CN117701693A

CN117701693A - Application of BACH1 molecule in pathological vascular reconstruction

Info

Publication number: CN117701693A
Application number: CN202311362861.XA
Authority: CN
Inventors: 孟丹; 李沁函; 王新红; 侯燕楠; 郭阶雨
Original assignee: Fudan University
Current assignee: Fudan University
Priority date: 2023-10-19
Filing date: 2023-10-19
Publication date: 2024-03-15

Abstract

The present invention relates to the use of BACH1 molecules in the diagnosis, prevention and/or treatment of diseases associated with pathological vascular remodeling. The BACH1 molecule can be used as a biomarker for detecting pathological vascular remodeling-related diseases, and simultaneously, the BACH1 molecule can be regulated to enhance or inhibit the activity and/or the expression of the BACH1 molecule, so that the activity and/or the expression of a TGF beta receptor 2 signal pathway and/or collagen and fibrosis molecules mediated by the BACH1 molecule can be regulated, thereby regulating the proliferation of vascular smooth muscle cells, hypoxia-induced extracellular matrix deposition and thickening of right ventricle walls, and being used for preventing and/or treating the pathological vascular remodeling-related diseases.

Description

Application of BACH1 molecule in pathological vascular reconstruction

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of a BACH1 molecule in pathological vascular reconstruction.

Background

The common pathological basis of cardiovascular and cerebrovascular diseases is vascular lesions, which refer to pathological changes of blood vessels caused by abnormal functions and structures of blood vessels. Vascular remodeling refers to the process of adaptive physiological and pathological changes caused by changes in blood flow, mechanical loading or vascular injury by vessel wall structure or vessel diameter. Physiological revascularization is necessary for the developmental process of the body, promoting continued maturation of vascular networks, such as embryonic angiogenesis or arteriogenesis. Pathological vascular remodeling is the process of development and progression of vascular disease due to poorly adapted changes in vascular structures. The key pathological basis of cardiovascular and cerebrovascular diseases such as coronary heart disease, hypertension, cerebral apoplexy, pulmonary hypertension and the like is the vascular reconstruction caused by vascular function imbalance and injury repair abnormality. Therefore, the method has great theoretical and clinical significance for deeply understanding the regulation mechanism of vascular remodeling, establishing a disease occurrence and prognosis early warning method, discussing new intervention and treatment targets and the like for explaining the common pathological basis of vascular lesions existing in various serious diseases.

Pulmonary arterial hypertension (pulmonary arterial hypertension, PAH) is a clinical syndrome characterized by significant pulmonary vascular load increase and vascular remodeling. The long-term and continuous progress of pulmonary hypertension will lead to right ventricular hypertrophy and dilation, and if there is a lack of timely effective intervention, it will develop into right heart insufficiency and even die. In recent years, the morbidity and mortality of pulmonary artery hypertension diseases still remain high, and the human health is seriously endangered. Due to the poor prognosis of pulmonary arterial hypertension, high mortality has become a current urgent problem to be solved. The current clinical treatment of pulmonary hypertension is still limited to some basic supportive and symptomatic treatments to relieve the patient's symptoms, lacking targeted treatments for pathogenesis. Although many research progress has improved our knowledge of pulmonary hypertension over the past decades, the complex pathogenesis of pulmonary hypertension is not yet fully elucidated, and the intensive research of the pathogenesis of pulmonary hypertension is significant for exploring clinical intervention means and developing new targets for treating pulmonary hypertension.

The transcription factor BACH1 (BTB and CNC homology, BTB-CNC homolog 1) is a member of a family of basic leucine zipper proteins widely expressed in various tissues and organs of mammals, and plays a critical transcriptional activation or transcriptional repression role. Early researches found that the transcription factor BACH1 can regulate and control vascular endothelial cell adhesion molecule expression by directly combining Yes related transcription regulatory factors (Yes associated transcriptional regulator, YAP) in endothelial cells, promote vascular inflammatory reaction, and thus regulate and control the occurrence and development of atherosclerosis; in smooth muscle cells, BACH1 knockout can inhibit smooth muscle cell phenotype switching by modulating chromatin accessibility, reducing the formation of angiogenic intima in a femoral artery guidewire injury model. Moreover, BACH1 was shown to be able to affect the development of pulmonary fibrosis by modulating mouse pulmonary fibroblast viability. This suggests that BACH1 plays a very important regulatory role in cardiovascular and pulmonary diseases. However, the role and mechanism of BACH1 in vascular remodeling and how it further affects pulmonary arterial hypertension is not known.

Disclosure of Invention

The invention researches the action mechanism of BACH1 for regulating vascular remodeling, and discovers that by regulating the expression of BACH1 molecules, the TGF beta receptor 2 (TGFBR 2) signal channel can be regulated so as to influence vascular remodeling, thus,

in a first aspect the invention relates to the use of a BACH1 molecule as a biomarker in a pathological vascular remodeling-related disease.

Preferably, the BACH1 molecule comprises a BACH1 protein, gene and/or mRNA.

Preferably, the test sample of the biomarker is derived from blood and/or tissue, further preferably, the tissue comprises heart, blood vessel, brain, lung tissue, more preferably, the test sample is derived from vascular smooth muscle, still further preferably, the test sample is derived from vascular smooth muscle cells.

In a second aspect, the invention relates to the use of a detection reagent for a BACH1 molecule for the preparation of a diagnostic product for a disease associated with pathological vascular remodeling.

Preferably, the detection reagent includes:

1) Reagents for detecting BACH1 protein expression levels;

2) A reagent for detecting the expression level of Bach1 gene; and/or the number of the groups of groups,

3) And (3) a reagent for detecting the expression level of Bach1 mRNA.

Preferably, the reagent for detecting the BACH1 molecule comprises a primer, a probe, an antibody, a substrate for an enzyme, a gene chip or a protein chip.

Preferably, the primers for detecting BACH1 molecule comprise a forward primer and a reverse primer, further preferably, the primers comprise:

forward primer 1:5'-GACCTCACGGGCTCTACT-3' (SEQ ID NO: 3),

reverse primer 1:5'-TTCTCGTCCTGGGCATCT-3' (SEQ ID NO: 4); or,

forward primer 2:5'-CACAATTCTTCCATAGACCCTC-3' (SEQ ID NO: 13),

reverse primer 2:5'-TCTGCCACTTCTCGCTC-3' (SEQ ID NO: 14),

forward primer 3:5'-TGTGATTAGCCTGGGAGA-3' (SEQ ID NO: 33),

reverse primer 3:5'-CGATTTCCGACTCAAGGT-3' (SEQ ID NO: 34), or alternatively,

forward primer 4:5'-AGCAGTCTTATGGAACCAACTC-3' (SEQ ID NO: 35),

reverse primer 4:5'-CGTTCCTTGGAAGATCTGTGAT-3' (SEQ ID NO: 36).

In a third aspect the invention relates to a diagnostic product comprising a detection reagent for a BACH1 molecule.

Preferably, the BACH1 molecule comprises a BACH1 protein, gene and/or mRNA.

Preferably, the detection reagent includes:

1) Reagents for detecting BACH1 protein expression levels;

3) And (3) a reagent for detecting the expression level of Bach1 mRNA.

Preferably, the diagnostic product includes, but is not limited to, a diagnostic kit, a primer, a probe, an antibody, a substrate for an enzyme, a gene chip, or a protein chip.

Preferably, the primers for detection of a BACH1 molecule comprise a forward primer and a reverse primer, and further preferably the primers are as defined in the second aspect.

In a fourth aspect the present invention relates to the use of a modulator of a BACH1 molecule comprising an enhancer of a BACH1 molecule or an inhibitor of a BACH1 molecule, said BACH1 enhancer enhancing the activity of a BACH1 molecule and/or its expression, and said inhibitor of a BACH1 molecule inhibits the activity of a BACH1 molecule and/or its expression, in modulating the activity of a BACH1 molecule-mediated tgfβ receptor 2 signaling pathway and/or the activity of a collagen and fibrosis molecule and/or its expression.

Preferably, the BACH1 molecule comprises a protein, gene and/or mRNA of BACH 1.

Preferably, the modulating agent of the BACH1 molecule inhibits or enhances the activity of the BACH1 molecule and/or its expression, thereby inhibiting or enhancing the activity of a BACH1 molecule-mediated tgfβ receptor 2 signaling pathway and/or collagen and fibrosis molecules and/or its expression.

Preferably, the TGF-beta receptor 2 signaling pathway comprises phosphorylation of TGF-beta receptor 2, SMAD 2/3; the collagen and fibrosis molecules include extracellular matrix genes or proteins thereof, and more preferably, the extracellular matrix genes include genes encoding Periostin (Postn), tenascin C (tnac), type i collagen α1 (Collagen Type I Alpha 1, col1a 1) or type iii collagen α1 (Collagen Type III Alpha 1, col3a 1).

Preferably, the modulating agent modulates vascular smooth muscle cell proliferation, hypoxia-induced extracellular matrix deposition, thickening of the right ventricle wall.

Preferably, the modulating agent comprises:

1) A vector, over-expression or knockout agent comprising the Bach1 gene;

2) A regulator that enhances or inhibits Bach1 gene or mRNA expression; and/or the number of the groups of groups,

3) An agent that enhances or inhibits BACH1 protein activity.

Preferably, the modulating agent comprises a need according to the particular embodiment, and the modulating agent may be any agent known in the art, provided that it enhances or inhibits the expression level of the BACH1 molecule.

Preferably, the over-expression or knockout according to the present invention includes systemic or local specific knockout, and more preferably, the over-expression or knockout is vascular specific over-expression or knockout, and even more preferably, the over-expression or knockout is vascular smooth muscle specific over-expression or knockout.

Preferably, the Bach1 gene knockout reagent includes knockout of exon 1, exon 2, exon 3, exon 4 and/or exon 5 of Bach1 gene.

Preferably, the modulating agent comprises an antibody to BACH1 protein or an agent used by a point mutation, deletion, insertion, antisense polynucleotides, siRNA, shRNA, microRNA or gene editing technique; further preferably, the gene editing technology comprises a DNA homologous recombination technology based on embryonic stem cells, a CRISPR/Cas9 technology, a zinc finger nuclease technology, a transcription activator-like effector nuclease technology, a homing endonuclease and other gene editing technologies.

Preferably, the modulating agent comprises an inhibitor of a BACH1 molecule, inhibiting the activity of the BACH1 molecule and/or its expression.

More preferably, the inhibitor comprises:

1) A knockout reagent comprising the Bach1 gene;

2) A regulator that inhibits Bach1 gene or mRNA expression; and/or the number of the groups of groups,

3) An agent that inhibits BACH1 protein activity.

Preferably, the Bach1 gene knockout reagent comprises a shRNA of a BACH1 molecule, more preferably, the shRNA comprises:

CCGCAGGUAUCAAGGAAAU(SEQ ID NO：38)；

GUCAGGAUUUACCUUUGAA (SEQ ID NO: 39); or (b)

CCAGGUCAAAGGACUUUCA(SEQ ID NO：40)。

Preferably, the knockdown includes knockdown using a Cre-LoxP or Flp-Frt gene recombination system followed by induction of specific knockdown using tamoxifen.

Preferably, the modulating agent comprises a chemical, such as rosuvastatin.

Preferably, the inhibitor of the BACH1 molecule inhibits BACH1 molecule mediated tgfβ receptor 2 signaling pathway and/or activity of and/or expression of collagen and fibrosis molecules.

Preferably, the inhibitor of the BACH1 molecule inhibits phosphorylation of TGF-beta receptor 2, SMAD 2/3.

Preferably, the inhibitor of the BACH1 molecule inhibits expression of an extracellular matrix gene or protein thereof.

Preferably, the inhibitor of BACH1 molecule inhibits proliferation of vascular smooth muscle cells, inhibits hypoxia-induced extracellular matrix deposition, inhibits thickening of right ventricle wall.

Preferably, the inhibitor of BACH1 molecule inhibits pulmonary artery pathologic vascular remodeling, ameliorating pulmonary arterial hypertension.

Preferably, the inhibitor of the BACH1 molecule enhances expression of myosin heavy chain 11 (Myosin heavy chain, myh 11).

Preferably, the modulator of the BACH1 molecule is an enhancer of the BACH1 molecule which enhances the activity of the BACH1 molecule and/or its expression, thereby enhancing the activity of the BACH1 molecule-mediated tgfβ receptor 2 signalling pathway and/or collagen and fibrosis molecules and/or its expression.

Preferably, the enhancer of the BACH1 molecule enhances the phosphorylation of TGF-beta receptor 2, SMAD 2/3.

Preferably, the enhancer of the BACH1 molecule enhances expression of an extracellular matrix gene or protein thereof.

Preferably, the enhancer of the BACH1 molecule promotes vascular smooth muscle cell proliferation, promotes hypoxia-induced extracellular matrix deposition, promotes thickening of the right ventricle wall.

Preferably, the enhancer of the BACH1 molecule inhibits expression of myosin heavy chain 11 (Myosin heavy chain, myh 11).

Preferably, the BACH1 molecule binds to the promoter region of tgfβ receptor 2 to regulate its expression.

In a fifth aspect the present invention relates to the use of a modulator of a BACH1 molecule comprising an enhancer of a BACH1 molecule or an inhibitor of a BACH1 molecule, said enhancer of a BACH1 molecule enhancing the activity of a BACH1 molecule and/or its expression, said inhibitor of a BACH1 molecule inhibiting the activity of a BACH1 molecule and/or its expression, for the preparation of a pharmaceutical composition for the prevention and/or treatment of a disease associated with pathological vascular remodeling.

Preferably, the BACH1 molecule comprises a BACH1 protein, gene and/or mRNA.

Preferably, the modulating agent is as defined in the fourth aspect.

Preferably, the modulating agent is an inhibitor of a BACH1 molecule, inhibits the activity of and/or expression of a BACH1 molecule, or inhibits the activity of and/or expression of a BACH1 molecule-mediated tgfβ receptor 2 signaling pathway and/or collagen and fibrosis molecules.

Preferably, the inhibitor is as defined in the fourth aspect.

The sixth aspect of the present invention relates to the use of a regulatory agent of TGFBR2 molecules for the preparation of a pharmaceutical composition for the prevention and/or treatment of diseases associated with pathological vascular remodeling.

Preferably, the modulating agent enhances or inhibits the activity of the TGFBR2 molecule and/or its expression.

Preferably, the TGFBR2 molecule comprises TGFBR2 protein, gene and/or mRNA.

Preferably, the modulating agent comprises:

1) A vector, over-expression or knockout agent comprising a TGFBR2 gene;

2) A modulator that enhances or inhibits TGFBR2 gene or mRNA expression; and/or the number of the groups of groups,

3) An agent that enhances or inhibits TGFBR2 protein activity.

Preferably, the modulating agent comprises any agent according to the needs of the specific embodiment, which may be any agent of the prior art, provided that it is capable of modulating the expression level of the TGFBR2 molecule.

Preferably, the modulating agent comprises an antibody using TGFBR2 protein or an agent used by a point mutation, deletion, insertion, antisense polynucleotides, siRNA, shRNA, microRNA or gene editing technique; further preferably, the gene editing technology comprises a DNA homologous recombination technology based on embryonic stem cells, a CRISPR/Cas9 technology, a zinc finger nuclease technology, a transcription activator-like effector nuclease technology, a homing endonuclease and other gene editing technologies.

Preferably, the modulating agent is an inhibitor of the TGFBR2 molecule, inhibiting the activity of the TGFBR2 molecule and/or its expression.

Preferably, the inhibitor comprises:

1) A knockout agent comprising the TGFBR2 gene;

2) A modulator that inhibits TGFBR2 gene or mRNA expression; and/or the number of the groups of groups,

3) An agent that inhibits TGFBR2 protein activity.

Preferably, the inhibitor comprises an siRNA of a TGFBR2 molecule, more preferably, the siRNA of a TGFBR2 molecule comprises: upstream sequence GCUCUGAUGAGUGCAAUGA (SEQ ID NO: 41) and downstream sequence UCAUUGCACUCAUCAGAGC (SEQ ID NO: 42);

upstream sequence GUUCAGAAGUCGGUUAAUA (SEQ ID NO: 43) and downstream sequence UAUUAACCGACUUCUGAAC (SEQ ID NO: 44);

Upstream sequence GCUUUGCUGAGGUCUAUAA (SEQ ID NO: 45) and downstream sequence UUAUAGACCUCAGCAAAGC (SEQ ID NO: 46).

Preferably, the inhibitor of the TGFBR2 molecule inhibits the activity of tgfβ receptor 2 signaling pathways and/or collagen and fibrosis molecules and/or expression thereof.

Preferably, the inhibitor of the TGFBR2 molecule inhibits phosphorylation of TGF-beta receptor 2, SMAD 2/3.

Preferably, the collagen and fibrosis molecule comprises an extracellular matrix gene or protein thereof, and more preferably, the extracellular matrix gene comprises a gene encoding Periostin (Postn), tenascin C (Tnc), collagen type i α1 (Collagen Type I Alpha 1, col1a 1) or collagen type iii α1 (Collagen Type III Alpha 1, col3a 1).

Preferably, the inhibitor of the TGFBR2 molecule inhibits proliferation of vascular smooth muscle cells, inhibits hypoxia-induced extracellular matrix deposition, inhibits thickening of right ventricular wall.

Preferably, the inhibitor of the TGFBR2 molecule inhibits pulmonary artery pathologic vascular remodeling, improving pulmonary arterial hypertension.

In a seventh aspect the invention relates to a pharmaceutical composition comprising a modulator of a BACH1 molecule or a modulator of a TGFBR2 molecule.

Preferably, the BACH1 molecule comprises a BACH1 protein, gene and/or mRNA.

Preferably, the modulating agent is as defined in the fourth, fifth and/or sixth aspects.

Preferably, the modulator of the TGFBR2 molecule is an inhibitor of the TGFBR2 molecule, more preferably the inhibitor of the TGFBR2 molecule is as defined in the sixth aspect.

In an eighth aspect the present invention relates to a method for the prophylaxis and/or treatment of a pathological vascular remodeling related disease comprising administering to a diseased individual an effective amount of a modulating agent of a BACH1 or TGFBR2 molecule and/or a pharmaceutical composition as described above.

Preferably, the modulator of the BACH1 or TGFBR2 molecule is as defined in the fourth, fifth and/or sixth aspect.

Preferably, the diseased individual includes a human or non-human animal, such as a non-human mammal.

In any of the above aspects, the pathological vascular remodeling-related disorder comprises cardiovascular and cerebrovascular diseases, and more preferably, the cardiovascular and cerebrovascular diseases comprise, but are not limited to, pulmonary hypertension, atherosclerosis, angina pectoris, myocardial infarction, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, congenital heart disease, valvular heart disease, cardiac inflammation, aortic aneurysm, cerebral thrombosis, cerebral arteritis, cerebral arterial injury, cerebral aneurysm, intracranial vascular malformation or cerebral arteriovenous fistula.

The beneficial technical effects of the invention are as follows:

the invention discovers that the vascular remodeling can be regulated by the modified Bach1 gene for the first time. The first finding that BACH1 expression is up-regulated in pulmonary arterial hypertension patients and mouse smooth muscle cells demonstrates a key role for BACH1 in pulmonary vascular remodeling regulating pulmonary arterial hypertension, demonstrating that BACH1 can affect progression of pulmonary arterial hypertension by regulating extracellular matrix deposition and proliferation of smooth muscle cells. Further, the present invention has found that the transcription factor activity of SMAD3 and the expression of a target gene are inhibited in smooth muscle-specific Bach1 gene knockout. And in vitro experiments prove that in smooth muscle cells, hypoxia can promote BACH1 enrichment in TGFBR2 promoter region to activate gene transcription thereof, thereby regulating extracellular matrix reconstruction. The effect of BACH1 in regulating extracellular matrix related genes at least partially depends on TGFBR2, so that the important effect of BACH1-TGFBR2 in transcriptional regulation of pulmonary hypertension is clarified, and a theoretical basis is provided for treating pulmonary hypertension by taking BACH1 as a target point and inhibiting TGF beta signal paths.

The "cardiovascular and cerebrovascular diseases" described in the present invention include, but are not limited to, pulmonary hypertension, atherosclerosis, angina pectoris, myocardial infarction, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, congenital heart disease, valvular heart disease, cardiac inflammation, aortic aneurysm, cerebral thrombosis, cerebral arteritis, cerebral arterial injury, cerebral aneurysm, intracranial vascular malformation or cerebral arteriovenous fistula.

The "product" according to the invention comprises reagents for detecting and/or reagents for inhibiting a biomarker. Including but not limited to pharmaceuticals, kits, devices, and the like.

The term "diagnosis" in the present invention refers to ascertaining whether a patient has a disease or condition in the past, at the time of diagnosis, or in the future, or to ascertaining the progression of a disease or the likely progression in the future.

The term "treatment" as used herein means slowing, interrupting, arresting, controlling, stopping, alleviating, or reversing the progression or severity of one sign, symptom, disorder, condition, or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

The term "effective amount" as used herein refers to the amount or dose of the medicament of the invention that provides the desired treatment or prophylaxis after administration to an individual or organ in single or multiple doses.

The terms "comprising" or "includes" are used in this specification to be open-ended, having the specified components or steps described, and other specified components or steps not materially affected.

All combinations of items to which the term "and/or" is attached "in this description shall be taken to mean that the respective combinations have been individually listed herein. For example, "a and/or B" includes "a", "a and B", and "B". Also for example, "A, B and/or C" include "a", "B", "C", "a and B", "a and C", "B and C" and "a and B and C".

The "individual" of the present invention may be a human or non-human animal, and the non-human animal may be a non-human mammal such as a mouse, a cow, a sheep, a rabbit, a pig, a monkey, etc.

The foregoing is merely illustrative of some aspects of the present invention and is not, nor should it be construed as limiting the invention in any respect.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA and immunology. These techniques are explained in detail in the following documents. For example:

1、Molecular Cloning ALaboratory Manual，2ndEd.，ed.By Sambrook，Fritschand Maniatis(Cold Spring Harbor Laboratory Press：1989)；

2、L.Jiang et al.,Bach1 represses Wnt/beta-Catenin signaling and angiogenesis.Circ Res 117,364-375(2015)；

3、L.Jiang et al.,The Transcription Factor Bach1 Suppresses the Developmental Angiogenesis of Zebrafish.Oxid Med Cell Longev 2017,2143875(2017)；

4、Oligonucleotide Synthesis(M.J.Gaited.，1984)；O.Shalem et al.,Genome-scale CRISPR-Cas9 knockout screening in human cells.Science 343,84-87(2014)；

5、S.Tu et al.,Co-repressor CBFA2T2 regulates pluripotency and germline development.Nature 534,387-390(2016).

all patents and publications mentioned in this specification are incorporated herein by reference in their entirety. It will be appreciated by those skilled in the art that certain changes may be made thereto without departing from the spirit or scope of the invention. The following examples further illustrate the invention in detail and are not to be construed as limiting the scope of the invention or the particular methods described herein.

Drawings

In the following figures, hPASMC is human pulmonary artery smooth muscle cells, mPASC is mouse pulmonary artery smooth muscle cells, normoxia is normoxic, and Hypoxia is hypoxic.

Fig. 1: single cell transcriptome sequencing profile, a t-SNE plot of cell groupings (21510 cells), different cell groupings labeled with different colors; B. t-SNE plot of Smooth Muscle Cell (SMC) populations, three smooth muscle cell subsets were determined (systolic, synthetic and oxygen-aware smooth muscle cells), with different cell populations labeled with different colors; C. a dot plot of typical markers for smooth muscle cells, where TAGLN, MYH11, and CNN1 represent contractile smooth muscle cells, TIMP1, and SPP1 represent synthetic smooth muscle cells; SOCS3 and MT1M represent oxygen-responsive smooth muscle cells, the size of the dots represents the percentage number of cells expressing the gene, and the color of the dots represents the average expression level.

Fig. 2: BACH1 expression in pulmonary arterial hypertension patient and model mouse synthesized smooth muscle cells, A. Pseudo-time trace heat map shows the expression change of related genes from healthy state to pulmonary arterial hypertension state in smooth muscle cells; B. visual control network of BACH1 in human synthetic smooth muscle cell populations.

Fig. 3: elevated expression of BACH1 in pulmonary arterial hypertension patient lung tissue and pulmonary artery, mRNA expression analysis of a.bach1 in Pulmonary Arterial Hypertension (PAH) patient (n=15) and control group (n=11) lung tissue, (data mean ± SD); B. the upper panel shows BACH1 immunohistochemical staining of lung tissue of patients with pulmonary hypertension or with death from non-pulmonary hypertension disease, scale bar = 50 μm, quantitative and statistical analysis see below, (n = 3, data mean ± SD).

Fig. 4: hypoxia stimulation can up-regulate BACH1 expression levels in pulmonary artery smooth muscle cells, a. Single cell sequencing analysis of dot patterns of normoxic and hypoxic mice for pulmonary artery smooth muscle cell BACH1 expression levels, con: normoxic control, PAH: hypoxia induces pulmonary hypertension, the size of the dots represents the percentage number of cells expressing the gene, the color of the dots represents the average expression level; B. representative images of TAGLN (red) and BACH1 (green) immunofluorescent staining of hypoxia-induced pulmonary hypertension mice pulmonary arteries (top panel) and quantitative analysis (bottom panel), scale bar: 20 μm, (n=6, data mean ± SD); bach1 mRNA was up-regulated in hypoxia-induced pulmonary arterial hypertension mouse lung tissue and Bach2 mRNA was not significantly different before and after hypoxia. (n=6, data mean ± SD).

Fig. 5: hypoxia stimulation can up-regulate the expression level of BACH1 in human pulmonary artery smooth muscle cells and primary cultured mice pulmonary artery smooth muscle cells, A. The BACH1 protein level in human pulmonary artery smooth muscle cells under normoxic and anoxic conditions is quantitatively and statistically analyzed to see right graph, (n=3, data is mean.+ -. SD); B. BACH1 protein levels in mice pulmonary artery smooth muscle cells primary cultured under normoxic and hypoxic conditions were quantified and analyzed statistically as shown in the right panel, (n=3, data mean ± SD).

Fig. 6: construction of smooth muscle-specific Bach1 gene knockout mice, A. Reproduction of Bach1 ^loxp/loxp And Bach1 ^SMCKO Pattern diagram of mice; bach1 ^loxp/loxp And Bach1 ^SMCKO DNA identification gel electrophoresis pattern of mice.

Fig. 7: constructing a chronic hypoxia-induced pulmonary artery high pressure mouse model, and A. A pattern diagram of the hypoxia-induced pulmonary artery high pressure mouse model; B. immunofluorescent staining confirmed the specific absence of BACH1 in vascular smooth muscle layer (BACH 1: green, TAGLN: red, DAPI: blue), scale bar: 20 μm.

Fig. 8: smooth muscle-specific Bach1 gene knockout inhibited pulmonary arterial pressure increase in mice, A.WT and Bach1 ^SMCKO Body weight of mice after 4 weeks of rearing under normoxic or hypoxic conditions (n=10, data mean ± SD, no statistical significance); WT and Bach1 ^SMCKO Mice were exposed to normoxic or hypoxic conditions for 4 weeks and subjected to hemodynamic measurements of representative waveforms of right ventricular systolic pressure; C.WT and Bach1 ^SMCKO Mice were exposed to normoxic or anoxic conditions for 4 weeksQuantitative analysis of post right ventricular systolic pressure, (n=10, data mean ± SD); D.WT and Bach1 ^SMCKO Representative hypercardiography and quantitative analysis of pulmonary artery acceleration time of cardiac ultrasound after mice were exposed to normoxic or hypoxic conditions for 4 weeks of feeding, (n=6, data mean ± SD).

Fig. 9: smooth muscle-specific Bach1 gene knockout inhibited vascular remodeling of mouse pulmonary artery, a.wt and Bach1 ^SMCKO H of mouse Lung tissue&Representative images of E staining and TAGLN (red) immunofluorescence staining, scale bar: 20 μm; B. quantitative and statistical analysis of the ratio of the thickness of the pulmonary artery media to the vessel diameter of the mice, (n=6, data mean ± SD); C. the proportion of pulmonary artery vessels (diameter 20-50 μm) of mice that were not, partially or fully muscular, each bar graph was fully muscular, partially muscular and not muscular in order from top to bottom.

Fig. 10: smooth muscle-specific Bach1 gene knockout inhibited right ventricular hypertrophy in mice, a. The ratio of right ventricular wall to left ventricular wall to ventricular septum weight (RV/(lv+s)) statistics, (n=10, data mean ± SD); B. h & E staining of the largest cross section of the mouse heart represents the image, the upper plot is the whole heart, the lower plot is the highlighted right ventricle wall, scale bar: 1mm; C. right ventricular wall thickness quantitative and statistical analysis of the mice heart maximum face cross section H & E staining, (n=6, data mean ± SD).

Fig. 11: single cell nuclear transcriptome sequencing analysis shows that the smooth muscle specific Bach1 gene knockout can inhibit the proportion of synthetic smooth muscle cells of mice, A. An even manifold approximation and projection (Uniform Manifold Approximation and Projection, UMAP) diagram of the lung tissue cell grouping of mice is marked with different colors for different cell groupings; B. violin plots show classical marker genes for 12 cell populations; C. violin shows WT and Bach1 ^SMCKO Myh11 and Postn gene expression in mouse lung tissue clustered with contractile SMC (SMC 1) and synthetic SMC (SMC 2); D.WT and Bach1 ^SMCKO Cell number comparison of contractile smooth muscle and synthetic smooth muscle cell groupings in mouse lung tissue, wherein the left column is WT and the right column is Bach1 ^SMCKO As a result.

Fig. 12: BACH1 knockdown inhibited hypoxia-induced extracellular matrix deposition of pulmonary artery, mRNA levels of Tnc, col1a1, col3a1, postn in control or smooth muscle-specific BACH1 gene knockdown pulmonary artery high pressure model mice lung tissue, (n=6, data mean ± SD); B. immunofluorescent staining of mouse lung tissue Periostin (POSTN) protein, co-staining of sections with TAGLN, DAPI staining of nuclei, (n=6, data mean ± SD); C. immunofluorescent staining of the murine lung tissue Tenascin C (TNC) protein, sections co-stained with TAGLN, DAPI stained nuclei, (n=6, data mean ± SD).

Fig. 13: BACH1 deletion can inhibit proliferation of pulmonary artery high pressure mouse primary smooth muscle cells, A. Primary cultured mouse pulmonary artery smooth muscle cells are cultured under normal oxygen or hypoxia condition and then are subjected to EdU staining, cell nuclei are stained by DAPI, and the proportion scale is: 20 μm; B. statistics of EdU staining positive cells after primary cultured mouse pulmonary artery smooth muscle cells were cultured under normoxic or hypoxic conditions, (n=3, data mean ± SD).

Fig. 14: constructing vascular smooth muscle specific Bach1 over-expression mice and pulmonary artery high pressure models, and A, constructing a pattern diagram of the vascular smooth muscle specific Bach1 over-expression mice and the pulmonary artery high pressure models; B. immunofluorescent staining confirmed the specific overexpression of BACH1 in vascular smooth muscle layer (BACH 1: green, TAGLN: red, DAPI: blue), scale bar: 20 μm.

Fig. 15: inhibiting TGFBR2 function can reverse increasing pulmonary artery pressure and right ventricular hypertrophy of mice caused by vascular smooth muscle specific Bach1 overexpression, A.WT and VSMC-Bach1 ^OE Body weight of mice after 3 weeks of rearing under normoxic or hypoxic conditions (n=6, data mean ± SD, no statistical significance); WT and VSMC-Bach1 ^OE Mice were exposed to normoxic or hypoxic conditions for 3 weeks and subjected to hemodynamic measurements of representative waveforms of right ventricular systolic pressure; C.WT and VSMC-Bach1 ^OE Quantitative analysis of right ventricular systolic pressure after 3 weeks of mice were exposed to normoxic or hypoxic conditions, (n=6, data mean ± SD); D.WT and VSMC-Bach1 ^OE The right ventricle wall of the mouse occupies the left ventricle wall and the ventricular septumWeight ratio statistics, (n=6, data mean ± SD).

Fig. 16: inhibiting TGFBR2 function can reverse the exacerbation of pulmonary vascular remodeling in mice caused by vascular smooth muscle specific Bach1 overexpression, A.WT and VSMC-Bach1 ^OE H of mouse Lung tissue&Representative image of E staining, scale: 20 μm; B. the ratio of the thickness of the pulmonary artery media to the vessel diameter was quantified and statistically analyzed (n=6, data mean ± SD).

Fig. 17: inhibiting the function of TGFBR2 can reverse the aggravation of extracellular matrix deposition of mice caused by vascular smooth muscle specific Bach1 overexpression, immunofluorescence staining of Tenasmin C (TNC) protein of lung tissues of mice, co-staining of slices and TAGLN, staining cell nuclei by DAPI, and the scale bar: immunofluorescence quantitative analysis of the b.tenascin C (TNC) protein (n=6, data mean ± SD).

Fig. 18: inhibition of TGFBR2 function can reverse the increase of SMAD3 phosphorylation level caused by vascular smooth muscle specific Bach1 overexpression, a. Immunofluorescent staining of p-SMAD3 protein of mouse lung tissue, co-staining of sections with α -SMA, DAPI staining of nuclei, scale bar: immunofluorescence quantitative analysis of 20 μm, B.p-SMAD3 protein (n=6, data mean ± SD).

Fig. 19: single cell nuclear transcriptome sequencing analysis shows that smooth muscle specific Bach1 gene knockout inhibits TGF beta signal pathway, and A. Gene enrichment analysis (GSEA) shows that the gene is compared with the SMAD3 target gene in Bach1 ^SMCKO Down-regulation in mouse smooth muscle cells; B. heat-maps show WT mice and Bach1 in single cell nuclear transcriptome sequencing analysis ^SMCKO Transcription factor activity in mouse smooth muscle cells; C.WT and Bach1 ^SMCKO Interaction of tgfβ ligands and receptors in mouse smooth muscle cells between different cell types.

Fig. 20: BACH1 knockout inhibited TGFBR2 expression, A.RT-qPCR detection of normoxic or hypoxic treated WT and Bach1 ^SMCKO mRNA (Tgfbr 2, tgfbr1, tgfβ1, bmpr 2) levels in mouse lung tissue, (n=6, data mean ± SD); rt-qPCR detects mRNA (TGFBR 2, TGFBR1, tgfβ1, BACH 1) levels, (n=3, data mean ± SD) in normoxic or hypoxic cultured human pulmonary artery smooth muscle cells.

Fig. 21: BACH1 binding promoted transcription at TGFBR2 promoter region, a representative peak pattern of BACH1 enrichment peaks at TGFBR2 promoter region in CUT-Tag data of hasmcs (left panel), binding motif of BACH1 was found at TGFBR2 gene promoter region (right panel); the ChIP-qPCR detection result proves that BACH1 is enriched in the TGFBR2 gene promoter region, igG is used as a negative control, (n=3, and the data are average value +/-SD); C. TGFBR2 luciferase reporter was transfected into rat aortic smooth muscle cells and luciferase activity was detected after hypoxia stimulation, (n=5, data mean ± SD).

Fig. 22: BACH1 knockdown can inhibit TGFBR2/SMAD signal pathway in pulmonary artery smooth muscle cells, A. Primary cultured mouse pulmonary artery smooth muscle cells detect protein expression after normoxic or hypoxia treatment; B. detecting protein expression of human pulmonary artery smooth muscle cells after normoxic or hypoxic treatment; C. quantitative and statistical analysis of the protein bands in fig. 22A was performed with ImageJ, (n=3, data mean ± SD); D. quantification and statistical analysis of protein bands in fig. 22B were performed with ImageJ, (n=3, data mean ± SD).

Fig. 23: smooth muscle Bach1 gene knockout inhibited TGFBR2/SMAD signaling pathway and extracellular matrix deposition, a. Control or smooth muscle specific Bach1 gene knockout pulmonary artery high pressure model mice lung tissue detected corresponding protein expression; B. quantification and statistical analysis of the protein bands in fig. 23A were performed with ImageJ, (n=6, data mean ± SD).

Fig. 24: inhibiting TGFBR2, inhibiting expression of extracellular matrix deposition related protein promoted by over-expression of BACH1, A. Transfecting human pulmonary artery smooth muscle cells with Ad-GFP shRNA or Ad-BACH1 shRNA for 24 hours, then transfecting the cells with control siRNA or TGFBR2 siRNA for 72 hours, and determining the expression result of the protein by Western blot; B. transfecting human pulmonary artery smooth muscle cells for 24h by using Ad-GFP shRNA or Ad-BACH1 shRNA, then treating for 48h by using LY2109761, and measuring the expression result of the protein by using Western blot; C. quantitative and statistical analysis of the protein bands in fig. 24A was performed with ImageJ, (n=3, data mean ± SD); D. quantification and statistical analysis of the protein bands in fig. 24B were performed with ImageJ, (n=3, data mean ± SD).

Fig. 25: BACH1 expression was positively correlated with TGFBR2 in patients with pulmonary hypertension, and mRNA expression of BACH1 and TGFBR2 was found to be positively correlated in carotid plaque in patients with pulmonary hypertension in published chip data (GEO number: GSE 48149) (n=18).

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. These examples are merely exemplary and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions of details and forms of the technical solution of the present invention may be made without departing from the spirit and scope of the present invention, but these changes and substitutions fall within the scope of the present invention.

In each of the following examples, the primary equipment and materials were obtained from several companies indicated below:

1. experimental materials

1.1 Experimental cells

Primary human pulmonary artery smooth muscle cells were purchased from Shanghai and Oriental Biotechnology Inc., cat# Hum-009.

A7R5 rat thoracic aortic smooth muscle cells were purchased from Medium Qiao Xinzhou company under the accession number ZQ0139.

1.2 laboratory apparatus:

NanoDrop2000 (THERMO filter, usa); a general PCR instrument (THERMO filter, usa); multifunctional enzyme labeling apparatus (Bio Tek instruments Co., U.S.A.); gel image processing system, WB electrophoresis apparatus (Tanon); a fluorescence microscope (Olympus corporation, japan), a confocal laser fluorescence microscope (Calzeiss, germany).

1.3 antibodies

BACH1: product number sc-271211, santaCruz; BACH1: cargo ab115210, abcam corporation; TAGLN: cargo No. ab10135, abcam corporation; beta-actin: product number 66009-1-Ig, proteintech; TGFBR2: product number 79424s, cst company; p-SMAD2: cargo number AP1007, abclonal; p-SMAD3: product number 9520s, cst company; SMAD2/3: product number 8685s, cst company; COL1A1: product number E8I9Z, CST company; COL3A1: cargo number 22734-1-AP, proteintech; tenascin (TNC): cargo ab108930, abcam corporation; periostin (POSTN): cargo number 19899-1-AP, proteintech company.

1.4 Virus

GFP control adenovirus, BACH1 over-expression adenovirus, con shRNA control adenovirus and BACH1 shRNA adenovirus are all from Shanghai Heng Biotech company.

1.5 primer sequences for RT-qPCR

Table 1: primer sequences for RT-qPCR

1.6shRNA and siRNA sequences

Table 2: shRNA related sequence

Table 3: siRNA related sequences

1.7 primer sequences for ChIP-qPCR detection

Table 4: primer sequences for ChIP-qPCR

1.8 sequences for reporter genes

TGFBR2-reporter：

GCTGAAAGTCGGCCAAAGCTCTCGGAGGGGCTGGTCTAGGAAACATGATTGGCAGCTACGAGAGAG

CTAGGGGCTGGACGTCGAGGAGAGGGAGAAGGCTCTCGGGCGGAGAGAGGTCCTGCCCAGCTGTTG

GCGAGGAGTTTCCTGTTTCCCCCGCAGCGCTGAGTTGAAGTTGATTAATAACGACATGATAGTCACT

GACAACAACGGTGCAGTCAAGTTTCCACAACTGTGTAAATTTTGTGATGTGAGATTTTCCACCTGTG

ACAACCAGAAATCCTGCATGAGCAACTGCAGCATCACCTCCATCTGTGAGAAGCCACAGGAAGTCT

GTGTGGCTGTATGGAGAAAGAATGACGAGAACATAACACTAGAGACAGTTTGCCATGACCCCAAGCTCCCCTACCATGACTTTATTCTGGAAGATGCTGCTTCTCCAAAGTGC(SEQ ID NO：53)

2 Experimental methods

2.1 acquisition of pulmonary tissue sections and normal human pulmonary tissue samples from patients with pulmonary arterial hypertension

Pulmonary tissue sections of patients with pulmonary hypertension were obtained from the pulmonary hospital, and normal human pulmonary tissue sections were obtained from the judicial identification center of the Shanghai medical college of the complex university, and have been applied for informed consent to be used in scientific research, and related experiments were approved by the ethical committee of the basic medical college of the complex university (lot number: 2022-C012).

2.2 culture of Primary mouse pulmonary artery smooth muscle cells

(1) The autoclaved instrument was prepared, sterile 1 XPBS, penicillin/streptomycin, amphotericin, DMEM/F12 medium, fetal bovine serum, and whole microscope.

(2) Dissecting mice 1) intraperitoneal injection of 1% sodium pentobarbital, anesthetizing the mice at a dose of 30mg/kg until no pain is felt; 2) Wiping and sterilizing the whole body of the mouse with 75% ethanol, and fixing the mouse on an operation table; 3) Ophthalmic scissors carefully dissect the chest cavity, expose the heart and lung, perfuse the pulmonary circulation with sterile 1 x PBS containing 1% penicillin/streptomycin; 4) Rapidly separating heart and lung tissue under microscope, simply peeling fat and connective tissue, and placing in sterile 1×PBS culture dish containing 1% penicillin/streptomycin;

(3) Isolation of pulmonary artery smooth muscle cells 1) carefully dissecting fibrous connective tissue surrounding the adventitia of a pulmonary artery under a microscope with forceps, exposing pulmonary artery trunks and left and right pulmonary artery stems; 2) Carefully dissecting lung tissue along the pulmonary artery trunk to isolate a complete distal pulmonary arteriole network; 3) Isolated pulmonary arteries were immersed in sterile 1 XPBS containing 1% penicillin/streptomycin and carefully rinsed to avoid intermixing with large numbers of blood cells. 4) The pulmonary artery is cut with the intima facing upward and the blade gently scrapes the intima. 5) Shearing the tissues into 1mm < 3 > pieces of crushed tissues, uniformly spreading and distributing the pieces in a T25 cell culture flask, and avoiding the influence of overcrowding on cell climbing; 6) The flask was inverted and 4ml DMEM/F12 cell culture medium containing 20% fbs and 1% penicillin/streptomycin was added; 7) After 2 hours, the flask was carefully turned over to allow the medium to cover the tissue, avoiding floating the tissue, and the next day the fluid was carefully changed.

2.3 culture of human pulmonary artery smooth muscle cells

2.3.1 resuscitation of human pulmonary artery smooth muscle cells

(1) Opening the water bath kettle in advance, and preheating to 37 ℃; (2) Taking out the frozen human pulmonary artery smooth muscle cells from the liquid nitrogen tank; (3) thawing the cells rapidly in a 37 ℃ water bath; (4) spraying 75% ethanol on the bottle body for disinfection; (5) Adding an equal volume of culture medium based on the neutralization frozen stock solution in a frozen stock tube, transferring the culture medium into a 15ml centrifuge tube, centrifuging at normal temperature of 200g for 3-5min, absorbing and discarding the supernatant, and lightly flicking the tube wall of the centrifuge tube to separate cell clusters; (6) Adding a proper volume of SMCM culture medium, blowing the resuspended cells, seeding into a T25 cell culture flask, and slowly and uniformly mixing to ensure that the cells are uniformly distributed. (7) placing in a cell culture box, and changing liquid for cells every other day.

2.3.2 passage of human pulmonary artery smooth muscle cells

(1) Observing the growth state of cells every day, sucking the cell culture medium after the cell growth in the cell culture flask reaches about 90% of the density, and carefully flushing the cells with 1ml of sterile PBS; (2) Adding 0.5ml of 0.25% concentration pancreatin to digest cells, and performing digestion at room temperature or 37deg.C, and repeatedly observing cell morphology under microscope during the period to avoid over digestion; (3) When the shrinkage of the cell edge is observed, after the morphology is rounded, absorbing and discarding pancreatin, and forcefully beating the culture flask to make the cells fall off in pieces; (4) Adding 1-2ml of cell culture medium to neutralize pancreatin, gently blowing, and transferring to a 15ml centrifuge tube; (5) 200g at normal temperature, centrifuging for 3-5min, carefully sucking and discarding the supernatant, adding a proper volume of culture medium (2-3 ml) to resuspend cells, and gently blowing and mixing; (6) at 1:3, transferring the mixture to a new culture flask, placing the culture flask in a cell culture box, and changing the liquid every other day.

2.3.3 cryopreservation of human pulmonary artery smooth muscle cells

(1) Placing the gradient cooling cryopreservation box at normal temperature in advance for thawing; (2) Normally digesting human pulmonary artery smooth muscle cells according to the steps; (3) 200g at normal temperature, centrifuging for 3-5min, and preparing frozen stock solution (10% DMSO and 90% FBS) during the centrifugation; (4) After centrifugation, the cell supernatant was aspirated and the cells were resuspended with cell cryopreservation solution; (5) further according to 1:3, transferring the mixture to a freezing tube; (6) And (3) placing the freezing tube in a gradient cooling freezing box which is thawed in advance, then placing the box in a refrigerator at the temperature of-80 ℃, transferring the box from the refrigerator at the temperature of-80 ℃ to a liquid nitrogen tank after about 24 hours, and preserving the box for later use.

2.4 analysis of Single cell Nuclear transcriptome sequencing (single nuclei RNA-sequencing, snRNA-seq)

2.4.1 construction of a Seurat subject, cell grouping of lung tissue

(1) Cell types of mouse lung tissue were analyzed using a semat package (version 4.2). Directly reading the gene expression matrix using read.csv; or reading in data by using Read10X, splitting the original data by 10X Cell Ranger into barcodes.tsv, gene list features.tsv and gene expression matrix matrix.mtx, for Bach1 ^WT And Bach1 ^SMCKO Single cell nuclear transcriptome sequencing data of pulmonary artery high pressure mouse pulmonary tissue creates a SeuratObject object for preliminary filtering;

(2) Mitochondrial genes were counted: drawing a violin graph of total gene number of cells, reads number and mitochondrial gene percentage, and filtering out cells with excessive or insufficient mitochondrial gene percentage or gene number;

(3) The sequencing data was homogenized: using normazedate to eliminate differences in cell sequencing depth, reads were corrected for the same library size;

(4) Then, using ScaleData to convert the value of the gene expression quantity to z-score, so that the data is subjected to normal distribution, and laying a cushion for the subsequent PCA analysis;

(5) Screening out genes with larger difference of cell expression quantity by using FindVariableFeaturs, and selecting 2000 hypervariable genes with the most obvious change for principal component analysis;

(6) Linear dimension reduction: the hypervariable genes were analyzed using RunPCA. Analyzing principal components in a sample after visualizing the result of DimHeatmap, simply exploring the heterogeneity of the principal data of the dataset, deciding which principal component can be used for downstream analysis, and setting cells and features according to scoring values thereof;

(7) The most significant principal components are evaluated, and the dimension of the dataset is determined: using JackStraw to visualize the P value distribution of the main component, and selecting the main component with P less than 0.05;

(8) Cell cluster analysis: partitioning the cell distance matrix by using FindNeighbors, clustering into small clusters, and then performing cell clustering by using FindCluters;

(9) UMAP/tSNE nonlinear dimension reduction analysis: visualization of cell groupings using RunUMAP or RunTSNE;

(10) Identifying differentially expressed marker genes: analyzing the specific marker genes of each cell group by using FindAllmarkers to complete the grouping of the cell groups;

(11) Renaming the cell population to distinguish cell type identity: the renameides was used to rename the cell grouping marker genes.

2.4.2 removal of double cells

The ideal case of single cell nuclear transcriptome sequencing is to have only one cell under each marker, but in practice double or multiple cells, called dubblets, will occur, which need to be removed, and the dubbletFinder used to identify the dubblets.

2.5 analysis of Single cell RNA-sequencing (scRNA-seq)

Single cell transcriptome sequencing data was obtained from the GEO database (GEO No. GSE 210248).

2.5.1 pseudo-time trajectory analysis

(1) Calculating the differential expression genes of the synthetic smooth muscle cells in the GEO data set;

(2) Important differentially expressed genes, determined by the "differential genetest" function of Monocle2, were used to define the Monocle object of synthetic smooth muscle cells;

(3) Performing pseudo-time track analysis by using a 'reduction dimension' method and a 'plot_pseudo-time_hetmap' method based on a DDRTreee algorithm; (4) Single cell trajectories of synthetic smooth muscle clusters were drawn from healthy to pulmonary arterial high pressure.

Regulatory network analysis of 2.5.2BACH1 in human synthetic smooth muscle cells

(1) The expression matrix of synthetic smooth muscle cells was used as a network for constructing BACH1 and regulatory targets;

(2) Regulatory network analysis was performed using R software package Gene Network Inference with Ensemble of trees (GENIE 3) (V1.12); (3) The interaction of highly weighted (> 0.98) BACH1 with the target gene was screened and a visual network map was drawn.

Other analysis methods are similar to single cell nuclear transcriptome sequencing analysis.

2.6 pulmonary artery hypertension animal model

(1) Anoxic treatment: c57BL/6 Male smooth muscle-specific Bach1 gene knockout (Bach 1) at 8-12 weeks of age ^SMCKO ) Mice and WT (Bach 1) ^loxp/loxp ) Mice were exposed to normoxic (air) or hypoxic (10% oxygen) for 4 weeks. The feeding vessel was opened once a week for 30 minutes each for cleaning and replenishing food and water;

(2) Heart ultrasound: after 4 weeks, the neck and chest hairs were shaved off, and the heart ultrasound was performed to measure the wall thickness of the right ventricular end diastole and the pulmonary artery acceleration time of the mice;

(3) Pressure measurement: isoflurane gas anesthetizing the mice, cutting the skin on the right side of the neck to a size of about 2cm, carefully separating subcutaneous tissues, freeing the right jugular vein of the mice, inserting the mice into the right ventricle by using a Miller catheter, detecting the Right Ventricular Systolic Pressure (RVSP) of the mice by using a PowerLab system, and performing data analysis by using LabChart software;

(4) Drawing materials: dissecting the chest of the mice, exposing the heart and lung, perfusing the heart and lung with PBS solution, fixing the left lung with 10% paraformaldehyde, performing paraffin embedding treatment, immediately cutting the right lung, quickly freezing in liquid nitrogen, performing mRNA and protein expression analysis subsequently, and preserving at-80 ℃ until further analysis; the heart of the mice was cut, partially fixed with 10% paraformaldehyde and paraffin-embedded, partially carefully stripped of connective tissue, cut off the free wall of the right ventricle, and accurately weigh the right ventricle and left ventricle + ventricular septum to give FutonIndex (RV/LV + S).

(5) Media/CrossSectionalArea (CSA) statistics: according to H & E staining, imageJ software was used to count the percentage of membrane area to vessel cross-sectional area.

(6) Vascular myonization statistics: according to TAGL immunofluorescence staining photographs, 50 pulmonary arterioles with the diameters of 20-50 mu m of blood vessels are randomly selected from each group, and according to the proportion of the TAGL positive expression part of the pulmonary arterioles to the peripheral diameters of the blood vessels, the pulmonary arterioles are classified into three types of blood vessels which are not myogenic (75%), and the percentage of each type of blood vessel is counted.

EXAMPLE 1 smooth muscle BACH1 and pulmonary arterial hypertension

1 single cell transcriptome sequencing profile

To investigate key molecules that regulate pulmonary arterial hypertension disease, the present application analyzed the scRNA-seq dataset (GSE 210248), which contained pulmonary arteries of healthy donor and pulmonary arterial hypertension patients as well as mouse pulmonary artery samples exposed to Chang Yang and hypoxia. The present application identifies 12 cell types, including T cells (T cells), fibroblasts (fibroplasts), monocytes (Monocytes), smooth muscle cells (smooth muscle cells, SMCs), endothelial cells (endothelial cells, ECs), granulocytes (granulocytocys), macrophages (Macrophages), T/NK cells (T/NK cells), epithelial cells (epihalohydr cells), mast cells (mals), dendritic Cells (DCs), and B cells (B cells) (fig. 1A). Among these, three smooth muscle cell populations highly express the corresponding typical markers, and contracted smooth muscle cells highly express actin-binding protein (TAGLN), myosin heavy chain11 (Myosin heavy chain, MYH 11), and calmodulin 1 (Calponin 1, cnn 1); synthetic smooth muscle cells highly express matrix metalloproteinase inhibitor 1 (TIMP Metallopeptidase Inhibitor 1, timp 1) and secreted phosphoprotein 1 (Secreted Phosphoprotein, spp 1); oxygen-aware smooth muscle cells highly expressed cytokine signaling inhibitor 3 (Suppressor of Cytokine Signaling, SOCS 3) and Metallothionein 1M (MT1M) (FIGS. 1B-C).

Expression elevation of 2BACH1 in pulmonary arterial hypertension patients and model mice

Due to the critical role of synthetic smooth muscle cells in pulmonary hypertension, the present application analyzed differentially expressed genes (differentially expressed gene, DEG) of synthetic smooth muscle cells under healthy and pulmonary hypertension conditions, and performed a pseudo-temporal trajectory analysis. The results show that BACH1 expression was significantly up-regulated in patients with pulmonary hypertension and hypoxia-induced pulmonary hypertension model mice (fig. 2A). In addition, a gene regulation network of genes and transcription factors related to the conversion of smooth muscle cells to synthetic phenotypes was constructed by R software package Gene Network Inference with Ensemble of trees (GENIE 3), and BACH1 was found to be an important regulator of genes related to vascular remodeling, such as: aquaporin 1 (Aquaporin 1, aqp 1), filamin a (Filamin a, FLNA), L-type voltage dependent calcium channel α1c subunit (Calciumchannel voltage-dependent L type alpha 1C subunit,CACNA1C), and the like (fig. 2B). The above results indicate that smooth muscle cell BACH1 is closely related to pulmonary arterial hypertension disease.

Example 2: BACH1 expression in patients with pulmonary hypertension and hypoxia-induced pulmonary hypertension model mice

1BACH1 expression in pulmonary tissue and pulmonary artery of patients with pulmonary arterial hypertension

To further elucidate the correlation of BACH1 gene expression with pulmonary arterial hypertension, the present application first analyzed published chip data (GEO number: GSE 113439) for BACH1 expression in pulmonary arterial hypertension patient (n=15) lung tissue, and found that mRNA expression of BACH1 was increased in pulmonary arterial hypertension patient lung tissue compared to healthy lung (n=11) (fig. 3A). Subsequently we collected paraffin sections of pulmonary tissue from patients with pulmonary hypertension and normal, and examined the expression level of BACH1 in pulmonary arteries by immunohistochemical staining. The results show that BACH1 expression is significantly elevated in the pulmonary artery smooth muscle layer in patients with pulmonary arterial hypertension compared to healthy controls (fig. 3B).

Elevated expression of 2BACH1 in pulmonary artery smooth muscle of mice with pulmonary arterial hypertension

Chronic hypoxia is a key factor in inducing elevated pulmonary artery pressure. In a hypoxic environment, pulmonary artery, to maintain normal pulmonary circulation, undergoes various degrees of pulmonary vascular remodeling, manifested as thickening of the media in the pulmonary artery. Due to single cell transcriptome sequencing data (GEO No. GSE 210)248 Analysis results suggested that BACH1 expression was significantly up-regulated in smooth muscle cells of hypoxia-induced pulmonary hypertension mice (fig. 4A). The present application is thus carried out by applying to WT (Bach 1 ^loxp/loxp ) Mouse hypoxia (10% O) ₂ ) Pulmonary arterial hypertension model was constructed 4 weeks after induction. Immunofluorescent staining confirmed that the pulmonary artery of mice was significantly thickened following hypoxia induction, and BACH1 expression was found to be elevated in the pulmonary artery of hypoxia-induced mice (fig. 4B). The application further extracts lung tissue RNA of hypoxia-induced mice for detection, and discovers that the expression of Bach1 mRNA of lung tissue of hypoxia-induced mice is significantly up-regulated, while the expression of Bach2 genes of the same family is not significantly different (FIG. 4C).

Upregulation of 3BACH1 expression in hypoxia-induced human pulmonary artery smooth muscle cells and primary extracted mouse pulmonary artery smooth muscle cells

The above results show that vascular smooth muscle cell BACH1 plays a key role in the disease progression of pulmonary hypertension and that BACH1 expression in smooth muscle cells is significantly altered in pulmonary arterial hypertension patients and in mouse pulmonary arterial hypertension models. To further verify this result, human pulmonary artery smooth muscle cells and primary extracted mouse pulmonary artery smooth muscle cells were cultured in vitro by hypoxia (1%O ₂ ) Stimulation of cells, detection of BACH1 protein expression, and hypoxia was found to induce elevated BACH1 expression in pulmonary artery smooth muscle cells (fig. 5). These results indicate that BACH1 expression can be upregulated by hypoxia induction, and that BACH1 expression by smooth muscle cells is closely related to the development of pulmonary arterial hypertension.

Since significant changes in BACH1 expression can be detected in patients with pulmonary hypertension and in mouse pulmonary hypertension models, the results are statistically significant, which can be indicative of close association of BACH1 with pulmonary hypertension, while further hypoxia experiments simulate conditions that may exacerbate or develop to pulmonary hypertension, and the results also demonstrate that BACH1 will change. Thus, BACH1 can be used as a biomarker to determine whether an organism is suffering from pulmonary hypertension and a disease state by detecting BACH1 expression or changes in expression.

Example 3: construction of vascular smooth muscle specific Bach1 gene knockout model and application thereof in pulmonary arterial hypertension

The long-term and continuous progress of pulmonary hypertension will lead to right ventricular hypertrophy and dilation, and if there is a lack of timely effective intervention, it will develop into right heart insufficiency and even die. Among them, pulmonary artery smooth muscle cells have been widely demonstrated to play an important role in the development of various types of pulmonary arterial hypertension. Excessive proliferation, migration and phenotypic switching of pulmonary artery smooth muscle cells are an extremely important factor in pulmonary vascular remodeling. Abnormal deposition and reconstitution of extracellular matrix is indispensable in the progression of pulmonary arterial hypertension, in particular collagen and tenascin-C. There is growing evidence that extracellular matrix remodeling is an important cause of distal pulmonary vascular remodeling. In this process, the shift of pulmonary artery smooth muscle cells from resting, contracted phenotype to synthetic phenotype is a central feature that promotes extracellular matrix synthesis. Examples 3-5 will further investigate the relationship of BACH1 to pulmonary hypertension based on the pathogenesis of pulmonary hypertension.

1 construction of conditional vascular smooth muscle-specific Bach1 Gene knockout mice (Bach 1) ^SMCKO )

In order to explore the role of smooth muscle cell BACH1 in regulating pulmonary arterial hypertension, the subject purchased Bach1 loxp heterozygote mice from Nanjing Jizhikang, and obtained Bach1 loxp homozygous mice by breeding. Transgenic mice (Myh 11-CreERT 2) specifically expressing Cre recombinase in smooth muscle cells were treated with Bach1 ^loxp/loxp Mice were hybridized to ultimately produce vascular smooth muscle-specific Bach 1-inducible knockout mice (Bach 1 ^SMCKO Knockout of exons 2, 3) (fig. 6A). Mouse gene identification was performed by polymerase chain reaction (Polymerase Chain Reaction, PCR) experiments, confirming that the control WT mouse genotype was Bach1 ^loxp/loxp Smooth muscle-specific Bach1 gene knockout mice containing Myh11-Cre locus have genotype Bach1 ^SMCKO (FIG. 6B). At 8 weeks in mice, bach1 was induced to knock out under smooth muscle cell specific conditions by intraperitoneal injection of tamoxifen.

2 construction of mouse pulmonary artery high pressure model by smooth muscle specific Bach1 Gene knockout mice

Then, the present application was carried out in WT (Bach 1 ^loxp/loxp ) And Bach1 ^SMCKO On mice with chronic hypoxia (10% O) ₂ ) Hypoxia-induced mice were modeled for pulmonary arterial hypertension (fig. 7A) and specific knockout of BACH1 in vascular smooth muscle layers was verified by immunofluorescent staining (fig. 7B).

3 smooth muscle-specific Bach1 gene knockout inhibits increases in pulmonary arterial pressure in mice

After 4 weeks of hypoxia, the body weights of the mice did not significantly differ (fig. 8A), and the specific data are shown in table 5. By conducting cardiac ultrasound and hemodynamic detection on the mice, the right ventricular systolic pressure of the mice is detected (figure 8B), and hypoxia can be found to significantly increase the Right Ventricular Systolic Pressure (RVSP), which proves that the modeling of the pulmonary arterial hypertension mouse model is successful. Meanwhile, smooth muscle-specific Bach1 gene knockout was able to significantly suppress the rise in right ventricular systolic pressure induced by hypoxia, from 38mmHg down to 30mmHg (fig. 8C), and specific data are shown in table 6. The heart super showed that smooth muscle specific Bach1 gene knockout increased Pulmonary Artery Acceleration Time (PAAT) from 15ms to 18ms (fig. 8D), with specific data shown in table 7.

TABLE 5 FIG. 8A concrete data-Body Weight (g)

TABLE 6 FIG. 8C specific data-RVSP (mmHg)

TABLE 7 FIG. 8D specific data-PAAT (ms)

/>

4 smooth muscle specific Bach1 gene knockout inhibits pulmonary vascular remodeling of pulmonary arterial hypertension in mice

Decreased pulmonary arterial compliance and progressive narrowing of the distal resistance pulmonary artery are pathological features of pulmonary arterial hyperbaric pulmonary vessel remodeling, manifested by thickening of pulmonary arterial wall smooth muscle layers, and abnormal myozation of the otherwise non-myogenic distal small pulmonary artery. Hypoxia was found to promote increased thickness of pulmonary artery smooth muscle layer and myonization of pulmonary arterioles by H & E staining and TAGLN immunofluorescence staining of mouse lung tissue, whereas smooth muscle-specific Bach1 gene knockout was able to significantly inhibit pulmonary artery smooth muscle layer thickening and myonization of pulmonary arterioles (fig. 9), as shown in fig. 9B, 9C for the specific data in tables 8-9.

TABLE 8 FIG. 9B concrete data-Percentage of medial thickness (%)

TABLE 9 FIG. 9C concrete data-Vascular Muscularization (%)

5 smooth muscle specific Bach1 gene knockout inhibiting thickening of right ventricular wall in pulmonary arterial hypertension mice

Due to the thickening and reconstruction of the wall of the pulmonary blood vessel in pulmonary arterial hypertension, the blood flow of the pulmonary artery is significantly reduced, thereby increasing the afterload of the right ventricle. Thus, pulmonary hypertension develops late in the course of right ventricular hypertrophy and right heart dysfunction. Thus, the present application further observes whether smooth muscle-specific Bach1 gene knockout can affect right ventricular hypertrophy in a pulmonary arterial hypertension mouse model. The results showed that smooth muscle-specific Bach1 gene knockout was able to suppress right ventricular wall weight gain in pulmonary arterial hypertension mice (fig. 10A), and the specific data are shown in table 10. Cardiac H & E staining showed that hypoxia induced thickening of the right ventricle wall in mice, whereas smooth muscle-specific Bach1 gene knockout was able to significantly inhibit right ventricular hypertrophy (fig. 10B-C), and specific data in fig. 10C are shown in table 11.

TABLE 10 specific data-RV/(LV+S) for FIG. 10A

TABLE 11 FIG. 10C concrete data-Mean thickness of the RV wall (mm)

6 single cell nuclear transcriptome sequencing analysis shows that the smooth muscle specific Bach1 gene knockout can inhibit the proportion of synthetic smooth muscle cells of mice

To explore in depth the role of smooth muscle cell BACH1 in regulating pulmonary arterial hypertension, the present application was directed to WT and BACH1 after 4 weeks of hypoxia induction ^SMCKO Single cell nuclear transcriptome sequencing of pulmonary arterial hypertension mouse lung tissue was performed and by integrating known marker gene expression for cell types, 12 cell populations with well-defined marker gene expression characteristics for known lung tissue cell types were determined. These cell populations with specific marker genes included type I alveolar cells (agr positive), type II alveolar cells (sptf positive), endothelial cells (Cdh 5 positive), macrophages (Mrc 1 positive), fibroblasts (Fbn 1 positive), smooth muscle cells (Myh 11 positive), adipocytes (Nrg 4 positive), bone marrow cells (Csf 3r positive), T lymphocytes (Skap 1 positive), B lymphocytes (Bank 1 positive), ciliated cells (Dnah 12 positive), bronchiolar exocrine cells (Cyp 2f2 positive) (fig. 11A-B). Among them, two smooth muscle cell clusters (SMC 1 and SMC 2) have been identified, SMC2 cell cluster expresses Postn gene higher than that of SMC1 cluster and Myh11 gene is expressed low, so we mark SMC1 as a contractile smooth muscle cell and SMC2 as a synthetic smooth muscle cell (fig. 11C). Furthermore, we found that in smooth muscle-specific Bach1 knockout mice, the number of synthetic smooth muscle cells was smaller than in WT mice (fig. 11D), and the specific data are shown in table 12. Postn is a marker of fibroblast activation, demonstrating that synthetic smooth muscle cells exhibit a more myofibroblast phenotype than the contracted smooth muscle cell population, indicating that in smooth muscle-specific Bach1 knockout mice, The low proportion of synthetic smooth muscle cell number and the high proportion of contractile smooth muscle cell number are beneficial to alleviating the thickening of the pulmonary vessel wall and inhibiting the pulmonary vessel reconstruction.

TABLE 12 FIG. 11D concrete data-Cell counts

	WT	Bach1 ^SMCKO
			SMC1	43	62
SMC2	392	298

7 smooth muscle specific Bach1 Gene knockout can inhibit mouse extracellular matrix deposition

Extracellular matrix aggregation and remodeling of the pulmonary artery is one of the important causes of pulmonary arterial hypertension pulmonary vascular remodeling. The synthetic phenotype of pulmonary artery smooth muscle cells promotes extracellular matrix synthesis and vascular fibrosis. The extracellular matrix of normal human pulmonary arteries mainly comprises the following components: collagen, elastin, laminin, fibronectin, tenascin C, proteoglycans, and the like. Collagen deposition is a relatively early pathological change, and then gradually causes vascular fibrosis, which aggravates the progress of pulmonary arterial hypertension. Single cell sequencing analysis results show that the expression of the collagen-related gene in pulmonary arterial hypertension is up-regulated, and that BACH1 is a key gene for regulating vascular remodeling. Is thatIt was verified whether BACH1 regulates extracellular matrix aggregation in pulmonary arterial hypertension, for WT and Bach1 ^SMCKO qPCR detection and immunofluorescence staining of pulmonary artery high pressure mouse lung tissue revealed that smooth muscle-specific Bach1 gene knockout was able to inhibit hypoxia-induced extracellular matrix-related gene expression (POSTN, TNC, COL a1, COL3a 1), the differences being statistically significant (FIG. 12).

8 vascular smooth muscle specific Bach1 gene knockout can inhibit proliferation of mouse pulmonary artery smooth muscle cells

Hypoxia-induced pulmonary artery smooth muscle cell proliferation is another major cause of pulmonary artery vascular structure remodeling, and is also a research hotspot for pulmonary artery high-pressure diseases. Many studies have demonstrated that inhibiting proliferation of pulmonary artery smooth muscle cells under hypoxic conditions can significantly alleviate pulmonary vascular remodeling, thereby alleviating pulmonary arterial hypertension. Earlier studies have found that BACH1 can inhibit aortic smooth muscle cell proliferation, but it is not known whether BACH1 can exert a regulatory effect on pulmonary arterial smooth muscle cell proliferation under normoxic and hypoxic conditions. Thus, the present application explores whether BACH1 can also affect disease progression in pulmonary arterial hypertension by modulating proliferation of pulmonary arterial smooth muscle cells. Thus, primary cultured mouse pulmonary artery smooth muscle cells, normoxic and hypoxic (1% O) were extracted ₂ ) After culturing, proliferation of pulmonary artery smooth muscle cells was detected by EdU staining, and after EdU positive smooth muscle cells were counted, bach1 knockdown was found to significantly inhibit proliferation of mouse pulmonary artery smooth muscle cells under normoxic and hypoxic conditions (FIG. 13), and specific data in FIG. 13B are shown in Table 13. EdU staining results indicate that BACH1 is also able to regulate pulmonary arterial hypertension by affecting proliferation of pulmonary arterial smooth muscle cells.

TABLE 13 specific data-%EdU+mPASMCs of FIG. 13B

Example 4: construction and application of vascular smooth muscle specific Bach1 overexpression model

1 construction of vascular smooth muscle-specific Bach1 overexpressing mice (VSMC-Bach1 ^OE ) Pulmonary artery high pressure model

To further elucidate the regulatory role of vascular smooth muscle BACH1 in pulmonary arterial hypertension, we constructed vascular smooth muscle-specific BACH1 over-expression mice (VSMC-BACH 1 ^OE ) To investigate whether in vivo overexpression of Bach1 would produce spontaneous pulmonary hypertension and whether inhibition of TGFBR2 would eliminate the effects of smooth muscle overexpression of Bach 1. AAV 9-type adeno-associated virus carrying SM22 alpha promoter and BACH1 coding sequence (NM-007520.2) was purchased from Weizhen Biotechnology Inc., and was injected into wild-type mice via tail vein to obtain vascular smooth muscle-specific over-expressed Bach1 mice (VSMC-Bach 1) ^OE ) Mice in the control group were injected with an equivalent dose of control virus. On this basis, an inhibitor LY2109761 which specifically inhibits the activity of TGFBR2 kinase is injected into mice (100 mg/kg) by means of gastric lavage to inhibit the function of TGFBR2 and its downstream pathways. Followed by chronic hypoxia (10% O) ₂ ) For 3 weeks to induce a pulmonary arterial hypertension model in mice (fig. 14A). Specific overexpression of BACH1 in vascular smooth muscle layers was confirmed by immunofluorescent staining (fig. 14B).

2 inhibiting TGFBR2 function can reverse the increase of pulmonary artery pressure and right ventricular hypertrophy of mice caused by vascular smooth muscle specific Bach1 over-expression

After 3 weeks of hypoxia, the body weights of the mice did not significantly differ (fig. 15A), and the specific data are shown in table 14. We examined the right ventricular systolic pressure of mice by hemodynamics (fig. 15B), and found that vascular smooth muscle-specific Bach1 overexpression significantly aggravated hypoxia-induced elevation of right ventricular systolic pressure, whereas LY2109761 treatment was significantly attenuated (fig. 15C), as shown in table 15. At the same time, we also examined the right ventricular hypertrophy of mice, and the results showed the same trend (fig. 15D), and the specific data are shown in table 16.

TABLE 14 FIG. 15A concrete data-Body Weight (g)

TABLE 15 FIG. 15C specific data-RVSP (mmHg)

TABLE 16 FIG. 15D specific data-RV/(LV+S)

3 inhibiting the function of TGFBR2 can reverse the aggravation of pulmonary vascular remodeling of mice caused by the overexpression of vascular smooth muscle specific Bach1

Decreased pulmonary arterial compliance and progressive narrowing of the distal resistance pulmonary artery are pathological features of pulmonary arterial hyperbaric pulmonary vessel remodeling, manifested by thickening of pulmonary arterial wall smooth muscle layers, and abnormal myozation of the otherwise non-myogenic distal small pulmonary artery. We found by H & E staining of mouse lung tissue that vascular smooth muscle specific Bach1 gene overexpression aggravated the increase in pulmonary artery smooth muscle layer thickness due to hypoxia, whereas LY2109761 treatment significantly reduced this effect (fig. 16A, 16B), as shown in figure 16B with specific data in table 17.

TABLE 17 FIG. 16B concrete data-Percentage of medial thickness (%)

4 inhibiting the function of TGFBR2 can reverse the aggravation of mouse extracellular matrix deposition caused by vascular smooth muscle specific Bach1 overexpression

Extracellular matrix aggregation and remodeling of the pulmonary artery is one of the important causes of pulmonary arterial high pressure pulmonary vascular remodeling. The synthetic phenotype of pulmonary artery smooth muscle cells promotes extracellular matrix synthesis and vascular fibrosis, exacerbating the progression of pulmonary arterial hypertension. To further verify the regulation of BACH1 on extracellular matrix aggregation in pulmonary arterial hypertension, we performed on WT and VSMC-Bach1 ^OE Immunofluorescent staining is carried out on the lung tissue of the mouse, and after the vascular smooth muscle specificity over-expresses Bach1, extracellular inside the lung tissue of the mouse is foundThe matrix-related gene (Tnc) was further increased, while treatment with LY2109761 significantly attenuated this effect (fig. 17).

5 inhibition of TGFBR2 function to reverse the elevation of SMAD3 phosphorylation levels caused by vascular smooth muscle-specific Bach1 overexpression

SMAD3 proteins are well known downstream targets of the TGF- β pathway and play a critical role in the transmission of TGF- β signals from cell surface receptors to the nucleus. The level of phosphorylation of SMAD3 reflects, to some extent, the level of activation of the TGF- β pathway. To explore the effect of vascular smooth muscle-specific Bach1 overexpression on TGFBR2 kinase downstream, we have on WT and VSMC-Bach1 ^OE Immunofluorescent staining of p-SMAD3 protein in mouse lung tissue showed that vascular smooth muscle specific overexpression of Bach1 further increased p-SMAD3 protein expression levels in mouse lung vessels, while p-SMAD3 expression levels decreased after LY2109761 inhibited kinase activity of TGFBR2 (fig. 18).

Example 5: mechanism for regulating and controlling pulmonary artery high-pressure vessel reconstruction by BACH1

In pulmonary hypertension patients and in rodent models of chronic hypoxic pulmonary hypertension, the expression levels of TGFBR2 and phosphorylated SMAD2/3 were elevated. Abnormal activation of the TGF-beta/TGFBR 2/p-SMAD2/3 signaling pathway can cause vascular hypertrophy, contributing to pulmonary vascular remodeling. In addition, inhibition of TGFBR2/SMAD signaling can inhibit proliferation, extracellular matrix deposition and vascular remodeling, thereby alleviating hypoxia-induced pulmonary hypertension. However, the transcriptional mechanism of TGFBR2 in smooth muscle cells involved in the onset of pulmonary hypertension has not been fully elucidated.

1 Single cell Nuclear transcriptome sequencing analysis finds that smooth muscle-specific Bach1 Gene knockout inhibits the TGF beta Signal pathway

To further explore the mechanism by which BACH1 regulates pulmonary vascular remodeling, for WT and BACH1 ^SMCKO Gene set enrichment analysis (Gene Set Enrichment Analysis, GSEA) of pulmonary artery high pressure mice single cell nuclear transcriptome sequencing results demonstrated that in Bach1 compared to WT mice ^SMCKO The target gene for SMAD3 was down-regulated in smooth muscle cell clusters in mice (fig. 19A). Calculation of these transcription factors using DoRothEATranscription factor Activity in smooth muscle cells Bach1 was found to be compared to WT ^SMCKO The transcription factor activity of SMAD3 was low in mouse smooth muscle cells (fig. 19B). Since SMAD3 is a classical downstream transcription factor in the tgfβ signaling pathway, smooth muscle-specific Bach1 gene knockout can be speculated to inhibit the tgfβ signaling pathway. Furthermore, the present application detects the interaction of tgfβ ligands and receptors between smooth muscle cells and other cells by analyzing the expression of genes encoding tgfβ ligands and receptors in different cells. The results showed that the smooth muscle cell clusters of WT mice interacted more strongly with the fibroblast and endothelial cell clusters, whereas Bach1 ^SMCKO Is diminished (fig. 19C). 2BACH1 promotes the expression of transforming growth factor beta receptor 2 (TGFBR 2) under normoxic and hypoxic conditions

Since smooth muscle-specific Bach1 gene knockout was found to inhibit transcription factor activity of transcription factor SMAD3 and expression of target gene in single-cell nuclear transcriptome sequencing, it was speculated that smooth muscle-specific Bach1 gene knockout could inhibit pulmonary vascular remodeling by inhibiting tgfβ signaling pathway, thereby regulating occurrence and development of pulmonary arterial hypertension. To verify this hypothesis, tgfβ important ligands and receptor expression were verified in hypoxia-induced pulmonary arterial hypertension mouse lung tissue, and smooth muscle Bach1 knockdown was found to inhibit Tgfbr2 gene expression, but did not affect expression of transforming growth factor β receptor 1 (Tgfbr 1), transforming growth factor β 1 (tgfβ1), and bone morphogenic protein receptor 2 (Bmpr 2) (fig. 20A). In normoxic and hypoxic treated human pulmonary artery smooth muscle cells, BACH1 gene expression was inhibited with BACH1 shRNAs, and consistent results were obtained after validation of the knockdown effect of BACH1 (FIG. 20B).

3BACH1 binds to the promoter region of TGFBR2 to regulate its transcription

To further explore how BACH1 regulates TGFBR2 expression, targeting cleavage and labeling (CUT-Tag) data of human aortic smooth muscle cells were analyzed and significant binding peaks were found in the promoter regions of BACH1 and TGFBR 2. Furthermore, motif analysis results showed that the binding motif of BACH1 was enriched in the promoter region of TGFBR2 (fig. 21A), indicating that TGFBR2 may co-localize chromatin with BACH1, and BACH1 may bind to the promoter region of TGFBR2 and regulate its transcription. To verify whether BACH1 interacted with TGFBR2, binding of BACH1 to the promoter region of TGFBR2 in smooth muscle cells was confirmed by ChIP-qPCR assay and hypoxia stimulation was able to promote BACH1 enrichment in the promoter region of TGFBR2 (fig. 21B), as detailed data shown in table 18. In addition, the present application also validated the promoter region binding of BACH1 and TGFBR2 in A7R5 cells by luciferase reporter gene experiments (HO-1 is a positive control) (FIG. 21C). The above results indicate that BACH1 binds to and activates transcription of the TGFBR2 promoter region.

Table 18 figure 21B specific data-%input

4 knock down of BACH1 in smooth muscle cells inhibits TGFBR2/SMAD signaling pathway and extracellular matrix deposition related protein expression

The above results indicate that knock-down of BACH1 inhibits TGFBR2 expression, but it has not been elucidated whether TGFBR2 plays a role in the regulation of extracellular matrix deposition by BACH 1. Protein detection in primary cultured mouse pulmonary artery smooth muscle and human pulmonary artery smooth muscle cells was found to inhibit protein expression of TGFBR2 and phosphorylation of SMAD2/3 after normoxic and hypoxic culture by knock-down of BACH 1. At the same time, knock-down of BACH1 inhibited extracellular matrix deposition-related protein expression (COL 1A1, COL3A1, TNC) (fig. 22).

5 smooth muscle Bach1 Gene knockout inhibits TGFBR2/SMAD Signal pathway and extracellular matrix deposition in pulmonary arterial hypertension mouse model

In the lung tissue of a mouse with a hypoxia-induced pulmonary arterial hypertension model, the TGFBR2/SMAD signal pathway is verified by extracting protein, and a result consistent with that in a cell experiment is obtained. Following smooth muscle cell-specific knockdown of Bach1, hypoxia-induced increases in TGFBR2 expression can be significantly inhibited, phosphorylation of SMAD2/3 inhibited, and expression of extracellular matrix deposition-related proteins is down-regulated (fig. 23). The results above all demonstrate that BACH1 can regulate the phosphorylation of TGFBR2 and SMAD2/3 in vivo and in vitro, and regulate downstream extracellular matrix deposition, promote pulmonary vascular remodeling, and affect the development of pulmonary arterial hypertension.

6TGFBR2 mediated smooth muscle cell BACH1 regulating extracellular matrix deposition related gene expression

To further verify the mediating effect of TGFBR2 in BACH1 regulating pulmonary arterial hypertension extracellular matrix deposition, 3 TGFBR2-siRNA mixtures were first transfected into human pulmonary artery smooth muscle cells, expression of TGFBR2 was knocked down, and expression of TGFBR2/SMAD signaling pathway and downstream extracellular matrix deposition related proteins were then verified by immunoblotting experiments. Overexpression of BACH1 was found to significantly promote the expression of the above proteins, as well as corroborating the results of studies prior to the present application. Also, upon knocking down TGFBR2, both the phosphorylation of SMAD3 and the expression of extracellular matrix deposition-related proteins promoted by over-expression of BACH1 were reversed (FIG. 24A, C), where the control siRNA used in FIG. 24A was (UUCUCCGAACGUGUCACGU (SEQ ID NO: 54)). In addition, treatment of control and BACH1 overexpressing human pulmonary artery smooth muscle cells with an inhibitor LY2109761 that specifically inhibited TGFBR2 kinase activity, LY2109761 was found to significantly inhibit BACH 1-overexpressing SMAD 3-induced phosphorylation and extracellular matrix deposition-related protein expression (fig. 24B, D). This suggests that BACH 1's role in regulating genes associated with pulmonary arterial hypertension extracellular matrix deposition is dependent on TGFBR2.

BACH1 and TGFBR2 expression in lung tissue of 7 pulmonary arterial hypertension patient

mRNA expression levels of BACH1 and TGFBR2 in pulmonary arterial hypertension patients (n=18) were analyzed in published chip data (GEO number: GSE 48149), and expression of BACH1 and TGFBR2 was found to be significantly positively correlated, which also further demonstrates that TGFBR2 mediates regulation of BACH1 development of pulmonary arterial hypertension (fig. 25).

Although the present invention has been described in detail by way of preferred embodiments, the present invention is not limited thereto. Various equivalent modifications and substitutions may be made in the embodiments of the present invention by those skilled in the art without departing from the spirit and scope of the present invention, and it is intended that all such modifications and substitutions be within the scope of the present invention/be within the scope of the present invention as defined by the appended claims.

Claims

1. Use of a BACH1 molecule as a biomarker in a pathological vascular remodeling-related disease, preferably the BACH1 molecule comprises a protein, gene and/or mRNA of BACH 1.

2. Application of a detection reagent of BACH1 molecules in preparing diagnostic products of pathological vascular remodeling-related diseases.

3. The use according to claim 2, wherein the detection reagent comprises:

1) Reagents for detecting BACH1 protein expression levels;

3) And (3) a reagent for detecting the expression level of Bach1 mRNA.

4. Use of a modulator of a BACH1 molecule to modulate the activity of a BACH1 molecule-mediated tgfβ receptor 2 signaling pathway and/or collagen and fibrosis molecules and/or expression thereof, wherein said modulator of a BACH1 molecule comprises an enhancer of a BACH1 molecule or an inhibitor of a BACH1 molecule, wherein said BACH1 enhancer enhances the activity of a BACH1 molecule and/or expression thereof, and wherein said inhibitor of a BACH1 molecule inhibits the activity of a BACH1 molecule and/or expression thereof, preferably wherein said BACH1 molecule comprises a protein, gene and/or mRNA of BACH 1.

5. The use according to claim 4, wherein the agent for modulating a BACH1 molecule inhibits or enhances the activity of a BACH1 molecule and/or its expression, thereby inhibiting or enhancing the activity of a BACH1 molecule-mediated TGF-beta receptor 2 signaling pathway and/or collagen and fibrosis molecule and/or its expression,

preferably, the TGF-beta receptor 2 signaling pathway comprises phosphorylation of TGF-beta receptor 2, SMAD 2/3; the collagen and fibrosis molecule comprises an extracellular matrix gene or a protein thereof, and more preferably, the extracellular matrix gene comprises a gene encoding periostin, tenascin C, type i collagen α1 or type iii collagen α1;

6. Use of an inhibitor of a BACH1 molecule for the preparation of a pharmaceutical composition for the prevention and/or treatment of a disease associated with pathological vascular remodeling, characterized in that said inhibitor of a BACH1 molecule inhibits the activity of and/or the expression of a BACH1 molecule, preferably said BACH1 molecule comprises a protein, gene and/or mRNA of BACH 1.

7. The use of claim 6, wherein the inhibitor of BACH1 molecule comprises:

1) A knockout reagent comprising the Bach1 gene;

2) Regulatory factors that inhibit Bach1 gene or mRNA expression, and/or,

3) An agent that inhibits the activity of a BACH1 protein,

preferably, the inhibitor of the BACH1 molecule inhibits BACH1 molecule mediated tgfβ receptor 2 signaling pathway and/or activity of collagen and fibrosis molecules and/or expression thereof;

more preferably, said TGF-beta receptor 2 signaling pathway comprises phosphorylation of TGF-beta receptor 2, SMAD 2/3; the collagen and fibrosis molecule comprises an extracellular matrix gene or a protein thereof, and more preferably, the extracellular matrix gene comprises a gene encoding periostin, tenascin C, type i collagen α1 or type iii collagen α1; more preferably, the BACH1 molecule binds to the promoter region of tgfβ receptor 2 to regulate its expression;

Preferably, the inhibitor of BACH1 molecule inhibits proliferation of vascular smooth muscle cells, inhibits hypoxia-induced extracellular matrix deposition, inhibits thickening of right ventricle wall;

preferably, the inhibitor of BACH1 molecule inhibits pulmonary artery pathologic vascular remodeling, ameliorating pulmonary arterial hypertension;

preferably, the knockout reagent comprising the Bach1 gene comprises a shRNA of a Bach1 molecule, more preferably the shRNA comprises:

CCGCAGGUAUCAAGGAAAU(SEQ ID NO：38)；

GUCAGGAUUUACCUUUGAA (SEQ ID NO: 39); or (b)

CCAGGUCAAAGGACUUUCA(SEQ ID NO：40)。

8. A pharmaceutical composition comprising an inhibitor of a BACH1 molecule, said inhibitor inhibiting the activity of and/or expression of a BACH1 molecule, preferably said BACH1 molecule comprises a protein, gene and/or mRNA of BACH 1.

9. The pharmaceutical composition of claim 8, wherein the inhibitor of BACH1 molecule comprises:

1) A knockout reagent comprising the Bach1 gene;

2) Regulatory factors that inhibit Bach1 gene or mRNA expression, and/or,

3) An agent that inhibits BACH1 protein activity;

More preferably, said TGF-beta receptor 2 signaling pathway comprises phosphorylation of TGF-beta receptor 2, SMAD 2/3; the collagen and fibrosis molecule comprises an extracellular matrix gene or a protein thereof, and more preferably, the extracellular matrix gene comprises a gene encoding periostin, tenascin C, type i collagen α1 or type iii collagen α1;

CCGCAGGUAUCAAGGAAAU(SEQ ID NO：38)；

GUCAGGAUUUACCUUUGAA (SEQ ID NO: 39); or (b)

CCAGGUCAAAGGACUUUCA(SEQ ID NO：40)。

10. The use according to any one of claims 1-3, 6-7, wherein said pathological vascular remodeling-related disorder comprises cardiovascular and cerebrovascular disorders, preferably said cardiovascular and cerebrovascular disorders comprise pulmonary hypertension, atherosclerosis, angina pectoris, myocardial infarction, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, congenital heart disease, valvular heart disease, cardiac inflammation, aortic aneurysm, cerebral thrombosis, cerebral arteritis, cerebral arterial injury, cerebral aneurysm, intracranial vascular malformations or arteriovenous fistula.