CN117701729B - SNP locus and locus combination related to bacterial gill rot disease resistance of grass carp and application thereof - Google Patents
SNP locus and locus combination related to bacterial gill rot disease resistance of grass carp and application thereof Download PDFInfo
- Publication number
- CN117701729B CN117701729B CN202311726318.3A CN202311726318A CN117701729B CN 117701729 B CN117701729 B CN 117701729B CN 202311726318 A CN202311726318 A CN 202311726318A CN 117701729 B CN117701729 B CN 117701729B
- Authority
- CN
- China
- Prior art keywords
- grass carp
- snp
- gill rot
- bacterial gill
- locus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000252230 Ctenopharyngodon idella Species 0.000 title claims abstract description 67
- 230000001580 bacterial effect Effects 0.000 title claims abstract description 33
- 208000035240 Disease Resistance Diseases 0.000 title claims abstract description 14
- 238000009395 breeding Methods 0.000 claims abstract description 20
- 230000001488 breeding effect Effects 0.000 claims abstract description 20
- 210000000349 chromosome Anatomy 0.000 claims abstract description 13
- 239000003153 chemical reaction reagent Substances 0.000 claims description 13
- 238000011144 upstream manufacturing Methods 0.000 claims description 7
- 241000700605 Viruses Species 0.000 claims description 4
- 201000010099 disease Diseases 0.000 abstract description 23
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 abstract description 23
- 239000003147 molecular marker Substances 0.000 abstract description 7
- 238000012098 association analyses Methods 0.000 abstract description 4
- 238000012163 sequencing technique Methods 0.000 abstract description 4
- 210000002816 gill Anatomy 0.000 description 30
- OPTASPLRGRRNAP-UHFFFAOYSA-N cytosine Chemical compound NC=1C=CNC(=O)N=1 OPTASPLRGRRNAP-UHFFFAOYSA-N 0.000 description 12
- 229940104302 cytosine Drugs 0.000 description 6
- RWQNBRDOKXIBIV-UHFFFAOYSA-N thymine Chemical compound CC1=CNC(=O)NC1=O RWQNBRDOKXIBIV-UHFFFAOYSA-N 0.000 description 6
- 238000000034 method Methods 0.000 description 5
- 241000251468 Actinopterygii Species 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 4
- 239000012634 fragment Substances 0.000 description 4
- 238000003205 genotyping method Methods 0.000 description 4
- 229930024421 Adenine Natural products 0.000 description 3
- GFFGJBXGBJISGV-UHFFFAOYSA-N Adenine Chemical compound NC1=NC=NC2=C1N=CN2 GFFGJBXGBJISGV-UHFFFAOYSA-N 0.000 description 3
- 108020004414 DNA Proteins 0.000 description 3
- 229960000643 adenine Drugs 0.000 description 3
- 229940031551 inactivated vaccine Drugs 0.000 description 3
- 239000002773 nucleotide Substances 0.000 description 3
- 125000003729 nucleotide group Chemical group 0.000 description 3
- 230000004083 survival effect Effects 0.000 description 3
- 229940113082 thymine Drugs 0.000 description 3
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 238000012408 PCR amplification Methods 0.000 description 2
- 238000009360 aquaculture Methods 0.000 description 2
- 244000144974 aquaculture Species 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 238000001914 filtration Methods 0.000 description 2
- 230000002068 genetic effect Effects 0.000 description 2
- 238000003908 quality control method Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000007619 statistical method Methods 0.000 description 2
- 208000024891 symptom Diseases 0.000 description 2
- USFZMSVCRYTOJT-UHFFFAOYSA-N Ammonium acetate Chemical compound N.CC(O)=O USFZMSVCRYTOJT-UHFFFAOYSA-N 0.000 description 1
- 239000005695 Ammonium acetate Substances 0.000 description 1
- 241000252231 Cyprinus Species 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 241000589565 Flavobacterium Species 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 229940043376 ammonium acetate Drugs 0.000 description 1
- 235000019257 ammonium acetate Nutrition 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 208000022531 anorexia Diseases 0.000 description 1
- 230000000844 anti-bacterial effect Effects 0.000 description 1
- 201000005008 bacterial sepsis Diseases 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 206010061428 decreased appetite Diseases 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 230000006806 disease prevention Effects 0.000 description 1
- 238000009313 farming Methods 0.000 description 1
- 239000013505 freshwater Substances 0.000 description 1
- 230000007614 genetic variation Effects 0.000 description 1
- 208000031169 hemorrhagic disease Diseases 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 210000004400 mucous membrane Anatomy 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 230000035764 nutrition Effects 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 230000001681 protective effect Effects 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 230000008268 response to external stimulus Effects 0.000 description 1
- 238000007480 sanger sequencing Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000009394 selective breeding Methods 0.000 description 1
- 235000011225 shan shi Nutrition 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of aquatic organism breeding, and particularly relates to SNP loci and locus combinations related to bacterial gill rot resistance of grass carp and application thereof. The invention successfully screens SNP loci related to bacterial gill rot resistance of grass carp by re-sequencing and whole genome association analysis, and the SNP loci are respectively positioned at 22749095 th and 5960961 th bases of chromosome 6 and chromosome 13. For the two SNP loci, a SNP locus combination related to bacterial gill rot disease resistance of grass carp is further developed, and by detecting the SNP locus combination, individual resistant to bacterial gill rot disease of grass carp can be screened. Therefore, the SNP molecular marker provided by the invention can be used for grass carp molecular marker assisted breeding, so that the breeding of disease-resistant grass carp varieties is quickened, and a reference basis is provided for the disease-resistant breeding work of grass carp.
Description
Technical Field
The invention belongs to the field of aquatic organism breeding, and particularly relates to SNP loci and locus combinations related to bacterial gill rot resistance of grass carp and application thereof.
Background
Grass carp (Ctenopharyngodon idellus), belonging to the order of Cyprinus, cypriidae, paracorus, grass carp, is the first large freshwater aquaculture economic fish in China, and has been the main breed for aquaculture for more than 60 years. The feed has the advantages of high growth speed, wide feed source, rich nutrition, delicious taste, high yield and the like, is popular in the aquatic product consumer market, and is an ideal breeding variety.
In recent years, bacterial gill rot disease is found to be serious in the grass carp cultivation process due to high-density and intensive cultivation, the disease is caused by the infection of flavobacterium columnificus, and pathogens mainly cause serious gill rot through mucous membranes attached to gills, so that grass carp is ill and dead, and symptoms are anorexia, blackening of the back and head, dislocation, lying down, slow response to external stimulus and rotting of the tail ends of gill wires and adhesion of silt and dirt during the disease. The disease has the onset time of 4-11 months, and is mainly harmful to grass carp of 1-2 years old, the death rate is not controlled to be more than 90%, and the development of grass carp farming industry is seriously affected.
At present, the effective treatment method for bacterial gill rot disease of grass carp is to inoculate an immune inactivated vaccine in the young fish period, but one-to-one inoculation not only affects the growth of the young fish, but also increases the investment cost of cultivation. Therefore, the development of cultivation of grass carp disease-resistant varieties is a relatively economical and effective mode. SNPs refer to variation of a single nucleotide in the genome, one of the most common forms of genetic variation. The research of SNP loci can reveal genetic differences among different individuals, and provides an important basis for the research of genetic characters. In grass carp, the correlation between SNP locus and bacterial gill rot resistance is researched, so that an important theoretical basis can be provided for disease resistance breeding of grass carp. Therefore, the method for excavating the SNP locus related to bacterial gill rot resistance of the grass carp has important significance for cultivation and disease prevention and control of the grass carp. At present, researchers have identified some SNP sites related to grass carp hemorrhagic disease and bacterial sepsis resistance, but SNP sites related to grass carp bacterial gill rot viruses are not reported.
Disclosure of Invention
In view of the shortcomings of the prior art, the invention aims to provide application of a reagent for detecting 22749095 th basic group of a grass carp chromosome 6 in breeding of grass carp antibacterial gill rot viruses.
The invention also aims at providing a reagent for detecting 22749095 th basic group of a grass carp chromosome 6 and application of the reagent for detecting 5960961 th basic group of the grass carp chromosome 13 in breeding of bacterial gill rot viruses of grass carp.
In order to achieve the above object, the present invention adopts the following technical measures:
The applicant collects 120 tail of dying individuals who have not been injected with immune inactivated vaccine and naturally infected columnar yellow stems and exploded bacterial gill rot disease from the same pond of grass carp culture base of Guangdong sea large group, inc. of Guangdong province, after the period of attack, collects 180 stable individuals as disease resistant groups, sends 300 grass carp samples to Shanghai Paulo Biotechnology Co Ltd for whole genome re-sequencing, uses software GATK for genotyping, uses bell for filling the missing genotype, uses plink for quality control filtration of parting files to obtain the final parting result. Using the case-control phenotype recording format, combined with genotyping results, full genome association analysis (GWAS) using EMMAX software to combine SNP genotype and phenotype data sets the threshold to-log 10 (1/N) = 6.464 (N is the number of SNPs used for analysis) as a statistically significant threshold, and sites where the p-value reached the threshold were considered to have significant correlation. Finally screening out 2 SNP related to bacterial gill rot resistance, wherein SNP locus Chr06-22749095 is positioned at 200 th position in the sequence of table 1, and the base Y at 200 th position is C (cytosine) or T (thymine); SNP locus Chr13-05960961 is located at position 600 of the displayed sequence of Table 1, wherein the base M at position 600 is A (adenine) or C (cytosine).
The protection scope of the invention comprises:
the application of the reagent for detecting 22749095 th basic group of grass carp chromosome 6 in bacterial gill rot disease resistance breeding of grass carp.
The application of the reagent for detecting 22749095 th basic group of grass carp chromosome 6 and the reagent for detecting 5960961 th basic group of grass carp chromosome 13 in bacterial gill rot disease resistance breeding of grass carp.
In the above application, preferably, the reagent is a primer, and the SNP can be detected by the conventional PCR primer, so that the SNP site can be detected by the skilled person through the conventional primer design.
SEQ ID NO.1 is the sequence of a base fragment before and after molecular marking of SNP locus Chu 06-22749095, and the 200 th base is C (cytosine);
SEQ ID NO.2 is the sequence of a base fragment before and after molecular marking of SNP locus Chu 06-22749095, and the 200 th base is T (thymine);
SEQ ID NO.3 shows the sequence of the base fragment before and after molecular marking of SNP locus Chr13-05960961, and the 600 th base is A (adenine);
SEQ ID NO.4 is the sequence of a base fragment before and after molecular marking of SNP locus Chr13-05960961, and the 600 th base is C (cytosine);
SEQ ID NO.5 is an upstream primer of a Chu 06-22749095 molecular marker;
SEQ ID NO.6 shows that the Chu 06-22749095 molecule marks the downstream primer;
SEQ ID NO.7 shows an upstream primer of a Chu 13-05960961 molecular marker;
SEQ ID NO.8 shows the Chu 13-05960961 molecular marker downstream primer.
Preferred primers are:
chr06-22749095: upstream primer F5'CCTGCTCAGCACTGCTTACA 3', downstream primer R5'TTATCCATAGTCTCGTCGTTCTC 3';
Chr13-05960961: upstream primer F5'CCCATCCTCCTCATCCTTG 3', downstream primer R5 'AAAGCCACAGGTTACCACAG3'.
Compared with the prior art, the invention has the beneficial effects that:
According to the invention, 2 SNP molecular markers which are obviously related to bacterial gill rot disease resistance of the grass carp are selected, the related SNP molecular markers can be used for auxiliary breeding of the grass carp molecular markers, the breeding of disease-resistant grass carp varieties is quickened, and a reference basis is provided for disease-resistant breeding work of grass carp or other cultured fishes.
Drawings
FIG. 1 Manhattan diagram of whole genome association analysis of disease resistant and susceptible groups.
Detailed Description
The present invention will be further described with reference to specific examples and drawings for a better understanding of the technical contents of the present invention to those skilled in the art. The technical scheme of the invention is a conventional scheme in the field unless specifically stated; the reagents or materials, unless otherwise specified, are commercially available. The grass carp reference genome used in the invention is NCBI public edition (https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/019/924/925/GCF_019924925.1_HZGC01/GCF_019924925.1_HZGC01_genomic.fna.gz).
Example 1:
Excavating SNP (Single nucleotide polymorphism) related to bacterial gill rot disease resistance of grass carp
1) Collecting 120 tails of dying individuals who are not injected with an immune inactivated vaccine and naturally infect columnar yellow stems to outbreak bacterial gill rot disease from a grass carp culture base of Guangdong sea large group Co., ltd., guangdong province, collecting 180 stable individuals after the period of onset as disease resistant groups, sending 300 grass carp samples to Shanghai Pacific biological technology Co., ltd., carrying out whole genome re-sequencing, using software GATK for genotyping, using bell for filling the missing genotypes, and using plink for quality control filtration of the typing files to obtain a final typing result.
2) Using the case-control phenotype recording format, combined with genotyping results, full genome association analysis (GWAS) using EMMAX software to combine SNP genotype and phenotype data sets the threshold to-log 10 (1/N) = 6.464 (N is the number of SNPs used for analysis) as a statistically significant threshold, and sites where the p-value reached the threshold were considered to have significant correlation. The manhattan diagram is created using ggplot packages as shown in fig. 1.
The result shows that 7 SNP loci in all SNPs meet the requirements, 2 SNPs possibly related to bacterial gill rot resistance are primarily identified according to physical information and linkage region gene annotation by Blast analysis and comparison, the physical position and sequence information of the SNP loci are shown in table 1, SNP loci Chr06-22749095 in table 1 are positioned at 22749095 th position of grass carp chromosome 6 and are 200 th position of a corresponding sequence in table 1, wherein base Y at 200 th position is C (cytosine) or T (thymine); SNP locus Chr13-05960961 is positioned at 5960961 of grass carp chromosome 13 and is 600 of the corresponding sequence of table 1, wherein the base M at 600 is A (adenine) or C (cytosine);
they are related to bacterial gill rot resistance of grass carp, can be used for breeding grass carp disease resistance characters, and analysis of the sites is shown in table 2.
TABLE 1 SNP information related to bacterial gill rot resistance of grass carp
TABLE 2 genotypic statistical analysis of SNP at susceptible and disease resistant populations
As can be seen from table 2, the genotypes of the 2 SNPs sites are significantly different in both the anti-susceptibility group and the susceptibility group (P < 0.05), and the genotypes significantly associated with the disease resistance trait in the 2 SNPs sites are respectively: chr06-22749095:CC, chr13-05960961:CC. Genotypes significantly associated with susceptibility are: chr06-22749095:TT, chr13-05960961:AA. Therefore, the SNPs mark can be used for breeding the bacterial gill rot resistance of grass carp.
Example 2:
application of SNP locus related to bacterial gill rot disease resistance of grass carp in breeding of grass carp
Based on the 2 single nucleotide polymorphism sites positioned in the embodiment 1 of the invention, corresponding primers are developed and used for molecular marker assisted selective breeding of disease-resistant grass carp so as to obtain a grass carp variety resisting bacterial gill rot disease. Primer information is shown in Table 3.
TABLE 3 primer nucleotide sequences for amplifying bacterial gill rot resistance-related SNPs
Bacterial gill rot disease symptoms appear in 1-year grass carp bred in an aquatic breeding base of the Shanshi institute of China, the disease-resistant living individuals 94 are collected, and the correlation between genotypes and bacterial gill rot disease resistance of grass carp is verified by detecting genotypes of 2 SNP loci located in example 1 of the individuals. The method specifically comprises the following steps:
1) DNA extraction and PCR amplification
188 Tail fin DNA of the validation population was extracted using the isopropanol/ammonium acetate method and diluted to 100ng/μl for use. PCR amplification was performed using primers shown in Table 3 using grass carp genomic DNA as a template.
PCR reaction conditions: pre-denaturation at 94℃for 4min; denaturation at 94℃for 30s, T m annealing for 30s, extension at 72℃for 40s,34 cycles; extending at 72deg.C for 10min, and preserving at 4deg.C.
The PCR system is as follows: the upper and lower primers were each 0.25. Mu.L, the DNA template was 0.5. Mu.L, HIEFF PCR MASTER Mix (Yeasen, shanghai, china) was 5. Mu.L, and ddH 2 O was added to 10. Mu.L.
2) Genotype statistics
After the PCR was completed, sequences of the corresponding samples were obtained by Sanger sequencing, and genotypes of the SNP loci of the present invention were read according to the sequencing peak pattern of each sample and the survival rate and death rate were counted, and the counted results are shown in Table 4.
TABLE 4 statistical analysis of disease resistance SNP locus genotypes in 188 grass carp morbidity populations
As can be seen from Table 4, there are 78 individuals of the genotype CC of the Chr06-22749095 in the 188 grass carp morbidity population, of which 68 survived and 10 died; individuals with the genotype CC for Chr13-05960961 had 41 tails, of which 28 survived and 13 died. Therefore, in grass carp, if the genotype of the genome SNP locus Chur 06-22749095 individual is CC or the genotype of the SNP locus Chur 13-05960961 individual is CC, the survival probability of the individual suffering from bacterial gill rot disease is higher than the death probability. It can be seen that the accuracy of the molecular marker Chr06-22749095 is high. The two can also be used simultaneously, namely when the genotype of the SNP locus Chur 06-22749095 and the genotype of the Chur 13-05960961 locus of an individual are CC, the survival rate is obviously higher than the death rate, namely, the individual is bacterial gill rot disease resistant grass carp.
The above embodiments are merely illustrative of the present invention, and the protective scope of the present invention is not limited to the above embodiments only. The object of the present invention can be achieved by a person skilled in the art based on the above disclosure, and any modifications and variations based on the concept of the present invention fall within the scope of the present invention, which is defined in the claims.
Claims (2)
1. An application of a reagent for detecting 22749095 th basic group of a grass carp chromosome 6 in breeding of bacterial gill rot viruses of grass carp, wherein the reagent is a primer and comprises the following components: chr06-22749095: upstream primer F5'CCTGCTCAGCACTGCTTACA 3', downstream primer R5 'TTATCCATAGTCTCGTCGTTCTC'.
2. The application of a reagent for detecting 22749095 th basic group of a grass carp chromosome 6 and a reagent for detecting 5960961 th basic group of a grass carp chromosome 13 in bacterial gill rot disease resistance breeding of grass carp is provided, wherein the reagents are primers: chr06-22749095: upstream primer F5'CCTGCTCAGCACTGCTTACA 3', downstream primer R5'TTATCCATAGTCTCGTCGTTCTC 3' and Chr13-05960961: upstream primer F5'CCCATCCTCCTCATCCTTG 3', downstream primer R5 'AAAGCCACAGGTTCCACAGA'.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202311726318.3A CN117701729B (en) | 2023-12-15 | 2023-12-15 | SNP locus and locus combination related to bacterial gill rot disease resistance of grass carp and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202311726318.3A CN117701729B (en) | 2023-12-15 | 2023-12-15 | SNP locus and locus combination related to bacterial gill rot disease resistance of grass carp and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN117701729A CN117701729A (en) | 2024-03-15 |
CN117701729B true CN117701729B (en) | 2024-05-03 |
Family
ID=90147486
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202311726318.3A Active CN117701729B (en) | 2023-12-15 | 2023-12-15 | SNP locus and locus combination related to bacterial gill rot disease resistance of grass carp and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN117701729B (en) |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105132444A (en) * | 2015-09-23 | 2015-12-09 | 华中农业大学 | Molecular marker for hemorrhagic disease resistance trait of grass carp and application of molecular marker |
CN106544410A (en) * | 2016-07-28 | 2017-03-29 | 华中农业大学 | A kind of and megalobrama amblycephala disease resistance trait related SNP molecular labeling and its application |
CN112266967A (en) * | 2020-11-09 | 2021-01-26 | 湖州师范学院 | Weever immune-related SNP (single nucleotide polymorphism) locus and application thereof in breeding |
CN115725722A (en) * | 2022-10-26 | 2023-03-03 | 西藏自治区农牧科学院水产科学研究所 | Detection reagent and detection kit for identifying bacterial gill disease tolerance of east Asian salmon |
CN116516028A (en) * | 2023-06-27 | 2023-08-01 | 中国海洋大学三亚海洋研究院 | SNP locus related to anti-nervous necrosis virus character of leopard gill-acanthus japonicus and application thereof |
-
2023
- 2023-12-15 CN CN202311726318.3A patent/CN117701729B/en active Active
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105132444A (en) * | 2015-09-23 | 2015-12-09 | 华中农业大学 | Molecular marker for hemorrhagic disease resistance trait of grass carp and application of molecular marker |
CN106544410A (en) * | 2016-07-28 | 2017-03-29 | 华中农业大学 | A kind of and megalobrama amblycephala disease resistance trait related SNP molecular labeling and its application |
CN112266967A (en) * | 2020-11-09 | 2021-01-26 | 湖州师范学院 | Weever immune-related SNP (single nucleotide polymorphism) locus and application thereof in breeding |
CN115725722A (en) * | 2022-10-26 | 2023-03-03 | 西藏自治区农牧科学院水产科学研究所 | Detection reagent and detection kit for identifying bacterial gill disease tolerance of east Asian salmon |
CN116516028A (en) * | 2023-06-27 | 2023-08-01 | 中国海洋大学三亚海洋研究院 | SNP locus related to anti-nervous necrosis virus character of leopard gill-acanthus japonicus and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN117701729A (en) | 2024-03-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Liu et al. | Genetic diversity in three Japanese flounder (Paralichthys olivaceus) populations revealed by ISSR markers | |
CN110129456B (en) | Prawn vibrio resistance molecular marker combination and application thereof in breeding | |
CN109182556B (en) | SNP molecular marker related to growth traits of pelteobagrus vachelli and application | |
CN109182545B (en) | SNP marker associated with vibrio harveyi disease of large yellow croaker, primer and application thereof | |
CN113881785B (en) | SNP locus primer combination for multi-character breeding of litopenaeus vannamei and application | |
CN116121397A (en) | Reagent for detecting SNP molecular marker combination related to anti-nerve necrosis virus character of groupers | |
CN116356038A (en) | Breeding method for screening Fugu rubripes individuals with rapid growth performance | |
CN110747282B (en) | Low-salt-resistant molecular marker C22 of portunus trituberculatus and application thereof | |
CN116516028A (en) | SNP locus related to anti-nervous necrosis virus character of leopard gill-acanthus japonicus and application thereof | |
CN106167826B (en) | A kind of relevant SNP site of yellow catfish growing characteristic and its detection and application | |
CN117701729B (en) | SNP locus and locus combination related to bacterial gill rot disease resistance of grass carp and application thereof | |
CN101899526B (en) | Method for selecting molecular marker for goat yeaning traits | |
CN113322328A (en) | SNP molecular marker with cryptocaryon irritans disease resistance-related traits for trachinotus ovatus and application of SNP molecular marker | |
CN113186299A (en) | Trachinotus ovatus cryptocaryon irritans disease associated SNP molecular marker, primer and application thereof | |
CN113637777B (en) | SNP molecular marker and primer pair related to eriocheir sinensis anti-vibrio anguillarum, screening method and application | |
CN117327809B (en) | Bay scallop accumulated carotenoid related molecular marker and application thereof | |
CN114574597B (en) | SNP marker on chitin binding protein gene related to vibrio parahaemolyticus infection resistance of litopenaeus vannamei and application thereof | |
CN115976263B (en) | KASP molecular marker of wheat thousand grain weight major QTL and application thereof | |
CN118064605A (en) | Molecular marker related to disease resistance of micropterus salmoides, detection primer, kit and application | |
Liu et al. | Genetic differentiation among common and selected hatchery populations of flounder: Evidence from RAPD markers | |
CN112322755B (en) | SNP locus related to growth traits of fugu rubripes and application of SNP locus in genetic breeding | |
CN110923337B (en) | Molecular marker related to anti-DHAV-3 character of Beijing duck and application thereof | |
CN118291649A (en) | ABCF1 gene molecular marker related to vibriosis resistance character of penaeus vannamei and application thereof | |
CN118345178A (en) | Penaeus vannamei Boone cell-secretion complex 1 gene molecular marker and application thereof | |
CN117551785A (en) | SNP molecular marker related to nitrous acid nitrogen resistance of litopenaeus vannamei and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |