RAA system, and the result was shown in FIG. 5 at a concentration of 10 at 39℃for 20min ¹⁰ The copy/. Mu.l of standard RNA template showed a distinct fluorescent signal in the first 5 cycles, and an amplification curve was present, indicating successful construction of standard RNA. The non-nucleic acid water was used as a Negative Control (NC).

Example 5 sensitivity test

Will 10 ⁰ ～10 ⁸ The copy/. Mu.l RNA standard is used as a template, and the real-time fluorescence RT-RAA method established by the invention is used for detection, and the non-nucleic acid water is used as a negative control.

At the same time, the detection system is 1 mu L of each of the upstream and downstream primers (10 mu M), 10 mu L of Mix, 1 mu L of template and ddH by using common PCR ₂ O7. Mu.L, the total system was 20. Mu.L. The detection procedure was 94℃for 5min,30 cycles (94℃for 30s,56℃for 30s,72℃for 1 min) and 72℃for 10min.

The sequence of the upstream and downstream primers is as follows:

BRSV-F：5’-GTGCAGTTAGTAGAGGTTATCTTAGT-3’；SEQ ID NO.8；

BRSV-R：5’-TAGTTCTTTAGATCAAGTACTTTGCT-3’；SEQ ID NO.9。

and comparing and analyzing the detection results of the two, and evaluating the sensitivity of the real-time fluorescence RT-RAA method established by the invention.

At 10 ⁸ ～10 ⁰ The sensitivity of the real-time fluorescence RT-RAA method established by the invention is detected by taking the copy/μl RNA standard as a template, the result is shown in FIG. 6, the peak time is gradually prolonged along with the reduction of the copy number, and the negative control fluorescence signal has no obvious change, thus showing that the minimum detection limit is 10 ² Copy/. Mu.l, whereas the lowest detection limit of the ordinary PCR method is 10 ⁴ Copy/. Mu.L (FIG. 7). The sensitivity of the real-time fluorescence RT-RAA detection method is proved to be 100 times higher than that of the common PCR. Indicating that the BRSV established by the invention is fluorescent in real timeThe RT-RAA detection method has higher sensitivity.

Example 6 repeatability test

Selection 10 ⁸ Copy/. Mu.L, 10 ⁶ Copy/. Mu.L, 10 ⁴ Copying/mu L of 3 concentration standard substances as templates, respectively repeating for 3 times, and performing in-batch repeatability test; and simultaneously taking the concentration standard substance, and repeatedly carrying out 3 times of real-time fluorescence RT-RAA detection under the same condition and in different time to serve as a batch-to-batch repeatability test. The reproducibility of the RT-RAA method established by the invention was evaluated.

Pair 10 ⁸ Copy/. Mu.L, 10 ⁶ Copy/. Mu.L, 10 ⁴ RNA standards at 3 concentrations were used as templates in triplicate. The real-time fluorescence RT-RAA detection established by the invention is used for respectively carrying out the repeatability test between batches and in batches, and the results show that the peak time difference of the RNA standard products with the same concentration in batches and between batches is smaller (figure 8), which shows that the repeatability of the BRSV real-time fluorescence RT-RAA detection method established by the invention is better.

Example 7 detection of clinical samples

40 bovine tissue samples are detected by using the machine extracted virus nucleic acid as a template and using the real-time fluorescence RT-RAA method established by the invention, the detection results are compared with RT-PCR, and the detection results of the two are compared.

The real-time fluorescence RT-RAA detection method and the common PCR detection method constructed by the invention are utilized to detect 40 clinical samples, and the results show that 3 samples are positive and the positive rate is 7.5% (3/40). The real-time fluorescence RT-RAA detection result method is consistent with the RT-PCR method result, which shows that the BRSV real-time fluorescence RT-RAA detection method established by the research is suitable for clinical detection of BRSV.

Bovine Respiratory Syncytial Virus (BRSV) is one of the most relevant pathogens causing respiratory diseases in dairy and beef farms, and the impact of BRSV infection on animal husbandry results in economic losses due to morbidity, mortality, treatment and prevention costs, ultimately resulting in lost production and reduced carcass value. Despite the significant time, effort and money invested in many countries, there is still a lack of effective vaccines and methods of treatment. Bovine respiratory syncytial virus particles are fragile, have poor tolerance to the environment and poor cell adaptability, are main obstacles in BRSV research, and inactivated vaccine-mediated disease aggravating effect and attenuated live vaccine cannot find a balance between virulence and immunogenicity, are difficult problems faced by BRSV vaccine research, and no effective vaccine is applied clinically at present. In order to efficiently detect BRSV, several diagnostic methods have been developed. These methods play a very important role in preventing and controlling BRSV infection. However, these methods are time consuming, complex to operate, expensive in materials, and require skilled personnel. Therefore, establishing a rapid, simple and reliable BRSV detection method, eliminating positive cattle is particularly important for reducing the loss caused by the disease

The BRSV F gene is highly conserved, so the F gene is used as a target gene for primer and probe design in constructing BRSV nucleic acid detection methods. In the present invention, primers and probes are designed to ensure a high degree of specificity of the method by selecting conserved sequences of the BRSV F gene. In the RT-RAA reaction system, recombinases, DNA polymerases, single-stranded DNA binding proteins allow rapid amplification of nucleic acids at constant temperature. Meanwhile, adding a reverse transcription system to the RAA system can reduce a single reverse transcription step and shorten the detection time.

The invention successfully establishes a novel method for detecting BRSV by real-time fluorescence RT-RAA, which can rapidly amplify at a constant temperature of 39 ℃, can detect fluorescence signals within 8-15 minutes and can obtain results within 20 minutes. The time consumption is shorter than that of the established RT-PCR, fluorescent quantitative PCR, nano-PCR, ELISA and immunofluorescent antibody detection methods. The lowest limit of detection for real-time RT-RAA assays was 10 per reaction ² The sensitivity of the copy is 100 times higher than that of RT-PCR and 10 times higher than that of fluorescent quantitative PCR as that of Nano-PCR established by M.Box. Although LAMP (loop-mediated isothermal amplification) detection is simple, it is very susceptible to contamination. Fluorescent quantitative PCR is more accurate but requires complex equipment and complex procedures. The ELISA detection method has high false positive rate, long detection time of the immunofluorescence antibody and complex operation. The method for detecting BRSV by using the real-time fluorescence RT-RAA has no cross reaction of other strains and has specificity. In addition, a total of 40 clinical samples were takenTesting to determine the clinical effect of the method. The matching rate of RT-RAA and TaqMan probes based on RT-qPCR is 100%. Real-time RT-RAA detection shows high accuracy, and the matching rate of RT-RAA and TaqMan probes based on RT-qPCR is 100%. The result shows that the real-time fluorescence RT-RAA is a rapid, specific and sensitive method for detecting BRSV.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims (6)

1. A primer and a probe for detecting bovine respiratory syncytial virus (RT-RAA), which are characterized by comprising the following sequences:

BRSV F1：5’-TGTCAAGTAATGTTCAAATAGTYAGGCAAC-3’；SEQ ID NO.1；

BRSV R1：5’-CAATACCACCCACGATCTGTCCTAGTTAAG-3’；SEQ ID NO.2；

Probe：TATTTATGGAGTTATAGACACCCCCTGTTGGAAACTACACA CCTCTC；SEQ ID NO.7；

adding a fluorescence-labeled reporter group FAM after 29 th base at the 5 'end of the probe, adding a fluorescence quenching group BHQ after 16 th base at the 3' end of the probe, labeling THF between 30 th base and 31 st base at the 5 'end of the probe, and performing C3-spacer blocking modification at the 3' end.

2. Use of the primer and probe for detecting bovine respiratory syncytial virus RT-RAA according to claim 1 in the preparation of a reagent for detecting BRSV.

3. A bovine respiratory syncytial virus RT-RAA detection kit comprising the bovine respiratory syncytial virus RT-RAA detection primer and probe of claim 1.

4. Use of the bovine respiratory syncytial virus RT-RAA detection kit of claim 3 in the detection of BRSV.

5. A method for detecting BRSV for non-diagnostic purposes, comprising the steps of:

(1) Collecting a tissue sample to be tested, and extracting virus nucleic acid as a template;

(2) Performing an RT-RAA reaction using the bovine respiratory syncytial virus RT-RAA detection primer and probe of claim 1 or the kit of claim 3;

(3) And (3) result judgment: when a typical amplification curve appears and the peak time is less than or equal to 18min, the BRSV exists in the sample; no typical amplification curve, or peak time >18min, was present, indicating no BRSV in the sample.

6. The method for detecting BRSV without diagnostic purposes according to claim 5, wherein the RT-RAA reaction conditions are 39℃for 20min.